1. Developmental Biology
  2. Stem Cells and Regenerative Medicine

Decoding the activated stem cell phenotype of the neonatally maturing pituitary

  1. Emma Laporte
  2. Florian Hermans
  3. Silke De Vriendt
  4. Annelies Vennekens
  5. Diether Lambrechts
  6. Charlotte Nys
  7. Benoit Cox
  8. Hugo Vankelecom  Is a corresponding author
  1. Laboratory of Tissue Plasticity in Health and Disease, Cluster of Stem Cell and Developmental Biology, Department of Development and Regeneration, KU Leuven, Belgium
  2. Laboratory of Morphology, Biomedical Research Institute, Hasselt University, Belgium
  3. Center for Cancer Biology, VIB, Belgium
  4. Laboratory for Translational Genetics, Department of Human Genetics, KU Leuven, Belgium
https://doi.org/10.7554/eLife.75742
Share this article
Cite this article
  1. Emma Laporte
  2. Florian Hermans
  3. Silke De Vriendt
  4. Annelies Vennekens
  5. Diether Lambrechts
  6. Charlotte Nys
  7. Benoit Cox
  8. Hugo Vankelecom
(2022)
Decoding the activated stem cell phenotype of the neonatally maturing pituitary
eLife 11:e75742.
https://doi.org/10.7554/eLife.75742
  2. Download BibTeX
  3. Download .RIS

Abstract

The pituitary represents the endocrine master regulator. In mouse, the gland undergoes active maturation immediately after birth. Here, we in detail portrayed the stem cell compartment of neonatal pituitary. Single-cell RNA-sequencing pictured an active gland, revealing proliferative stem as well as hormonal (progenitor) cell populations. The stem cell pool displayed a hybrid epithelial/mesenchymal phenotype, characteristic of development-involved tissue stem cells. Organoid culturing recapitulated the stem cells’ phenotype, interestingly also reproducing their paracrine activity. The pituitary stem cell-activating interleukin-6 advanced organoid growth, although the neonatal stem cell compartment was not visibly affected in Il6−/− mice, likely due to cytokine family redundancy. Further transcriptomic analysis exposed a pronounced WNT pathway in the neonatal gland, shown to be involved in stem cell activation and to overlap with the (fetal) human pituitary transcriptome. Following local damage, the neonatal gland efficiently regenerates, despite absence of additional stem cell proliferation, or upregulated IL-6 or WNT expression, all in line with the already high stem cell activation status, thereby exposing striking differences with adult pituitary. Together, our study decodes the stem cell compartment of neonatal pituitary, exposing an activated state in the maturing gland. Understanding stem cell activation is key to potential pituitary regenerative prospects.

Editor's evaluation

This is a well conducted study on development of neonatal mouse pituitary using multiple ScRNA Seq and organoid culture models. In this revised version, the authors have done a thorough job of addressing the concerns of the reviewers on the previous version and significantly improved it. In particular they have provided additional data with regard to the role of Wnt signaling and further defined the IL6 null mouse phenotypes.

https://doi.org/10.7554/eLife.75742.sa0

eLife digest

The pituitary gland is a pea-sized structure found just below the brain that produces hormones controlling everything from growth and stress to reproduction and immunity. To perform its role, the pituitary gland needs specialised hormone-producing cells, but it also contains stem cells. These stem cells can divide to produce more cells like themselves, or differentiate into cells of different types, including hormone-producing cells.

In mice, the stem cells of the pituitary gland appear to be activated in the first few weeks after birth, and later become ‘quiescent’ (or lazy) in the adult pituitary gland. However, it remains unclear how the activated state found in the maturing gland is established and regulated.

To answer this question, Laporte et al. used single-cell RNA sequencing, a technique that allows researchers to profile which genes are active in individual cells, which can provide vital information about the state and activity of a tissue. The researchers compared the cells of the maturing pituitary gland of newborn mice to the cells in the established gland of adult mice. This analysis revealed that the maturing pituitary gland is a dynamic tissue, with populations of cells that are actively dividing (including the stem cells), which the mature pituitary gland lacks. Additionally, Laporte et al. established the molecular basis for the activated state of the stem cells in the maturing pituitary gland, which relies on the activation of a cell signalling pathway called WNT.

To confirm these findings, Laporte et al. used an organoid system that allowed them to recapitulate the stem cell compartment of the maturing pituitary gland in a dish. When Laporte et al. blocked WNT signalling in these organoids, the organoids failed to form or divide. Furthermore, blocking the pathway directly in newborn mice reduced the number of dividing stem cells in the pituitary gland. Both findings support the notion that WNT signalling is required to establish the activated state of the maturing pituitary gland in newborn mice.

Laporte et al. also wanted to know whether the newborn pituitary gland responded to injury differently than the adult gland. It had already been established that the adult pituitary stem cells become activated upon injury, and that the gland has some regenerative capacity. However, when Laporte et al. injured the newborn pituitary gland, the gland was able to fully regenerate, despite the stem cells not becoming more activated. This is likely because these cells are already activated (or ‘primed’), and do not require further activation to divide and repair the gland with the help of other proliferating cells.

With these results, Laporte et al. shed light on the activated state of the stem cells in the pituitary gland of newborn mice. This provides insight into the role of these stem cells, as well as unveiling possible routes towards regenerating pituitary tissue. This could eventually prove useful in medicine, in cases when the pituitary gland is damaged or removed.

Introduction

As central hub of the endocrine system, the pituitary plays a quintessential role in governing the endocrine glands throughout the body, thereby regulating key physiological processes including growth, metabolism, fertility, stress, and immunity. To execute this primordial function, the pituitary has to properly develop into a compound gland of multiple endocrine cells, encompassing somatotropes (producing growth hormone [GH]), corticotropes (adrenocorticotropic hormone [ACTH]), lactotropes (prolactin [PRL]), gonadotropes (luteinizing hormone [LH] and/or follicle-stimulating hormone [FSH]), and thyrotropes (thyroid-stimulating hormone [TSH]) (Melmed, 2011; Willems and Vankelecom, 2014). In the mouse, the pituitary undergoes an intense growth and maturation process during the first postnatal weeks, with number and size of hormone-producing cells substantively expanding following proliferation of committed (progenitor) and endocrine cells (Carbajo-Pérez and Watanabe, 1990; Laporte et al., 2021; Sasaki, 1988; Taniguchi et al., 2002; Zhu et al., 2015). Simultaneously, the local stem cell (SOX2+) compartment shows signs of activation including elevated abundance and expression of stemness pathways when compared to the adult pituitary stem cells (Gremeaux et al., 2012; Laporte et al., 2021). The stem cells can give rise to new endocrine cells, a property which has been found most prominent (although not extensive) during this neonatal period (Andoniadou et al., 2013; Rizzoti et al., 2013; Zhu et al., 2015). In contrast, stem cells in the mature, adult pituitary are quiescent and do not highly contribute to new endocrine cells during the (slow) homeostatic turnover of the gland (Andoniadou et al., 2013; Laporte et al., 2021; Rizzoti et al., 2013; Vankelecom and Chen, 2014). However, the adult stem cells become activated following local injury in the gland, showing a proliferative reaction and signs of differentiation toward the ablated cells, coinciding with substantial regeneration (Fu et al., 2012). We recently identified interleukin-6 (IL-6) to be upregulated in the adult pituitary (in particular its stem cells) upon this local damage which activated the stem cells (Vennekens et al., 2021). However, it is not clear what molecular mechanisms underlie the activation status of the stem cells in the neonatal gland.

Here, we set out to decode the stem cells’ phenotype during the neonatal pituitary maturation stage starting from single-cell RNA-sequencing (scRNA-seq) interrogations, which uncovered an activation-designating hybrid epithelial–mesenchymal and WNT profile. We applied organoid and mouse models which supported and expanded the bioinformatic findings. Moreover, we found that the neonatal pituitary displayed high regeneration efficiency, more pronounced than in older mice (Fu et al., 2012; Willems et al., 2016), which is in line with its activated (stem cell) nature. Further decoding the molecular mechanisms underlying stem cell activation may open the door toward regenerative approaches for repairing harmed pituitary tissue, having serious endocrine consequences. In this prospect, our single-cell transcriptome database of neonatal (as well as adult) pituitary provides a highly valuable resource.

Results

Single-cell transcriptomics pictures prominent developmental activity in the neonatal maturing pituitary

To obtain a granular view on the cell type and activity landscape in the neonatal maturing pituitary, we performed scRNA-seq analysis of the major endocrine anterior pituitary (AP) from neonatal mouse (postnatal day 7, PD7), and contrasted the data with adult AP (Vennekens et al., 2021). After quality control and exclusion of doublets and dead and low-quality cells (Figure 1—figure supplement 1A; Vennekens et al., 2021), the neonatal AP cell transcriptomic data were integrated with our recent scRNA-seq dataset of adult AP (Vennekens et al., 2021) followed by filtering-out of ambient RNA (Figure 1A). Unsupervised clustering and annotation using established lineage markers (see Cheung et al., 2018; Vennekens et al., 2021) revealed all main endocrine cell types, as well as distinct clusters of pericytes and of stem, mesenchymal, immune, and endothelial cells (Figure 1A, B, Figure 1—figure supplement 1B). Of note, the neonatal data also revealed a small contaminating cluster with posterior lobe (PL) signature (i.e., Nkx2-1, Rax [Cheung et al., 2018] and pituicyte markers Scn7a, Cldn10 [Chen et al., 2020]), in addition expressing the stem cell markers Sox2 and Sox9 (Figure 1A, B, Figure 1—figure supplement 1B), the latter in accordance with a previous report (Cheung et al., 2018). In general, sizable overlap between neonatal and adult cell clusters was observed (Figure 1A; visualization using Uniform Manifold Approximation and Projection [UMAP]). In particular, two stem cell subclusters (SC1 and SC2) were discerned in the neonatal AP as before also identified in the adult gland (Vennekens et al., 2021). These subclusters exhibit a diverging transcriptomic fingerprint, with SC1 displaying more prominent expression of keratins Krt8 and Krt18, and SC2 of Six1 and Sox2 (Figure 1—figure supplement 1C), similar to the adult gland (Vennekens et al., 2021). Notwithstanding considerable overlap, clear differences emerged between neonatal and adult pituitary. First, the stem cell populations (both SC1 and SC2) are larger in neonatal than adult AP (three- to fourfold; Figure 1A), corroborated in situ by immunofluorescence analysis of the SOX2+ cells (Figure 1—figure supplement 1D). Moreover, higher proliferative activity was observed in this SOX2+ cell compartment (as assessed by Ki67 immunoanalysis; Figure 1—figure supplement 1D), as also found before (Gremeaux et al., 2012). In accordance, the scRNA-seq interrogation exposed a clear proliferative stem cell cluster (Prolif SC; as identified by coexpression of proliferation genes Mki67, Pcna, Top2a, Mcm6, with stem cell markers Sox2, Krt8, Sox9) in the neonatal AP, not discerned in the adult gland (Figure 1A, B, Figure 1—figure supplement 1B). Gene Ontology (GO) analysis using differentially expressed genes (DEGs) indeed revealed enrichment of cell cycle processes in the Prolif SC versus the aggregate SC1 and SC2 clusters (Figure 1—figure supplement 2A; Figure 1—figure supplement 2—source data 1).

Figure 1 with 2 supplements see all
Download asset Open asset
Single-cell transcriptomics of the neonatal maturing pituitary and its activated stem cell compartment.

(A) Left: UMAP plot of neonatal and adult anterior pituitary (AP) combined. Middle: UMAP plot of the annotated cell clusters in the integrated AP samples (i.e., collective single-cell transcriptome datasets from neonatal and adult AP). Somato, somatotropes; Lacto, lactotropes; (Prolif) Cortico, (proliferating) corticotropes; Gonado, gonadotropes; Thyro, thyrotropes; Melano, melanotropes; SC1 and SC2, stem cell clusters 1 and 2; EC, endothelial cells; IC, immune cells; MC, mesenchymal cells; PL, posterior lobe cells; Gonado Prog, gonadotrope progenitor cells; Gonado Prec, gonadotrope precursor cells. Right: Bar plots showing proportions of each cell cluster at both ages. (B) Dot plot displaying percentage of cells (dot size) expressing indicated marker genes with average expression levels (color intensity; see scales on top) in the collective AP samples (i.e., adult and neonatal AP). (C) Top: Heatmap displaying scaled expression of selected epithelial and mesenchymal marker genes in the stem cell clusters SC1, SC2, and Prolif SC of neonatal and adult AP. Bottom: Immunofluorescence staining of CK8/18 (green), VIM (red/green), and SOX2 (red) in neonatal and adult AP. Nuclei are stained with Hoechst33342 (blue). Boxed area is magnified (scale bar, 100 µm).

Interestingly, proliferative subclusters were also perceived for other cell types, moreover exclusively in the neonatal gland. First, we discerned a proliferative Pou1f1+ (Pit1+) cell group. Pou1f1 represents the transcriptional regulator of hormone expression in somatotropes, lactotropes, and thyrotropes, and its expression also marks differentiation of progenitors within this so-called Pou1f1+ lineage (Zhu et al., 2015). In addition, we distinguished a proliferative corticotrope subcluster. Both findings were corroborated by DEG/GO and hormone/Ki67 immunostaining analyses (Figure 1—figure supplement 2B; Figure 1—figure supplement 2—source data 2). Strikingly, the neonatal AP also contains gonadotrope progenitor and precursor subclusters as characterized by gradually increasing gonadotrope markers (Nr5a1, Cga, Lhb, Fshb, and Gnrhr) in parallel with declining stem cell factors (Sox2, Krt8, and Sox9) (Figure 1A, B, Figure 1—figure supplement 1B). The gonadotrope lineage arises last during embryonic development just before birth (Stallings et al., 2016), and some cells in the neonatal AP indeed coexpress SOX2 and the common gonadotropin subunit αGSU (Figure 1—figure supplement 2C). In further support of an endocrine progenitor phenotype (as opposed to a stem cell state), DEG analysis revealed upregulation of genes involved in hormone production (e.g., Chga, Ascl1, Cga, and Insm1) and enrichment of GO terms related to endocrine differentiation and secretion when compared to the stem cell clusters (Figure 1—figure supplement 2C; Figure 1—figure supplement 2—source data 3).

Taken together, scRNA-seq interrogation captured and embodied the prominent developmental activity that is taking place in the maturing neonatal gland, epitomized in the stem cell as well as endocrine lineage phenotypes. While the hormonal cell types (particularly somatotropes and lactotropes) rise in abundance toward adulthood, stem cells as well as supportive mesenchymal cells (MC) are more numerous in the neonatal gland (Figure 1A), suggesting that the latter populations play an active role in the critical development and growth of the gland at this acute period after birth, which becomes less prominent at mature age.

