DNA-PK promotes DNA end resection at DNA double strand breaks in G0 cells

  1. Faith C Fowler
  2. Bo-Ruei Chen
  3. Nicholas Zolnerowich
  4. Wei Wu
  5. Raphael Pavani
  6. Jacob Paiano
  7. Chelsea Peart
  8. Zulong Chen
  9. André Nussenzweig
  10. Barry P Sleckman  Is a corresponding author
  11. Jessica K Tyler  Is a corresponding author
  1. Weill Cornell Medicine Pharmacology Graduate Program, United States
  2. Weill Cornell Medicine, Department of Pathology and Laboratory Medicine, United States
  3. Department of Medicine, Division of Hematology and Oncology, O'Neal Comprehensive Cancer Center, University of Alabama at Birmingham, United States
  4. Laboratory of Genome Integrity, National Cancer Institute, United States

Abstract

DNA double-strand break (DSB) repair by homologous recombination is confined to the S and G2 phases of the cell cycle partly due to 53BP1 antagonizing DNA end resection in G1 phase and non-cycling quiescent (G0) cells where DSBs are predominately repaired by non-homologous end joining (NHEJ). Unexpectedly, we uncovered extensive MRE11- and CtIP-dependent DNA end resection at DSBs in G0 murine and human cells. A whole genome CRISPR/Cas9 screen revealed the DNA-dependent kinase (DNA-PK) complex as a key factor in promoting DNA end resection in G0 cells. In agreement, depletion of FBXL12, which promotes ubiquitylation and removal of the KU70/KU80 subunits of DNA-PK from DSBs, promotes even more extensive resection in G0 cells. In contrast, a requirement for DNA-PK in promoting DNA end resection in proliferating cells at the G1 or G2 phase of the cell cycle was not observed. Our findings establish that DNA-PK uniquely promotes DNA end resection in G0, but not in G1 or G2 phase cells, which has important implications for DNA DSB repair in quiescent cells.

Editor's evaluation

This manuscript will be of relevance to scientists interested in cell cycle, DNA repair, and genome stability reporting the unexpected discovery that the DNA-dependent protein kinase (DNA-PK) is required for DSB resection in G0 cells, whereas it is known and confirmed here that it inhibits resection in G1 and G2 cells. This finding has important implications for the clinical application of DNA-PK-targeted inhibitors. The data are of high quality and derive from two independent cell lines, genetic requirements were mostly established by gene knockouts, and the latest genome-wide sequencing techniques were applied to measure resection tracts. The key claims of the manuscript are supported by the data presented by the authors.

https://doi.org/10.7554/eLife.74700.sa0

Introduction

DNA double-strand breaks (DSBs) are particularly deleterious lesions which, if left unrepaired, can lead to cell death, or if repaired aberrantly, can lead to oncogenic chromosomal translocations and deletions (Jackson and Bartek, 2009). Eukaryotic cells utilize two main mechanisms of DSB repair: non-homologous end joining (NHEJ), where the broken DNA ends are ligated together with minimal processing of the DNA termini; and homologous recombination (HR), which uses a homologous sequence, usually on a sister chromatid, as a template for accurate DNA repair. Because HR relies on a homologous template for accurate repair, HR is mostly restricted to S and G2 phases of the cell cycle when sister chromatids exist. On the other hand, cells can employ NHEJ in any phase of the cell cycle and it is the only option in quiescent (G0) cells and G1 phase cells (Scully et al., 2019).

Extensive DNA end resection of the broken DNA ends, which generates long tracts of 3’ ssDNA overhangs at DSBs, is a critical step in committing the cell to use HR to repair DSBs. DNA end resection is initiated by nucleases MRE11 and CtIP, and subsequently extended by nucleases including EXO1 and DNA2/BLM (Paull and Gellert, 1998; Trujillo et al., 1998; Sartori et al., 2007; Gravel et al., 2008; Mimitou and Symington, 2008; Zhu et al., 2008; Bunting et al., 2010). The 3’ ssDNA overhangs are quickly bound by the single-stranded binding protein trimer replication protein A (RPA) to stabilize and protect the ssDNA, and later in repair RPA is replaced by the RAD51 recombinase protein that leads to the homology search to find a homologous template to achieve accurate HR repair (Sugiyama and Kowalczykowski, 2002; San Filippo et al., 2008; Wright et al., 2018). NHEJ is initiated by the KU70/KU80 heterodimer binding to broken DNA ends (Zahid et al., 2021). KU70/KU80 recruits the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) which together form a complex called DNA-PK (Gottlieb and Jackson, 1993; Hammarsten and Chu, 1998). Once the DNA-PK complex is formed, the KU heterodimer translocates inwards along the DNA and DNA-PKcs remains at the DNA ends, undergoing activation via conformational changes mediated by autophosphorylation of the ABCDE cluster (Yaneva et al., 1997; Chen et al., 2021b). Recent cryo-EM structures of DNA-PK also implicate dimerization of DNA-PK as important in recruiting downstream NHEJ factors by bringing broken DNA ends together (Chaplin et al., 2021; Zha et al., 2021). In addition to autophosphorylation, DNA-PKcs phosphorylates members of the NHEJ machinery, including the KU heterodimer, XRCC4, XLF, and Artemis (Bartlett and Lees-Miller, 2018).

The critical bifurcation point in the choice to use HR or NHEJ to repair DSBs is the processing of broken DNA ends to form single-stranded 3’ DNA overhangs, which blocks NHEJ and commits the cell to HR (Symington and Gautier, 2011). Therefore, DNA end resection is tightly regulated to prevent aberrant DNA end resection in G0 and G1 phase cells, where NHEJ is the major DSB repair pathway. Several factors have been identified as critical DNA end protection factors that limit resection of DNA DSBs including 53BP1, RIF1, and the Shieldin complex. The proposed mechanism of action of 53BP1 and its downstream effectors include acting as a physical barrier to protect DNA ends from nucleases and promoting DNA polymerase α activity to quickly fill in any resected ends (Bunting et al., 2010; Dev et al., 2018; Mirman et al., 2018; Noordermeer et al., 2018; Setiaputra and Durocher, 2019; Paiano et al., 2021). Additionally, KU70/KU80 has also been shown in budding yeast Saccharomyces cerevisiae to inhibit DNA end resection in G1 and G2 phases of the cell cycle, and in S phase in mammalian cells (Lee et al., 1998; Barlow et al., 2008; Clerici et al., 2008; Shao et al., 2012).

While nuclease activity is largely limited in G0/G1 phase cells to prevent aberrant DNA end resection, evidence exists suggesting that nuclease-mediated DNA end processing occurs at some DSBs in G0/G1. For example, Artemis is required to open hairpin-sealed DNA ends generated during V(D)J recombination in lymphocytes (Menon and Povirk, 2016). Additionally, DNA end resection has been observed in G1 phase after DNA damage at complex DNA lesions (Averbeck et al., 2014; Biehs et al., 2017), suggesting that DNA end resection is not completely inhibited in the absence of sister chromatids. Moreover, though CtIP phosphorylation by CDKs in G2 is required for its activity during HR, CtIP also functions in G1 at DSBs after phosphorylation by PLK3 (Barton et al., 2014). To investigate what additional factors may regulate DNA end resection in cells lacking sister chromatids, we performed a genome-wide CRISPR/Cas9 screen for genes whose inactivation either increases or decreases RPA bound to chromatin after irradiation (IR) in G0-arrested murine cells. We discovered, unexpectedly, that KU70, KU80, and DNA-PKcs promote extensive DNA end resection in G0 cells, but not in G1 or G2 phases of the cell cycle.

Results

RPA associates with IR-induced DNA DSBs in G0 cells

Murine pre-B cells transformed with Abelson murine leukemia virus (termed abl pre-B cells hereafter) continuously proliferate in vitro and can be efficiently arrested in G0, also referred to as the quiescent state, upon treatment with the abl kinase inhibitor imatinib (Figure 1—figure supplement 1A). (Bredemeyer et al., 2006; Chen et al., 2021a). To investigate how DNA end resection is regulated in G0 cells, we used a flow cytometric approach to assay RPA bound to chromatin after detergent extraction of soluble RPA, as a proxy for ssDNA generated at DSBs after exposing cells to irradiation (IR) (Forment et al., 2012; Chen et al., 2021a). This assay was performed in murine abl pre-B cell lines deficient in DNA Ligase IV (Lig4-/-), to maximize our ability to detect chromatin-bound RPA at DSBs, given that completion of NHEJ is prevented in the absence of DNA Ligase IV. We also performed the analysis in Lig4-/-:Trp53bp1-/- abl pre-B cells which lack the DNA end protection protein 53BP1 and accumulate high levels of RPA on chromatin after IR (Chen et al., 2021a). In agreement with our previous work, we detected a high level of chromatin-bound RPA in G0-arrested Lig4-/-:Trp53bp1-/- abl pre-B cells after IR, consistent with the role of 53BP1 in DNA end protection (Figure 1A). Surprisingly, we also observed RPA associated with chromatin after IR of G0-arrested Lig4-/- abl pre-B cells, although at lower levels than in Lig4-/-:Trp53bp1-/- abl pre-B cells (Figure 1A). Moreover, the increase in IR-induced chromatin-bound RPA does not require DNA Ligase IV deficiency as we were able to observe similar results using the RPA flow cytometric assay in wild-type (WT) murine abl pre-B cells arrested in G0 (Figure 1—figure supplement 1B). These data indicate that extensive DNA end resection occurs at DSBs in G0 cells, despite the presence of the DNA end protection proteins 53BP1 and KU70/KU80.

Figure 1 with 2 supplements see all
RPA is loaded onto ssDNA after DSBs in G0 mammalian cells.

