Somite morphogenesis is required for axial blood vessel formation during zebrafish embryogenesis
- Department of Biochemistry and Cell Biology, Stony Brook University, United States
- Molecular Cardiovascular Biology Division and Heart Institute, Cincinnati Children's Hospital Medical Center, United States
- Department of Pediatrics, University of Cincinnati College of Medicine, United States
Figures
Figure 1 with 1 supplement
Retinoic acid (RA) is required prior to segmentation for angioblast migration.
-
Figure 1—source data 1
Wild-type and aldh1a2 -/- midline fluorescence percentages.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig1-data1-v2.csv
-
Figure 1—source data 2
DMSO and RA treatment midline fluorescence percentages.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig1-data2-v2.csv
Figure 1—figure supplement 1
Three alternative methods of retinoic acid (RA) signaling disruption inhibit midline angioblast migration.
Angioblasts are labeled by etv2 in situ hybridization in 13-somite stage embryos (black arrows) after (A) DMSO, (B) BMS453, or (C) DEAB treatment, or after bud stage heat shock in (D) wild-type and …
Figure 2 with 1 supplement
Retinoic acid (RA) signaling is not present in the endothelium and is required in the somites for angioblast migration.
(A) Representative images of a time-lapse of tg(HS:dnRAR), tg(HS:id3) cells transplanted into a wild-type embryo. Cells labeled in magenta indicate migrating cells. These cells migrate along with …
-
Figure 2—source data 1
Fluorescence percentage at midline for somite targeted transplants.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig2-data1-v2.csv
-
Figure 2—source data 2
Fluorescence percentage at midline for notochord targeted transplants.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig2-data2-v2.csv
Figure 2—figure supplement 1
Apela/Aplnr axis is not altered by the changes in retinoic acid signaling.
In situ hybridization of the 10-somite stage embryos. (A, B) In situ hybridization against aplnra. (A) DMSO-treated embryos. (B) DEAB-treated embryos. (C, D) In situ hybridization against aplnrb. (C)…
Figure 3 with 1 supplement
The somitic mesoderm, not the notochord, is required for midline convergence of angioblasts.
(A) Time-lapse imaging of tg(kdrl:eGFP) embryos injected with control morpholino over a 240′ period. (B) tg(kdrl:eGFP) embryos injected with noto morpholino over a 240′ period. Red arrows indicate …
Figure 3—figure supplement 1
Bifurcated angioblasts in tbx16 mutants preferentially join the venous population.
(A, B) dab2 and (C, D) cldn5b in situ hybridization labels the veins and arteries, respectively (black arrows) in (A, C) wild-type and (B, D) tbx16-/- embryos. Embryos are shown from a dorsal view …
Figure 4
Retinoic acid (RA) signaling promotes dorsal translocation of the notochord.
(A–C) Fluorescent images of fixed (A) DMSO-treated, (B), DEAD-treated, and (C) RA-treated tg(ubb:lck-mNG) embryo trunks at the 12- and 15-somite stage. Yellow brackets indicate the distance between …
-
Figure 4—source data 1
Distances of notochord to endoderm after RA manipulation.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig4-data1-v2.csv
Figure 5 with 1 supplement
Retinoic acid (RA) mediates a notochord-endoderm separation required for terminal angioblast migration.
(A–I) Embryos generated by crossing tg(HS:lifeact) to tg(kdrl:eGFP) to label both actin and angioblasts. Yellow arrowheads indicate the midline while white arrows indicate angioblasts. A magnified …
-
Figure 5—source data 1
Fluorescence percentage at midline for DMSO treated embryos at 5th and 12th somite.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig5-data1-v2.csv
-
Figure 5—source data 2
Fluorescence percentage at midline for DEAB treated embryos at 5th and 12th somite.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig5-data2-v2.csv
Figure 5—figure supplement 1
The ventral midline cavity is acellular.
Maximum projections of a 15 µm image stack from a section at the fifth somite of a 12-somite stage embryo. The transgenic tg(kdrl:eGFP), tg(HS:lifeact) embryos were labeled with DAPI to stain …
Figure 6 with 1 supplement
Retinoic acid loss contributes to changes in the definitive vasculature, resulting in large veins and small arteries.