Neonatal pituitary stem cells display a hybrid epithelial/mesenchymal phenotype

Using the scRNA-seq dataset, we assessed the epithelial character of the stem cell clusters. Surprisingly, the stem cell compartment of the neonatal AP displays a highly mixed epithelial/mesenchymal (E/M) phenotype, manifestly expressing both epithelial and mesenchymal markers, which is clearly faded in the adult gland (Figure 1C). In accordance, cells that coexpress the epithelial markers cytokeratin 8 and 18 (CK8/18) and the mesenchymal marker vimentin (VIM) were found in the marginal zone (MZ) SOX2+ stem cell niche of the neonatal pituitary, and were visibly less prominent in the adult gland (Figure 1C). Similarly, coexpression of SOX2 with VIM was more pronounced in the neonatal gland (Figure 1C). In other developing tissues, stem/progenitor cells also show a hybrid E/M character, indicative of their activation and participation in the tissues’ developmental process (Dong et al., 2018). Recently, a hybrid E/M phenotype was also uncovered in the stem/progenitor cell cluster of the fetal human pituitary, with the mesenchymal aspect lowering along further maturation (Zhang et al., 2020). Moreover, epithelial-to-mesenchymal transition has been reported to play a role in mouse pituitary development through driving the exit of stem cells from the MZ toward the developing AP (Pérez Millán et al., 2016; Yoshida et al., 2016).

Organoid culturing recapitulates the neonatal pituitary stem cell phenotype

To further explore the stem cells’ nature of neonatal pituitary, we applied our recently established pituitary organoid model (Cox et al., 2019; Vennekens et al., 2021). We have shown that organoids developing from adult mouse AP originate from the SOX2+ stem cells and reflect their phenotype and activation state (e.g., higher organoid number following damage [Cox et al., 2019; Vennekens et al., 2021]), thus serving as a valuable pituitary stem cell biology research model and activation readout tool (Cox et al., 2019; Vennekens et al., 2021).

Dissociated AP cells from PD7 mice, embedded in Matrigel droplets (Figure 2A) and cultured in medium previously defined to grow organoids from adult AP (Cox et al., 2019) (referred to as pituitary organoid medium or PitOM, Appendix 1—table 1), were found to generate organoid structures, with a trend of higher number (although not significant; p = 0.18) than from adult AP (Figure 2B). Surprisingly, individual removal of several growth and signaling factors (i.e., fibroblast growth factors [FGF] 2/8/10, nicotinamide, sonic hedgehog [SHH], the transforming growth factor-β [TGFβ] inhibitor A83-01, the bone morphogenetic protein [BMP] inhibitor noggin and insulin-like growth factor 1 [IGF-1]) from the adult AP-geared PitOM resulted in a visible increase in organoid number developing from neonatal AP (Figure 2—figure supplement 1A), indicating that these PitOM-included factors are not essential (rather impedimental) for organoid outgrowth from the neonatal gland. Indeed, the neonatal pituitary stem cells show high expression of several of these factors, suggesting already prominent intrinsic pathway activity. Among others, Fgf10 and Igf1, together with their receptors Fgfr2 and Igf1r, and noggin (Nog) are found upregulated in the neonatal stem cell compartment (SC1+SC2+Prolif SC) as compared to the adult stem cells (Figure 2—figure supplement 1B). Moreover, this expression pattern is retained in the neonatal pituitary-derived organoids (Figure 2—figure supplement 1B). In contrast, cholera toxin (CT), p38 mitogen-activated protein kinase (MAPK) inhibitor (p38i; SB202190), the WNT-signaling amplifier R-spondin 1 (RSPO1) and epithelial growth factor (EGF) were found essential since organoid formation was largely abrogated in the absence of each one of these factors (Figure 2—figure supplement 1A). Together, this top-down screening by individually omitting PitOM factors led to an optimized medium for neonatal AP organoid development, further referred to as RSpECT (being the acronym of the essential core factors RSPO1, p38i, EGF and CT; Appendix 1—table 1).

Figure 2 with 3 supplements see all
Download asset Open asset
Organoids from neonatal pituitary recapitulate its stem cell phenotype.

(A) Experimental schematic for organoid culturing. PD, postnatal day; wks, weeks; MZ, marginal zone; PP, posterior pituitary. Mouse icons obtained from BioRender. (B) Organoid formation efficiency (passage 0, P0) from adult and neonatal anterior pituitary (AP) cultured in PitOM or RSpECT medium. Left: Representative brightfield pictures of organoid cultures (scale bar, 500 μm). Right: Bar graph indicating number of organoids developed per well (mean ± standard error of the mean [SEM]). Data points represent biological replicates (n = 4 for Adult, n = 3 for Neonatal; two-way analysis of variance (ANOVA) with Tukey’s multiple comparison test). (C) Immunofluorescence staining of SOX2, E-cadherin (E-cad), TACSTD2 (all red), and CK8/18 (green) in neonatal pituitary and derived organoids. Nuclei are labeled with Hoechst33342 (blue) (scale bar, 100 μm). (D) Organoid formation efficiency (P0) starting from AP cells of adult ROSA26mT/mG (tdTomato+ (tdT)) mice, or from a 1:1 mixture of adult ROSA26mT/mG and neonatal wild type (WT) AP cells (P0). Top left: Light microscopic (LM) and epifluorescence (tdT) pictures. Arrowheads indicate tdT+ organoids (scale bar, 500 µm). Top right: Bar graph indicating number of adult (tdT+) organoids developing per 5000 cells in indicated cultures (mean ± SEM). Data points represent biological replicates (n = 4, paired t-test). Bottom: Immunofluorescence staining of Ki67 (green) and tdT (red) in AP organoids derived from adult ROSA26mT/mG, neonatal WT or a 1:1 mixture of adult ROSA26mT/mG and neonatal WT AP cells. Nuclei are labeled with Hoechst33342 (blue) (scale bar, 100 μm). Bar graphs showing percentage of Ki67+ cells in organoids as indicated (mean ± SEM). Data points represent individual organoids (n = 3). (E) Organoid formation efficiency from AP of neonatal Il6+/+ and Il6−/− mice in RSpECT with or without interleukin-6 (IL-6) (P0). Left: Representative brightfield pictures of organoid cultures (scale bar, 500 μm). Right: Bar plot showing number of organoids developed per well in conditions as indicated (mean ± SEM). Data points represent biological replicates (n = 5 for Il6+/+, n = 6 for Il6−/−; two-way ANOVA with Tukey’s multiple comparison test). (F) Neonatal AP organoid passageability with or without IL-6. Left: Representative brightfield images at indicated passage (scale bar, 500 µm). Right: Bars depicting the passage number reached at the end of this study.

The organoids, as before shown for adult AP (Cox et al., 2019), originated from the tissue-resident SOX2+ stem cells. Seeding AP from neonatal Sox2eGFP/+ reporter mice (expressing enhanced green fluorescent protein [eGFP] in SOX2+ cells) generated only organoids that were fluorescent (eGFP+; Figure 2—figure supplement 1C). Furthermore, when Sox2eGFP/+ AP cells were mixed with wildtype (WT) cells, organoids that developed were either eGFP+ or not (Figure 2—figure supplement 1C), thereby pointing to a clonal origin, as further supported by live-culture time-lapse imaging showing organoids growing from individual cells (Figure 2—figure supplement 1D and Video 1). The obtained organoids display a pituitary stemness phenotype expressing SOX2 as well as other known pituitary stem cell markers (such as E-cadherin, CK8/18, TACSTD2 (alias TROP2) [Chen et al., 2009; Cox et al., 2019; Fauquier et al., 2008; Vennekens et al., 2021]) (Figure 2C, Videos 2 and 3), while being devoid of hormone expression (Figure 2—figure supplement 1E). Using the optimized RSpECT medium, the number of organoids that developed from neonatal AP was significantly higher than from adult gland (for which RSpECT did not change the formed organoid number) (Figure 2B). Of note, the much larger number (~40-fold) can only partially be explained by the higher abundance of SOX2+ cells in the neonatal AP (~3- to 4-fold; see above). Indeed, normalized to the absolute number of SOX2+ cells seeded per well, the proportion of organoid-initiating SOX2+ cells is ~10-fold higher in neonatal than adult AP (Figure 2—figure supplement 1F). Thus, organoid formation efficiency reflects the higher intrinsic activation (or ‘primed’) status of neonatal pituitary stem cells per se.

Video 1
Download asset
Time-lapse video of neonatal anterior pituitary (AP) organoid formation.

Video reconstruction of live time-lapse brightfield images captured by IncuCyte S3 (following the timepoints shown in the timetable on the video) of organoid culture after neonatal AP cell seeding (P0). Cultures were scanned automatically every 3 hr for 12 days.

Video 2
Download asset
3D imaging of neonatal anterior pituitary (AP) organoids.

Movie of z-stack through a neonatal AP organoid immunofluorescently stained for SOX2 (red) and E-cadherin (green). Hoechst33342 was used as nuclear stain (blue).

Video 3
Download asset
3D imaging of neonatal anterior pituitary (AP) organoids.

3D reconstruction of a neonatal AP organoid immunofluorescently stained for SOX2 (red) and E-cadherin (green). Hoechst33342 was used as nuclear stain (blue).

Very recently, it has been reported that stem cells in early-postnatal (PD14) pituitary can function as autocrine and paracrine signaling center, among others stimulating proliferation within the own stem cell compartment (Russell et al., 2021). Interestingly, when co-cultured, neonatal (PD7) AP organoids (as developed from WT mice) elevate the outgrowth of organoids from adult AP (as established from ubiquitously tdTomato(tdT)-expressing ROSA26mT/mG mice) (Figure 2D), coinciding with increased proliferation of the adult AP organoid-constituting stem cells, showing a Ki67+ index reaching the one of neonatal AP-derived organoids (Figure 2D).

Taken together, organoids from neonatal AP reflect the stem cell compartment of the gland at this developmental stage regarding its activated and signaling center phenotype.

One factor that may be responsible for activating the stem cells in the neonatal pituitary is IL-6 which we recently uncovered as pituitary stem cell-activating factor in adult mouse (Vennekens et al., 2021). Intriguingly, gene expression of Il6 is low in neonatal AP when compared to adult gland (Figure 2—figure supplement 2A). Similarly, gene-regulatory network (regulon) activity of the IL-6 signal-mediating JAK/STAT member Stat3 is low as compared to adult gland (analysis using ‘single-cell regulatory network inference’ (SCENIC) [Aibar et al., 2017]) (Figure 2—figure supplement 2A). Notwithstanding, IL-6 is still produced, and beneficial, for AP organoid development. Indeed, a significantly smaller number of organoids grew from Il6 knockout (Il6−/−) versus WT neonatal AP, which was (partially) rescued by adding exogenous IL-6 (Figure 2E). Moreover, although IL-6 addition did not significantly increase the number of organoids formed from WT (Il6+/+) neonatal AP (most likely because the stem cell activation status is already high) (Figure 2E), it strongly enhanced the passageability of the organoid cultures, from 4 to 5 passages without IL-6 to at least 15 passages (6 months of expansive culture) with the cytokine (Figure 2F), as also observed before for adult AP (Vennekens et al., 2021). Addition of IL-6 is considered to compensate for the decline in endogenous levels that is observed at passaging (Figure 2—figure supplement 2B). Of note, the organoids robustly retained their stemness phenotype during the long-term expansion, showing consistent stem cell marker expression (and hormone absence) between early (P2) and late (P8–11) passage (Figure 2—figure supplement 2C). Intriguingly, the in vivo lack of IL-6 does not visibly affect the SOX2+ stem cell compartment and its proliferative phenotype (Figure 2—figure supplement 3A). Also, expression of other stem cell markers and of lineage progenitor and endocrine cell markers is not changed in the Il6−/− neonatal AP (Figure 2—figure supplement 3B). One possible explanation is that IL-6’s function is in vivo taken over by other cytokines when IL-6 is absent from conception. Expression of the IL-6 family members Il11 and leukemia-inhibitory factor (Lif), and of the related cytokine tumor necrosis factor-α (Tnf), was found slightly enhanced in the neonatal Il6−/− AP (Figure 2—figure supplement 3C). These cytokines, as well as the related IL-1β, did not significantly increase the number of organoids formed, but enhanced organoid expandability (Figure 2—figure supplement 3D), all similar to IL-6 (Figure 2E, F). The effects of TNFα and IL-1β seem to be mediated by IL-6 since these cytokines did not rescue its absence in organoid culturing from Il6−/− AP (Figure 2—figure supplement 3E), and increased the expression of IL-6 (as measured in WT AP organoids) (Figure 2—figure supplement 3F). In contrast, the IL-6 family members LIF and IL-11, known to act through the same gp130/JAK–STAT pathway (Rose-John, 2018), could substitute for IL-6 since increasing the number of developing organoids from Il6−/− AP as well as their expansion (passaging), while not affecting Il6 expression in WT AP organoids (Figure 2—figure supplement 3E, F). An important underlying role of JAK–STAT signaling in organoid development as well as expansion is supported by the strong reduction of both processes when adding the STAT3 inhibitor STATTIC (Figure 2—figure supplement 3G). Taken together, the adult pituitary stem cell activator IL-6, although not highly expressed in neonatal AP stem cells, still advances organoid culturing from neonatal AP but appears not absolutely required for in situ stem cell maintenance and proliferative behavior in the neonatal gland, potentially due to redundancy of other IL-6 family cytokines.

The neonatal pituitary stem cell compartment presents a pronounced WNT pathway

To continue the search for molecular mechanisms underlying the activated stem cell phenotype in the neonatal pituitary, we in further detail compared the neonatal and adult AP scRNA-seq datasets. DEG analysis revealed significantly increased expression of multiple WNT signaling-associated genes (e.g., Frizzled (Fzd)2, Fzd3, Gsk3b, Ctnnb1, and Tnks) in the neonatal versus adult stem cell clusters (Figure 3A; Figure 3—source data 1A). In analogy, GO analysis exposed that biological WNT pathway terms are enriched in the neonatal stem cell compartment (Figure 3B; Figure 3—source data 1B), and GSEA examination showed significant enrichment of WNT-associated hallmarks (Figure 3—figure supplement 1A). Regulon activity of the WNT downstream transcription factors Tcf7l1 and Tcf7l2 is most prominent in the stem cell clusters (SC1, SC2, and Prolif SC) when compared to the endocrine cell clusters (Figure 3C). Besides, high regulon activity is also present in the MC and EC clusters (Figure 3C). Clearly, regulon activity of these WNT transcription factors is higher in neonatal than adult gland (Figure 3C, violin plots). Furthermore, looking at upstream WNT pathway components, we found that ligands and receptors are overall higher expressed at neonatal age as analyzed in the whole AP (Figure 3—figure supplement 1B). Regarding the stem cell and MC clusters, particularly Wnt5a and Fzd2 receptor are much higher expressed (both virtually absent in the adult AP) (Figure 3—figure supplement 1C). This age-related expression difference is even visible in whole AP gene expression analysis (RT-qPCR; Figure 3—figure supplement 1C). Taken together, the WNT pathway is more prominently present in the neonatal gland, which is proposed to contribute to the activated state of the stem cell compartment. A pronounced WNT profile has recently also been reported in the later PD14 mouse pituitary (Russell et al., 2021).