(A) Flow cytometric analysis of chromatin-bound RPA in G0-arrested Lig4-/- and Lig4-/-:Trp53bp1-/- abl pre-B cells before and 3 hr after 20 Gray IR. Representative of three independent experiments. (B) Flow cytometric analysis of chromatin-bound RPA before and 2 hr after 15 Gy IR in G0-arrested Lig4-/- abl pre-B cells (left), Lig4-/- cells depleted of MRE11 (middle), and Lig4-/- cells depleted of CtIP (right). Representative of three independent experiments. (C) Representative images and quantification of IR-induced RPA foci from three independent experiments in G0-arrested MCF10A cells before and 3 hr after 10 Gray IR. n=365 cells in -IR and n=433 cells in +IR. Red bars indicate average number of RPA foci in - IR = 0.96 and average number of RPA foci in +IR = 9.4 (****p<0.0001, unpaired t test). (D) RPA ChIP-seq tracks at AsiSI DSBs on chromosome 2, 5, and 4 at 4 hr (top) and 8 hr (bottom) after AsiSI endonuclease induction in G0-arrested Lig4-/- abl pre-B cells. (E) Representative END-Seq tracks showing resection at AsiSI DSBs at chromosome 2, 5, and 4 at 4 hr (top) and 8 hr (bottom) after AsiSI induction in G0-arrested Lig4-/- abl pre-B cells. END-seq data is representative from two independent experiments.

To determine whether higher levels of chromatin-bound RPA in irradiated G0-arrested Lig4-/- abl pre-B cells is a result of DNA end resection, we depleted the nucleases that are required for the initiation of DNA end resection during HR in cycling cells. We found that the depletion of CtIP or MRE11 reduced the levels of RPA on chromatin in irradiated G0-arrested Lig4-/- abl pre-B cells (Figure 1B and Figure 1—figure supplement 1C), indicating that the RPA we observe with our flow cytometric assay after IR is indeed a result of DNA end resection. Next, we investigated whether this observed chromatin-bound RPA depended on the nuclease Artemis, which has been shown to have endo and exonuclease activity and is essential in opening DNA hairpins during V(D)J recombination, which occurs in pre-B cells (Ma et al., 2002; Ma et al., 2005). We found that Artemis depletion had no effect on levels of RPA on chromatin in irradiated G0-arrested wildtype abl pre-B cells, indicating that Artemis activity does not contribute to this process (Figure 1—figure supplement 1D).

To determine whether the DNA end resection that we observed was unique to murine abl pre-B cells or not, we performed the RPA flow cytometric chromatin association assay in the human breast epithelial cell line MCF10A. We arrested the MCF10A cells in G0 by EGF deprivation (Chen et al., 2021a). Similarly, to Lig4-/- and WT murine abl pre-B cells in G0, we observed IR-induced chromatin-bound RPA in G0 human MCF10A cells (Figure 1—figure supplement 1E), consistent with DNA end resection occurring in these cells at DSBs. RPA binding to ssDNA surrounding DSBs often form distinct nuclear foci that can be easily detected by immunofluorescence staining and microscopy analysis (Golub et al., 1998). Therefore, we performed immunofluorescence staining for RPA in EGF-deprived MCF10A cells. We observed discrete IR-induced RPA foci, consistent with the RPA associated with ssDNA accumulating at DNA damage sites (Figure 1C). Together, these results suggest that broken DNA ends are resected in a CtIP and MRE11-dependent manner, leading to RPA accumulation on ssDNA in G0 murine and human cells.

DNA end resection and RPA loading occurs at site-specific DSBs in G0 cells

As irradiation induces DNA base lesions and single-stranded DNA breaks in addition to DSBs, it could potentially complicate our analysis of DNA end processing at regions surrounding DSBs. Therefore, we investigated DSBs at specific locations in the mouse genome upon induction of the AsiSI endonuclease. We performed RPA chromatin immunoprecipitation sequencing (RPA ChIP-seq) after induction of AsiSI DSBs in G0-arrested Lig4-/- murine abl pre-B cells. We detected RPA binding adjacent to AsiSI DSBs, consistent with ssDNA generated by resection around DNA DSBs (Paiano et al., 2021; Figure 1D and Figure 1—figure supplement 1F). Moreover, the association of RPA with chromatin was strand specific around the DSBs, consistent with the 5’–3’ nature of DNA end resection which generates 3’ ssDNA overhangs (Paiano et al., 2021; Figure 1D). To determine the extent of DNA end processing in G0 cells, we performed END-seq (Canela et al., 2016; Wong et al., 2021) to directly measure DNA end resection at nucleotide resolution at AsiSI-induced DSBs, the majority of which are within 2 kb of the transcriptional start site of transcriptionally active genes (Figure 1—figure supplement 2). Using END-seq, we detected extensive DNA end resection in G0-arrested Lig4-/- abl pre-B cells at 4 and 8 hr after AsiSI DSB induction (Figure 1E). Together, these data indicate that in G0-arrested cells, DNA ends are resected at DSBs induced by IR or site-specific endonucleases, generating ssDNA that is bound by RPA.

A CRISPR/Cas9 screen identifies the DNA-PK complex as promoting DNA end resection in G0 cells

To identify factors that influence DNA end resection in G0 cells, we performed a genome-wide CRISPR/Cas9 screen in G0-arrested Lig4-/- murine abl pre-B cells 2 hr after irradiation to identify factors that either promote or impair DNA end resection (Figure 2A). We isolated the 10% of cells with the lowest RPA (low RPA) and the 10% cells with the highest RPA (high RPA) staining intensity using our RPA flow cytometric assay followed by flow assisted cell sorting. We then amplified the guide RNAs (gRNAs) in these populations of cells and determined their frequencies using high-throughput sequencing. gRNAs enriched in the low RPA staining population correspond to genes encoding proteins that normally promote DNA end resection, while gRNAs enriched in the high RPA population correspond to genes encoding proteins that normally impair resection. In this screen, we identified several gRNAs enriched in the low RPA staining population to Rbbp8 which encodes the nuclease CtIP, and Nbn, which encodes the NBN subunit of the MRE11-RAD50-NBN (MRN) complex, consistent with their established roles in promoting DNA end resection (Figure 2B). Unexpectedly, we also found gRNAs targeting Xrcc6 (the gene encoding KU70), Xrcc5 (the gene encoding KU80), and Prkdc (the gene encoding DNA-PKcs) highly enriched in our low RPA population (Figure 2B). This suggested that DNA-PK may promote DNA end resection in G0 cells, contrary to the established role of these factors in preventing DNA end resection in other phases of the cell cycle.

Figure 2 with 1 supplement see all
A genome-wide gRNA screen identifies DNA-PK as a factor that promotes DNA end resection in G0.

(A) Schematic of a genome-wide gRNA screen for factors promoting (bottom 10%/RPA low) or inhibiting (top 10%/RPA high) chromatin-bound RPA loading 2 hr after 20 Gray IR in G0-arrested Lig4-/- abl pre-B cells. (B) Fold enrichment of selected gRNAs in low RPA and high RPA populations. Fold enrichment was calculated as the ratio of normalized read number of gRNAs in the low RPA population and that in the high RPA population and vice versa (n=1). (C) Flow cytometric analysis of chromatin-bound RPA in G0-arrested Lig4-/- and Lig4-/-:Prkdc-/- abl pre-B cells before and 3 hr after 15 Gray IR. Data is representative of three independent experiments in two different cell lines. (D) Flow cytometric analysis of chromatin-bound RPA in G0-arrested Lig4-/- abl pre-B cells with and without 10 μM NU7441 (DNA-PK inhibitor) pre-treatment 1 hr before 20 Gray IR. Data is representative of three independent experiments in two different cell lines. (E) Representative END-seq tracks at chromosome 3 (left) and chromosome 13 (right) in G0-arrested Lig4-/- abl pre-B cells 4 hr (top) and 8 hr (bottom) after AsiSI DSB induction, with and without 10 μM NU7441 treatment.

To validate the screen and determine if DNA-PK is required for DNA end resection, we generated Lig4-/-:Prkdc-/- abl pre-B cells that do not express DNA-PKcs by CRISPR/Cas9-mediated gene inactivation (Figure 2—figure supplement 1A). G0-arrested Lig4-/-:Prkdc-/- abl pre-B cells had lower levels of chromatin-bound RPA after IR compared to Lig4-/- abl pre-B cells (Figure 2C). DNA-PKcs and Ataxia-telangiectasia mutated (ATM) are two major serine/threonine kinases that are activated in response to DNA DSBs and share some overlapping functions due to similar substrate specificity (Blackford and Jackson, 2017). Because DNA-PKcs but not ATM was identified in our screen, we wanted to determine if the pro-resection activity in G0-arrested cells is unique to DNA-PKcs or also shared by ATM. We treated G0-arrested Lig4-/- abl pre-B cells with the ATM inhibitor KU55933 or the DNA-PK inhibitor NU7441 before IR and performed flow cytometric analysis of IR-induced chromatin-bound RPA. In contrast to the consistent reduction in the levels of chromatin-bound RPA observed in G0-arrested Lig4-/- abl pre-B cells treated with DNA-PK inhibitor, ATM inhibition did not have a detectable effect on the levels of IR-induced binding of RPA in G0-arrested Lig4-/- abl pre-B cells (Figure 2D and Figure 2—figure supplement 1B). Additionally, DNA-PK inhibition in wild type abl pre-B cells arrested in G0 showed a modest effect in reducing levels of chromatin-bound RPA (Figure 2—figure supplement 1C). The role of DNA-PK in promoting DNA end resection in G0 is not limited to murine abl pre-B cells as we also observed a reduced number of IR-induced RPA foci in G0-arrested human MCF10A cells upon inhibition of DNA-PK (Figure 2—figure supplement 1D). These results indicate that DNA-PKcs activity, but not ATM, uniquely promotes resection and RPA binding to damaged chromatin after IR in G0 cells.

