A specific role for importin-5 and NASP in the import and nuclear hand-off of monomeric H3
- Division of Biomedical Sciences, Warwick Medical School, University of Warwick, United Kingdom
Figures
Figure 1 with 1 supplement
H3 and H4 dimerisation mutants translocate to the nucleus but do not incorporate into chromatin.
(A) Positions of fold-disruptor (FD) substitutions (asterisks) and helix-breaker (HB) insertions (brackets). (B) Positions of the FD mutations superimposed on the H3-H4 heterodimer (PDB: 2HUE). …
Figure 1—figure supplement 1
Calibration for precise input quantification.
(A) Residual fluorescence activity of GFP constructs on a semi-denaturing gel before staining (left) and after Coomassie staining (right). (B) Area under the curve (AUC) analysis of residual GFP …
Figure 2
Proteomic analysis of wild-type (WT) and monomeric histone mutants.
(A–D) Mutant versus WT scatter plots of normalised total precursor intensity from H3 vs. HB (A), H3 vs. FD (B), H4 vs. HB (C), and H4 vs. FD (D). Average of three experiments. By plotting mutants …
-
Figure 2—source data 1
Processed mass spectrometry data for CoIP of H3-eGFP WT and mutants ‘helix breaker’ (H3 HB) and ‘fold-disruptor’ (H3 FD).
Limma linear model coefficients of normalised total precursor intensity used in Figure 2A, B and E.
- https://cdn.elifesciences.org/articles/81755/elife-81755-fig2-data1-v2.xlsx
-
Figure 2—source data 2
Processed mass spectrometry data for CoIP of H4-eGFP WT and mutants ‘helix breaker’ (H4 HB) and ‘fold-disruptor’ (H4 FD).
Limma linear model coefficients of normalised total precursor intensity used in Figure 2C, D and F.
- https://cdn.elifesciences.org/articles/81755/elife-81755-fig2-data2-v2.xlsx
Figure 3 with 3 supplements
NASP associates with an H3 monomer and H3-H4 dimers in discrete, multi-chaperone complexes.
(A) CRISPR knock-in tagging scheme. Endogenous NASP was tagged on exon 1 with eGFP-TEVcs and ASF1B with SpotTag-mCherry-3Ccs. (B) Histone chaperone immunoprecipitations separated by 15% SDS-PAGE and …
-
Figure 3—source data 1
Processed mass spectrometry data for eGFP-sNASP CoIP native gel bands.
Total precursor intensity used in Figure 3G.
- https://cdn.elifesciences.org/articles/81755/elife-81755-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Comparision of wild type NASP with transiently expressed eGFP-sNASP and quantification of H3-H4 staining.
(A) Representative Western blot of HEK293-F cells transiently transfected as used for GFP-trap eGFP-sNASP Co-IPs (including glycerol gradient and 2D sub-complexes separations). (B) Serial dilutions …
Figure 3—figure supplement 2
Validation of eGFP-TEVcs-NASP and mCherry-3C-ASF1b knock-in cell lines.
(A) CRISPR knock-in tagging scheme. Endogenous NASP was tagged on exon 1 with eGFP-TEVcs and ASF1B with SpotTag-mCherry-3Ccs. (B) Experimental design for HeLa CRISPR Knock-in clonal cell line …
Figure 3—figure supplement 3
Related to Figure 3E and G.
(A) Native gel (1D) and SDS-PAGE (2D) for three independent experiments (performed with different batches of cell transfected on different days, processed subsequently 36 hr after transfection). (B) …
Figure 4 with 1 supplement
H3 binding by Imp5 and sNASP is mutually exclusive and relies on RanGTP for histone transfer.
(A) Imp5-H3 reconstituted complex was purified by size-exclusion chromatography (SEC) and incubated on ice (control) for 3 hr before separating through ultracentrifugation on a 5–40% glycerol …
Figure 4—figure supplement 1
Related to Figure 4.
(A) Experimental design for Imp5 purification and complex reconstitution (H3, H4, and H3–H4). SEC280 trace (on Superdex Increase 200), peak volumes (mL), and Coomassie-stained gels. (B) …
Figure 5 with 1 supplement
Imp5 is the predominant importin bound to nascent H3 in the cytoplasm, with histone chaperones binding only after nuclear import.
(A) In the Mito-2-Hybrid assay, cytoplasmic interactions are detected by tethering of a bait protein (H3) to the outer mitochondrial membrane (OMM) via an OMP25 tail-anchoring peptide. Recruitment …
-
Figure 5—source data 1
mCherry (control), mCherry-Imp4, and mCherry-Imp5 versus H3-eGFP-OMP25 Pearson’s correlation coefficients used in Figure 5C.