Figure 3 with 2 supplements see all
Download asset Open asset
Neonatal pituitary stem cells show a pronounced WNT profile.

(A) Heatmap displaying scaled expression of selected WNT-associated differentially expressed genes (DEGs) in the stem cell clusters SC1, SC2, and Prolif SC between adult and neonatal anterior pituitary (AP). (B) DEG-associated Gene Ontology (GO) terms linked with WNT signaling enriched in SC1, SC2, and Prolif SC of neonatal versus adult AP. (C) Left: Tcf7l1 and Tcf7l2 regulon activity projected on UMAP plot of neonatal AP, with indication of cell clusters. Right: Violin plots displaying regulon activity of Tcf7l1 and Tcf7l2 in the indicated clusters of adult and neonatal AP. (D) Dot plot displaying selected WNT-associated ligand–receptor interactions revealed by CellPhoneDB in neonatal SC1, SC2, Prolif SC, and MC clusters. p values are indicated by dot size, means of average expression of interacting molecule 1 in cluster 1 and interacting molecule 2 in cluster 2 are specified by color intensity (see scales on top). (E) Organoid development from neonatal AP cells, cultured and exposed to compounds as indicated (P0). Left: Representative brightfield pictures of organoid cultures (scale bar, 500 μm). Right: Bar graphs showing number of organoids formed per well under conditions as indicated (mean ± standard error of the mean [SEM]). Data points represent biological replicates (n = 6; one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test). (F) Top: Schematic of in vivo treatment schedule and analysis. IF, immunofluorescence. Mouse icon obtained from BioRender. Middle: Bar plots depicting relative expression level of indicated genes in neonatal AP of mice treated as indicated (relative to vehicle [VEH], set as 1 [dashed line]) (mean ± SEM) (n = 3; unpaired t-test). Bottom: Bar graph showing percentage of SOX2+Ki67+ cells in SOX2+ cell population in neonatal AP of mice treated as indicated (relative to VEH, set as 100% [dashed line]) (mean ± SEM). Data points represent biological replicates (n = 4; paired t-test). (G) UMAP plot of the annotated cell clusters in human fetal pituitary (Zhang et al., 2020) and projection of selected WNT-associated genes’ expression. PL, posterior lobe (pituicyte) cells; CC, cell cycle cells; RBC, red blood cells; Pro.PIT1, progenitor cells of PIT1 lineage; Pre.Gonado, precursor cells of gonadotropes.

Figure 3—source data 1

Differentially expressed gene (DEG) and Gene Ontology (GO) analysis in SC1+SC2+Prolif SC of neonatal versus adult anterior pituitary (AP).

(A) DEG analysis in SC1+SC2+Prolif SC of neonatal versus adult AP. The columns represent: gene names (Gene), p values (p_val), average log fold change expression (avg_logFC; positive values indicate upregulation and negative values downregulation in neonatal), percentage of cells expressing the indicated gene in neonatal (pct.1) and in adult (pct.2), and the FDR adjusted p value (p_val_adj). (B) Gene Ontology (GO) analysis of genes upregulated in neonatal versus adult SC1+SC2+Prolif SC. Analyses were performed using Reactome overrepresentation analysis. Pathway name, number of mapped identifiers that match the pathway (#Entities found), total number of identifiers in the pathway (#Entities total), total entities in the pathway/total number of entities for the entire species (Entities ratio), p value, FDR, and −log10(FDR) are shown in the columns. Associated with Figure 3A, B.

https://cdn.elifesciences.org/articles/75742/elife-75742-fig3-data1-v2.xlsx

We have recently shown that the MC cluster is part of the formerly designated folliculo-stellate cell population in the (adult) AP (Vennekens et al., 2021), a heterogeneous cell group encompassing, among others, stem cells as well as paracrine-supportive cells (Allaerts and Vankelecom, 2005; Chen et al., 2009; Fauquier et al., 2008; Vennekens et al., 2021). Here, we applied CellPhoneDB (Efremova et al., 2020) on the neonatal scRNA-seq dataset to predict ligand–receptor interactions between MC and stem cells, thereby focusing on the prominently present WNT pathway. Multiple reciprocal interactions of Wnt5a with canonical (Fzd) and noncanonical (Ror1) receptors are projected (Figure 3D), with Fzd1, Fzd3, and Fzd6 being the prevalent mediating receptors in the stem cells, and Fzd2 both in the stem cells and MC (Figure 3D, Figure 3—figure supplement 1D). Within the RSPO/LGR-driven WNT amplification system, Rspo3, being predominantly expressed by MC cells, is forecasted to mainly bind to Lgr4 and Lgr6 receptors on the stem cells (Figure 3D, Figure 3—figure supplement 1D). RNAscope confirmed the pronounced expression of Lgr4 and Lgr6 in the Sox2+ stem cells in situ, clearly different from Rspo3 (Figure 3—figure supplement 1D).

To functionally validate the proposed stem cell-activating impact of WNT signaling in the neonatal gland, we first applied our in vitro organoid model. We observed that the stem cell WNT pathway components remained expressed in the organoids (Figure 3—figure supplement 2A). Addition of the WNT inhibitor XAV-939 (XAV; stabilizing the WNT-inhibitory protein AXIN2) at seeding (passage 0 [P0]) completely abolished organoid formation (Figure 3E). Exogenous administration of WNT ligands (WNT5A and WNT3A) to these cultures did not have an effect (Figure 3—figure supplement 2B), thereby validating the complete blockage of the intracellular (canonical) WNT-signaling path by the supplemented XAV. Addition of IWP2 (which blocks endogenous WNT ligand palmitoylation, as needed for secretion from the cell) to the seeded AP cells significantly reduced the number of organoids formed, which was substantially rescued by adding exogenous WNT5A and WNT3A (Figure 3E). Of note, both WNT inhibitors decreased the proliferative activity in the organoids (added to formed organoids at d7 of P0; Figure 3—figure supplement 2C). Together, these findings show that neonatal AP organoid growth, which reflects stem cell biology/activation, is dependent on (endogenous) WNT activity. Notably, RSPO1, which is typically used in organoid culturing (as we also did here and before, see Appendix 1—table 1; Cox et al., 2019; Vennekens et al., 2021), is only slightly expressed in the neonatal pituitary (Figure 3—figure supplement 2D) whereas Rspo3 expression is prominent (especially in the MC cluster; Figure 3—figure supplement 1D). This naturally abundant RSPO ligand was found capable to replace RSPO1 for efficient organoid formation (Figure 3—figure supplement 2D). Together, our findings advance the concept that the WNT pathway is an activator of pituitary stem cells. In support, addition of WNT5A or WNT3A to cultures from adult AP in which the stem cells are basically not activated (quiescent) (Vennekens et al., 2021) and the WNT pathway is much less prominent (Figure 3A–D, Figure 3—figure supplement 1A, B), increased stem cell proliferation in the organoids resulting in larger organoid structures (Figure 3—figure supplement 2E). Moreover, adding the WNT-signaling inhibitor Dickkopf 1 (DKK1) (which binds to the WNT co-receptors LRP5/6 thereby blocking WNT ligand action) to the co-culture of neonatal (WT) and adult (tdT+) AP organoids resulted in decreased proliferative activity in the adult organoids (Figure 3—figure supplement 2F), strongly supporting that the proliferation-activating effect of the neonatal organoid (stem) cells on the adult organoid (stem) cells, when cultured together (see Figure 2D), is mediated, at least partly, by paracrine WNT activity.

To in vivo validate our organoid-based finding that the WNT pathway plays a role in stem cell activation in the neonatal pituitary, we treated neonatal (WT) pups with the WNT pathway (porcupine) inhibitor LGK-974 (LGK; Figure 3F). WNT target gene (Axin2 and Lgr5) expression in the AP diminished following LGK administration, thereby verifying its activity and efficacy at the level of the pituitary (Figure 3F). Interestingly, the number of proliferating SOX2+ cells decreased (Figure 3F), thus further supporting the involvement of WNT signaling in the activated phenotype of the neonatal AP stem cells.

Finally, as a first translation of our mouse-based pituitary findings to humans, we explored the recently published scRNA-seq dataset of fetal human pituitary (Zhang et al., 2020) regarding WNT component expression. First, we found that the mouse neonatal and fetal human pituitary showed significant overlap and high concordance in clustering outcome (Figure 3—figure supplement 2G). Of note, in utero development of humans is more extended than of mice (Xue et al., 2013), and the neonatal mouse stage thus rather corresponds to (late) embryonic stage in humans. Projection of above specified WNT-associated genes on the human fetal pituitary UMAP plot revealed a comparable expression pattern as in neonatal mouse AP, with, for instance, WNT5A being expressed in the SC and MC clusters, and RSPO3 being most pronounced in the MC cluster (Figure 3G). Thus, the WNT pathway also appears highly present in fetal human pituitary where it may play comparable (e.g. stem-cell activating) roles. Of note, IL6 is also expressed in the human fetal pituitary stem cells, moreover at similarly low levels as in the neonatal mouse pituitary (Figure 3—figure supplement 2H).

The dynamic neonatal pituitary shows swift and complete regeneration after local damage

We have previously shown that somatotrope-ablation damage in the adult pituitary triggers acute proliferative activation of the stem cell compartment and expression of GH in the SOX2+ cells, and that the somatotrope population was eventually regenerated to 50–60% at 5–6 months after damage infliction (Fu et al., 2012). Here, we investigated whether the neonatal gland, housing a more activated (‘primed’) stem cell compartment, behaves differently regarding acute stem cell reaction and regeneration.

Three-day diphtheria toxin (DT) injection of neonatal (PD4) GhCre/+;ROSA26iDTR/+ pups (further referred to as GHCre/iDTR mice, or ‘damaged’ condition) (Figure 4A) resulted in 50–60% ablation of GH+ cells (Figure 4B) (as compared to 80–90% ablation at adult age [Fu et al., 2012]). The stem cell compartment did not visibly react (i.e., no increase in SOX2+ cells and their proliferative index, neither proportion-wise nor in absolute cell numbers; Figure 4C, Figure 4—figure supplement 1A), which may be due to their already high activation status. Similarly, organoid formation did not significantly increase (Figure 4—figure supplement 1B). Fascinatingly, the somatotrope cell population was fully restored to normal numbers, moreover already achieved after 2 months (Figure 4D), meaning a more efficient regenerative capacity of the dynamic neonatal AP than the adult gland (Fu et al., 2012).

Figure 4 with 2 supplements see all
Download asset Open asset
Neonatal pituitary’s reaction to local damage and efficient regeneration.

(A) Schematic of in vivo treatment schedule and analysis. DT, diphtheria toxin; m, months. Mouse icons obtained from BioRender. (B) Ablation of somatotropes (GH+ cells) in neonatal mouse anterior pituitary (AP). Left: Immunofluorescence staining of GH (green) in control and damaged pituitary following DT injection (PD7). Nuclei are labeled with Hoechst33342 (blue) (scale bar, 100 μm). Right: Bar graph showing proportion of GH+ cells in AP as indicated (mean ± standard error of the mean [SEM]). Data points represent biological replicates (n = 5; paired t-test). (C) SOX2+ stem cell reaction to damage. Left: Immunofluorescence staining of SOX2 (red) and Ki67 (green) in control and damaged pituitary following DT injection (PD7). Nuclei are labeled with Hoechst33342 (blue) (scale bar, 100 μm). Right: Bar graphs showing proportion of SOX2+ cells in AP as indicated, or of SOX2+Ki67+ cells in SOX2+ cell population (mean ± SEM). Data points represent biological replicates (n = 5 for % SOX2+ cells, n = 3 for % SOX2+Ki67+ cells). (D) Regeneration of somatotropes in neonatal mouse AP after their ablation. Left: Immunofluorescence staining of GH (green) in control and damaged pituitary 2 months after DT-induced ablation. Nuclei are labeled with Hoechst33342 (blue) (scale bar, 100 μm). Right: Bar graph showing proportion of GH+ cells in AP as indicated (mean ± SEM). Data points represent biological replicates (n = 4 for Control, n = 5 for Damaged). (E) Left: UMAP plot of control and damaged neonatal AP combined. Right: UMAP plot of annotated cell clusters in the integrated neonatal AP samples (i.e., collective single-cell transcriptome datasets from control and damaged AP). (F) Bar plots depicting proportion of PIT1+Ki67+ or GH+Ki67+ cells in PIT1+ or GH+ cell population, respectively, 1 week after DT-induced damage (PD14) (mean ± SEM). Data points represent biological replicates (n = 4 for Control, n = 3–8 for Damaged; unpaired t-test). (G) Left: Immunofluorescence staining of SOX2 (red) and GH (green) in control and damaged neonatal pituitary at indicated timepoints (PD7 and PD14) following DT-induced injury. Nuclei are stained with Hoechst33342 (blue). Boxed areas are magnified (scale bar, 100 µm). Right: Bar graph showing proportion of SOX2+GH+ cells in GH+ cell population following DT-induced damage (PD7) (mean ± SEM). Data points represent biological replicates (n = 4; paired t-test).

To start delving into the underlying mechanisms, we performed scRNA-seq analysis of damaged neonatal AP (the day after DT treatment (PD7); Figure 4A) and integrated the data with the control PD7 AP dataset as obtained above (Figure 4E, Figure 4—figure supplement 1C). First, in strong contrast to our recent findings in adult pituitary (Vennekens et al., 2021), Il6 expression, being very low in neonatal pituitary (see above), was not upregulated in the stem cell and MC clusters following damage (Figure 4—figure supplement 1D), in line with a lack of extra stem cell activation (while IL-6 activates the stem cells in adult pituitary following damage [Vennekens et al., 2021]), together indicating that there is a striking difference in adult and neonatal pituitary (stem cell) reaction to damage. Moreover, also in line with the absence of additional stem cell activation, the WNT pathway appeared not to become extra fired, neither immediately upon damage (Figure 4—figure supplement 1E), nor at later timepoints during the regenerative period (i.e., one (PD14) and two (PD21) weeks after damage infliction), as assessed by Lgr5 and Axin2 target gene expression (Figure 4—figure supplement 1E). Intriguingly, a cluster of Pou1f1 lineage progenitors (Pou1f1 Lin Prog) became distinguishable in the aggregate (control + damaged) neonatal AP analysis (Figure 4E). DEG and GO examination of the two Pou1f1 clusters together (Prolif Pou1f1+ cells and Pou1f1 Lin Prog) revealed enriched cell proliferation genes and terms in damaged versus control condition (Figure 4F; Figure 4—figure supplement 2A; Figure 4—figure supplement 2—source data 1). In accordance, in situ proliferative activity of the PIT1+ cells was found increased upon damage (Figure 4F), as well as of already GH-expressing cells (Figure 4F), the latter not observed in adult gland (Fu et al., 2012). Finally, there is also an increase in SOX2+GH+ cells in damaged versus control gland (Figure 4G), suggesting rising stem cell differentiation. DEG and GO analysis of all SC clusters together revealed enriched NOTCH signaling terms in control versus damaged pituitary, or in others words, that NOTCH signaling is downregulated in the stem cells following the inflicted injury (Figure 4—figure supplement 2B; Figure 4—figure supplement 2—source data 2), which may be in line with the knowledge that NOTCH inhibition is needed for proper endocrine cell differentiation from stem/progenitor cells as observed during pituitary embryogenesis (Cox et al., 2017; Zhu et al., 2006). Taken together, restoration of the GH+ cell population in the neonatal pituitary may encompass several mechanisms including proliferative activation of the PIT1+ (progenitor) and derived (or existing) GH+ cell populations, and GH/somatotrope differentiation of SOX2+ stem cells, together embodying the active nature of the neonatal gland.