(A, B) A 24 hpf tg(kdrl:eGFP) embryo labeled with DAPI. (A) Wild-type embryos show lumenized blood vessels and normal-sized dorsal aorta. (B) Labeled aldh1a2-/-, tg(kdrl:eGFP) sibling shows small …
-
Figure 6—source data 1
Nuclei count in dorsal aorta and cardinal vein.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig6-data1-v2.csv
Figure 6—figure supplement 1
Effects of retinoic acid (RA) depletion on arterial and venous markers.
(A, C) dab2 and (B, D) cldn5b in situ hybridization labels the veins and arteries, respectively, in (A, B) wild-type or (C, D) aldh1a2-/- embryos. Embryos are shown from a lateral view with anterior …
Figure 7 with 2 supplements
Retinoic acid controls intrasomitic cellular movements and somite shape changes that contribute to angioblast convergence to the midline.
(A) Image and schematic of newly born 12th somite using tg(HS:lifeact), tg(kdrl:eGFP) embryo as reference. Dashed lines indicate the somite and notochord. (B) Schematic of more mature fifth somite …
-
Figure 7—source data 1
Displacement of nuclei within the somite.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig7-data1-v2.csv
-
Figure 7—source data 2
Speed of nuclei within the somite.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig7-data2-v2.csv
-
Figure 7—source data 3
The ratio of ventral expansion of the somite over NES.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig7-data3-v2.csv
-
Figure 7—source data 4
The percentage of midline fluorescence in relation to ventral somite expansion.The percentage of midline fluorescence in relation to ventral somite expansion.The percentage of midline fluorescence in relation to ventral somite expansion.
- https://cdn.elifesciences.org/articles/74821/elife-74821-fig7-data4-v2.csv
Figure 7—figure supplement 1
Loss of retinoic acid (RA) function in chimeric embryos shows regional defects in notochord-endoderm separation (NES) and angioblast migration.
(A–D) Sections of chimeric embryos at roughly the fifth somite. (A) Transplant of rhodamine dextran-labeled wild-type cells into tg(ubb:lck-mNG) host embryo at the 12-somite stage. (B) Transplant of …
Figure 7—figure supplement 2
Retinoic acid (RA) signaling affects the expression of genes associated with somitic movements.
(A–C) In situ hybridization for cxcr4a and (D–F) cxcl12a in (A, D) DMSO, (B, E) 20 µM DEAB, or (C, F) 0.1 µM RA-treated embryos. Embryos are shown from a dorsal view with anterior to the top.
Videos
Video 1
Time-lapse fluorescent imaging of tg(kdrl:eGFP) embryo at the 10-somite stage.tg(kdrl:eGFP) marks angioblasts as they migrate to the midline.
Angioblasts display the anterior posterior processivity while coalescing at the midline. Frame rate = 1 image/5 min. Run time = 235 min.
Video 2
Time-lapse fluorescent imaging of tg(kdrl:eGFP), aldh1a2-/- embryo at the 10-somite stage.tg(kdrl:eGFP) marks angioblasts as they migrate to the midline.
Angioblasts lose anterior to posterior processivity and show disrupted migration. Frame rate = 1 image/5 min. Run time = 235 min.
Video 3
Time-lapse fluorescent imaging of a 10-somite stage tg(kdrl:eGFP) embryo with addition of 0.1 μM retinoic acid (RA) at the tailbud stage.
tg(kdrl:eGFP) marks angioblasts as they migrate to the midline. Angioblasts accelerate their processivity toward the midline. Frame rate = 1 image/5 min. Run time = 235 min.
Video 4
Time-lapse fluorescent imaging of HS:id3, HS;dnRAR cells in a tg(kdrl:eGFP) host.
Cells expressing HS:id3, HS;dnRAR migrate to the midline along with angioblasts in a tg(kdrl:eGFP) host. Cells with dnRAR migrate faithfully with angioblasts. Frame rate = 1 image/5 min. Run time = …
Video 5
Time-lapse fluorescent imaging of tg(tbxta:kaedae), tg(actc1b:gfp) trunk explant.
Trunk explant shows notochord displacement away from ventral-most portion of somites. Frame rate = 1 image/15 min. Run time = 285 min.
Video 6
Time-lapse confocal fluorescent imaging of an HS:mCherry-CAAX-p2a-NLS-kikume embryo in DMSO treatment.