To directly observe if DNA-PKcs influenced DNA end resection at DSBs, we performed nucleotide resolution END-seq on G0-arrested Lig4-/- murine abl pre-B cells with and without DNA-PK inhibitor treatment before the induction of AsiSI DSBs. Consistent with our RPA flow cytometric assay results, DNA-PK inhibitor-treated G0-arrested Lig4-/- abl pre-B cells showed greatly reduced END-Seq signals distal to DSBs, consistent with limited DNA end processing when DNA-PK is inactivated (Figure 2E and Figure 2—figure supplement 1E). These results demonstrate that DNA-PK activity promotes DNA end resection of DSBs in G0 mammalian cells.

FBXL12 inhibits KU70/KU80-dependent DNA end resection in G0 cells

Given that DNA-PKcs promotes DNA end resection in G0 cells (Figure 2C, D and E, Figure 2—figure supplement 1C and D, 1E), and that Xrcc6 and Xrcc5 (genes encoding KU70 and KU80) were enriched in the RPA low population of cells in the CRISPR/Cas9 screen (Figure 2B), we determined whether KU70/KU80 may also promote resection in G0 cells. We generated Lig4-/-:Xrcc6-/- murine abl pre-B cells and measured DNA end resection using our RPA flow cytometric approach. Consistent with our observations in DNA-PK inhibitor-treated G0-arrested Lig4-/- abl pre-B cells and Lig4-/-:Prkdc-/- abl pre-B cells, the level of chromatin-bound RPA after IR was greatly reduced in G0-arrested Lig4-/-:Xrcc6-/- abl pre-B cells compared to Lig4-/- abl pre-B cells (Figure 3A and Figure 3—figure supplement 1A). As such, the entire DNA-PK complex is required for DNA end resection in G0 cells.

Figure 3 with 1 supplement see all
FBXL12 inhibits KU70/KU80-promoted DNA end resection.

(A) Flow cytometric analysis of chromatin-bound RPA in G0-arrested Lig4-/- abl pre-B cells and Lig4-/-:Xrcc6-/- abl pre-B cells before and 3 hr after 20 Gray IR. Data is representative of three independent experiments in two different cell lines. (B) As in A, in G0-arrested Lig4-/- and Lig4-/-:Fbxl12-/- abl pre-B cells. Data is representative of three independent experiments in at least two different cell lines. (C) Flow cytometric analysis of chromatin-bound RPA in G0-arrested Lig4-/-:Fbxl12-/- abl pre-B cells with and without 10 μM NU7441 treatment, before and 3 hr after 20 Gray IR. Data is representative of three independent experiments in at least two different cell lines (D) Flow cytometric analysis of chromatin-bound RPA in G0-arrested Lig4-/-:Fbxl12-/- abl pre-B cells before and after Xrcc6 knockout, before and 3 hr after 15 Gray IR. Data is representative of three independent experiments.

KU70/KU80 is removed from DSBs via ubiquitylation, which has been shown to be mediated by E3 ligases including RNF138, RNF8, RNF126, and the SCFFbxl12 complex (Postow et al., 2008; Feng and Chen, 2012; Postow and Funabiki, 2013; Ismail et al., 2015; Ishida et al., 2017). In agreement, gRNAs targeting Fbxl12, which encodes the substrate recognition subunit FBXL12 of the SCFFbxl12 E3 ubiquitin ligase complex, were highly enriched in our screen in the high RPA staining cell population (Figure 2B), consistent with the idea that the persistent presence of KU70/KU80 at DSBs in cells lacking FBXL12 would lead to extensive DNA end resection. Indeed, we observed that in G0-arrested Lig4-/-:Fbxl12-/- murine abl pre-B cells, the level of IR-induced chromatin-bound RPA increased compared to Lig4-/- abl pre-B cells (Figure 3B). Given the role of FBXL12 on limiting the levels of KU70/KU80 at broken DNA ends, we tested whether the increased DNA end resection phenotype in Lig4-/-:Fbxl12-/- abl pre-B cells depended on DNA-PK activity or the presence of the KU70/KU80 complex. Indeed, inhibition of DNA-PK with NU7441 (Figure 3C) and depletion of KU70 (Figure 3D and Figure 3—figure supplement 1B) in G0-arrested Lig4-/-:Fbxl12-/- abl pre-B cells prevented excessive accumulation of RPA on chromatin after IR. Our results suggest that the ability of DNA-PK to promote DNA end resection in G0 cells is regulated through maintaining proper levels of KU70/KU80 at DNA DSBs by the SCFFbxl12 E3 ubiquitylation complex.

DNA-PK uniquely promotes DNA end resection exclusively in G0 cells

KU70/KU80 have been shown to prevent DNA end resection in G1 and G2 phases in budding yeast and in S phase in mammalian cells but has not been examined in G0 cells (Lee et al., 1998; Clerici et al., 2008; Shao et al., 2012). Thus, we set out to determine whether DNA-PK-dependent DNA end resection is limited to G0 or can occur in other phases of the cell cycle. To this end, we compared the levels of IR-induced chromatin bound RPA in Lig4-/-, Lig4-/-:Prkdc-/- and Lig4-/-:Xrcc6-/- murine abl pre-B cells arrested in G0 by imatinib, arrested in G2 by the CDK1 inhibitor RO3306, and in G1 phase (cells with 2 N DNA) in a proliferating population. In contrast to G0 cells, loss of DNA-PKcs (Lig4-/-:Prkdc-/-) did not reduce the levels of IR-induced chromatin-bound RPA in G2-arrested or cycling G1 phase cells (Figure 4A and Figure 4—figure supplement 1A). Similar results were obtained when analyzing Lig4-/-:Xrcc6-/- abl pre-B cells (Figure 4B). The unique function of DNA-PK activity in promoting DNA end resection in G0-arrested cells was confirmed with END-seq analysis of AsiSI-induced DSBs in Lig4-/- abl pre-B cells arrested in G0 or G2 and treated with or without DNA-PK inhibitor. Whereas G0-arrested Lig4-/- abl pre-B cells treated with DNA-PK inhibitor exhibited significantly reduced END-seq signals in regions distal to the DSBs, the same treatment had little effect in cells arrested in G2 phase of the cell cycle (Figure 4C and Figure 4—figure supplement 1B). Quantitation of the resection tract lengths from the End-seq analysis showed that they were on average 3–4 kb in the G0-arrested cells and were greatly reduced upon treatment with DNA-PK inhibitor (Figure 4D). In comparison, the resection tract lengths in G2 arrested cells were minimally affected by treatment with DNA-PK inhibitor (Figure 4D). Additionally, NHEJ-proficient wild-type MCF10A cells arrested in G0, but not cells in G1 phase, exhibited reduced RPA on chromatin after IR upon DNA-PK inhibition (Figure 4E). These results suggest that DNA-PK distinctly promotes DNA end resection at DSBs in mammalian cells in G0 but not in other cell cycle phases.

Figure 4 with 1 supplement see all
DNA-PK mediates DNA end resection in G0 but not in G1 or G2 phases of the cell cycle.

(A) Flow cytometric analysis of chromatin-bound RPA in Lig4-/- and Lig4-/-:Prkdc-/- abl pre-B cells arrested in G0 (left), arrested in G2 by 10 μM RO-3306 treatment for 16 hr and gated on 4 N (middle), and G1 cells gated on 2 N DNA content in cycling cells (right), before and 3 hr after 20 Gray IR. Data is representative of three independent experiments in at least two different cell lines. (B) As in A in Lig4-/- and Lig4-/-:Xrcc6-/- abl pre-B cells. (C) Representative END-seq tracks in G0 (left) and G2-arrested (right, by 10 μM RO-3306 treatment for 16 hr) Lig4-/- abl pre-B cells, with and without 10 μM NU7441 treatment on chromosome 1, 4 hr (top) and 8 hr (bottom) after AsiSI endonuclease induction. (D) Average resection length in G0-arrested Lig4-/- abl pre-B (left) and G2-arrested Lig4-/- abl pre-B (right) 4 and 8 hr after AsiSI DSB induction, with and without 10 μM NU7441 treatment (DNA-PKi). (E) Flow cytometric analysis of chromatin-bound RPA 4 hr after 20 Gray IR in MCF10A cells arrested in G0 after EGF withdrawal for 48 hr or cycling cells gated on 2 N DNA content, with and without 10 μM NU7441 treatment (DNA-PKi).

Discussion

DNA end resection is one of the key events that determines whether cells utilize NHEJ, HR, or other repair pathways utilizing homologous sequences. During G0 and G1 phase of the cell cycle, NHEJ is the predominant DSB repair pathway and DNA end resection is largely limited compared to other phases of the cell cycle. However, in this study we revealed that DNA end resection dependent on CtIP and MRE11, which are required for resection in S and G2 phases of the cell cycle, occurs at DSBs in G0 mammalian cells (Figure 1B). Because CtIP activity in G1, G2 and S phases requires its phosphorylation, this is likely to be the case in G0 cells and future studies will identify the kinase responsible for any CtIP phosphorylation in G0 cells. In addition to CtIP and MRE11, we identified additional factors that promote resection in G0 cells as components of the DNA-PK complex, including KU70, KU80, and DNA-PKcs, in a genome-wide CRISPR/Cas9 screen and showed that the kinase activity of DNA-PK is critical as resection of DSBs diminishes upon DNA-PK inhibitor treatment (Figures 2 and 3). Interestingly, we also found in our genome wide CRISPR/Cas9 screen that inactivating FBXL12, the substrate recognition subunit of the SCFFBXL12 E3 ubiquitin ligase complex, promotes extensive resection of DNA ends in G0 cells (Figure 3B). As the SCFFBXL12 E3 ubiquitin is thought to limit the abundance of the KU70/KU80 heterodimer (Postow and Funabiki, 2013), our data are in line with the notion that loss of FBXL12 results in aberrant accumulation of KU70/KU80 at DSBs, and consequently elevated or prolonged activation of DNA-PK at DSBs which promotes resection in G0 cells (Figure 5).