In conclusion, these data show that the dynamic neonatal gland more efficiently regenerates after injury than the adult gland, but that the already highly activated stem cell population does not show extra visible activation. Further insights into the underlying molecular mechanisms of neonatal AP regeneration will derive from still more extended scRNA-seq and functional explorations.

Discussion

In our study, we in detail portray the activated nature of the neonatally maturing pituitary, in particular of its stem cells, using single-cell transcriptome profiling and functional in vitro (organoid) and in vivo (mouse) exploration. The stem cell compartment, shown to be expanded and proliferatively activated in the neonatal gland, presents a pronounced WNT profile. Inhibiting WNT-signaling abrogated organoid formation and decreased proliferative activity of the neonatal pituitary stem cell compartment in vivo, thereby indicating the importance of the WNT pathway in the activated stem cell phenotype. This WNT signaling may act between the stem cells and supportive mesenchymal cells as projected by CellPhoneDB. Furthermore, the stem cells display a prominent hybrid E/M phenotype in the neonatal gland. A hybrid E/M character has recently also been found in the active stem/progenitor population of the fetal human pituitary (Zhang et al., 2020). More in general, a hybrid E/M nature is present in stem/progenitor cells of developing organs (such as lung, intestine, and liver), and underlies their active contribution to the tissues’ development (Dong et al., 2018). Hence, the hybrid E/M phenotype of the neonatal pituitary stem cells likely embodies their active participation in the intense maturation process of the neonatal gland, as proposed during embryogenesis in human pituitary (Zhang et al., 2020). Along this line, we provide further indications that our findings in mouse are translatable to humans. Integrating our neonatal mouse AP scRNA-seq dataset with the recently published scRNA-seq data of fetal human pituitary (Zhang et al., 2020) revealed considerable overlap, including an analogous WNT landscape. A pronounced WNT profile has recently also been reported in the early-postnatal (2-week-old) mouse pituitary (Russell et al., 2021). Interestingly, this study showed a paracrine-regulatory role of these stem cells, stimulating neighboring committed progenitor cells (as well as stem cells) to proliferate and expand. We also show this paracrine-stimulatory nature of neonatal (1-week-old) pituitary stem cells, inducing proliferative activation of (adult) AP stem cell organoids. Moreover, organoid culturing recapitulated the activated stem cell phenotype of the neonatal AP showing higher outgrowth efficiency. Together, these findings again indicate the faithful reproduction of pituitary stem cell biology and activation by our organoid model.

We recently found that IL-6 is promptly upregulated in the adult pituitary, in particular in its stem cells, following transgenically inflicted damage, associated with proliferative stem cell activation (Vennekens et al., 2021). Intriguingly, Il6 expression did not rise following damage in the neonatal gland. Together, these findings suggest that the pituitary reacts to damage differently according to developmental age. Along the same line, the dynamic neonatal pituitary more efficiently (faster and more extensively) regenerates than the adult pituitary following the local injury (Fu et al., 2012), likely due to the presence of activated (‘primed’) stem, committed progenitor and just differentiated endocrine cells that all appear to contribute by increased proliferation or differentiation (as supported by transcriptomic and in situ immunostaining analyses). Of note, the somewhat lower somatotrope ablation grade in neonatal pituitary may also partly contribute to the higher regeneration level. Interestingly, efficient regenerative capacity is also present in other mouse organs at neonatal age (such as heart and cochlea), while seriously declining or disappearing in adulthood (Cox et al., 2014; Lam and Sadek, 2018). Detailed unraveling of neonatal-pituitary regenerative mechanisms further needs profound studies, which may find ground in our existing and to be extended single-cell transcriptomic analyses.

IL-6 expression in the neonatal gland is low (much lower than in adult pituitary), and its absence does not visibly affect the neonatally activated stem cell compartment. Either, IL-6 is not needed in the neonatal gland to induce or sustain the activated stem cell phenotype, or its lack has been taken over by cytokine family members such as LIF or IL-11. We provide support for the latter, and also propose that the JAK/STAT pathway may be the common denominator that lies at the basis of stem cell activation in the neonatal gland, hence also critical for organoid outgrowth (as we show with STATTIC and suggest with the Il6−/− mouse) and organoid expandability (as induced by the JAK/STAT-signaling factors IL-6, LIF, and IL-11). Adding IL-6 significantly prolonged the passageability of the organoids (as also found before for adult AP-derived organoids [Vennekens et al., 2021]), thereby compensating for its declining expression at culturing which may be due the stem cells’ removal from the activating (micro-)environment and disappearance of stimulatory factors (such as IL-1β and TNFα which indeed stimulate IL-6 expression). Further research is now needed to unravel these hypotheses.

In conclusion, our study provides deeper insight into the activated phenotype of the neonatal pituitary stem cell compartment. Together with the scRNA-seq datasets and organoid models developed from adult and aging pituitary (Cox et al., 2019; Vennekens et al., 2021), we provide an arsenal of tools to compose a comprehensive view on pituitary stem cell biology, activation and role across key time points of life. Decoding stem cell activation will be needed and instrumental toward future aspirations of repairing and regenerating harmed pituitary tissue.

Materials and methods

Mice and in vivo treatments

Request a detailed protocol

Mice with C57BL/6 background were used for the experiments, which were approved by the KU Leuven Ethical Committee for Animal Experimentation (P153/2018). Mice were bred and kept in the animal housing facility of the KU Leuven under conditions of constant temperature, humidity, and day–night cycle, and had access to food and water ad libitum. For the neonatal pituitary experiments (biological replicates), male and female pups were pooled. For the adult pituitary experiments, biological replicates were performed with male or female mice, and results combined for statistical analyses.

Sox2eGFP/+ (Sox2tm1Lpev) reporter mice contain the gene encoding for eGFP in the Sox2 open reading frame, resulting in eGFP expression in SOX2-expressing cells (Ellis et al., 2004). Offspring was genotyped for the presence of the eGFP transgene by PCR using 5′-TACCCCGACCACATGAAGCA-3′ as forward primer and 5′-TTCAGCTCGATGCGGTTCAC-3′ as reverse primer.

ROSA26mT/mG mice (Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo) contain, in the absence of Cre-mediated recombination, cell membrane-localized fluorescent tdTomato in all cells (Muzumdar et al., 2007).

GhCre/+ mice (Tg(Gh1-cre)bKnmn) were crossed with ROSA26iDTR/iDTR animals (Gt(ROSA)26Sortm1(HBEGF)Awai) to create GhCre/+;ROSA26iDTR/+ offspring (i.e., heterozygous for both transgenes and abbreviated to GHCre/iDTR) as described in detail before (Fu et al., 2012). Offspring is genotyped for the presence of the Cre transgene by PCR using 5′-TGCCACGACCAAGTGACAGCAATG-3′ as forward primer and 5′- ACCAGAGACGGAAATCCATCGCTC-3′ as reverse primer, as previously described (Fu et al., 2012). GHCre/iDTR mice and Cre-negative control littermates (further referred to as −/iDTR) (PD4) were intraperitoneally (i.p.) injected with 4 ng DT (Merck, Darmstadt, Germany) per g bodyweight, twice a day (8 hr in between the injections) for 3 consecutive days. Pituitaries (damaged and control) were isolated and analyzed the following day (PD7), 1 week later (PD14), or 2 months later.

Il6-/- (Il6tm1Kopf) mice carry a targeted disruption of the Il6 gene through replacement of the second exon by a neor cassette (Kopf et al., 1994). These mice were generously provided by Dr. P. Muñoz Cánoves (Cell Biology Unit, Pompeu Fabra University, Barcelona, Spain). Offspring was genotyped for the presence of the neor cassette and the WT Il6 gene by PCR using 5′-TTCCATCCAGTTGCCTTCTTGG-3′ as common forward primer, 5′-TTCTCATTTCCACGATTTCCCAG-3′ as WT reverse primer, and 5′-CCGGAGAACCTGCGTGCAATCC-3′ as mutant reverse primer.

WT (C57BL/6) neonatal mice (PD5) were treated twice with 5 μg LGK-974 (Biogems, Westlake Village, CA) per g bodyweight or vehicle (corn oil, Merck) trough oral gavage, for 2 consecutive days. Pituitaries were isolated and analyzed the following day (PD7).

scRNA-seq analysis

Request a detailed protocol

The AP of neonatal (PD7) mice was isolated and dispersed into single cells using trypsin (Thermo Fisher Scientific, Waltham, MA), all as previously described (Denef et al., 1978; Van der Schueren et al., 1982). The eventual cell suspension was then subjected to scRNA-seq analyses (two biological replicates). Cells were loaded on a 10× Genomics cartridge according to the manufacturer’s instructions based on 10× Genomics’ GemCode Technology (10× Genomics, Pleasanton, CA). Barcoded scRNA-seq libraries were prepared with the Chromium Single-cell 3’ v2 Chemistry Library Kit, Gel Bead & Multiplex Kit and Chip Kit (10× Genomics). The libraries were sequenced on an Illumina NextSeq and NovaSeq6000. Data are accessible from ArrayExpress database (accession number E-MTAB-11337). Raw sequencing reads were demultiplexed, mapped to the mouse reference genome (mm10) and gene expression matrices were generated using CellRanger (v3; 10× Genomics). Downstream analysis was performed in R (v.3.6.1) using Seurat (v.3.1.3) (Butler et al., 2018). First, low-quality/dead cells and potential doublets (i.e., with less than 750 genes or more than 8000 genes and more than 17.5% mitochondrial RNA; see cutoffs in Figure 1—figure supplement 1A) were removed, resulting in a total of 21,419 good-quality single cells (i.e., 9618 from undamaged AP and 11,801 from damaged AP) for downstream analyses. To allow integrated, comparative examination of undamaged and damaged AP samples, the standard Seurat v3 integration workflow was followed (Stuart et al., 2019). In short, after normalization and identification of variable features for each sample, integration anchors were identified using the FindIntegrationAnchors function with default parameters and dims = 1:20, and data were integrated across all features. Following integration, expression levels were scaled, centered and subjected to principal component analysis (PCA). The top 20 PCs were selected and used for UMAP dimensionality reduction (McInnes et al., 2018). Clusters were identified with the FindClusters function by use of the shared nearest neighbor modularity optimization with a clustering resolution set to 1. This analysis resulted in the identification of 33 distinct clusters, which were annotated based on canonical (AP) cell markers and on previous mouse pituitary scRNA-seq reports (Cheung et al., 2018; Ho et al., 2020; Mayran et al., 2019; Vennekens et al., 2021). Background (ambient) RNA was removed using SoupX (v.1.4.5) with default parameters (Ho et al., 2020). The global contamination (ambient RNA) fraction was estimated at 1.4%, well within the common range of 0–10%. The SoupX-filtered expression matrices were then loaded into Seurat, and processed using standard preprocessing (normalization, variable feature selection and scaling) to enable further downstream analyses.

To integrate our neonatal pituitary dataset with our previously published adult pituitary dataset (Vennekens et al., 2021), we applied Seurat’s reference-based integration approach, for which the ‘adult’ condition was used as reference dataset when applying the FindIntegrationAnchors function (as described above [Stuart et al., 2019]). The top 30 PCs were selected and used for UMAP dimensionality reduction (McInnes et al., 2018). Clusters were identified with the FindClusters function with a clustering resolution set to 1.6. This analysis resulted in the identification of 37 distinct clusters, which were annotated.

Differential gene expression analysis was performed using the FindMarkers function with default parameters. GO analysis of biological processes was executed on significant DEGs FDR ≤0.05 and logFC ≥0.25 using Reactome overrepresentation analysis v3.7 and GOrilla (Eden et al., 2009; Fabregat et al., 2018). Gene-set enrichment analysis (GSEA; v.4.1.0) was performed using normalized expression data (Mootha et al., 2003; Subramanian et al., 2005). Gene sets (hallmarks) tested were obtained from the Molecular Signatures Database (MSigDB; v.7.2) (Liberzon et al., 2015; Subramanian et al., 2005), and converted to mouse gene signatures using MGI batch query (http://www.informatics.jax.org/batch).

Gene regulatory networks (regulons) were determined in our integrated pituitary dataset using pySCENIC, that is, SCENIC (v.0.9.15 [Aibar et al., 2017]) in Python (v.3.6.9). Raw expression data were normalized by dividing feature counts of each cell by the total counts for that same cell and multiplying by 10,000 followed by log1p transformation. Next, co-expression modules were generated using GRNboost2 algorithm (v.0.1.3) (Moerman et al., 2019). Subsequently, gene regulatory networks were inferred using pySCENIC (with default parameters and mm10__refseqr80__10 kb_up_and_down_tss.mc9nr and mm10__refseqr80__500 bp_up_and_100 bp_down_tss.mc9nr motif collections) resulting in the matrix of AUCell values that represent the activity of each regulon in each cell. The AUCell matrix was imported into Seurat for further downstream analysis, after which it was integrated using the default integration method, as described above. To generate regulon-based UMAP plots, the integrated AUCell matrix was scaled, centered, and subjected to PCA analysis and the top 20 PCs were selected for UMAP representation.

For integration of our dataset with the recently published human fetal pituitary scRNA-seq dataset (Zhang et al., 2020), the standard Seurat v3 workflow was used as described above. Following integration, expression levels were scaled, centered, and subjected to PCA. The top 30 PCs were selected and employed for UMAP dimensionality reduction.

Interactions between pairwise cell clusters were inferred by CellPhoneDB v.2.1.5, which includes a public repository of curated ligands, receptors, and their interactions (Efremova et al., 2020). We ran the CellPhoneDB framework using a statistical method and detected ligand–receptor pairs that were expressed in more than 20% of cells. Selected significant ligand–receptor pairs (p-value ≤0.05 and mean value ≥0.5) are shown.

Organoid culture and treatment

Request a detailed protocol

Organoids were developed and cultured as in detail described before (Cox et al., 2019; Laporte et al., 2022). In short, AP cells were plated at a density of 10,000 cells per 30 µl drop of growth factor-reduced Matrigel (Corning, New York, NY) mixed with serum-free defined medium (SFDM; Thermo Fisher Scientific) in a 70:30 ratio (Figure 2A). For all cultures, PitOM or RSpECT (Appendix 1—table 1) was used unless otherwise stated. At seeding of the primary AP cells and at replating of the organoid fragments (i.e., passaging), ROCK inhibitor (Y-27632; 10 µM; Merck) was added to the medium. Organoid cultures were passaged every 10–14 days; the organoids were incubated with TrypLE Express (Thermo Fisher Scientific) and mechanically dispersed until organoid fragments were obtained which were reseeded in Matrigel drops as above.