HS:mCherry-CAAX-p2a-NLS-kikume marks nuclei within the somite. Sample tracks ranging from red (most displacement) to blue (least displacement) show broad movement within the somite. Frame rate = 1 …
Video 7
Time-lapse confocal fluorescent imaging of an HS:mCherry-CAAX-p2a-NLS-kikume embryo in DEAB treatment.
HS:mCherry-CAAX-p2a-NLS-kikume marks nuclei within the somite. Sample tracks ranging from red (most displacement) to blue (least displacement) show little directional movement in 20 μM DEAB …
Video 8
Time-lapse fluorescent video of mCherry-CAAX mRNA-injected tg(kdrl:eGFP) explant at the 10-somite stage.
tg(kdrl:eGFP) marks angioblasts as they migrate to the midline, and mCherry-CAAX marks the cell surfaces. A trunk explant, imaged around the fifth somite, shows normal migration of the angioblasts …
Video 9
Time-lapse fluorescent video of mCherry-CAAX mRNA-injected tg(kdrl:eGFP) explant at the 10-somite stage, treated with 20 μM DEAB.
tg(kdrl:eGFP) marks angioblasts as they migrate to the midline. The trunk explant shows angioblast migration defects seen in fixed DEAB sections. Frame rate = 1 image/5 min. Run time = 175 min.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-Etv2 (rabbit polyclonal) | Kerafast | Cat# ES1004; RRID:AB_2904554 | IH (1:500) |
| Antibody | Anti-GFP (mouse monoclonal) | Thermo Fisher | Cat# A11120; RRID:AB_221568 | IH (1:500) |
| Antibody | Secondary antibody, Alexa Fluor 488 (goat polyclonal) | Thermo Fisher | Cat# A11008; RRID:AB_143165 | IH (1:1000) |
| Antibody | Secondary antibody, Alexa Fluor 568 (goat polyclonal) | Thermo Fisher | Cat# A11004; RRID:AB_2534072 | IH (1:1000) |
| Antibody | Anti-Digoxigenin-AP, Fab fragments (sheep polyclonal) | Roche | Cat# 11093274910; RRID: AB_514497 | ISH (1:5000) |
| Chemical compound, drug | 4-Nitro blue tetrazolium chloride, solution | Roche | Cat# 11383213001 | |
| Chemical compound, drug | 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine | Roche | Cat# 11383221001 | |
| Chemical compound, drug | DIG RNA Labeling Mix | Roche | Cat# 11277073910 | |
| Peptide, recombinant protein | SP6 RNA polymerase | NEB | Cat# M0207S | |
| Peptide, recombinant protein | T7 RNA polymerase | NEB | Cat# M0251S | |
| Chemical compound, drug | Tricaine-S (MS-222) | Pentair | Cat# TRS1 | |
| Chemical compound, drug | DAPI | Sigma | Cat# D9542 | |
| Chemical compound, drug | 4-Diethylamino benzaldehyde (DEAB) | Sigma | Cat# D86256 | |
| Chemical compound, drug | BMS453 | Cayman Chemical | CAS# 166977-43-1 | |
| Chemical compound, drug | All-trans retinoic acid | Sigma | Cat# R2625 | |
| Other | Tetramethylrhodamine dextran, 10,000 MW, lysine fixable | Invitrogen | Cat# D1817 | |
| Other | Alexa Fluor 647 Dextran, 10,000 MW, Anionic, Fixable | Invitrogen | Cat# D22914 | |
| Other | Modified Barth’s Saline (1×), liquid, without Ficoll 400 | Sigma | Cat# 32160801 | |
| Strain, strain background (Danio rerio) | Wild-type Tupfel long-fin/AB | N/A | N/A | Wild-type progeny of Tupfel long-fin and AB |
| Strain, strain background (D. rerio) | aldh1a2i26 | Begemann et al., 2001 | ZFIN ID: ZDB-FISH-150901-19358; RRID:ZFIN_ZDB-ALT-000412-8 | |
