The accumulation of lin-4 microRNA occurs during mid to late L1, primarily due to the activation of lin-4 primary RNA transcription, as supported by multiple studies (Bracht et al., 2010; Ow et al., 2008; Figure 1A and C). We confirmed their findings by observing a Plin-4::GFP (maIs134) reporter generated by the Ambros group (Ow et al., 2008), consisting of 2.4 kb of DNA sequences upstream of the mature lin-4 fused to GFP. After its on-set, lin-4 expression appears to be constitutive and ubiquitous throughout the larval stages (see discussion). MYRF-1 is also expressed broadly in larvae, but unlike lin-4, MYRF-1 transcription is active in both embryos and early L1, with an increase in transcription observed towards late L1 (Meng et al., 2017). However, the activity of MYRF-1 as a transcription factor is determined by the presence of N-MYRF-1 in the nucleus (Xia et al., 2021). Initially, full-length MYRF-1 localizes to the cell membrane during early L1, and only during mid to late L1 is the processing of MYRF-1 cleavage increased, resulting in an elevated amount of N-MYRF-1 being released and shuttled into the nucleus (Figure 1A and B). Therefore, the nuclear accumulation of N-MYRF-1 coincides with the induction of lin-4 both temporally and spatially.

Figure 1

Download asset Open asset

Figure 1—source data 1

The quantification of animals exhibiting a specific pattern of GFP::MYRF-1 at various stages, as illustrated in Figure 1B.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig1-data1-v1.xlsx

Download elife-89903-fig1-data1-v1.xlsx

Figure 1—source data 2

The detailed statistical analysis of the fluorescence intensity for the lin-4 transcriptional reporter, as illustrated in Figure 1C.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig1-data2-v1.xlsx

Download elife-89903-fig1-data2-v1.xlsx

We previously reported that two loss-of-function deletion mutants of myrf-1 (syb1491 and syb1468) (Figure 1D and E) exhibit phenotypic similarities to putative myrf-1 null mutants, particularly in their arresting stages (the end of L1) and mild synaptic rewiring deficits (Xia et al., 2021). The lin-4 transcription reporter (maIs134) is not activated in these mutants (Figure 2—figure supplement 1), indicating that myrf-1 plays a crucial role in promoting lin-4 transcription. In another allele, myrf-1(ju1121 G274R), the MYRF-1 mutant protein not only loses its DNA binding capability but also negatively interferes with its close paralogue MYRF-2 (Figure 1D and E; Meng et al., 2017). Consequently, myrf-1(ju1121) displays phenotypic resemblance to double mutants of myrf-1 and myrf-2, exhibiting severe synaptic rewiring blockage and arrest during L2 (Meng et al., 2017), one stage later than myrf-1 single mutants. Our analysis reveals that the maIs134 reporter fails to be expressed in myrf-1(ju1121) (Figure 2A and B), with the latest stage being during L2-3 molting. Therefore, based on the 2.4 kb promoter-reporter analysis, the activation of lin-4 at late L1 is dependent on the presence of MYRF.

Figure 2 with 4 supplements see all

Download asset Open asset

Figure 2—source data 1

The statistical analysis of the fluorescence intensity of the lin-4 transcriptional reporter (maIs134) in wild-type and myrf-1(ju1121) mutants, as illustrated in Figure 2B.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig2-data1-v1.xlsx

Download elife-89903-fig2-data1-v1.xlsx

Figure 2—source data 2

The statistical analysis of the fluorescence intensity of lin-4p::nls::mScarlet in wild-type, myrf-1(ybq6), myrf-2(ybq42), and myrf-1(ybq6); myrf-2(ybq42) double mutants, as illustrated in Figure 2D.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig2-data2-v1.xlsx

Download elife-89903-fig2-data2-v1.xlsx

Figure 2—source data 3

The statistical analysis of the fluorescence intensity of lin-4p::nls::mScarlet in wild-type and myrf-1(ju1121) mutants at the mid L1 (6 hr), late L1 (16 hr), and early L2 (21 hr) stages, as illustrated in Figure 2F.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig2-data3-v1.xlsx

Download elife-89903-fig2-data3-v1.xlsx

Figure 2—source data 4

The statistical analysis of the fluorescence intensity of lin-4p::nls::mScarlet in wild type and pan-1(gk142) mutant , as illustrated in Figure 2H.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig2-data4-v1.xlsx