To explore their effect on organoid culturing, IL-6 (20 ng/ml; Peprotech, London, UK), IL-1β (10 ng/ml; Peprotech), TNFα (20 ng/ml; Peprotech), LIF (25 ng/ml; Peprotech), IL-11 (25 ng/ml; Peprotech) or STATTIC (20 µM; Merck) was added to the medium.

To assess WNT pathway involvement in organoid culturing, IWP2 (4 µM; Merck), XAV-939 (10 µM; Merck), WNT3A (200 ng/ml; R&D systems, Minneapolis, MN), WNT5A (100 ng/ml; AMSBIO, Cambridge, MA), or RSPO3 (200 ng/ml; Peprotech) were supplemented to the medium.

Brightfield and fluorescence pictures of organoid cultures were recorded using an Axiovert 40 CFL microscope (Zeiss, Oberkochen, Germany). Organoid-forming efficiency was determined by quantifying the number of clearly developed organoids (≥100 μm) in whole organoid culture drops using Fiji (https://imagej.net/Fiji; Schindelin et al., 2012).

Histochemical and immunostaining analysis

Request a detailed protocol

Pituitary and organoids were fixed in 4% paraformaldehyde (PFA; Merck) and embedded in paraffin using the Excelsior ES Tissue Processor (Thermo Fisher Scientific). Sections were subjected to immunofluorescence staining as described earlier (Cox et al., 2019). Antigen retrieval in citrate buffer (Merck) was followed by permeabilization with Triton X-100 (Merck) and blocking with donkey serum (Merck). Following incubation with primary and secondary antibodies (Appendix 1—key resources table), sections were covered with ProLong Gold (Thermo Fisher Scientific) after nuclei counterstaining with Hoechst33342 (Merck).

To quantify SOX2+, Ki67+, PIT1+, and GH+ cells, dissociated AP cells were spun onto SuperFrost glass slides (Thermo Fisher Scientific) and the cytospin samples immunostained as described before (Fu et al., 2012). Proportions of immunoreactive cells were counted using Fiji software as previously described (Vennekens et al., 2021).

Images were recorded using a Leica DM5500 upright epifluorescence microscope (Leica Microsystems, Wetzlar, Germany) accessible through the Imaging Core (VIB, KU Leuven) and converted to pictures for figures with Fiji imaging software.

Gene expression analysis

Request a detailed protocol

Total RNA was isolated using the RNeasy Micro kit (Qiagen, Hilden, Germany) and reverse-transcribed (RT) with Superscript III First-Strand Synthesis Supermix (Invitrogen, Waltham, MA). SYBR Green-based quantitative ‘real-time’ PCR (RT-qPCR) was performed, using specific forward and reverse primers (Appendix 1—table 2), as described before (Cox et al., 2019). β-Actin (Actb), displaying stable expression levels among the conditions tested, was used as housekeeping gene for normalization. Normalized gene expression levels are shown as bar graphs of dCt values (Ct target − Ct housekeeping gene), or gene expression levels were compared between sample and reference as relative expression ratio (fold change) using the formula 2−(dCt sample − dCt reference).

Time-lapse recording of organoid development and growth

Request a detailed protocol

AP cells were seeded at a density of 1000 cells in 5 µl Matrigel/SFDM drops in 96-well plates (Corning). Brightfield time-lapse images were recorded with the IncuCyte S3 (Sartorius, Göttingen, Germany) every 3 hr for 12 days. Time-lapse videos were generated with the IncuCyte software using 10 frames per second.

3D imaging of cleared organoids

Request a detailed protocol

Whole organoids were immunofluorescently stained and imaged as described (Dekkers et al., 2019). In short, organoids were removed from the Matrigel droplet and fixed in 4% PFA. Permeabilization and blocking were performed with Triton X-100 and bovine serum albumin (Serva, Heidelberg, Germany) prior to sequential incubation with primary and secondary antibodies (Appendix 1-key resources table). Clearing was achieved by incubating the organoids in a fructose-glycerol solution (Merck; Thermo Fisher Scientific). Samples were mounted and images recorded using a Zeiss LSM 780 – SP Mai Tai HP DS accessible through the Cell and Tissue Imaging Cluster (CIC; KU Leuven). Acquired z-stacks were imported into Fiji image analysis software and 3D reconstructions made using the 3D viewer plugin (Pietzsch et al., 2015).

RNAscope in situ hybridization

Request a detailed protocol

Whole pituitary was fixed in 4% PFA for 24 hr at room temperature and then paraffin-embedded as described above. Five-µm sections were subjected to in situ hybridization with the RNAscope Multiplex Fluorescent Reagent Kit v2 (Advanced Cell Diagnostics, Newark, CA) following the manufacturer’s instructions. Differently labeled RNAscope probes (Advanced Cell Diagnostics) were used for mouse Sox2 (401041-C3), Rspo3 (483781-C2), Lgr4 (318321-C2), and Lgr6 (404961-C2). Sections were counterstained with DAPI, mounted with ProlongGold, and analyzed with the Zeiss LSM 780 – SP Mai Tai HP DS. Recorded images were converted to pictures using Fiji.

Electrochemiluminescent measurement of IL-6

Request a detailed protocol

IL-6 protein levels were measured with the sensitive electrochemiluminescent ‘Meso Scale Discovery’ (MSD) V-PLEX mouse IL-6 kit (MSD; Rockville, MD), according to the manufacturer’s protocol, in organoid culture supernatant which was collected and centrifuged for 10 min at 1500 rpm (4°C). Plates were run on the MESO QuickPlex SQ 120 reader and data were analyzed using the MSD discovery workbench software (v4.0.12).

Appendix 1

Appendix 1—table 1
Overview of medium components in PitOM and RSpECT, used for organoid culturing.
Pituitary organoid medium (PitOM)
ComponentConcentrationCatalogue numberCompany
SFDMThermo Fisher Scientific
B271×12587010Thermo Fisher Scientific
L-Glutamine2 mM25030081Thermo Fisher Scientific
N21×17502048Thermo Fisher Scientific
N-Acetyl-cysteine1.25 mMA7250Sigma-Aldrich
EGF50 ng/ml236-EGR&D systems
SB202190 (=p38 i)10 µMS7067Sigma-Aldrich
Cholera toxin100 ng/mlC8052Sigma-Aldrich
RSPO1200 ng/ml120-38Peprotech
Nicotinamide10 mMN0636Sigma-Aldrich
bFGF (=FGF2)20 ng/ml234-FSER&D systems
IGF1100 ng/ml100-11Peprotech
FGF8200 ng/ml100-25Peprotech
FGF10100 ng/ml100-26Peprotech
A83-010.5 µMSML0788Sigma-Aldrich
SHH100 ng/ml464-SHR&D systems
Noggin100 ng/ml120-10CR&D systems

  1. Bold: components of RSpECT medium.

Appendix 1—table 2
Overview of primers, used for RT-qPCR.
Primer sequences
TargetForward (5′ > 3′)Reverse (5′ > 3′)
ActbGCTGAGAGGGAAATCGTGCGTGCCAGGGAGGAAGAGGATGCGG
Axin2CGACCCAGTCAATCCTTATCACGGGACTCCATCTACGCTACTG
Cdh1AGAAGATCACGTATCGGATTTGGTTCTTCACATGCTCAGCGTC
CgaCAAGCTAGGAGCCCCCATCTACACTCTGGCATTTCCCATTACT
CntfTCTGTAGCCGCTCTATCTGGGGTACACCATCCACTGAGTCAA
Ct1AAGATCCGCCAGACACACAACCTGAGAAGCCCGGCAGCCCAAA
Fgf10ATCACCTCCAAGGAGATGTCCGCGGCAACAACTCCGATTTCCAC
Fgfr2GTCTCCGAGTATGAGTTGCCAGCCACTGCTTCAGCCATGACTAC
Fzd1CAGCAGTACAACGGCGAACGTCCTCCTGATTCGTGTGGC
Fzd2AAGAATGACCTCCTTTCCCTCACAACCCAATCCTACAAACAG
Fzd3CCCTATTTGTATGGAATATGGACGTCATCACAATCTGGAAACCTACTG
Fzd6TCTTCCCTAACCTGATGGGTCACAATTTCCGACAGGGTAGAAC
Gata2AAGGATGGCGTCAAGTACCAATATCGGGTGGTGTGTTGCAG
GhGCTACAGACTCTCGGACCTCGGAAAAGCACTAGCCTCCTGA
IfngGCCACGGCACAGTCATTGATGCTGATGGCCTGATTGTCTT
Igf1GTGGATGCTCTTCAGTTCGTGTGTCCAGTCTCCTCAGATCACAGC
Igf1rCGGGATCTCATCAGCTTCACAGTCCTTGTTCGGAGGCAGGTCTA
Il11CTGACGGAGATCACAGTCTGGAGGACATCAAGTCTACTCGAAGCC
Il1bTGGACCTTCCAGGATGAGGACAGTTCATCTCGGAGCCTGTAGTG
Il31ACAACGAAGCCTACCCTGGTACATCCCAGATGCCTGCTTTAT
Il6CACGGCCTTCCCTACTTCACTGCCATTGCACAACTCTTTTCT
Krt18ACTCCGCAAGGTGGTAGATGATCCACTTCCACAGTCAATCCA
Krt8TGGAAGGACTGACCGACGAGATGGCACGAACTTCAGCGATGAT
Lgr4CTCTCAACAACATCTCAAGCATAATTCAAGTCCAGGGTTTCCA
Lgr5GTAGGCAACCCTTCTCTTATCACCAAAGTCAGTGTTCTTAGTTCAGG
Lgr6CTCTCAACCATATCCGCCACTATAGTTCAGGTCTAGTGTCTCCA
LifCCCATGCCTGATACGCCTGCAAGTGGGAGTGCAAACTGAC
NogGGTGGAGTTCAACATCCTGTGGATCCGCATCTCGTAGGCACTCA
OsmATGCAGACACGGCTTCTAAGATTGGAGCAGCCACGATTGG
Pou1f1ATGAGTTGCCAATCTTTCACCTAATGAAGTCCTGTCGCTGTG
PomcAGAGGTTAAGAGCAGTGACTAAGAGAACATGTTCAGTCTCCTGCCT
PrlCTGGCTACACCTGAAGACAAGCGAGGACTGCACCAAACTGA
Prop1CCATCTTTGGTTTGGGTGGCAGAGCTCCTGTCTACCGT
Sox2AAAGTATCAGGAGTTGTCAAGGCTCTTCTTTCTCCCAGCCC
Sox9CGGAACAGACTCACATCTCTCCGCTTGCACGTCGGTTTTGG
Tacstd2GTCTGCCAATGTCGGGCAAGTTGTCCAGTATCGCGTGCT
Tbx19AGCTGTGTCTACATTCACCCTCAGCATTATCTGCCCACCT
TnfGGTGCCTATGTCTCAGCCTCTTGCCATAGAACTGATGAGAGGGAG
Wnt5aATGCAGTACATTGGAGAAGGTGCGTCTCTCGGCTGCCTATTT
Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent (Mus musculus)Sox2eGFP/+; Sox2tm1LpevDOI: 10.1159/000082134. PMID:15711057.MGI:3589809
Genetic reagent (Mus musculus)Il6−/−; Il6tm1KopfDOI: 10.1038/368339a0. PMID:8127368.MGI:1857197; RRID:IMSR_JAX:002650Gifted by Dr. Pura Muñoz Cánoves, University of Valencia
Genetic reagent (Mus musculus)GHCre/+; Tg(Gh1-cre)bKnmnDOI: 10.1210/en.2006–1542. PMID:17289844.MGI:4442901
Genetic reagent (Mus musculus)ROSA26iDTR/+; Gt(ROSA)26Sortm1(HBEGF)Awai; −/iDTRDOI: 10.1038/nmeth762. PMID:15908920.MGI:3772576; RRID:IMSR_JAX:007900
Biological sample (Mus musculus)Primary anterior pituitary (AP) cellsThis paperN/AFreshly isolated from Mus musculus
AntibodyAnti-SOX2 (rabbit monoclonal)AbcamCat. #:AB92494; RRID:AB_10585428(1:2000)
AntibodyAnti-SOX2 (goat polycolonal)Immune SystemsCat. #:GT15098; RRID:AB_2732043(1:750)
AntibodyAnti-ACTH (rabbit polyclonal)National Hormone and Peptide Program (NHPP)Cat. #:AFP-6328031; RRID:AB_2665562(1:5000)
AntibodyAnti-CK8/18 (guinea pig polyclonal)ProgenCat. #:GP11; RRID:AB_2904125(1:20)
AntibodyAnti-E-cad (rabbit monoclonal)Cell Signalling TechnologyCat. #:3195; RRID:AB_2291471(1:400)
AntibodyAnti-GH (guinea pig polyclonal)National Hormone and Peptide Program (NHPP)Cat. #:AFP12121390;RRID: B_2756840(1:1000)
AntibodyAnti-GH (rabbit polyclonal)National Hormone and Peptide Program (NHPP)RRID:AB_2629219(1:10,000)
AntibodyAnti-Ki67 (rabbit monoclonal)Thermo Fisher ScientificCat. #:RM-9106; RRID:AB_2341197(1:50)
AntibodyAnti-Ki67 (mouse monoclonal)BD BioscienceCat. #:550609; RRID:AB_393778(1:100)
AntibodyAnti-PIT1 (rabbit polyclonal)OtherCat. #:422_Rhodes; RRID:AB_2722652(1:500) Gifted by Dr. S. J. Rhodes (IUPUI, USA); Dr. K. Rizzoti (Francis-Crick institute, UK)
AntibodyAnti-PRL (rabbit polyclonal)National Hormone and Peptide Program (NHPP)RRID:AB_2629220(1:10,000)
AntibodyAnti-TACSTD2 (goat polyclonal)R&D systemsCat. #:AF1122; RRID:AB_2205662(1:50)
AntibodyAnti-aGSU (guinea pig polyclonal)National Hormone and Peptide Program (NHPP)(1:10,000)
AntibodyAnti-VIM (rabbit monoclonal)Cell Signalling TechnologyCat. #:5741 S; RRID:AB_10695459(1:50)
AntibodyAnti-TdT (rabbit monoclonal)AbcamCat. #:ab76544; RRID:AB_2094447(1:100)
AntibodyAnti-goat IgG 555 (donkey polyclonal)Thermo Fisher ScientificCat. #:A-21432; RRID:AB_2535853(1:1000)
AntibodyAnti-mouse IgG 555 (donkey polyclonal)Thermo Fisher ScientificCat. #:A-31570; RRID:AB_2536180(1:1000)
AntibodyAnti-mouse IgG 488 (donkey polyclonal)Thermo Fisher ScientificCat. #:A-32766; RRID:AB_2762823(1:1000)
AntibodyAnti-rabbit IgG 488 (donkey polyclonal)Thermo Fisher ScientificCat. #:A-21206; RRID:AB_2535792(1:1000)
AntibodyAnti-rabbit IgG 555 (donkey polyclonal)Thermo Fisher ScientificCat. #:A-31572; RRID:AB_162543(1:1000)
AntibodyAnti-guinea pig FITC (donkey polyclonal)Jackson ImmunoResearchCat. #:706-545-148; RRID:AB_2340472(1:500)
Sequence-based reagentRNAscope probe M. musculus Sox2Advanced Cell DiagnosticsCat. #:401041 C3
Sequence-based reagentRNAscope probe M. musculus Rspo3Advanced Cell DiagnosticsCat. #:483781 C2
Sequence-based reagentRNAscope probe M. musculus Lgr4Advanced Cell DiagnosticsCat. #:318321 C2
Sequence-based reagentRNAscope probe M. musculus Lgr6Advanced Cell DiagnosticsCat. #:404961 C2
Peptide, recombinant proteinR-Spondin 1; RSPO1R&D systemsCat. #:4645-RS
Peptide, recombinant proteinWNT3AR&D systemsCat. #:5036-WN
Peptide, recombinant proteinInterleukin-6; IL-6PeprotechCat. #:200-06
Peptide, recombinant proteinEpidermal growth factor; EGFR&D systemsCat. #:236-EG
Peptide, recombinant proteinBasic fibroblast growth factor; bFGF; FGF2R&D systemsCat. #:234-FSE
Peptide, recombinant proteinInsulin-like growth factor 1; IGF1PeprotechCat. #:100-11
Peptide, recombinant proteinFibroblast growth factor 8; FGF8PeprotechCat. #:100-25
Peptide, recombinant proteinFibroblast growth factor 10; FGF10PeprotechCat. #:100-26
Peptide, recombinant proteinSonic hedgehog; SHHPeprotechCat. #:464-SH
Peptide, recombinant proteinNogginPeprotechCat. #:120-10C
Peptide, recombinant proteinIL-1βPeprotechCat. #:200-01B
Peptide, recombinant proteinTumor necrosis factor-α; TNFαPeprotechCat. #:300-01A
Peptide, recombinant proteinLeukemia-inhibitory factor; LIFPeprotechCat. #:300-05
Peptide, recombinant proteinIL-11PeprotechCat. #:200-11
Peptide, recombinant proteinWNT5AAMSBIOCat. #:AMS.P5172
Peptide, recombinant proteinRSPO3PeprotechCat. #:120-44
Commercial assay or kitRNAscope Multiplex Fluorescent Reagent Kit v2Advanced Cell DiagnosticsCat. #:323,100
Commercial assay or kitRNeasy Micro kitQiagenCat. #:74,004
Commercial assay or kitV-PLEX mouse IL-6 kitMeso Scale DiscoveryCat. #:K152QXD-1
Commercial assay or kitSuperscript III First-Strand Synthesis SupermixInvitrogenCat. #:18080400
Commercial assay or kitSYBR Green PCR Master MixThermo Fisher ScientificCat. #:4309155
Chemical compound, drugLGK-974; LGKBiogemsCat. #:1241454
Chemical compound, drugDiphtheria toxin; DTSigma-AldrichCat. #:D0564
Chemical compound, drugCholera toxin; CTSigma-AldrichCat. #:C8052
Chemical compound, drugSB202190; P38iSigma-AldrichCat. #:S7067
Chemical compound, drugA83-01Sigma-AldrichCat. #:SML0788
Chemical compound, drugNicotinamideSigma-AldrichCat. #:72,340
Chemical compound, drugN-Acetyl-cysteineSigma-AldrichCat. #:A7250
Chemical compound, drugB-27Thermo Fisher ScientificCat. #:12587010
Chemical compound, drugL-GlutamineThermo Fisher ScientificCat. #:25030081
Chemical compound, drugN2Thermo Fisher ScientificCat. #:17502048
Chemical compound, drugSTATTICMerckCat. #:573,099
Chemical compound, drugXAV939; XAVMerckCat. #:575,545
Chemical compound, drugIWP2MerckCat. #:681,671
Chemical compound, drugMatrigelCorningCat. #:356,234
Software, algorithmGraphPad Prism SoftwareGraphPad Prim (https://www.graphpad.com/)RRID:SCR_002798Version 9.3.1
Software, algorithmFijiImageJ (http://imagej.nih.gov/ij/) DOI: 10.1038/nmeth.2019 PMID:22743772RRID:SCR_002285
Software, algorithmIncuCyte softwareSartorius (https://www.sartorius.com/en/products/live-cell-imaging-analysis/live-cell-analysis-software/incucyte-s3-software-v2018b)Version 2018B
Software, algorithmMSD discovery workbench softwareMSD (https://www.mesoscale.com/en/products_and_services/software)RRID:SCR_019192Version 4.0.12
OtherDeposited Data, scRNA-seqArrayExpressEMBL-EBI:E-MTAB-11337scRNA-seq of neonatal mouse AP in steady-state conditions and after transgenically inflicted local damage (see Materials and methods)