| Strain, strain background (D. rerio) | aldh1a2i26, tg(kdrl:eGFP) s843 | Begemann et al., 2001; Jin et al., 2005 | RRID:ZFIN_ZDB-ALT-000412-8; RRID: ZFIN_ZDB-GENO-170216-13 | |
| Strain, strain background (D. rerio) | tg(hsp70l:id3-2A-NLS-KikGR) sbu105 | Row et al., 2018 | ZFIN ID: ZDB-ALT-190306-81; RRID:ZFIN_ZDB-ALT-190306-81 | |
| Strain, strain background (D. rerio) | tg(hsp70l:eGFP-dnHsa.RARA) ci1008 | Brilli Skvarca et al., 2019 | ZFIN ID: ZDB-TGCONSTRCT-190925-6; RRID:ZFIN_ZDB-ALT-190925-15 | |
| Strain, strain background (D. rerio) | tg(kdrl:NLS-eGFP)ubs1 | Blum et al., 2008 | ZFIN ID: ZDB-TGCONSTRCT-081105-1; RRID:ZFIN_ZDB-GENO-081105-1 | |
| Strain, strain background (D. rerio) | tg(kdrl:eGFP) s843 | Jin et al., 2005 | RRID:ZFIN_ZDB-GENO-170216-13 | |
| Strain, strain background (D. rerio) | tg(hsp70l:CAAX-mCherry-2A-NLS-KikGR) sbu104 | Goto et al., 2017 | ZFIN ID: ZDB-ALT-170829-4;RRID:ZFIN_ ZDB-ALT-170829-4 | |
| Strain, strain background (D. rerio) | tg(β-actin:GDBD-RLBD) ci1001, Tg(5XUAS:eGFP)nkwasgfp1a | Mandal et al., 2013 | ZFIN ID: ZDB-FISH-150901-11429; RRID:ZFIN_ZDB-GENO-131107-12 | |
| Strain, strain background (D. rerio) | tbx16b104, tg(kdrl:eGFP) s843 | Kimmel et al., 1989; Jin et al., 2005 | RRID:ZFIN_ZDB-ALT-980224-16; RRID: ZFIN_ZDB-GENO-170216-13 | |
| Strain, strain background (D. rerio) | tg(actc1b:gfp) zf13tg | ichi et al., 1997 | ZFIN ID: ZDBTGCONSTRCT-070117-83; RRID:ZFIN_ZDB-GENO-070830-2 | |
| Strain, strain background (D. rerio) | tg(tbxta:kaedae) sbu102 | Row et al., 2016 | ZFIN ID: ZDB-TGCONSTRCT-160321-5; RRID:ZFIN_ZDB-TGCONSTRCT-160321-5 | |
| Strain, strain background (D. rerio) | tg(hsp70l:lifeact-mScarlet) sbu110 | This paper | N/A | Transgenic zebrafish line with heat shock-inducible Lifeact |
| Sequence-based reagent | Morpholino: MO-Noto | Ouyang et al., 2009 | ZFIN ID: ZDB-MRPHLNO-100514-1 | GGGAATCTGCATGGCGTCTGTTTAG |
| Sequence-based reagent | Morpholino: MO1-tbx16 | Row et al., 2011 | ZFIN ID: ZDB-MRPHLNO-051107-1 | AGCCTGCATTATTTAGCCTTCTCTA |
| Sequence-based reagent | Morpholino: MO2-tbx16: | Row et al., 2011 | ZFIN ID: ZDB-MRPHLNO-051107-2 | GATGTCCTCTAAAAGAAAATGTCAG |
| Sequence-based reagent | Riboprobe: etv2 | Sumanas et al., 2005 | N/A | Anti-sense riboprobe synthesized using DIG-labeled nucleotides |
| Sequence-based reagent | Riboprobe: cldn5b | This paper | N/A | Anti-sense riboprobe synthesized using DIG-labeled nucleotides |
| Sequence-based reagent | Riboprobe: cxcr4a | This paper | N/A | Anti-sense riboprobe synthesized using DIG-labeled nucleotides |
| Sequence-based reagent | Riboprobe: cxcl12a | This paper | N/A | Anti-sense riboprobe synthesized using DIG-labeled nucleotides |
| Sequence-based reagent | Riboprobe: dab2 | This paper | N/A | Anti-sense riboprobe synthesized using DIG-labeled nucleotides |
| Sequence-based reagent | Riboprobe: apela | This paper | N/A | Anti-sense riboprobe synthesized using DIG-labeled nucleotides |
| Sequence-based reagent | Riboprobe: aplnra | This paper | N/A | Anti-sense riboprobe synthesized using DIG-labeled nucleotides |