Download elife-89903-fig2-data4-v1.xlsx

Figure 2—source data 5

The abundance of mature lin-4 miRNAs in wild-type and myrf-1(ju1121) animals at the early L1 (0 hr), late L1 (16 hr), and early L2 (21 hr) stages using qPCR analysis, as illustrated in Figure 2I.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig2-data5-v1.xlsx

Download elife-89903-fig2-data5-v1.xlsx

To confirm the crucial role of MYRF in the activation of lin-4 transcription, we investigated how myrf influences lin-4 transcription by employing a reporter system with a nucleus-localized mScarlet protein, endogenously inserted at the lin-4 locus (umn84), wherein the reporter open reading frame replaced the primary RNA sequence of lin-4. Our observations revealed that mScarlet signals were not detected in early L1 larvae (Figure 2C–F; Figure 2—figure supplement 2). These signals markedly increase during the late L1 stage and exhibit even stronger intensity in the early L2 stage. The mScarlet signals exhibit a marked reduction in the putative null mutant myrf-1(ybq6) (Figure 1D and E). Intriguingly, in the putative null myrf-2(ybq42) mutants, there is a noticeable trend towards increased mScarlet signals, although this increase does not reach statistical significance (Figure 2C and D). When the myrf-1(ybq6) mutation is combined with myrf-2(ybq42), the mScarlet signals disappear under comparable detection conditions (Figure 2C and D). Only under a greatly reduced maximum display range can some signals be inconsistently observed in the intestines of the double mutants (Figure 2—figure supplement 3). Given that the distribution pattern of these residual signals differs significantly from the normal lin-4 expression pattern (e.g. strong in the pharynx, epidermis, and neurons), it is questionable whether these signals truly reflect the regulation of lin-4. These results suggest that both myrf-1 and myrf-2 contribute to promoting lin-4 expression, with myrf-1 playing a predominant role and myrf-2 a minor role.

We analyzed this endogenously tagged lin-4 expression reporter (umn84) in myrf-1(ju1121) mutants (Figure 2E and F). We find that the mScarlet signals were largely absent throughout the body during the late L1 stage (14 hr), except for an interesting presence in 8–9 nuclei in the posterior bulb of the pharynx, with intensity comparable to that observed in the wild-type counterparts (Figure 2E and F; Figure 2—figure supplement 3). The overall absence of lin-4 expression persisted in myrf-1(ju1121) mutants during early L2 stage (21 hr), except for the aforementioned subset of pharyngeal nuclei where the mScarlet signals increased, although the ascent was much weaker compared to the wild-type controls.

We previously discovered that the trafficking of MYRF-1 and MYRF-2 to the cell membrane depends on the transmembrane, leucine-rich repeat domain-containing protein PAN-1 (Xia et al., 2021). In the absence of PAN-1, MYRF is unstable and undergoes degradation in the ER. pan-1(gk142) deletion mutants exhibit severe synaptic rewiring blockage in DD neurons and undergo progressive larval arrest, never progressing beyond the L3 stage (Gao et al., 2012; Gissendanner and Kelley, 2013; Xia et al., 2021). Interestingly, the larval arrest in pan-1 mutants occurs at a notably later stage than myrf-1; myrf-2 double mutants. We find that the scarlet lin-4 expression reporter (umn84) is not activated in pan-1(gk142) mutants (Figure 2G and H; Figure 2—figure supplement 3B), consistent with the notion that MYRF is inactive without PAN-1.

We carried out qPCR analysis using probes specifically targeting lin-4 microRNA to examine endogenous lin-4 expression in wild-type and myrf-1(ju1121) mutants, and observed a significant reduction in the levels of mature lin-4 microRNA in myrf-1(ju1121) mutants (Figure 2I). This decrease in mature lin-4 microRNA has been further confirmed through microRNA sequencing analysis (Figure 7A). These findings, combined with the analysis of endogenous lin-4 reporter, provide compelling evidence supporting the critical role of MYRF in the induction of lin-4 during the late L1 stage.