Data availability

scRNA-seq data have been deposited in ArrayExpress (E-MTAB-11337). All other study data are included in the article and/or supporting information.

The following data sets were generated
    1. Hermans F
    2. Laporte E
    3. Vankelecom H
    (2022) ArrayExpress
    ID E-MTAB-11337. Single-cell transcriptomics of neonatal mouse anterior pituitary in steady-state conditions and after transgenically inflicted local damage.
    https://www.ebi.ac.uk/biostudies/arrayexpress/studies/E-MTAB-11337
The following previously published data sets were used
    1. Hermans F
    2. Vennekens A
    3. Laporte E
    4. Vankelecom H
    (2021) ArrayExpress
    ID E-MTAB-10021. Single-cell transcriptional profiling of young-adult and aging (middle-aged) mouse anterior pituitary in steady-state conditions and after transgenically inflicted local damage.
    https://www.ebi.ac.uk/biostudies/arrayexpress/studies/E-MTAB-10021
    1. Zhang S
    2. Cui Y
    3. Wen L
    4. Qiao J
    5. Tang F
    (2020) NCBI Gene Expression Omnibus
    ID GSE142653. Single-cell Transcriptomics Reveals the Divergent Developmental Lineage Trajectories during Human Pituitary Development.
    https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE142653

References

  30. Book
    1. Melmed S
    (2011)
    Pituitary (3rd ed)
    Cambridge: Elsevier/Academic Press.

Decision letter

  1. T Rajendra Kumar
    Reviewing Editor; University of Colorado, United States
  2. Edward E Morrisey
    Senior Editor; University of Pennsylvania, United States
  3. Gwen Childs
    Reviewer

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Decoding the activated stem cell phenotype of the vividly maturing neonatal pituitary" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Nancy Carrasco as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Gwen Childs (Reviewer #2).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) Want pathway involvement with regard to data presented in Figure 2 must be tested.

2) Demonstration of other pituitary defects in IL6 null mice need to be reported.

3) New folliculo-stellate markers have been characterised in the mouse and should be tested to clarify the identity of MC cluster. what are the MC cells in both the murine and human datasets?

4) Data on the mechanisms of regeneration following toxin ablation of GH cells needs to be defined.

5) The language of terms used in the Text as pointed out by Rev 2 must be addressed.

Reviewer #1 (Recommendations for the authors):

The results presented in this manuscript are interesting, however further investigation would greatly improve their significance. Furthermore, I have some precise questions about some of the data.

What is the sex of the animal used in this study? If both sexes were used, was any potential sex difference examined? If only one sex was used, were the main conclusions tested on the other sex?

Co-cultures of young organoids with older ones increase proliferative abilities of the latter (Figure 2). The authors suggest that Wnt signalling may be involved but this could be tested using conditioned medium, and potentially manipulating Wnt pathway.

Removal of growth factors in the organoid medium does not affect growth of adult organoids but improve number of neonatal ones. Are these factors superfluous for adult organoids? The data clearly shows that they actively inhibit neonatal cells. I think the significance of these observations should be further explored and discussed. Is there any evidence that these pathways are active, or regulators expressed in the young but not the old stem cells?

Supplementation of Il6 null organoids with LIF or IL-11 appears to rescue organoid formation. Do they also improve self-renewal (passage number)? Is there a dual role of the JAK-STAT pathway on organoid formation efficiency and self-renewal/passageability? I found the interpretation of these data (line 233-245) difficult to follow. A clear distinction between organoid formation efficiency and passage number could be made to clarify the conclusions of the authors.

I understand that pituitary stem cell proliferation is normal in IL6 null glands. Did the authors examine for the presence of further pituitary defects?

The authors identify the MC cluster as folliculo-stellate cells. These were previously shown to express SOX2. Here this is clearly not the case (Figure 1B). In addition, in their human single-cell study (Zhang et al., 2020), the authors state that folliculo-stellate cells are not present. Therefore, the identity of the MC cluster in the re-analysis of their dataset (Figure 3G), that I could not find in the original study, is unclear to me. I would have expected the cluster identification to be conserved, so more detail is needed here such as the method used for the identification of the different clusters. New folliculo-stellate markers have been characterised in the mouse and should be tested here to clarify this issue: what are the MC cells in both the murine and human datasets? This deserves further investigation because of the potential Wnt-mediated crosstalk with stem cells suggested, but not substantiated, in the present study.

Following DT mediated GH-cell ablation, regeneration is observed. Because this system is Cre-mediated, it is difficult to perform lineage tracing and identify the cells generating the new somatotrophs. However, mechanisms leading to this regeneration are not further investigated. A potential role for Wnt signalling, in the context of earlier results, could have been examined?

Davis et al., 2016 should be replaced by Perez-Millan et al., (line 153).

Reviewer #2 (Recommendations for the authors):

1. My concerns focus mainly on the grammar and context. The science is outstanding. The availability of data is outstanding.

2. Line 40 and Title. I am not certain the word vividly is used in the right context. The English meaning of vividly is brightly or intensely, clear, distinct, powerful, detailed, strongly, perceptibly, sharply, graphically. None of those synonyms would be appropriate as a way to describe neonatal development. Graphically is the only synonym that might be appropriate and indeed might be more appropriate than vividly. I am looking for another meaning that might fit with a bioinformatics type analysis and don't find one. There is no question that this is neonatal development, so why add an adverb that means "brightly, intensely, powerful, strongly, distinctly, sharply, perceptibly….etc. If you mean graphically, then that should be used, but even that doesn't describe "maturation".

3. Lines 83-100 and Figure 1. It appears that the posterior lobe was removed before cell dispersion. If so, that would have removed the intermediate lobe. However, melanotropes are still present from both groups, so it is not surprising that the PL cells are still there as well. Was the PL removed?

4. Line 131. The use of the word vivid is correct in this line as it points to powerful, distinct, detailed, etc. based on the findings.

5. Line 143. It is unclear what is meant by "In line"

6. Figure 1, bottom. Which is the neonatal pituitary and which is the adult pituitary in these immunolabeled fields.

7. Line 327. The English use of the word vivid is not appropriate in this context. What is meant by "vivid neonatal" pituitary. Of course one can see it clearly and it is developing, however vivid or even graphic is inappropriate here. It is simply a developing pituitary. Vivid only refers to the fact that you can perceive or see it intensely. Just discuss it as "developing" neonatal pituitary. Your analysis was robust and intense and comprehensive, however that describes the analysis, not the "maturation".

8. Line 372. The concept "vividly maturing" is not comprehensible in English. One would never use a synonym of vividly, like "brightly maturing, or distinctly maturing, or intensely maturing". The antonym for vivid would mean "unable to be seen or indistinct". Clearly you can see maturation with a number of approaches, however just describing it by the fact that it can be seen "brightly" or distinctly" is not descriptive. Unless there is a bioinformatics use of the word vividly of which I am unaware, another word should be chosen wherever it is used. One could use the word "actively maturing", however because only one age was chosen, the dynamics of maturation must be assumed based on PN7. I suggest that the term vividly be omitted as it is not a descriptive adverb.

https://doi.org/10.7554/eLife.75742.sa1

Author response

Essential revisions:

1) Want pathway involvement with regard to data presented in Figure 2 must be tested.

To address this interesting request, and investigate whether WNT ligands, secreted by neonatal pituitary organoids mediate, at least partly, the increased proliferative growth of adult pituitary organoids when cultured together in a Matrigel droplet, we tested the following approaches.

First, as suggested by Reviewer 1, we collected conditioned medium (CM) from neonatal pituitary organoids and assessed whether expression of WNT target genes is increased in adult (fully-grown) pituitary organoids when exposed to this CM (Author response image 1A, B). The outcome of this approach was not conclusive: although Lgr5 expression appeared to be upregulated, the other universal WNT target gene Axin2 was not (Author response image 1C). Other target genes (such as Lgr6) were more variable. Although the Reviewer’s suggestion looked straightforward, a literature search did actually not reveal studies with such CM approach to show WNT ligand secretion and activity. Indeed, it is known that WNT ligands are secreted by cells in only minute quantities (Mikels et al., 2006); and are very short-range signals, not traveling far in tissue (Routledge et al., 2019), moreover being hydrophobic and getting associated with the ECM (Mikels et al., 2006). Hence, secreted WNT ligands, while able to affect neighboring cells in the close environment (as in the co-culture situation of neonatal + adult organoids), are expected not to be capable of leaving the Matrigel droplet at reasonable levels, moreover being highly diluted in the medium if a small minority of ligands would eventually be able to enter the CM.

Author response image 1
Download asset Open asset

(A) Schematic overview of the organoid CM experiment. (B) Representative brightfield images of adult AP organoids exposed to CM or not (CTRL). Scale bar, 500 µm. (C) Gene expression analysis for main WNT target genes in adult AP organoids exposed to CM, compared to CTRL, set as 1 (dashed line). Bars represent mean ± SD (n=2).

Therefore, we tested another approach to answer the reviewer’s question, i.e. using the physiological WNT signaling inhibitor Dickkopf 1 (DKK1) (which binds to the WNT co-receptors LRP5/6 thereby blocking WNT ligand action). Adding this inhibitor to neonatal (WT) + adult (tdT+) AP organoid co-cultures resulted in decreased proliferative activity (% Ki67+ cells) in the adult organoids These new findings strongly support that the rise in proliferation in adult pituitary organoids, when cultured together with neonatal pituitary organoids, is mediated, at least partly, by WNT (paracrine) activity. We now included these new data in the Results section (lines 317-322), and added them to Figure 3 —figure supplement 2F.

2) Demonstration of other pituitary defects in IL6 null mice need to be reported.

In answer to this understandable question of Reviewer 1, we would like to clarify that the full examination and phenotyping of IL6 null pituitary (at multiple ages in both homeostatic and perturbed conditions) will be part of a comprehensive, forthcoming publication that we are preparing. In short, in neonatal IL6 null pituitary, no major phenotype regarding stem, progenitor and endocrine cells is observed in homeostatic conditions. To already touch upon this in the current study (without including and revealing all detailed analyses meant to be incorporated in the new paper), we provide extra gene expression data of stem, progenitor and endocrine cell markers in the neonatal IL6 KO versus WT pituitary, showing no differences (see lines 235-237 and new Figure 2 —figure supplement 3B).