| Sequence-based reagent | Riboprobe: aplnrb | This paper | N/A | Anti-sense riboprobe synthesized using DIG-labeled nucleotides |
| Sequence-based reagent | Primer: cldn5b forward | This paper | N/A | GCAGGCTTGTTTGTTCTGATTC |
| Sequence-based reagent | Primer: cldn5b reverse | This paper | N/A | CACAAACAAGTGGGTCGCTG |
| Sequence-based reagent | Primer: apela forward | This paper | N/A | CCATCCCTCAGAGGACAGAG |
| Sequence-based reagent | Primer: apela reverse | This paper | N/A | CATGTTTGGCAGCAGTAGGA |
| Sequence-based reagent | Primer: aplnra forward | This paper | N/A | ATGGAGCCAACGCCGGAAT |
| Sequence-based reagent | Primer: aplnra reverse | This paper | N/A | TCACACTTTGGTGGCCAGC |
| Sequence-based reagent | Primer: aplnrb forward | This paper | N/A | ATGAATGCCATGGACAACAT |
| Sequence-based reagent | Primer: aplnrb reverse | This paper | N/A | TCACACCTTCGTAGCCAGC |
| Sequence-based reagent | Primer: cxcr4a forward | This paper | N/A | CTGAAGGAGCTGGAGAAGTC |
| Sequence-based reagent | Primer: cxcr4a reverse | This paper | N/A | GCATGTTCATAGTCCAAGGTG |
| Sequence-based reagent | Primer: cxcr12a forward | This paper | N/A | GCGGATCTCTTCTTCACACTGC |
| Sequence-based reagent | Primer: cxcr12a reverse | This paper | N/A | TTACACACGCTCTGATCGGTC |
| Sequence-based reagent | Primer: dab2 forward | This paper | N/A | CTCCTTCATTGCTCGTGATGTC |
| Sequence-based reagent | Primer: dab2 reverse | This paper | N/A | GCCCTGGTTCAGGTTTCTGG |
| Sequence-based reagent | Primer: lifeact-mScarlet forward | This paper | N/A | CAAGCTACTTGTTCTTTTTGCAGGA TCCATGGGCGTGGCCGACTTG |
| Sequence-based reagent | Primer: lifeact-mScarlet reverse | This paper | N/A | TTCGTGGCTCCAGAGAATCGATTC ACTTGTACAGCTCGTCCATGC |
| Recombinant DNA reagent | Plasmid: PCRII-cldn5b | This paper | N/A | Recombinant vector used for riboprobe synthesis |
| Recombinant DNA reagent | Plasmid: PCRII-apela | This paper | N/A | Recombinant vector used for riboprobe synthesis |
| Recombinant DNA reagent | Plasmid: PCRII-aplnra | This paper | N/A | Recombinant vector used for riboprobe synthesis |
| Recombinant DNA reagent | Plasmid: PCRII-aplnrb | This paper | N/A | Recombinant vector used for riboprobe synthesis |
| Recombinant DNA reagent | Plasmid: PCRII-cxcr4a | This paper | N/A | Recombinant vector used for riboprobe synthesis |
| Recombinant DNA reagent | Plasmid: PCRII-cxcr12a | This paper | N/A | Recombinant vector used for riboprobe synthesis |
| Recombinant DNA reagent | Plasmid: PCRII-dab2 | This paper | N/A | Recombinant vector used for riboprobe synthesis |
| Recombinant DNA reagent | Plasmid: hsp70l:lifeact-mscarlet | This paper | pNJP002 | Plasmid used to generate tg(hsp70l:lifeact-mscarlet) |
| Software, algorithm | ImageJ/Fiji | NIH-public domain | https://imagej.nih.gov/ij/download.html; RRID:SCR_003070 | |
| Software, algorithm | Imaris | Bitplane | https://www.bitplane.comhttps://www.bitplane.com; RRID:SCR_007370 | |
| Software, algorithm | Excel | Microsoft | https://www.microsoft.com/en-us/microsoft-365/excel; RRID:SCR_016137 | |
| Software, algorithm | GraphPad Prism 8.4.2 | GraphPad | http://www.graphpad.com/; RRID:SCR_002798 |