Model of DNA-PK-mediated DNA end resection in G0 cells.

Normally in G0 phase at DSBs, the DNA-PK complex promotes DNA end resection. This resection is counteracted by FBXL12. Without DNA-PK, there is no DNA end resection in G0. Without FBXL12, DNA-PK persists at DSBs and leads to more extensive DNA end resection.

Why would resection occur in G0 cells? Chemical modifications or secondary structures at DSBs have been identified as requiring DNA end processing to create a more accessible repair environment, which could presumably be the case at DSBs in G0 cells (Weinfeld and Soderlind, 1991). For example, Artemis is an endo and exonuclease which is activated by DNA-PKcs and uses its nuclease activity to open DNA hairpins at coding ends, which is required for V(D)J recombination, and cleaves 3’ ssDNA overhangs during NHEJ (Ma et al., 2002; Ma et al., 2005). Artemis was also recently shown to contribute to slow, resection dependent NHEJ repair in G1 phase cells (Biehs et al., 2017). Though Artemis does not have a role in DNA end resection in G0 (Figure 1—figure supplement 1D). it serves as an example of nuclease activity being critical for DSB repair outside of HR. It is additionally possible that DNA end resection in G0 results in substrates that are ideal for Pol Theta-mediated end joining (TMEJ). TMEJ occurs after extensive DNA end resection when HR is not possible or when substrates are not suitable for NHEJ, which could be the case at a subset of breaks in G0 (Yousefzadeh et al., 2014; Wyatt et al., 2016). However, it is notably that TMEJ is KU70/KU80 independent, while the resection that we see in G0 is KU70/KU80 dependent. Interestingly, DNA end resection has a role in recruiting anti-resection factors to limit extensive DNA end resection. The SHLD2 component of Shieldin binds ssDNA, suppresses RAD51 loading, and ultimately limits DNA end resection by preventing access to resection nucleases (Noordermeer et al., 2018). HELB, a 5’–3’ DNA helicase, binds to RPA and limits EXO1 and BLM-DNA2-mediated DNA end resection (Tkáč et al., 2016). In this way, limited DNA end resection in G0 cells could be important in preventing more extensive DNA end resection. Altogether, we propose that DNA end resection in G0 cells is likely not resulting in aberrant HR but may be required to create more accessible DNA ends and/or to recruit anti-resection factors.

Studies investigating the role of KU70/KU80 during DSB repair have found that KU70/KU80 protects DSBs from nuclease activity. For example, at HO endonuclease breaks in budding yeast, deletion of KU70/KU80 leads to ssDNA accumulation in G1 cells and increased MRE11 recruitment to DSBs compared to wild-type cells (Lee et al., 1998; Clerici et al., 2008). Also in budding yeast, at inducible I-SceI DSBs, deletion of KU70 results in increased RFA1 foci formation in G1, but deletion of NHEJ factor DNA Ligase IV leads to no defect in RFA1 foci formation compared to wild-type cells, indicating that KU70 itself, not NHEJ, is a barrier to DNA end resection (Barlow et al., 2008). In mammalian cells, complementation of KU70/KU80 knockout cells with a M. tuberculosis KU homolog persistently bound to DSBs in S phase results in reduced RPA and RAD51 foci formation after IR (Shao et al., 2012). Contrary to these roles for KU70/KU80 in protecting DNA ends from nucleolytic attack, we found that in G0 cells, KU70/KU80 promotes DNA end resection (Figures 3A and 4B). We hypothesize that KU70/KU80 promotes resection through recruitment and activation of DNA-PKcs at DSBs (Gottlieb and Jackson, 1993), as we also found that DNA-PKcs inhibition and genetic deletion of Prkdc leads to less RPA on chromatin after IR and shorter tracts of DNA end resection in G0 cells (Figure 2C–E, Figure 2—figure supplement 1C and D, 4A, 4C, 4D). It is important to note that most studies establishing the role of KU70/KU80 in protecting DNA ends were performed in S. cerevisiae which do not have a homolog to DNA-PKcs. Therefore, we hypothesize that the function of DNA-PK promoting DNA end resection in G0 cells may not be evolutionarily conserved. Moreover, previous studies in S. cerevisiae and mammalian cells establishing DNA-PK as a pro-NHEJ complex did not analyze G0 cells. We found that DNA-PK does not promote DNA end resection in G1 or G2 phase cells, only in G0-arrested cells, indicating that DNA-PK-dependent DNA end resection is unique to G0, but is not contradictory to its anti-resection function in G1 or G2 phase cells (Figure 4). In G0 cells, KU70/KU80 could protect some DNA ends, but after recruitment and activation of DNA-PKcs, the net effect is DNA end resection. Additional studies may elucidate how the balance between DNA end protection and DNA end resection is regulated in G0.

ATM and DNA-PK have been shown to have some overlapping functions in DNA damage response and repair, including phosphorylation of H2A.X in response to IR and signal join formation during V(D)J recombination (Stiff et al., 2004; Gapud et al., 2011; Zha et al., 2011). However, we find that this is not the case during DNA end resection in G0 cells as DNA-PK promotes resection in G0 cells, but ATM does not have a detectable impact (Figure 2—figure supplement 1B). ATM has been implicated in promoting HR repair by phosphorylating CtIP and promoting KU70/KU80 removal from DSBs, as well as phosphorylating DNA-PKcs at single-ended DSBs to remove it from these breaks that require DNA end resection (Wang et al., 2013; Britton et al., 2020). DNA-PKcs autophosphorylation promotes HR by removing it from DSBs to allow nuclease access but is typically associated with promoting NHEJ by phosphorylating Artemis, XRCC4, and XLF (Zhou and Paull, 2013; Bartlett and Lees-Miller, 2018). So while ATM often promotes DNA end resection and HR, it appears that DNA-PKcs could be acting in place of ATM to promote DNA end resection in G0 cells. It is additionally possible that DNA-PKcs phosphorylates a unique substrate(s) in G0 cells that promotes DNA end resection.