- https://cdn.elifesciences.org/articles/81755/elife-81755-fig5-data1-v2.csv
-
Figure 5—source data 2
eGFP-Imp5 and H3-mCherry-RAPID-release Pearson’s correlation coefficients used in Figure 5E.
- https://cdn.elifesciences.org/articles/81755/elife-81755-fig5-data2-v2.csv
-
Figure 5—source data 3
H3.1-eGFP-RAPID-release and H3.1-APEX2-eGFP-RAPID-release nuclear localisation used in Figure 5F.
- https://cdn.elifesciences.org/articles/81755/elife-81755-fig5-data3-v2.csv
-
Figure 5—source data 4
Processed mass spectrometry data for APEX2-OMP25 control.
- https://cdn.elifesciences.org/articles/81755/elife-81755-fig5-data4-v2.xlsx
-
Figure 5—source data 5
Processed mass spectrometry data for H3.1-APEX2 at 0 and 120 min after addition of rapamycin.
Total precursor intensity and p-value used in Figure 5G and H.
- https://cdn.elifesciences.org/articles/81755/elife-81755-fig5-data5-v2.xlsx
Figure 5—figure supplement 1
Validation of the FRT-H3-APEX2-eGFP-RR cell line.
(A) Fluorescence-activated cell sorting (FACS) data for FRT-H3-APEX2-EGFP-RR cells induced with doxycycline for 12 hr compared to non-induced cells (faded) in blue laser histogram (bottom-right …
Figure 6 with 1 supplement
NASP binds rapidly to newly imported H3.
(A) Experimental design combining a histone pulse with co-immunoprecipitation. Addition of rapamycin recruits an otherwise autoinhibited TVMV protease which cleaves the tethered histone fusion, …
Figure 6—figure supplement 1
Kinetics of H3 RAPID-release and co-localistation analysis with Imp5.
(A) Confocal microscopy time course after the addition of rapamycin (RAPID release H3-mCherry-RR) in cells transiently expressing eGFP-Imp5. Scale bar = 10 μm. (B) Pearson’s correlation coefficient …
Figure 7
Model for nuclear translocation of histones H3 and H4 as monomers and processing in the nucleus Imp5 imports histone H3 and H4 as monomers whilst Imp4 has a preference for dimers, albeit with some redundancy.
Upon nuclear translocation, RanGTP induces cargo dissociation with H3 being transferred to sNASP and H4 to the HAT1 complex. These chaperones may have a holdase function that buffers imbalances in …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Bacterial cells DH5-alpha (Escherichia coli) | DH5-alpha | Thermo | EC0112 | Chemically competent cells |
| Bacterial cells BL21 (DE3) (Escherichia coli) | BL21(DE3) | Thermo | EC0114 | Chemically competent cells |
| HeLa Kyoto cell line (Homo-sapiens) | Cancer cell line | Originally sourced from CRUK Cell Services | RRID:CVCL_1922 | |
| HeLa FRT cell line (Homo-sapiens) | T-REx-HeLa Cell Line | Invitrogen | R71407 RRID: CVCL_D587 | |
| HEK293-F cells | FreeStyle 293 F Cells | Invitrogen | R79007 RRID: CVCL_D603 | |
| Plasmid for transfected construct (human) | H3.1-EGFP | Backbone plasmid: pEGFP-N1 | Apta-Smith et al., 2018 | transfected construct (human) |
| Plasmid for transfected construct (human) | H3.1 (A95_ GGG)-EGFP | Backbone plasmid: pEGFP-N1 | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | H3.1 (FLY >AAA)-EGFP | Backbone plasmid: pEGFP-N1 | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | H4-EGFP | Backbone plasmid: pEGFP-N1 | Apta-Smith et al., 2018 | transfected construct (human) |