To investigate if MYRF-1 is continuously required for lin-4 transcription after its initial activation, we used the auxin-inducible degradation (AID) system (Zhang et al., 2015). We combined the ubiquitously expressed F-box protein TIR1 with degron-tagged MYRF-1 to acutely deplete MYRF-1 protein. The degradation was induced by treating animals at L2, L3, and L4 stages with an K-NAA (1-Naphthaleneacetic acid potassium salt) solution, an auxin analog. Our results showed a significant reduction in the lin-4 transcription reporter signals in animals of all tested stages within 10 hr post-treatment (Figure 2—figure supplement 4). This demonstrates that MYRF-1 is necessary for lin-4 expression throughout the larval stages.

The LIN-14 protein is typically present in embryos and early L1 but is downregulated as development progresses. Loss of the microRNA lin-4 leads to sustained high levels of LIN-14 protein throughout larval development (Wightman et al., 1993). To investigate how myrf-1 mutations may affect LIN-14, we examined the signals of endogenously tagged LIN-14::GFP in myrf-1(ju1121) mutants (Arribere et al., 2014). The LIN-14::GFP signal remains bright and shows no signs of decreasing at late L1 and beyond in myrf-1(ju1121) mutants (Figure 3A and B), consistent with the low levels of lin-4 microRNA observed in the mutants.

Figure 3

Download asset Open asset

Figure 3—source data 1

The detailed statistical analysis of the fluorescence intensity for LIN-14::GFP in wild type and myrf-1(ju1121) mutant, as illustrated in Figure 3B.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig3-data1-v1.xlsx

Download elife-89903-fig3-data1-v1.xlsx

It is currently unclear that how MYRF specifically regulates the larval development. Identifying lin-4 as a potential transcriptional target of MYRF-1, we aimed to investigate how MYRF-1 may regulate lin-4 expression. One key question is whether MYRF-1 promotes lin-4 expression in terminal target cells or whether MYRF-1 acts in discrete tissues to control unidentified systemic signals that subsequently lead to lin-4 expression.

We conducted tissue-specific rescue experiments by expressing MYRF-1 under the myo-3 promoter, which is specific to body wall muscles, in myrf-1(ju1121) mutants. We observed a significant induction of lin-4 transcription in body wall muscles but not in other tissues (Figure 4A). We also used the epidermis-specific promoter of dpy-7 for another MYRF-1 rescue experiment, which resulted in the appearance of lin-4 transcription reporter signals only in the epidermis. Notably, the reporter GFP signals were absent in the seam cells, a group of specialized epidermal cells embedded in the syncytium epidermal cell. This aligns with the observation that the short promoter of dpy-7, employed in this experiment, remains inactive in seam cells (Gilleard et al., 1997), therefore excluding the induction of lin-4 in these cells. These results demonstrate that MYRF regulates lin-4 transcription autonomously within specific cells.

Figure 4

Download asset Open asset

Figure 4—source data 1

The detailed statistical analysis of the fluorescence intensity of the lin-4 transcriptional reporter(maIs134) in wild-type and myrf-1(ybq98); Pdpy-7-Cre(tmIs1028) animals, as illustrated in Figure 4C.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig4-data1-v1.xlsx

Download elife-89903-fig4-data1-v1.xlsx

Figure 4—source data 2

Assessments of developmental stages for wild-type, myrf-1(ybq98); Pdpy-7-Cre(tmIs1028) and myrf-1(ybq98)/mIn1; Pdpy-7-Cre(tmIs1028) animals cultured at 20 °C for 48 hours, starting from freshly laid eggs, as illustrated in Figure 4D.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig4-data2-v1.xlsx

Download elife-89903-fig4-data2-v1.xlsx

One concern over the lack of lin-4 activation in myrf-1 loss of function mutants is that it may be due to overall developmental arrest during L2. To investigate this possibility, we generated a conditional allele of myrf-1^LoxP(ybq98) using CRISPR-Cas9 editing. We then combined an epidermis-specific Cre-expressing transgene with the myrf-1^LoxP allele in animals (Figure 4B and C). Our analysis showed that the lin-4 transcription reporter signals in the epidermis are lost in animals with the combined Cre transgene and myrf-1^loxP allele, while the signals were still present in all surrounding tissues. Interestingly, animals with dual alleles develop into adults without apparent abnormalities (Figure 4D and E). However, these adults display a consistent body elongation, a phenotype similar to that observed in lin-4 loss of function mutants. Additionally, all of them die within two days due to internal organ spillage caused by vulva bursting and internal larvae hatching. These results provide further evidence that MYRF-1 promotes lin-4 activation cell autonomously and suggest that MYRF-1 acts directly in terminal tissues to regulate cell development.