In summary, we provide here evidence that DNA-PK promotes DNA end resection uniquely in G0 cells, and that this DNA end resection is counteracted by FBXL12. We speculate that some aspects of DSB repair in G0 function differently than DSB repair in cycling cells, and future studies may reveal the mechanism and utility of these key differences.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
AntibodyAnti-CtIP (Rabbit polyclonal)N/Acustom made (Richard Baer, Columbia University)WB (1:1000)
AntibodyAnti-MRE11 (Rabbit polyclonal)Novus BiologicalsNB100-142
RRID:AB_1109376
WB (1:2000)
AntibodyAnti-GAPDH (GAPDH-71.1) (Mouse monoclonal)Millipore SigmaG8795
RRID:AB_1078991
WB (1:10000)
AntibodyAnti-KAP1 (N3C2) (Rabbit polyclonal)GenetexGTX102226
RRID:AB_2037324
WB (1:2000)
AntibodyAnti-RPA32 (4E4) (Rat monoclonal)Cell Signaling Technology2,208 S
RRID:AB_2238543
WB (1:1000)
FC (1:200)
IF (1:500)
AntibodyAnti-KU70 (D10A7) (Rabbit monoclonal)Cell Signaling Technology4,588 S
RRID:AB_11179211
WB (1:1000)
AntibodyAnti-DNA-PK (SC57-08) (Rabbit monoclonal)InvitrogenMA5-32192
RRID:AB_2809479
WB (1:1000)
AntibodyAnti-RPA32
(rabbit polyclonal)
Abcamab10359 RRID:AB_297095ChIP (10 ug)
AntibodyHRP, goat anti-mouse (goat polyclonal)PromegaW4021
RRID:AB_430834
WB (1:5000)
AntibodyHRP, goat anti-rabbit IgG (goat polyclonal)PromegaW4011
RRID:AB_430833
WB (1:5000)
AntibodyAlexa Fluor 488, goat anti-rat IgG (goat polyclonal)BioLegend405,418
RRID:AB_2563120
FC (1:500)
AntibodyAlexa Fluor 647, goat anti-rat IgG (goat polyclonal)BioLegend405,416
RRID:AB_2562967
FC (1:500)
AntibodyAlexa Fluor 594, goat anti-rat IgG (goat polyclonal)BioLegend405,422
RRID:AB_2563301
IF (1:500)
Recombinant DNA reagentpCW-Cas9 (plasmid)Addgene50,661
RRID:Addgene_50661
Recombinant DNA reagentpKLV-U6 gRNA(BbsI)-PGKpuro-2ABFP (plasmid)Addgene50,946
RRID:Addgene_50946
Recombinant DNA reagentGenome-wide CRISPR guide RNA library V2 (plasmid)Addgene67,988
RRID:Addgene_67988
Cell line (H. sapiens)MCF10AATCCCRL-10317
RRID:CVCL_0598
Cell line (H. sapiens)MCF10A: iCas9This studyClone 25Available upon request
Cell line (M. musculus)WT:iCas9 abl pre-B cellsThis studyM63.1.MG36.iCas9.302Available upon request
Cell line (M. musculus)Lig4-/-:iCas9 abl pre-B cellsThis studyA5.83.MG9.iCas9.16Available upon request
Cell line (M. musculus)Lig4-/-:iCas9 abl pre-B cellsThis studyA5.115.iCas9.72Available upon request
Cell line (M musculus)Lig4-/-:Trp53bp1:iCas9 abl pre-B cellsThis studyClone 82Available upon request
Cell line (M musculus)Lig4-/-:Xrcc6-/-:iCas9 abl pre-B cellsThis studyClones 134 and 140Available upon request
Cell line (M. musculus)Lig4-/-:Prkdc-/-:iCas9 abl pre-B cellsThis studyClone 6Available upon request
Cell line (M. musculus)Lig4-/-:Fbxl12-/-:iCas9 abl pre-B cellsThis studyClone 6Available upon request
Cell line (M. musculus)Lig4-/-:iAsiSI abl pre-B cellsThis studyClone 20Available upon request
Chemical compound, drugImatinibSelleckchemS2475
Chemical compound, drugDoxycyclineSigma-AldrichD9891
Chemical compound, drugPolybreneSigma AldrichS2667
Chemical compound, drugLipofectamine 2000Thermo Fisher Scientific11668019
Chemical compound, drugNU7441Selleck ChemicalsS2638
Chemical compound, drugKU-55933Selleck ChemicalsS1092
Chemical compound, drugEGFPeproTechAF-100–15
Chemical compound, drugHydrocortisoneSigma-AldrichH-0888
Chemical compound, drugCholera ToxinSigma-AldrichC-8052
Chemical compound, drugInsulinSigma-AldrichI-1882
Commercial assay, kit7-AAD (DNA stain)BD Biosciences559,925
RRID:AB_2869266
Commercial assay, kitCytofix/Cytoperm solutionBD Biosciences554,722
RRID:AB_2869010
Commercial assay, kitPerm/Wash BufferBD Biosciences554,723
RRID:AB_2869011
Commercial assay, kitFITC BrdU Flow KitBD Biosciences559,619
RRID:AB_2617060
Sequence-based reagentpKLV lib330FThis study designed based on [Tzelepis et al., 2016]PCR primersAATGGACTATCATATGCTTACCGT
Sequence-based reagentpKLV lib490RThis study designed based on Tzelepis et al., 2016PCR primersCCTACCGGTGGATGTGGAATG
Sequence-based reagentPE.P5_pKLV lib195 FwdThis study designed based on Tzelepis et al., 2016 and standard Illumina adaptor sequencesPCR primersAATGATACGGCGACCACCGAGATCTGG
CTTTATATATCTTGTGGAAAGGAC
Sequence-based reagentP7 index180 RevThis study designed based on Tzelepis et al., 2016 and standard Illumina adaptor sequencesPCR primersCAAGCAGAAGACGGCATACGAGAT
INDEXGTGACTGGAGTTCAGACGTG
TGCTCTTCCGATCCAGACTGCCTTGGGAAAAGC
Sequence-based reagentBU1Canela et al., 2016PCR primers5′-Phos-GATCGGAAGAGCGTCGT
GTAGGGAAAGAGTGUU[Biotin-dT]U
[Biotin-dT]UUACACTCTTTC CCTACA
CGACGCTCTTCCGATC* T-3′
[*phosphorothioate bond]
Sequence-based reagentBU2Canela et al., 2016PCR primers5′-Phos-GATCGGAAGAGCACACG
TCUUUUUUUUAGACGTGTGCTC
TTCCGATC*T-3′ [*phosphorothioate bond]
Sequence-based reagentTrp53bp1 gRNA sequenceSequence is from Tzelepis et al., 2016N/AGAACCTGTCAGACCCGATC
Sequence-based reagentRbbp8 gRNA sequenceSequence is from Tzelepis et al., 2016N/AATTAACCGGCTACGAAAGA
Sequence-based reagentMre11 gRNA sequenceSequence is from Tzelepis et al., 2016N/ATGCCGTGGATACTAAATAC
Sequence-based reagentPrkdc gRNA sequenceSequence is from Tzelepis et al., 2016N/AATGCGTCTTAGGTGATCGA
Sequence-based reagentXrcc6 gRNA sequenceSequence is from Tzelepis et al., 2016N/ACCGAGACACGGTTGGCCAT
Sequence-based reagentFbxl12 gRNA sequenceSequence is from Tzelepis et al., 2016N/ATTCGCGATGAGCATCTGCA
Software, algorithmImage JNIHRRID:SCR_003070
Software, algorithmFlowJoFlowJoRRID:SCR_008520
Software, algorithmPrismGraphPadRRID:SCR_002798
Software, algorithmGen5Biotek InstrumentsRRID:SCR_017317
Software, algorithmSeqKitShen et al., 2016RRID:SCR_018926
Software, algorithmBowtieLangmead et al., 2009RRID:SCR_005476
Software, algorithmSAMtoolsLi et al., 2009RRID:SCR_002105
Software, algorithmBEDtoolsQuinlan and Hall, 2010RRID:SCR_006646
OtherLSRII Flow cytometerBD BioscienceRRID:SCR_002159Flow cytometer
OtherFACS Celesta Flow CytometerBD BioscienceRRID:SCR_019597Flow cytometer
OtherFACSAria II Cell SorterBD BioscienceRRID:SCR_018934Flow assisted cell sorter
OtherLionheart LX automated microscopeBioTex InstrumentsRRID:SCR_019745Automated microscope
Other4-D Amaxa NucleofecterLonzaNANucleofector

Cell lines and maintenance

Request a detailed protocol

Abelson virus-transformed pre-B cell lines were maintained in DMEM (Thermo Fisher #11960–077) supplemented with 10% fetal bovine serum, 1 X Penicillin-Streptomycin, 2 mM glutamine, 1 mM sodium pyruvate, 1 X nonessential amino acids, and 0.4% beta-mercaptoethanol at 37 °C with 5% CO2. MCF10A cells were maintained in DMEM/F12 (Gibco, #11330032), 5% horse serum, 20 ng/mL EGF, 0.5 μg/mL hydrocortisone, 100 ng/mL cholera toxin, 10 μg/mL insulin, and 1% Penicillin-Streptomycin at 37 °C with 5% CO2. 293T cells were maintained in DMEM (Corning, #10–013 CM) supplemented with 10% fetal bovine serum and 1 X Penicillin-Streptomycin at 37 °C with 5% CO2. MCF10A cell lines were authenticated by STR profiling, and MCF10A and murine cell lines tested negative for mycoplasma contamination.

Lig4-/- abl pre-B cells contain pCW-Cas9 (addgene, #50661) which expresses cas9 under a doxycycline-induced promoter. To generate single cell clones of Lig4-/-:Trp53bp1-/-, Lig4-/-:Xrcc6-/-, Lig4-/-:Prkdc-/-, and Lig4-/-:Fbxl12-/-, guide RNAs (gRNAs) against each gene were cloned into pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (addgene, #62348) modified to express human CD2 as a cell surface marker. Lig4-/- abl pre-B cells were grown in 3 μg/mL of doxycycline for 2 days and then nucleofected with the pKLV-gRNA plasmid using a Lonza Amaxa Nucleofector. The next day, cells were magnetically selected for human CD2 cell surface expression, and selected cells were grown in 3 μg/mL doxycycline overnight. Serial dilution in 96 well plates was used to isolate single cells. After cell growth, potential clones were confirmed to have the gene of interest knocked out by Sanger sequencing or western blotting. Lig4 deletion was confirmed by PCR as previously described (Chen et al., 2021a).

Bulk gene inactivation gRNAs against Mre11, Rbbp8, and Xrcc6 were cloned into pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (addgene, #62348). 293T cells were transfected with the pKLV-gRNA plasmid along with lentiviral packaging and lentiviral envelope plasmids. Three days post-transfection, supernatant containing pKLV-gRNA lentivirus was filtered with a 0.45 μm filter. Lig4-/- cells were resuspended in the filtered viral supernatant supplemented with 5 μg/mL polybrene (Sigma-Aldrich, #S2667) in six-well plates and centrifuged at 1800 RPM for 1.5 hr at room temperature. After spin infection, virally transduced cells were supplemented with DMEM containing 3 μg/mL doxycycline for 3 days before flow cytometry-assisted cell sorting or magnetic-assisted cell sorting based on hCD2 cell surface expression.

Flow cytometry

Request a detailed protocol

Abl pre-B cells were arrested in G0 using 3 μM imatinib (Selleck Chemicals, #S2475) for 48 hr. MCF10A cells were arrested in G0 by withdrawing EGF for 48 hr. To arrest cells in G2, abl pre-B cells were treated with 10 μM RO-3306 (Selleck Chemicals, #S7747) overnight. For experiments analyzing DNA-PKcs and ATM inhibition, 10 μM NU7441 (Selleck Chemicals, #S2638) or 15 μM KU-55933 (Selleck Chemicals, #S1092) was added 1 hr prior to irradiation. After irradiation with 20 Gray, cells were allowed to recover for 3 hr. Cells were then pre-extracted with 0.05% Triton-X 100 (imatinib-treated abl pre-B cells), 0.2% Triton-X 100 (proliferating abl pre-B cells), or 0.5% Triton-X 100 (MCF10A cells) in PBS and fixed with BD Cytofix/Cytoperm solution (BD Biosciences, #554722) containing 4.2% formaldehyde. Fixed cells were stained with anti-RPA32 (Cell Signaling Technology, #2,208 S) for 2 hr at room temperature, and then treated with a fluorescent conjugated secondary antibody (BioLegend, #405,416 or BioLegend, #405418) for 1 hr at room temperature. 7-AAD was added to each sample to stain for DNA content. Cells were analyzed using a BD LSRII Flow Cytometer or a BD FACSCelesta and flow cytometry results were further analyzed using FlowJo.