3) New folliculo-stellate markers have been characterised in the mouse and should be tested to clarify the identity of MC cluster. what are the MC cells in both the murine and human datasets?

The historically designated folliculo-stellate (FS) cells have eventually been found to represent a heterogeneous cell population in the pituitary, encompassing, among others, paracrine-regulatory, mesenchymal supportive as well as stem cells. Indeed, mapping the newly proposed FS cell markers (as reported by (Ho et al., 2020) and by (Fletcher et al., 2021) (rat pituitary) on our dataset revealed enriched expression in the mesenchymal cell (MC) and stem cell clusters (Author response images 2 and 3) and in pericytes (markers from (Ho et al., 2020); Author response image 2), cells being a general part of the mesenchymal component of tissues. Thus, it is clear (thereby supporting many previous observations) that FS cells do not form a delineated separate cell cluster but that this ‘flag covers multiple cargos’, being distributed over the stem cell and MC clusters. Comparable findings are observed in the human fetal pituitary dataset (Zhang et al., 2020) (Author response images 2 and 3). Other scRNA-seq papers on mouse pituitary did also not identify (designate) a separate FS cell cluster (Cheung et al., 2018; Ruf-Zamojski et al., 2021; Vennekens et al., 2021).

Author response image 2
Download asset Open asset
FS cell markers from (Ho et al., 2020).

These markers are mainly found in the MC population of mouse and human pituitary (and in the pericytes). Col3a1, Itih5 and Col1a1 were also identified and used in (Cheung et al., 2018) and (Vennekens et al., 2021) to annotate the CT cluster (thus, the MC cluster in our paper, see Figure 1 —figure supplement 1B).

Author response image 3
Download asset Open asset
FS cell markers from (Fletcher et al., 2022) (rat pituitary).

These markers are mainly found in the neonatal AP stem cell and progenitor cell populations. As these markers are also present in many other cell clusters (as also apparent in the human fetal pituitary data), they do not seem to be highly specific for FS cells.

Regarding the MC cluster, its annotation is based on the mesenchymal markers published in (Cheung et al., 2018) and in (Vennekens et al., 2021) (in which this cluster was named ‘connective tissue’ (CT) cluster) (see Supplementary Figure 1 —figure supplement 1B). These cells are considered to represent the supportive MC of the gland (both physically and regulatory).

Additional newly defined markers of FS cells include S100a6 (mouse; (Vennekens et al., 2021); shown in Figure 1 —figure supplement 1B), which is expressed in both stem cell clusters and MC of the neonatal AP; and Aldolase-C (Aldoc; rat and mouse; (Fujiwara et al., 2020)) which shows high expression in the stem cell clusters of the mouse neonatal AP (but is expressed throughout the human fetal pituitary cell types) (Author response image 4).

Author response image 4
Download asset Open asset
Aldolase C (Aldoc) expression, mapped on our neonatal mouse AP atlas (left) and the human fetal pituitary atlas (right).

Taken together, we feel that the cluster identification of our dataset has been done in an appropriate manner, concordant with several other pituitary scRNA-seq studies.

4) Data on the mechanisms of regeneration following toxin ablation of GH cells needs to be defined.

In our originally submitted manuscript, we already included two potential mechanisms: (i) proliferation of GH+ and PIT1+ progenitor cells (Figure 4F); and (ii) differentiation of sox2+ stem cells towards new GH+ somatotropes, i.e. increase in GH/SOX2 co-expressing cells (for which we now performed extra experiments to n=4 (new Figure 4G)); and (iii) decreased NOTCH signaling in damaged pituitary stem cells (Figure 4 —figure supplement 2B).

Moreover, we also already mentioned that both WNT and IL-6 signaling are most likely not involved in regeneration of the neonatal AP. Il6 expression is not increased in the stem cells or MC following the local damage (Figure 4 —figure supplement 1D), which is in clear contrast to findings in the adult pituitary (Vennekens et al., PNAS (2021)). Similarly, expression of WNT pathway components, neither the target genes Lgr5 and Axin2 (now added to the heatmap in Figure 4 —figure supplement 1E), did not acutely change after the damage infliction in the AP (Figure 4 —figure supplement 1E). To further examine a possible role of WNT in regeneration, we performed additional RT-qPCR analyses on damaged (regenerating) and control pituitary for the WNT target genes at later timepoints, i.e. one (PD14) and two weeks (PD21) after damage infliction. No upregulation was observed. These new data were included in the Results section (lines 370-373) and figures (Figure 4 —figure supplement 1E).

5) The language of terms used in the Text as pointed out by Rev 2 must be addressed.

We replaced the word ‘vivid/vividly’ with ‘active/dynamic’ (or other appropriate words) at the indicated places, or just deleted it (e.g. in the title and Abstract).

Reviewer #1 (Recommendations for the authors):

The results presented in this manuscript are interesting, however further investigation would greatly improve their significance. Furthermore, I have some precise questions about some of the data.

What is the sex of the animal used in this study? If both sexes were used, was any potential sex difference examined? If only one sex was used, were the main conclusions tested on the other sex?

For the neonatal pituitary experiments, pups were taken (and pooled) irrespective of sex since it is hard to correctly score sex at this very early age (PD7). In preparatory analyses, we did not find substantial differences between male and female PD7 pituitary regarding stem/progenitor and endocrine cells. In particular, the gonadotrope (sex hormone) lineage does not look different between both sexes (number of LHb+ and FSHb+ cells (Author response image 5A) and Lhb and Fshb gene expression level (Author response image 5B)). Moreover, proportion of sox2+ cells and expression of stem/progenitor cell markers is similar (Author response image 5A,B).

Author response image 5
Download asset Open asset
A.

Proportion of indicated cell types in the AP of male and female PD7 mice. B. Expression of indicatedgenes in the AP of male and female PD7 mice. (NB. sex determination by PCR amplification of the Y chromosome specific gene Kdm5d). C. DEG associated GO terms linked with NOTCH signaling enriched in SC1, SC2 and Prolif SC, in separate comparison of damaged male and female AP versus control (corresponding to Figure 4 - figure supplement 2B, in which both sexes are combined for comparison).

We retrospectively observed that, in the scRNA-seq analyses, one damaged pituitary was from male and one from female origin (based on Xist expression in the scRNA-seq analysis). We repeated some of the previous comparisons with control pituitary (such as DEG-associated GO analysis between the stem cell clusters, as presented in Figure 4 —figure supplement 2) for the individual sexes separately and did not find differences compared to our original conclusions (see e.g. for NOTCH in Author response image 5).

For the comparison experiments with adult pituitary (such as organoid analyses), biological replicates were performed with male or female adult mice, and results (which were found comparable irrespective of sex) combined for statistical analysis. We now added a sentence clarifying the sex of the animals used (lines 465-468).

Co-cultures of young organoids with older ones increase proliferative abilities of the latter (Figure 2). The authors suggest that Wnt signalling may be involved but this could be tested using conditioned medium, and potentially manipulating Wnt pathway.

Please see answer above (point 1 of Essential revisions).

Removal of growth factors in the organoid medium does not affect growth of adult organoids but improve number of neonatal ones. Are these factors superfluous for adult organoids? The data clearly shows that they actively inhibit neonatal cells. I think the significance of these observations should be further explored and discussed. Is there any evidence that these pathways are active, or regulators expressed in the young but not the old stem cells?

We thank the reviewer for this interesting suggestion to look closer into these pathways in neonatal and adult stem cells.

For the reviewer’s information, removal of (many of) these growth factors does negatively affect growth of adult organoids as shown in our previous paper in which the organoid model was established (Cox et al., 2019). In our current study, we found that several of these growth factors are not needed (rather impedimental) for neonatal pituitary organoid growth. To address the suggestion of the reviewer, we analyzed whether corresponding factors/regulators are indeed higher expressed in neonatal than adult stem cells (which thus may explain why they are not needed for neonatal organoid growth). Indeed, among others, Fgf10 and Igf1, together with their receptors Fgfr2 and Igf1r, as well as noggin (Nog), are found higher expressed in the neonatal than adult stem cells, as extracted from the scRNA-seq data. Moreover, these expression differences remain present when the stem cells are grown as organoids. These new data are now mentioned in the text (lines 176-181) and included as new figure (Figure 2 —figure supplement 1B).

Supplementation of Il6 null organoids with LIF or IL-11 appears to rescue organoid formation. Do they also improve self-renewal (passage number)?

To address this interesting question, we performed new experiments and found that addition of LIF and IL-11 indeed prolongs the expandability of the IL-6-/- AP organoids. At the end of this revision period, they were still in culture (thus, passageable beyond P4) while not in the other conditions tested (including RSpECT), in which the IL-6-/- AP organoids are lost in earlier passages. We included these new findings in the text (lines 246-250) and in Figure 2 —figure supplement 3E.

Is there a dual role of the JAK-STAT pathway on organoid formation efficiency and self-renewal/passageability? I found the interpretation of these data (line 233-245) difficult to follow. A clear distinction between organoid formation efficiency and passage number could be made to clarify the conclusions of the authors.

To answer this question, we performed new experiments in which the STAT3 inhibitor STATTIC was added at passaging (P0-P1), and found that organoids did not regrow, thereby supporting a role for JAK/STAT signaling in both organoid initial development (as already described in the original manuscript) and passaging (as added now to Figure 2 —figure supplement 3G). We also specified this better in the text (lines 250-252).

I understand that pituitary stem cell proliferation is normal in IL6 null glands. Did the authors examine for the presence of further pituitary defects?

Please see answer above (point 2 of Essential revisions).

The authors identify the MC cluster as folliculo-stellate cells. These were previously shown to express SOX2. Here this is clearly not the case (Figure 1B). In addition, in their human single-cell study (Zhang et al., 2020), the authors state that folliculo-stellate cells are not present. Therefore, the identity of the MC cluster in the re-analysis of their dataset (Figure 3G), that I could not find in the original study, is unclear to me. I would have expected the cluster identification to be conserved, so more detail is needed here such as the method used for the identification of the different clusters.

For the definition/description of folliculo-stellate (FS) cells and their relation to MC (and other cell types including stem cells), please see already our answer above (point 3 of Essential revisions). In particular, FS cells represent a heterogeneous cell population encompassing, among others, supportive cells (MC) and stem cells. In other words, the MC population is a part of the heterogeneous FS cell population, as also the stem cell population is. Hence, SOX2, indeed previously reported to be expressed by the (heterogeneous) FS cell population, is expressed in its stem cell part, whereas the MC part expresses mesenchymal (but not stem cell) markers. In our manuscript, we do not ‘identify the MC cluster as FS cells’, but mention that the MC cluster is a part of the formerly designated FS population (lines 280-283). Of note, the term FS cells is used in literature in ambiguous ways: (Ho et al., 2020) designate an FS cell cluster not containing stem cells (thus, no co-expression of Sox2 and ‘FS cell’ markers), whereas (Fletcher et al., 2021) report clear co-expression, all together pointing to a certain level of ambiguity in the definition and marker profile of FS cells (or, ‘what’s in a name?’). By the way, also (Zhang et al., 2020) report the FS cell marker S100B in some of the stem cells, not different from the S100B-negative stem cells regarding DEGs.

Regarding the MC cluster in the human scRNA-seq dataset of (Zhang et al., 2020), in supplementary figure 1D of the publication which shows the entire UMAP of all >4,000 sequenced cells, the MC cluster is indicated. However, in the main text, the authors state that ‘nine clusters of anterior pituitary endocrine cells including the stem cells (Stem), cycling cells (CC), corticotropes, progenitors of the PIT-1 lineage (Pro.PIT1), somatotropes, lactotropes, thyrotropes, precursors of gonadotropes (Pre.Gonado) and gonadotropes, comprising 2,388 cells’ were used for further analysis, causing the fact that the MC cluster is not visible in the main figures (as the reviewer noticed). However, here in our present analyses, we used and analyzed the entire dataset of (Zhang et al., 2020), therefore also revealing the MC cluster.

New folliculo-stellate markers have been characterised in the mouse and should be tested here to clarify this issue: what are the MC cells in both the murine and human datasets? This deserves further investigation because of the potential Wnt-mediated crosstalk with stem cells suggested, but not substantiated, in the present study.

Please see answer above (point 3 of Essential revisions). The potential crosstalk, as inferred from CellPhoneDB analysis (Figure 3D), will in follow-up studies indeed be comprehensively examined, thereby needing extensive genetic mouse and (composite) organoid models.

Following DT mediated GH-cell ablation, regeneration is observed. Because this system is Cre-mediated, it is difficult to perform lineage tracing and identify the cells generating the new somatotrophs. However, mechanisms leading to this regeneration are not further investigated. A potential role for Wnt signalling, in the context of earlier results, could have been examined?

Please see answer above (point 4 of Essential revisions).

Davis et al., 2016 should be replaced by Perez-Millan et al., (line 153).

We thank the reviewer for this attentive remark, and replaced the reference Davis et al., 2016 with ‘PROP1 triggers epithelial-mesenchymal transition-like process in pituitary stem cells. Perez-Milan, et al., eLife (2016).’

Reviewer #2 (Recommendations for the authors):

1. My concerns focus mainly on the grammar and context. The science is outstanding. The availability of data is outstanding.

We thank the reviewer for the positive appraisal of our work.

2. Line 40 and Title. I am not certain the word vividly is used in the right context. The English meaning of vividly is brightly or intensely, clear, distinct, powerful, detailed, strongly, perceptibly, sharply, graphically. None of those synonyms would be appropriate as a way to describe neonatal development. Graphically is the only synonym that might be appropriate and indeed might be more appropriate than vividly. I am looking for another meaning that might fit with a bioinformatics type analysis and don't find one. There is no question that this is neonatal development, so why add an adverb that means "brightly, intensely, powerful, strongly, distinctly, sharply, perceptibly….etc. If you mean graphically, then that should be used, but even that doesn't describe "maturation".

We used the word ‘vivid/vividly’ to indicate the actively (‘powerfully’, ‘intensely’) maturing state of the pituitary at this neonatal age. However, we understand the reviewer’s concern and that ‘vivid’ may not be the most appropriate word. Therefore, we removed it (e.g. in title and Abstract) or replaced it throughout the manuscript with ‘active/dynamic’ (or other appropriate words) at the indicated places.

3. Lines 83-100 and Figure 1. It appears that the posterior lobe was removed before cell dispersion. If so, that would have removed the intermediate lobe. However, melanotropes are still present from both groups, so it is not surprising that the PL cells are still there as well. Was the PL removed?

Please see answer above (point 4).

4. Line 131. The use of the word vivid is correct in this line as it points to powerful, distinct, detailed, etc. based on the findings.

In analogy with the replacement of ‘vivid’ at other places, we also changed the word here.

5. Line 143. It is unclear what is meant by "In line"

‘In line’ was used as ‘in accordance’. We changed this now (line 110, 146 and 378).