| Plasmid for transfected construct (human) | H4 (V65GGG)-EGFP | Backbone plasmid: pEGFP-N1 | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | H4 (FLI >AAA)-EGFP | Backbone plasmid: pEGFP-N1 | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | H3.2-mCherry- 2xTVMVcs-FRB- OMP5–IRES– FKBP-TVMV-AI | pEGFP-C1 | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | EGFP-Imp5 | pEGFP-C1 | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | EGFP-TEV-sNASP | pIRESpuro2 | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | H3.1-Flag-APEX2-EGFP-2xTVMVcs-FRB-OMP25-IRES-FKBP-TVMV-AI | pcDNA5/FRT/TO | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | pNASP-EGFP-TEV_HDR-donor | pBlueScript II KS (+) | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | pX461-NASP- sgRNA2-down | pX461-PSPCas9N(BB)–2A-GFP | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | pX461-NASP- sgRNA2-up | pX461-PSPCas9N(BB)–2A-GFP | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | pASF1b-Spot-mCherry-3C_HDR-donor | pBlueScript II KS (+) | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | pX461-ASF1B- sgRNA2-down | pX461-PSPCas9N(BB)–2A-GFP | This study | transfected construct (human) |
| Plasmid for transfected construct (human) | pX461-ASF1B- sgRNA2-up | pX461-PSPCas9N(BB)–2A-GFP | This study | transfected construct (human) |
| Plasmid for transformation (human) | pGST-HRV 3Ccs-Imp5 iso1 | pGEX-6P1 | This study | Bacterial expression construct (human) |
| Plasmid for transformation (human) | pHis-TEVcs-Ran | pETMCN6His | This study | Bacterial expression construct (human) |
| antibody | Anti-ASF1A (C6E10), Rabbit monoclonal | Cell Signaling Technology | C6E10 | WB (1:1000) |
| antibody | Anti-ASF1B, Rabbit monoclonal | Cell Signaling Technology | C70E2 | WB (1:1000) |
| antibody | Anti-HAT1, Rabbit monoclonal | Abcam | ab194296 | WB (1:1000) |
| antibody | Anti-Histone H3, Rabbit polyclonal, IgG | Cell Signaling Technology | #9715 | WB (1:1000) |
| antibody | Anti-Histone H4, Rabbit polyclonal | Abcam | ab7311 | WB (1:500) |
| antibody | Anti-Histone H4 k12Ac, Rabbit polyclonal | Millipore (Merck) | #07–595 | WB (1:1000) |
| antibody | Anti-Histone H4 k5Ac, Rabbit polyclonal | Millipore (Merck) | #07–327 | WB (1:2000-1:5000) |
| antibody | Anti-Importin4, Rabbit monoclonal [EPR13660-27] | Abcam | ab181037 | WB (1:10000) |
| antibody | Anti-Karyopherin beta 3 (IPO5), Mouse polyclonal | Abcam | ab88695 | WB (1:500) |
| antibody | Anti-NASP, rabbit polyclonal | Home-made | NA | WB (1:20000) |
| antibody | Anti-mCherry, Rabbit polyclonal | Abcam | ab167453 | WB (1:5000) |
| antibody | Anti-RbAp46/48, Rabbit - monoclonal (IgG) | Cell Signaling Technology | (D4F8) #9067 | WB (1:1000) |
| antibody | Anti-UBR7, Rabbit polyclonal | Abcam | ab241371 | WB (1:1000) |
| antibody | GFP (B-2) HRP, Mouse - monoclonal (clone B-2), IgG2a | Santa Cruz | sc-9996 HRP | WB (1:1000 to 1:5000) |
| antibody | Goat Anti-Mouse HRP, Goat polyclonal, IgG | Abcam | ab205719 | WB (1:5000) |
| antibody | Anti-Rabbit, HRP- linked antibody, Goat polyclonal, IgG | Cell Signaling Technology | 7074 S | WB (1:10000 to 1:20000) |
| antibody | Goat Anti-Rabbit Alexa 568, Goat polyclonal, IgG | Abcam | ab175471 | WB (1:1000) |
| sequence- based reagent | XhoI_IPO5_F | This paper | PCR primers | aaaaaaCTCGAGcaA TGGCGGCGGCCGC |
| sequence- based reagent | KpnI_IPO5_R | This paper | PCR primers | GGTGGTggtaccTCAC GCAGAGTTCAGGAGCTC |
| sequence- based reagent | IPO5_pGEX_F | This paper | PCR primers | ctgttccaggggcccctggg atccGCAATGGC GGCGGCtGCG |
| sequence- based reagent | IPO5_pGEX_R | This paper | PCR primers | gtcagtcagtcacgatgcggccgc TCACGCAGA GTTCAGGAGC |
| sequence- based reagent | Kozak5p_F | This paper | PCR primers | TGAACCGTCAG ATCCGCTAGC |
| sequence- based reagent | OMP25_IRES_R | This paper | PCR primers | CGGTAGCGCTAC AGCTGTTTGCGATAGCG |
| sequence- based reagent | OMP25_IRES_F | This paper | PCR primers | TCGCAAACAGCTG TAGCGCTACCGGACTCAG |
| sequence- based reagent | IRES_FKBP_R | This paper | PCR primers | TCCACCTGCACCAT GGTTGTGGCCATAT |
| sequence- based reagent | FKBP_IRES_F | This paper | PCR primers | ATGGCCACAACCA TGGTGCAGGTGGAAACC |