Nuclear RPA immunofluorescence staining

Request a detailed protocol

A total of 60,000 G0-arrested MCF10A cells grown on cover slips were irradiated with 10 Gray IR and then allowed to recover for 3 hr at 37 °C with 5% CO2. Cells were then washed with PBS containing 0.1% Tween-20 (PBST), pre-extracted using cold 0.5% Triton-X100 in PBS for 5 min, fixed with 4% formaldehyde for 15 min, and blocked in 3% BSA-PBST for 1 hr at room temperature. Cells were incubated overnight at 4 °C in primary antibody (anti-RPA32, Cell Signaling Technology, #2208). Samples diluted in 3% BSA-PBST were then washed 3 x with PBST, incubated with secondary antibody diluted in 3% BSA (Alexa Fluor 594 Goat anti-Rat IgG, BioLegend, #405422) in the dark for 1 hr at room temperature, washed 3 x with PBST, and mounted in Prolong Gold Antifade Mountant with DAPI (Life Technologies, #P-36931). Images were taken using a Biotek Lionheart Automatic Microscope and foci quantification was performed using Biotek Gen5 software.

END-Seq and RPA-ChIP Seq

Request a detailed protocol

Sequencing assays were performed in Lig4-/- abl pre-B cells after arrest in G0 with imatinib for 24 hr or arrest in G2 with RO-3306 for 12 hr, then treated with doxycycline (3 µg/µL) for 24 hr followed by tamoxifen treatment (1 µM) for 4 or 8 hr to induce AsiSI breaks in the nucleus. Cell cycle arrest and AsiSI induction were confirmed as previously described (Paiano et al., 2021). G1 and G2 arrest were confirmed by EdU/DAPI FACS. Cells were pulsed with EdU (10 µM) for 30 min and then fixed in a 1% formaldehyde solution and stained with an AF488 azide. Approximately 90% of cells were in G1 or G2 (respectively) at the time of tamoxifen addition. AsiSI induction was confirmed by staining with an anti-phospho-KAP1 antibody (Thermo Fisher A300-767A) at multiple timepoints and then staining with a fluorescent secondary antibody (AF647). AsiSI was induced at consistent levels after 4 hr (90–95% positivity) (data not shown). END-Seq was performed as previously described (Chen et al., 2021a; Wong et al., 2021). Cells were embedded in agarose plugs, lysed, and treated with proteinase K and RNase A. The DNA was then blunted with ExoVII (NEB) and ExoT (NEB), A-tailed, and ligated with a biotinylated hairpin adaptor. DNA was then recovered and sonicated to a length between 150 and 200 bp and biotinylated DNA fragments were purified using streptavidin beads (MyOne C1, Invitrogen). The DNA was then end-repaired and ligated to hairpin adaptor BU2 and amplified by PCR. RPA single-strand DNA sequencing was performed as previously described (Paiano et al., 2021). Cells were fixed in 1% formaldehyde (Sigma F1635) for 10 min at 37 °C, quenched with 125 mM glycine (Sigma), washed twice with cold 1×PBS. After centrifugation, pellets were frozen on dry ice, and stored at −80 °C. Sonication, immunoprecipitation, and library preparation were performed as previously detailed (Tubbs et al., 2018). Before immunoprecipitation, sheared chromatin was precleared with 40 µL of Dynabeads Protein A (Thermo Fisher) for 30 min at 4 °C. Sheared chromatin was enriched with 10 µg of anti-RPA32/RPA2 antibody (Abcam ab10359) on Dynabeads Protein A overnight at 4 °C. During library preparation, kinetic enrichment of single-strand DNA was performed by heating sheared DNA for 3 min at 95 °C and allowing DNA to return to room temperature (Tubbs et al., 2018). All END-seq and RPA ChIP-seq libraries were collected by gel purification and quantified using qPCR. Sequencing was performed on the Illumina NextSeq500 (75 cycles) as previously described (Chen et al., 2021a).

Genome alignment and visualization

Request a detailed protocol

END-seq and RPA ChIP-seq single-end reads were aligned to the mouse genome (mm10) using Bowtie v1.1.2 (Langmead et al., 2009) with parameters (-n 3 k 1 l 50) for END-seq and (-n 2 m 1 l 50) for RPA ChIP-seq. All plots or analysis were done for the top 200 AsiSI sites determined by END-seq. Alignment files were generated and sorted using SAMtools (Li et al., 2009) and converted to bedgraph files using bedtools genomecov Quinlan and Hall, 2010 following by bedGraphToBigWig to make a bigwig file (Kent et al., 2010). Visualization of genomic profiles was done by the UCSC genome browser (Kent et al., 2002) and normalized to present RPM. Heat maps were produced using the R package pheatmap.

Genome-wide guide RNA library screen

Request a detailed protocol

A total of 144 million Lig4-/- abl pre-B cells with tet-inducible Cas9 were transduced with a lentiviral gRNA library (Pooled Library #67988, Addgene) containing 90,000 gRNAs targeting over 18,000 mouse genes. Three days post-infection, cells were sorted for gRNA vector expression using a BD FACSAria flow cytometry assisted cell sorter by BFP fluorescence. The next day, sorted cells were treated with 3 µg/ml doxycycline to induce Cas9-mediated gene inactivation. Seven days later, cells were treated with imatinib to arrest cells in G0. Forty-eight hours later, cells were irradiated with 20 Gray and allowed to recover for 2 hr. After collection, cells were permeabilized, fixed, and stained with anti-RPA32 in the same manner as described in the Flow Cytometry section. After staining, the top 10% and bottom 10% of RPA stained cells were collected using flow cytometry assisted cell sorting and genomic DNA was extracted. An Illumina sequencing library was generated using two rounds of PCR to amplify the gRNA and add a barcode, then purified PCR products containing the barcoded enriched gRNAs were sequenced on an Illumina HiSeq2500. Sequencing data were processed as previously described (Chen et al., 2021a).

Western blotting

Request a detailed protocol

The following antibodies were used for western blot analysis: CtIP (gift from Dr. Richard Baer, [Columbia University, New York], 1:1000), MRE11 (Novus Biologicals, NB100-142, 1:2000), GAPDH (Sigma, G8795, 1:10,000), DNA-PKcs (Invitrogen, MA5-32192, 1:1000), KAP1 (Genetex, GTX102226, 1:2000), KU70 (Cell Signaling Technology, #4588, 1:1000).

Plasmid Constructs pCW-Cas9 was a gift from Eric Lander and David Sabatini (Addgene plasmid #50661) (Wang et al., 2014). pKLV-U6gRNA(BbsI)-PGKpuro2ABFP was a gift from Kosuke Yusa (Addgene plasmid #50946) (Koike-Yusa et al., 2014). Mouse Improved Genome-wide Knockout CRISPR Library v2 was a gift from Kosuke Yusa (Addgene #67988) (Tzelepis et al., 2016).

Data availability

Sequencing data have been deposited in GEO under accession codes GSE186087.

The following data sets were generated

References

  1. Book
    1. Bartlett EJ
    2. Lees-Miller SP
    (2018) Established and Emerging Roles of the DNA-Dependent Protein Kinase Catalytic Subunit (DNA-PKcs
    In: Bartlett EJ, editors. Targeting the DNA Damage Response for Anti-Cancer Therapy. Cham: Springer International Publishing. pp. 315–338.
    https://doi.org/10.1007/978-3-319-75836-7_12

Decision letter

  1. Wolf-Dietrich Heyer
    Reviewing Editor; University of California, Davis, United States
  2. Kevin Struhl
    Senior Editor; Harvard Medical School, United States
  3. Wolf-Dietrich Heyer
    Reviewer; University of California, Davis, United States

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "DNA-PK Promotes DNA End Resection at DNA Double Strand Breaks in G0 cells" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Wolf-Dietrich Heyer as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Kevin Struhl as the Senior Editor.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Recommendations to the authors

All reviewers agree that the authors made a significant discovery that will be of great interest to the field. There was also a consensus that more data are needed in three areas. (1) More evidence is needed to ensure that the observations apply to human cells, in light of the fact that human cells have 50x less DNA-PK than murine cells. (2) More evidence is needed that the phenomenon is truly G0 specific and not occurring in G1 cells. (3) There is some concern that most experiments were conducted in LIG4-deficient cells. Without wanting to be prescriptive, additional data with the LIG4-proficient human MCF10A cell line applying END-Seq to G0 and G1 cells evaluating DSB resection in dependence of DNA PK would nicely address these concerns.

Essential revisions

1) Despite showing a similar increase in the chromatin-bound RPA upon irradiation in WT abl pre-B cells, the authors utilize for the majority of the experiments abl pre-B cells deficient for Lig4. It is important to verify that the inability to complete the NHEJ repair process due to the lack of Lig4 does not cause pathological resection of the DSBs. Additional examination in NHEJ proficient cells would eliminate this concern.

2) The authors use Imatinib treatment for abl pre-B cells or serum deprivation in MCF10A for 48 h to arrest cells in G0 phase. However, further analyses are needed to validate that after only two days of treatment cells have really exited the cell cycle.

3) The authors suggest that the DNA-PK complex promotes DSBs resection uniquely in G0 but not in other cell cycle phases. To draw this conclusion, a few control experiments should be included. END-seq analysis of AsiSI-induced DSBs in Lig4-/- abl pre-B cells should be performed also in G1 phase. Moreover, taking into account that V(D)J recombination is happening in the G0/G1 phase of immune cells, which could explain the high level of resection shown in G1 pre-B cells, the experiments should be replicated in another cell line, like in MCF10A.