6. Figure 1, bottom. Which is the neonatal pituitary and which is the adult pituitary in these immunolabeled fields.

The designation of ‘neonatal’ and ‘adult’ was shown above the heatmaps of this figure. However, since not clear, we repeat the terms now above the immunofluorescence images.

7. Line 327. The English use of the word vivid is not appropriate in this context. What is meant by "vivid neonatal" pituitary. Of course one can see it clearly and it is developing, however vivid or even graphic is inappropriate here. It is simply a developing pituitary. Vivid only refers to the fact that you can perceive or see it intensely. Just discuss it as "developing" neonatal pituitary. Your analysis was robust and intense and comprehensive, however that describes the analysis, not the "maturation".

We understand the reviewer’s concern and agree that ‘vivid’ may not be the most appropriate word (although it sounded so when translated to our native language). Therefore, we removed it (e.g. in title and Abstract) or replaced it throughout the manuscript with ‘active/dynamic’ (or other appropriate words) at the indicated places.

8. Line 372. The concept "vividly maturing" is not comprehensible in English. One would never use a synonym of vividly, like "brightly maturing, or distinctly maturing, or intensely maturing". The antonym for vivid would mean "unable to be seen or indistinct". Clearly you can see maturation with a number of approaches, however just describing it by the fact that it can be seen "brightly" or distinctly" is not descriptive. Unless there is a bioinformatics use of the word vividly of which I am unaware, another word should be chosen wherever it is used. One could use the word "actively maturing", however because only one age was chosen, the dynamics of maturation must be assumed based on PN7. I suggest that the term vividly be omitted as it is not a descriptive adverb.

When using the word ‘vivid’, we meant ‘dynamic’ or ‘active’. We now changed it accordingly.

References

Cheung, L. Y. M., George, A. S., McGee, S. R., Daly, A. Z., Brinkmeier, M. L., Ellsworth, B. S., and Camper, S. A. (2018). Single-cell RNA sequencing reveals novel markers of male pituitary stem cells and hormone-producing cell types. Endocrinology, 159(12), 3910–3924. doi: 10.1210/en.2018-00750

Cox, B., Laporte, E., Vennekens, A., Kobayashi, H., Nys, C., Van Zundert, I., Uji-i, H., Vercauteren Drubbel, A., Beck, B., Roose, H., Boretto, M., and Vankelecom, H. (2019). Organoids from pituitary as novel research model to study pituitary stem cell biology. Journal of Endocrinology, 240(2), 287–308. doi: 10.1530/JOE-18-0462

Fletcher, P. A., Prévide, R. M., Smiljanic, K., Sherman, A., Coon, S. L., and Stojilkovic, S. S. (2021). Transcriptomic heterogeneity of Sox2-expressing pituitary cells. BioRxiv, 2021.12.10.472137. doi: 10.1101/2021.12.10.472137

Fujiwara, K., Tsukada, T., Horiguchi, K., Fujiwara, Y., Takemoto, K., Nio-Kobayashi, J., Ohno, N., and Inoue, K. (2020). Aldolase C is a novel molecular marker for folliculo-stellate cells in rodent pituitary. Cell and Tissue Research, 381(2), 273–284. doi: 10.1007/S00441-020-03200-1

Gremeaux, L., Fu, Q., Chen, J., and Vankelecom, H. (2012). Activated phenotype of the pituitary stem/progenitor cell compartment during the early-postnatal maturation phase of the gland. Stem Cells and Development, 21(5), 801–813. doi: 10.1089/scd.2011.0496

Hemeryck, L., Hermans, F., Chappell, J., Kobayashi, H., Lambrechts, D., Lambrichts, I., Bronckaers, A., and Vankelecom, H. (2022). Organoids from human tooth showing epithelial stemness phenotype and differentiation potential. Cellular and Molecular Life Sciences : CMLS, 79(3), 153. doi: 10.1007/S00018-022-04183-8

Ho, Y., Hu, P., Peel, M. T., Chen, S., Camara, P. G., Epstein, D. J., Wu, H., and Liebhaber, S. A. (2020). Single-cell transcriptomic analysis of adult mouse pituitary reveals sexual dimorphism and physiologic demand-induced cellular plasticity. Protein and Cell, 1–19. doi: 10.1007/s13238-020-00705-x

Mikels, A. J., and Nusse, R. (2006). Wnts as ligands: processing, secretion and reception. Oncogene 2006 25:57, 25(57), 7461–7468. doi: 10.1038/sj.onc.1210053

Routledge, D., and Scholpp, S. (2019). Mechanisms of intercellular wnt transport. Development (Cambridge), 146(10). doi: 10.1242/dev.176073

Ruf-Zamojski, F., Zhang, Z., Zamojski, M., Smith, G. R., Mendelev, N., Liu, H., Nudelman, G., Moriwaki, M., Pincas, H., Castanon, R. G., Nair, V. D., Seenarine, N., Amper, M. A. S., Zhou, X., Ongaro, L., Toufaily, C., Schang, G., Nery, J. R., Bartlett, A., … Sealfon, S. C. (2021). Single nucleus multi-omics regulatory landscape of the murine pituitary. Nature Communications, 12(1), 2677. doi: 10.1038/s41467-021-22859-w

Russell, J. P., Lim, X., Santambrogio, A., Yianni, V., Kemkem, Y., Wang, B., Fish, M., Haston, S., Grabek, A., Hallang, S., Lodge, E. J., Patist, A. L., Schedl, A., Mollard, P., Nusse, R., and Andoniadou, C. L. (2021). Pituitary stem cells produce paracrine WNT signals to control the expansion of their descendant progenitor cells. eLife, 10(1), e59142. doi: 10.7554/eLife.59142

Vennekens, A., Laporte, E., Hermans, F., Cox, B., Modave, E., Janiszewski, A., Nys, C., Kobayashi, H., Malengier-Devlies, B., Chappell, J., Matthys, P., Garcia, M. I., Pasque, V., Lambrechts, D., and Vankelecom, H. (2021). Interleukin-6 is an activator of pituitary stem cells upon local damage, a competence quenched in the aging gland. Proceedings of the National Academy of Sciences of the United States of America, 118(25), e2100052118. doi: 10.1073/pnas.2100052118

Zhang, S., Cui, Y., Ma, X., Yong, J., Yan, L., Yang, M., Ren, J., Tang, F., Wen, L., and Qiao, J. (2020). Single-cell transcriptomics identifies divergent developmental lineage trajectories during human pituitary development. Nature Communications, 11(1), 5275. doi: 10.1038/s41467-020-19012-4

https://doi.org/10.7554/eLife.75742.sa2

Article and author information

Author details

  1. Emma Laporte

    Laboratory of Tissue Plasticity in Health and Disease, Cluster of Stem Cell and Developmental Biology, Department of Development and Regeneration, KU Leuven, Leuven, Belgium
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0799-3116

  2. Florian Hermans

    1. Laboratory of Tissue Plasticity in Health and Disease, Cluster of Stem Cell and Developmental Biology, Department of Development and Regeneration, KU Leuven, Leuven, Belgium
    2. Laboratory of Morphology, Biomedical Research Institute, Hasselt University, Diepenbeek, Belgium
    Contribution
    Data curation, Formal analysis, Investigation, Methodology, Software
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2321-3995

  3. Silke De Vriendt

    Laboratory of Tissue Plasticity in Health and Disease, Cluster of Stem Cell and Developmental Biology, Department of Development and Regeneration, KU Leuven, Leuven, Belgium
    Contribution
    Formal analysis, Investigation, Methodology, Validation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4022-2869

  4. Annelies Vennekens

    Laboratory of Tissue Plasticity in Health and Disease, Cluster of Stem Cell and Developmental Biology, Department of Development and Regeneration, KU Leuven, Leuven, Belgium
    Contribution
    Investigation, Validation
    Competing interests
    No competing interests declared

  5. Diether Lambrechts

    1. Center for Cancer Biology, VIB, Leuven, Belgium
    2. Laboratory for Translational Genetics, Department of Human Genetics, KU Leuven, Leuven, Belgium
    Contribution
    Data curation, Formal analysis, Investigation, Methodology, Resources, Software, Validation
    Competing interests
    No competing interests declared

  6. Charlotte Nys

    Laboratory of Tissue Plasticity in Health and Disease, Cluster of Stem Cell and Developmental Biology, Department of Development and Regeneration, KU Leuven, Leuven, Belgium
    Contribution
    Investigation
    Competing interests
    No competing interests declared

  7. Benoit Cox

    Laboratory of Tissue Plasticity in Health and Disease, Cluster of Stem Cell and Developmental Biology, Department of Development and Regeneration, KU Leuven, Leuven, Belgium
    Contribution
    Conceptualization, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3139-268X

  8. Hugo Vankelecom

    Laboratory of Tissue Plasticity in Health and Disease, Cluster of Stem Cell and Developmental Biology, Department of Development and Regeneration, KU Leuven, Leuven, Belgium
    Contribution
    Conceptualization, Funding acquisition, Methodology, Project administration, Resources, Supervision, Writing - original draft, Writing - review and editing
    For correspondence
    hugo.vankelecom@kuleuven.be
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2251-7284

Funding

Fonds Wetenschappelijk Onderzoek (11A3320N)

  • Emma Laporte

Fonds Wetenschappelijk Onderzoek (1141717N)

  • Annelies Vennekens

Fonds Wetenschappelijk Onderzoek (1S14218N)

  • Charlotte Nys

Fonds Wetenschappelijk Onderzoek (11W9215N)

  • Benoit Cox

KU Leuven

  • Hugo Vankelecom

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Y Van Goethem and V Vanslembrouck for valuable technical help. We are also grateful to the Imaging Core (VIB, KU Leuven) and the CIC (KU Leuven) for use of microscopes and the Center for Brain & Disease Research (CBD) Histology unit (VIB, KU Leuven) for use of histology equipment. We are indebted to Dr Pura Muñoz-Cánoves (Universitat Pompeu Fabra, Barcelona, Spain) for generously providing the Il6−/− mice. We thank Thomas Van Brussel, Rogier Schepers, and Bram Boeckx (D L’s group, KU Leuven) for technical and bioinformatical support in scRNA-seq experiments. The computational resources used for scRNA-seq analysis were provided by the ‘Vlaams Supercomputer Centrum’, managed by the Fund for Scientific Research (FWO)—Flanders. We also thank the FACS core (KU Leuven) for training and use of the MESO QuickPlex SQ 120 reader. Finally, we recognize the Laboratory of Virology and Chemotherapy (Rega Institute; Dr D Daelemans) for experimental help and use of the IncuCyte S3. Funding: This work was supported by grants from the KU Leuven Research Fund and from the Fund for Scientific Research (FWO)—Flanders. E L (11A3320N), A V (1141717 N), C N (1S14218N), and B C (11W9215N) are supported by a PhD Fellowship from the FWO/FWO-SB. Use of the Zeiss LSM 780 – SP Mai Tai HP DS is supported by Hercules AKUL/11/37 and FWO G.0929.15 funding to Dr P Vanden Berghe (CIC, KU Leuven). The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Ethics

Mice with C57BL/6 background were used for the experiments, which were approved by the KU Leuven Ethical Committee for Animal Experimentation (P153/2018).

Senior Editor

  1. Edward E Morrisey, University of Pennsylvania, United States

Reviewing Editor

  1. T Rajendra Kumar, University of Colorado, United States

Reviewer

  1. Gwen Childs

Publication history

  1. Received: November 22, 2021
  2. Preprint posted: January 20, 2022 (view preprint)
  3. Accepted: June 13, 2022
  4. Accepted Manuscript published: June 14, 2022 (version 1)
  5. Version of Record published: July 27, 2022 (version 2)

Copyright

© 2022, Laporte et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 873
    Page views
  • 250
    Downloads
  • 4
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Emma Laporte
  2. Florian Hermans
  3. Silke De Vriendt
  4. Annelies Vennekens
  5. Diether Lambrechts
  6. Charlotte Nys
  7. Benoit Cox
  8. Hugo Vankelecom
(2022)
Decoding the activated stem cell phenotype of the neonatally maturing pituitary
eLife 11:e75742.
https://doi.org/10.7554/eLife.75742

Categories and tags

Research organism

Further reading

    1. Developmental Biology

    Npr3 regulates neural crest and cranial placode progenitors formation through its dual function as clearance and signaling receptor

    Arun Devotta, Hugo Juraver-Geslin ... Jean-Pierre Saint-Jeannet
    Research Article Updated

    Natriuretic peptide signaling has been implicated in a broad range of physiological processes, regulating blood volume and pressure, ventricular hypertrophy, fat metabolism, and long bone growth. Here, we describe a completely novel role for natriuretic peptide signaling in the control of neural crest (NC) and cranial placode (CP) progenitors formation. Among the components of this signaling pathway, we show that natriuretic peptide receptor 3 (Npr3) plays a pivotal role by differentially regulating two developmental programs through its dual function as clearance and signaling receptor. Using a combination of MO-based knockdowns, pharmacological inhibitors and rescue assays we demonstrate that Npr3 cooperate with guanylate cyclase natriuretic peptide receptor 1 (Npr1) and natriuretic peptides (Nppa/Nppc) to regulate NC and CP formation, pointing at a broad requirement of this signaling pathway in early embryogenesis. We propose that Npr3 acts as a clearance receptor to regulate local concentrations of natriuretic peptides for optimal cGMP production through Npr1 activation, and as a signaling receptor to control cAMP levels through inhibition of adenylyl cyclase. The intracellular modulation of these second messengers therefore participates in the segregation of NC and CP cell populations.

    1. Developmental Biology
    2. Evolutionary Biology

    Mutation of vsx genes in zebrafish highlights the robustness of the retinal specification network

    Joaquín Letelier, Lorena Buono ... Juan R Martínez-Morales
    Research Article

    Genetic studies in human and mice have established a dual role for Vsx genes in retina development: an early function in progenitors’ specification, and a later requirement for bipolar-cells fate determination. Despite their conserved expression patterns, it is currently unclear to which extent Vsx functions are also conserved across vertebrates, as mutant models are available only in mammals. To gain insight into vsx function in teleosts, we have generated vsx1 and vsx2 CRISPR/Cas9 double knockouts (vsxKO) in zebrafish. Our electrophysiological and histological analyses indicate severe visual impairment and bipolar cells depletion in vsxKO larvae, with retinal precursors being rerouted toward photoreceptor or Müller glia fates. Surprisingly, neural retina is properly specified and maintained in mutant embryos, which do not display microphthalmia. We show that although important cis-regulatory remodelling occurs in vsxKO retinas during early specification, this has little impact at a transcriptomic level. Our observations point to genetic redundancy as an important mechanism sustaining the integrity of the retinal specification network, and to Vsx genes regulatory weight varying substantially among vertebrate species.

    1. Developmental Biology

    Development: The hidden depths of zebrafish skin

    Yue Rong Tan, Megan Liaw, Chen-Hui Chen
    Insight

    Single-cell transcriptome analysis of zebrafish cells clarifies the signalling pathways controlling skin formation and reveals that some cells produce proteins required for human teeth to acquire their enamel.