| sequence- based reagent | FKBP_FRT_R | This paper | PCR primers | TGTGGGAGGTTTC TAGCTGCCCGGCGC |
| sequence- based reagent | FRT_AI_F | This paper | PCR primers | CCGGGCAGCTAGA AACCTCCCAC ACCTCCCCCT |
| sequence- based reagent | Kozak_H3.1_R | This paper | PCR primers | GATCTGACGG TTCACTAAAC |
| sequence- based reagent | APEX2_gBLOCK | Alice Ting lab, Lam et al., 2015 | G block (double strand DNA fragment) | Sequence taken from Addgene pcDNA3 APEX2-NES (#49386) |
| sequence- based reagent | NASP_HDR_ upstream_F | This paper | PCR primers | AGCTACTCGCCCT GAACATGCA GAGCAGCACTG |
| sequence- based reagent | NASP_HDR_ upstream_R | This paper | PCR primers | CGTTCCCCTGAGG TGGCGAACCAGCGAACG |
| sequence- based reagent | GFPforNASP_HDR_F | This paper | PCR primers | TTCGCCACCTCAG GGGAACGATGGT GAGCAAGGGCGAGGA |
| sequence- based reagent | GFPforNASP_HDR_R | This paper | PCR primers | GCTGTGGACTCCAT GGCCATATGGCCC TGGAAGTAAAGGT |
| sequence-based reagent | NASP_HDR_downstream_F | This paper | PCR primers | ATGGCCATGGAGT CCACAGCCACTGCCGC |
| sequence-based reagent | NASP_HDR_downstream_R | This paper | PCR primers | TTATATTCCCGGGT TATCCAGGGGTTC TACCAGAGGCACACG |
| sequence-based reagent | NASP_pair1_upstream_F | This paper | DNA oligomer for dsDNA (guide RNA) | CACCGCCATGG CCATCGTTCCCCTG |
| sequence-based reagent | NASP_pair1_upstream_R | This paper | DNA oligomer for dsDNA (guide RNA) | AAACCAGGGGAA CGATGGCCATGGC |
| sequence-based reagent | NASP_pair1_downstream_F | This paper | DNA oligomer for dsDNA (guide RNA) | CACCGAGCCAC TGCCGCCGTCGCCG |
| sequence-based reagent | NASP_pair1_downstream_R | This paper | DNA oligomer for dsDNA (guide RNA) | AAACCGGCGACG GCGGCAGTGGCTC |
| sequence-based reagent | ASF1B_UP_R | This paper | PCR primers | GGCCATCGCC TCGCCTCGCC |
| sequence-based reagent | ASF1B_UP_F | This paper | PCR primers | AATCACTTCGG GTGCGAGCACC |
| sequence-based reagent | Spot-tag_ mCherry_3 C_R | This paper | PCR primers | GCACCGACACC TTGGCCATGGGCC CCTGGAACAGAAC TTCCAGGAGTCC GGACTTGTACAGCT |
| sequence-based reagent | Spot-tag_ mCherry_3 C_F | This paper | PCR primers | GAGGCGAGGCGat ggccccggatcgcgtgcg cgcggtgagccattggag cagcGTGAGCAAGG GCGAGGAGGA |
| sequence-based reagent | ASF1B_DOWN_R | This paper | PCR primers | GGAAAATGGGAAG GGGCTGGATATTGG |
| sequence-based reagent | ASF1B_DOWN_F | This paper | PCR primers | ATGGCCAAGG TGTCGGTGC |
| sequence-based reagent | ASF1B_sgRNA_UP_F | This paper | DNA oligomer for dsDNA (guide RNA) | CACCGTCGCCTC GCCGCGCCGCAGC |
| sequence-based reagent | ASF1B_sgRNA_UP_R | This paper | DNA oligomer for dsDNA (guide RNA) | AAACGCTGCGGC GCGGCGAGGCGAC |
| sequence- based reagent | ASF1B_sgRNA_Down_F | This paper | DNA oligomer for dsDNA (guide RNA) | CACCGCAAGGTG TCGGTGCTGAACG |
| sequence- based reagent | ASF1B_sgRNA_Down_R | This paper | DNA oligomer for dsDNA (guide RNA) | AAACCGTTCAGC ACCGACACCTTGC |
| peptide, recombinant protein | Pierce High Capacity Streptavidin Agarose | Thermo Fisher | Cat. #: 20357 | |
| peptide, recombinant protein | GFP-trap agarose beads | ProteinTech (Chromoteck) | GTA | |
| chemical compound, drug | Biotin-phenol | Iris Biotech | LS-3500 | (Final concentration 500 µM) |
| chemical compound, drug | FugeneHD | Promega | E2311 | |
| chemical compound, drug | Rapamycin | ALFA (AESAR) | J62473.MC | (Final concentration 200 nM) |
| software, algorithm | R | R | Open Source | For graph plotting and statistical analysis |
| other | Hoechst 33342 stain | NEB | 4082 S | (1 µg/mL) |
Additional files
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/81755/elife-81755-transrepform1-v2.pdf
-
Source data 1
Uncropped source images for gels and western blots.
- https://cdn.elifesciences.org/articles/81755/elife-81755-data1-v2.docx