Given that both the induction of lin-4 and the cleavage of MYRF at the cell membrane happen within a specific time window, we investigated whether a gain of function in MYRF-1 alone is adequate to modify the onset timing of lin-4. Because of the intricate nature of regulated MYRF-1 cleavage, overexpressing full-length MYRF-1 by transgene does not enhance its transcriptional activity effectively, as excess MYRF-1 is unable to traffic to the cell membrane or undergo adequate cleavage (Meng et al., 2017). Overexpressing N-MYRF-1 alone is also insufficient as it unlikely to forms trimers efficiently. In another study, we have identified elements of the cleavage mechanism, which we will report in another manuscript. Using this information, we created a truncated form of MYRF-1 (deleting 601–650) that is expected to bypass the need for cell-membrane trafficking and circumvent the developmental signals that control cleavage. We expected that overexpressing this MYRF-1 variant would produce abundant N-MYRF-1 in trimeric form and enhance its endogenous function.

In this experiment, we used the endogenously mScarlet-tagged line (umn84) to report the transcription activity of lin-4. mScarlet expression is not detected in embryos and early L1 larvae (Figure 5A). We find that overexpressing the hyperactive MYRF-1(Δ601–650) driven by the ubiquitous promoter rpl-28 is detrimental to larval development, as all F1 progenies with the transgene arrest at early larval stages. Strikingly, expressing this hyperactive MYRF-1 variant causes the expression of lin-4 transcription reporter in both embryos and early L1 larvae, indicating that MYRF-1 alone is sufficient to activate lin-4 transcription (Figure 5B). Given that lin-4 transcription is suppressed by FLYWCH during embryogenesis and by distinct yet unidentified mechanisms during early L1, this result suggests that MYRF-1 plays a predominant role in promoting lin-4 transcription.

Figure 5

Download asset Open asset

Figure 5—source data 1

The detailed statistical analysis of the fluorescence intensity of the lin-4 transcriptional reporter(maIs134) in wild type and myrf-1(syb1313) mutant, as illustrated in Figure 5D.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig5-data1-v1.xlsx

Download elife-89903-fig5-data1-v1.xlsx

Figure 5—source data 2

The detailed statistical analysis of the fluorescence intensity of lin-4p::nls::mScarlet in wild-type and myrf-1(syb1313) mutants, as illustrated in Figure 5F.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig5-data2-v1.xlsx

Download elife-89903-fig5-data2-v1.xlsx

In our previous study, we characterized a mutant of myrf-1^1-700(syb1313) that exhibited precocious synaptic remodeling and M-cell division during mid-late L1, albeit in a discordant manner (Xia et al., 2021). Our analysis of MYRF-1^1-700 localization led us to infer that MYRF-1(syb1313) undergoes unregulated cleavage processing, resulting in the release of a small quantity of trimer N-MYRF (Figure 1D and E). However, this processing is inefficient and inconsistent across tissues. In the current study, we investigated the expression of the lin-4 transcription reporter (maIs134) in myrf-1(syb1313) and observed a clear appearance of the signal in the mutants, especially in neurons, at 6 hr, while it was undetectable in wild-type animals at this stage (Figure 5C and D). It is worth noting that at the time (15 hr) when lin-4 is typically upregulated in wild-type animals, the reporter GFP expression is significantly absent in the pharynx and epidermis of myrf-1(syb1313) mutants. However, there is sustained, higher-than-wild-type expression of the reporter GFP in neurons of these mutants. Considering the precocious phenotype observed in DD neurons in myrf-1(syb1313), these data support that hyperactive MYRF-1 promotes the premature transcription of lin-4.