4) The paper nicely demonstrates the involvement of the DNA-PK complex in DSBs resection in G0 murine abl pre-B cells. To consolidate the results, the authors should confirm the requirement of the DNA-PK complex (including KU70/80) and its regulation by FBXL12 also in MCF10A. This extends their finding from a murine model to human cells and is important to expand the impact of the paper.

5) The authors should extract more data from the END-seq analyses and report average and median resection tracts for each experiment.

6) In the discussion about the mechanistic significance for G0 DSB resection, the authors may want to consider adding a paragraph on TMEJ and the possibility that end-processing represents a way to shift an NHEJ substrate to a TMEJ substrate. The authors may also want to consider and discuss a relatively recent report on resection dependent classic NHEJ (https://pubmed.ncbi.nlm.nih.gov/28132842/).

7) CtIP is licensed by phosphorylation in S/G2. Can the authors comment on CtIP activity in G0/G1 and the possibility that some phosphorylation exists under these conditions?

8) Chromatin-bound RPA levels have been assessed in various experiments throughout the manuscript. However, the dose of X-rays and the time after irradiation have been frequently changing. Please clarify the reason for those inconsistencies.

9) A genome wide CRISPR/Cas9 screen was performed to identify factors promoting resection in G0 cells. Detailed information regarding the screen is however missing. Please specify how many times it was repeated and clarify how the fold enrichment of the gRNAs is calculated.

10) A clearer description of the Lig4-/- AsiSI abl pre-B cells is needed. Please specify how these cells were generated and how DSB induction was optimized. Please add also information on the concentration of tamoxifen utilized. Furthermore, the location of the DSBs should be analyzed to show if there is a subgroup of them which is prone to resection and is perhaps located in a particular genomic region (genes versus non-genes, transcriptionally active versus inactive, etc.).

11) In the discussion, the authors mention Artemis as an example of a nuclease involved in resection and V(D)J recombination. Since Artemis is known to be involved in NHEJ in G1, and in HR in G2, its function could be tested to assess the difference in NHEJ repair in quiescent and G1 cells and would serve as a nice control to show the processes are entirely different.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "DNA-PK Promotes DNA End Resection at DNA Double Strand Breaks in G0 cells" for further consideration by eLife. Your revised article has been evaluated by Kevin Struhl (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

The revised manuscript strengthened an already strong manuscript, and the revision addresses the concerns of the reviewers. There is one point of clarification needed about Figure 4E. The rebuttal and text describe that G0 wild type MCF10A cells show DNA PK dependent resection. It follows that upon DNAPK inhibition the amount of RPA should decrease, as resection is reduced. As far as I understand Figure 4E, the results show the opposite: the green curve (DNAPKi +IR) shifts to the right (more RPA) compared to IR only. IS there an error in the figure, in the description, or in my understanding?

https://doi.org/10.7554/eLife.74700.sa1

Author response

Essential revisions

1) Despite showing a similar increase in the chromatin-bound RPA upon irradiation in WT abl pre-B cells, the authors utilize for the majority of the experiments abl pre-B cells deficient for Lig4. It is important to verify that the inability to complete the NHEJ repair process due to the lack of Lig4 does not cause pathological resection of the DSBs. Additional examination in NHEJ proficient cells would eliminate this concern.

In addition to showing that chromatin-bound RPA increases upon irradiation in quiescent wild type (WT) abl pre-B cells (Figure 1 —figure supplement 1B) we now show that DNA-PK activity promotes DNA end resection in quiescent WT abl pre-B cells. This is included as new Figure 2 —figure supplement 1C. In addition to showing that chromatin-bound RPA increases upon irradiation in quiescent WT human MCF10A Figure 1 —figure supplement 1E, we show that RPA foci formation increases after IR in quiescent WT MCF10A (Figure 1C), the dependance of DNA-PK activity for RPA foci formation in quiescent WT MCF10A (Figure 2 —figure supplement 1D) and that DNA-PK promotes chromatin bound RPA in quiescent WT MCF10A cells, but not G1 WT RPA foci formation increases after IR in WT MCF10A (new figure 4E).

2) The authors use Imatinib treatment for abl pre-B cells or serum deprivation in MCF10A for 48 h to arrest cells in G0 phase. However, further analyses are needed to validate that after only two days of treatment cells have really exited the cell cycle.

This is a good point. Accordingly, we recently published an extensive analysis of phospho targets that demonstrates that Imatinib treatment in abl pre-B cells and serum deprivation in MCF10A for 48 h arrests cells in G0 phase not G1 phase (Chen et al. 2021 eLife), using the identical conditions for arrest that we use in the current manuscript.

3) The authors suggest that the DNA-PK complex promotes DSBs resection uniquely in G0 but not in other cell cycle phases. To draw this conclusion, a few control experiments should be included. END-seq analysis of AsiSI-induced DSBs in Lig4-/- abl pre-B cells should be performed also in G1 phase. Moreover, taking into account that V(D)J recombination is happening in the G0/G1 phase of immune cells, which could explain the high level of resection shown in G1 pre-B cells, the experiments should be replicated in another cell line, like in MCF10A.

We had shown that chromatin-bound RPA increases after IR in G1 phase cells by gating the cycling cells on 2N DNA content at the time of the analysis. RPA only binds to ssDNA, so there is no other conclusion to be made other than this is due to increased DNA end resection. It is not possible for us to perform the reviewers suggested END-seq in G1 phase cells, because we sort for cycling G1 cells, and by the time that the END-Seq analysis would be done the cells would no longer be in G1 phase, given that the induction of AsiSI is by treatment with doxycycline for 24 hours followed by nuclear localization of AsiSI by tamoxifen treatment for 4 and 8 hours to induce AsiSI cutting. Regarding the question of whether the RPA binding is due to V(D)J recombination, we have published extensively that VDJ occurs in the imatinib (G0) arrested cells while the RPA binding to chromatin and end-resection that we see in G0 arrested cells is totally dependent on irradiation. Nonetheless, we now show that chromatin-bound RPA increases in both G0 and G1 WT MCF10A cells after IR but is only dependent on DNA-PK in G0 cells (new Figure 4E).

4) The paper nicely demonstrates the involvement of the DNA-PK complex in DSBs resection in G0 murine abl pre-B cells. To consolidate the results, the authors should confirm the requirement of the DNA-PK complex (including KU70/80) and its regulation by FBXL12 also in MCF10A. This extends their finding from a murine model to human cells and is important to expand the impact of the paper.

Unfortunately, human cells are more sensitive to DNA-PK depletion than murine cells, so genetic knockout of DNA-PK was unsuccessful using our lab’s CRISPR/Cas9 technique. Previous literature shows that Ku70 and Ku80 are encoded by essential genes and a homozygous knockout is difficult to achieve (Hendrickson, E.A., et al. 2008 PNAS; Hendrickson, E.A. et al. 2002 PNAS). However, as discussed above, we now include new data showing DNAPK dependent resection in MCF10A cells in G0 phase (Figure 4E). We attempted to make MCF10A Fbxl12-/- cells numerous times with different gRNAs, and screened dozens of clones, but were unsuccessful at obtaining homozygous knockout clones. This is what has held up resubmission of our paper for so long. We are still attempting to make homozygous knockout clones but would add at a minimum 2 more months before our resubmission.

5) The authors should extract more data from the END-seq analyses and report average and median resection tracts for each experiment.

This has been done and included as Figure 4D.

6) In the discussion about the mechanistic significance for G0 DSB resection, the authors may want to consider adding a paragraph on TMEJ and the possibility that end-processing represents a way to shift an NHEJ substrate to a TMEJ substrate. The authors may also want to consider and discuss a relatively recent report on resection dependent classic NHEJ (https://pubmed.ncbi.nlm.nih.gov/28132842/).

We now include some discussion about these possibilities. TMEJ requires some DNA end resection and is considered a backup pathway for breaks that cannot complete HR but have undergone DNA end resection or at breaks that do not have suitable ends for NHEJ. It is possible, especially in Lig4-/- cells, that TMEJ could be responsible for DSB repair after resection in G0, though we note that TMEJ is Ku-independent and our G0 DNA end resection is Ku-dependent.

We now mention resection-dependent NHEJ as an example of nuclease activity in DSB repair outside of HR, but the reviewer cited paper shows that Artemis is absolutely required for this process, and our data shows Artemis has no role in G0 DSB repair (Figure 1—figure supplement 1D), it is unlikely this repair process is what we observe in G0 cells.

7) CtIP is licensed by phosphorylation in S/G2. Can the authors comment on CtIP activity in G0/G1 and the possibility that some phosphorylation exists under these conditions?

We now mention in the introduction that CtIP has been shown to be phosphorylated by PLK3 in G1 during DSB repair and have discussed the likelihood that CtIP is also phosphorylated in G0 cells.

8) Chromatin-bound RPA levels have been assessed in various experiments throughout the manuscript. However, the dose of X-rays and the time after irradiation have been frequently changing. Please clarify the reason for those inconsistencies.

Most flow cytometry experiments were performed with 20 Gray IR and samples were collected 3 hours after irradiation. Figures 1B, 2C, 3D, 4E exhibit either a slightly different dose of IR (15 Gy) or time point (2 hours or 4 hours) due to these experiments being performed at a different facility. The experimental parameters were reassessed and optimized at the new facility. The CRISPR/Cas9 screen was collected at 2 hours instead of 3 due to time constraints of the experiment. We have observed that the extent of resection in G0 is not significantly different between 2-4 hours after IR. For immunofluorescence experiments doses of IR were experimentally determined to provide resolution of the RPA foci by IF to enable counting, which required a lower IR dose. Immunofluorescence after 15-20 Gray showed RPA foci merging to fill the entire nucleus.