We conducted further analysis to investigate the impact of myrf-1^1-700(syb1313) on the endogenously tagged mScarlet lin-4 transcription reporter. In the mutants, we observed premature induction of mScarlet signals in a subset of nuclei, likely neurons based on their position and nucleus size, at 6 hr (Figure 5E and F). As mutant animals progressed towards late L1 (14 hr), the signal intensity significantly increased and remained consistently higher compared to the wild-type controls. From this stage on, while the mScarlet signals in many wild-type individuals were still in the process of upregulation, the signal intensity in myrf-1^1-700(syb1313) mutants did not exhibit a comparable sustained increase. This observation aligns with our assessment of myrf-1^1-700(syb1313) mutants, indicating an inconsistent precocity and developmental progression deficiency. Nonetheless, these results strongly support the notion that hyperactive MYRF can precociously activate endogenous lin-4 transcription.

Notable differences in expression patterns are observed between the maIs134 and umn84 reporters in myrf-1^1-700(syb1313). Contrary to the absence of maIs134 signals in the pharynx of mutants, mScarlet signals in umn84 show premature induction in the pharynx at 6 hr (which is absent in wild-type at a similar stage), and exhibit stronger expression at 14 hr compared to wild-type (Figure 5E and F). One possible explanation for this contrasting expression pattern is the presence of additional pharynx-enhancing elements located outside the 2.4 kb promoter region of lin-4 used in the maIs134 transgene. Alternatively, it should be considered that the threshold for transcription factor activation required to drive the expression of the endogenous reporter (umn84) versus the multicopy DNA array reporter (maIs134) is likely different. Therefore, resolving this discrepancy would require further investigation.

While analyzing Plin-4-GFP (maIs134), we observed that a subset of the animals carrying the transgene enter dauer even when the food is still available (Figure 6A and B; Figure 6—figure supplement 1). Dauer refers to the alternative L3 stage that animals develop into when they encounter unfavorable living conditions such as low food abundance and high temperature. In normal laboratory conditions, wild-type C. elegans would never become dauer before the food runs out. We also observed that animals carrying maIs134 invariably develop slower than wild-type animals, even though they show no obvious defect in becoming adults and in fertility (Figure 6B–E). The developmental delay starts from L2 and onwards based on their appearance and body length measurement. The L2 animals of maIs134 are typically darker, longer, fatter than normal L2 animals and resemble pre-dauer (L2d) animals in gross morphology (Figure 6D; Figure 6—figure supplement 1).

Figure 6 with 2 supplements see all

Download asset Open asset

Figure 6—source data 1

Measurements of the percentage of 1% SDS-resistant dauers for wild-type, maIs134, myrf-1(ybqIs112), and maIs134;myrf-1(ybqIs112) animals cultured at 25 °C for 50 hours, starting from freshly laid eggs, as illustrated in Figure 6A.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig6-data1-v1.xlsx

Download elife-89903-fig6-data1-v1.xlsx

Figure 6—source data 2

Assessments of developmental stages for wild-type, maIs134, and maIs134;myrf-1(ybqIs112) animals at 70 hours post-hatching at 20 °C, as illustrated in Figure 6B.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig6-data2-v1.xlsx

Download elife-89903-fig6-data2-v1.xlsx

Figure 6—source data 3

Assessments of developmental stages for wild-type, maIs134, and maIs134;myrf-1(ybqIs112) animals cultured at 20 °C for 48 hours, starting from freshly laid eggs, as illustrated in Figure 6C.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig6-data3-v1.xlsx

Download elife-89903-fig6-data3-v1.xlsx

Figure 6—source data 4

Measurements of body length for wild-type and maIs134 animals at various stages, as illustrated in Figure 6E.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig6-data4-v1.xlsx

Download elife-89903-fig6-data4-v1.xlsx

Figure 6—source data 5

The detailed statistical analysis of the fluorescence intensity for the GFP::MYRF-1 and tetR::RFP fluorescent spots, as illustrated in Figure 6I.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig6-data5-v1.xlsx

Download elife-89903-fig6-data5-v1.xlsx

Although constitutive dauer formation can be affected by a range of factors, given the crucial role of MYRF in facilitating larval development, we explored the possibility that the dauer formation observed in maIs134 might be due to the tandem array transgene of the lin-4 promoter DNA capturing a substantial amount of MYRF-1 protein. This could lead to a significant drop in MYRF-1 levels, hindering normal development. If the hypothesis was true, expressing more MYRF-1 in maIs134 animals might suppress the dauer phenotype. In the rescuing transgene myrf-1^LoxP(ybqIs112) generated in our previous studies (Meng et al., 2017), the MYRF-1 protein is observed to increase slightly beyond its endogenous level. We find that ybqIs112 transgene completely suppresses the slow-growth phenotype in maIs134, as well as dauer formation (Figure 6A–C). This suggests that the transgene containing lin-4 promoter DNA negatively interferes with the normal function of MYRF-1 in development (Figure 6F).