9) A genome wide CRISPR/Cas9 screen was performed to identify factors promoting resection in G0 cells. Detailed information regarding the screen is however missing. Please specify how many times it was repeated and clarify how the fold enrichment of the gRNAs is calculated.

We now include in the figure legend how the fold enrichment was calculated: the ratio of normalized read number of gRNAs in the low RPA population and that in the high RPA population and vice versa. We also indicate that the screen was performed once (n=1). Notably, we validated all the hits that we studied in this manuscript.

10) A clearer description of the Lig4-/- AsiSI abl pre-B cells is needed. Please specify how these cells were generated and how DSB induction was optimized. Please add also information on the concentration of tamoxifen utilized.

We now include this information in the methods section.

Furthermore, the location of the DSBs should be analyzed to show if there is a subgroup of them which is prone to resection and is perhaps located in a particular genomic region (genes versus non-genes, transcriptionally active versus inactive, etc.).

Generally, there are about 200 broken AsisI breaks detectable by ENDseq, so we used the top 200 sites. Most of them are close to TSS: 189 out of 200 are within +/2kb of TSS. And 170 of the 200 AsisI sites that their closest genes are expressed (RPKM>0.1) measured by a nasRNA-seq in abl pre-B cells. These analyses are now included in Figure 1 – supplemental figure 2.

11) In the discussion, the authors mention Artemis as an example of a nuclease involved in resection and V(D)J recombination. Since Artemis is known to be involved in NHEJ in G1, and in HR in G2, its function could be tested to assess the difference in NHEJ repair in quiescent and G1 cells and would serve as a nice control to show the processes are entirely different.

To address this comment, we have now tested Artemis dependency in G0 arrested abl pre-B cells after IR and show that it is not required for resection in G0 arrested cells in figure 1 —figure supplement 1D. We have altered the discussion accordingly.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

The revised manuscript strengthened an already strong manuscript, and the revision addresses the concerns of the reviewers. There is one point of clarification needed about Figure 4E. The rebuttal and text describe that G0 wild type MCF10A cells show DNA PK dependent resection. It follows that upon DNAPK inhibition the amount of RPA should decrease, as resection is reduced. As far as I understand Figure 4E, the results show the opposite: the green curve (DNAPKi +IR) shifts to the right (more RPA) compared to IR only. IS there an error in the figure, in the description, or in my understanding?

Thank you for carefully reading our manuscript and looking at the new data. It transpires that somehow upon Figure assembly we did invert the labelling somehow. Thanks so much for seeing this as it avoids an embarrassing correction. We have updated the figure accordingly.

https://doi.org/10.7554/eLife.74700.sa2

Article and author information

Author details

  1. Faith C Fowler

    1. Weill Cornell Medicine Pharmacology Graduate Program, New York, United States
    2. Weill Cornell Medicine, Department of Pathology and Laboratory Medicine, New York, United States
    Contribution
    Data curation, Formal analysis, Investigation, Methodology, Writing - original draft
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7180-8141
  2. Bo-Ruei Chen

    Department of Medicine, Division of Hematology and Oncology, O'Neal Comprehensive Cancer Center, University of Alabama at Birmingham, Birmingham, United States
    Contribution
    Conceptualization, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6404-2099
  3. Nicholas Zolnerowich

    Laboratory of Genome Integrity, National Cancer Institute, Bethesda, United States
    Contribution
    Data curation, Investigation
    Competing interests
    No competing interests declared
  4. Wei Wu

    Laboratory of Genome Integrity, National Cancer Institute, Bethesda, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  5. Raphael Pavani

    Laboratory of Genome Integrity, National Cancer Institute, Bethesda, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  6. Jacob Paiano

    Laboratory of Genome Integrity, National Cancer Institute, Bethesda, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  7. Chelsea Peart

    Weill Cornell Medicine, Department of Pathology and Laboratory Medicine, New York, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  8. Zulong Chen

    Weill Cornell Medicine, Department of Pathology and Laboratory Medicine, New York, United States
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  9. André Nussenzweig

    Laboratory of Genome Integrity, National Cancer Institute, Bethesda, United States
    Contribution
    Funding acquisition, Project administration
    Competing interests
    No competing interests declared
  10. Barry P Sleckman

    Department of Medicine, Division of Hematology and Oncology, O'Neal Comprehensive Cancer Center, University of Alabama at Birmingham, Birmingham, United States
    Contribution
    Conceptualization, Project administration
    For correspondence
    bps@uab.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8295-4462
  11. Jessica K Tyler

    Weill Cornell Medicine, Department of Pathology and Laboratory Medicine, New York, United States
    Contribution
    Conceptualization, Funding acquisition, Writing - review and editing
    For correspondence
    jet2021@med.cornell.edu
    Competing interests
    Senior editor, eLife
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-9765-1659

Funding

NIH Office of the Director (R35 GM139816)

  • Jessica K Tyler

NIH Office of the Director (RO1 CA95641)

  • Jessica K Tyler

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

The authors thank Chitra Mohan for designing the model graphic and Yinan Wang for performing the bioinformatics for the high throughput screen. We thank the Weill Cornell Flow Cytometry Core for flow cytometric analysis and the Weill Cornell Epigenomics Core for providing advice and performing the sequencing for the high throughput screen. JKT is supported by NIH R35 GM139816 and R01 CA95641. BPS is supported by NIH R01 AI047829 and R01 AI074953. FCF is supported by NIH F31 CA239442. JKT and BPS were also supported by the Starr Cancer Consortium and Emerson Collective Cancer Research Fund.

Senior Editor

  1. Kevin Struhl, Harvard Medical School, United States

Reviewing Editor

  1. Wolf-Dietrich Heyer, University of California, Davis, United States

Reviewer

  1. Wolf-Dietrich Heyer, University of California, Davis, United States

Publication history

  1. Received: October 14, 2021
  2. Preprint posted: October 21, 2021 (view preprint)
  3. Accepted: May 6, 2022
  4. Accepted Manuscript published: May 16, 2022 (version 1)
  5. Version of Record published: May 20, 2022 (version 2)

Copyright

This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.

Metrics

  • 1,230
    Page views
  • 393
    Downloads
  • 2
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Faith C Fowler
  2. Bo-Ruei Chen
  3. Nicholas Zolnerowich
  4. Wei Wu
  5. Raphael Pavani
  6. Jacob Paiano
  7. Chelsea Peart
  8. Zulong Chen
  9. André Nussenzweig
  10. Barry P Sleckman
  11. Jessica K Tyler
(2022)
DNA-PK promotes DNA end resection at DNA double strand breaks in G0 cells
eLife 11:e74700.
https://doi.org/10.7554/eLife.74700
  1. Further reading

Further reading

    1. Biochemistry and Chemical Biology
    2. Chromosomes and Gene Expression
    Radhika A Varier, Theodora Sideri ... Folkert Jacobus van Werven
    Research Article

    N6-methyladenosine (m6A) RNA modification impacts mRNA fate primarily via reader proteins, which dictate processes in development, stress, and disease. Yet little is known about m6A function in Saccharomyces cerevisiae, which occurs solely during early meiosis. Here we perform a multifaceted analysis of the m6A reader protein Pho92/Mrb1. Cross-linking immunoprecipitation analysis reveals that Pho92 associates with the 3’end of meiotic mRNAs in both an m6A-dependent and independent manner. Within cells, Pho92 transitions from the nucleus to the cytoplasm, and associates with translating ribosomes. In the nucleus Pho92 associates with target loci through its interaction with transcriptional elongator Paf1C. Functionally, we show that Pho92 promotes and links protein synthesis to mRNA decay. As such, the Pho92-mediated m6A-mRNA decay is contingent on active translation and the CCR4-NOT complex. We propose that the m6A reader Pho92 is loaded co-transcriptionally to facilitate protein synthesis and subsequent decay of m6A modified transcripts, and thereby promotes meiosis.

    1. Chromosomes and Gene Expression
    2. Structural Biology and Molecular Biophysics
    Yu Chen, Claudia Cattoglio ... Xavier Darzacq
    Research Article Updated

    Transcription factors (TFs) are classically attributed a modular construction, containing well-structured sequence-specific DNA-binding domains (DBDs) paired with disordered activation domains (ADs) responsible for protein-protein interactions targeting co-factors or the core transcription initiation machinery. However, this simple division of labor model struggles to explain why TFs with identical DNA-binding sequence specificity determined in vitro exhibit distinct binding profiles in vivo. The family of hypoxia-inducible factors (HIFs) offer a stark example: aberrantly expressed in several cancer types, HIF-1α and HIF-2α subunit isoforms recognize the same DNA motif in vitro – the hypoxia response element (HRE) – but only share a subset of their target genes in vivo, while eliciting contrasting effects on cancer development and progression under certain circumstances. To probe the mechanisms mediating isoform-specific gene regulation, we used live-cell single particle tracking (SPT) to investigate HIF nuclear dynamics and how they change upon genetic perturbation or drug treatment. We found that HIF-α subunits and their dimerization partner HIF-1β exhibit distinct diffusion and binding characteristics that are exquisitely sensitive to concentration and subunit stoichiometry. Using domain-swap variants, mutations, and a HIF-2α specific inhibitor, we found that although the DBD and dimerization domains are important, another main determinant of chromatin binding and diffusion behavior is the AD-containing intrinsically disordered region (IDR). Using Cut&Run and RNA-seq as orthogonal genomic approaches, we also confirmed IDR-dependent binding and activation of a specific subset of HIF target genes. These findings reveal a previously unappreciated role of IDRs in regulating the TF search and binding process that contribute to functional target site selectivity on chromatin.