These observations prompted us to investigate whether the transgene array of lin-4 promoter DNA binds a significant amount of MYRF-1 protein. To test this, we injected the 2.4 kb lin-4 promoter RFP reporter plasmid or the reporter without RFP into myrf-1^GFP(ybq14), and remarkably, we detected some puncta of intensified GFP signals in a subset of nuclei in animals carrying transgene (Figure 6G–I; Figure 6—figure supplement 2). This suggests that the MYRF-1^GFP protein is concentrated in discrete nuclear locations, a phenomenon that we never observed in wild-type myrf-1^GFP(ybq14) animals. To determine the specificity of their interaction, we designed a second plasmid containing 7 x TetO sequence to be bound by TetR. The TetR DNA binding domain with a RFP tag (TetR::RFP) is driven by a ubiquitous promoter, in a form of single copy transgene (ybqSi233) to ensure consistent, moderate expression (Figure 6G–I). The formation of the TetO tandem DNA array indeed led to the appearance of TetR::RFP puncta, demonstrating the effectiveness of the method. With such a method, the presence of RFP puncta can then mark the location of DNA arrays in the nucleus. The formation of the TetO DNA array alone was insufficient to sequester MYRF-1^GFP, while only the addition of the lin-4 promoter DNA into the tandem array caused the emergence of the MYRF-1^GFP puncta, indicating the specificity of the lin-4 promoter-MYRF-1 interaction. Therefore, the serendipitous observations concerning Daf-C in maIs134 and the nuclear loci co-labeling in vivo supports the direct regulator role of MYRF-1 in driving lin-4 transcription.

We wanted to investigate the extent to which MYRF-1’s transcriptional activity might affect the landscape of microRNA expression in genome, as microRNAs often have stronger effects when present in combination with homologous microRNAs or in synergy with other microRNA families (Ambros and Ruvkun, 2018). We performed microRNA-targeted sequencing analysis on myrf-1(ju1121) mutants of late L1 (16 hr) compared to controls. The sequencing analysis showed that a small subset of microRNA species was differentially expressed between myrf-1(ju1121) and control animals (P<0.05) (Figure 7A). We performed a phylogenetic analysis to analyze the relationships between these microRNA species (Figure 7B). Notably, 6 of the 7 microRNAs showing increased expression in myrf-1(ju1121) compared to wild-type are clustered on a single phylogenetic branch, distinct from the other two branches. Among the differentially expressed, lin-4 was the most decreased gene, consistent with our present analysis on lin-4. We then selected several candidates of relative abundance and examined their expression using transcriptional reporters. We generated single copy insertion transgenes carrying 2 kb upstream sequences of the candidate microRNA and eventually obtained lines for mir-48, mir-73, and mir-230 showing consistent GFP signals (Figure 7C and D). The reporter for mir-48 is primarily detected in the pharynx, mir-73 is present in both the pharynx and seam cells, whereas mir-230 is detected in seam cells. The mir-48 reporter (ybqSi206) was decreased, while mir-73 (ybqSi208) and mir-230 (ybqSi209) were increased in myrf-1(ju1121) at early L2, thus confirming the microRNA sequencing results. Notably, all three microRNAs were increased from L1 to L2 by transcriptional reporter; among the three, mir-48 reporter is hardly detected in L1 and shows the most dramatic increase when animals transition to L2. The loss of myrf-1 significantly decreased mir-48’s upregulation, but did not completely block it as it did with lin-4. mir-48 belongs to the let-7 microRNA family, and two other family members, mir-84 and mir-241, were also downregulated in myrf-1(ju1121), while let-7, the founding member, itself was upregulated in myrf-1(ju1121). Among the microRNAs upregulated in the myrf-1 mutants, mir-42 belongs to the mir-35 family, which is essential for embryogenesis, and mir-71 has been extensively studied for its upregulation in adults and regulatory role in aging. At this stage, it is unclear how these candidate microRNAs may be involved in regulating post-embryonic development, but our results suggest an intricate genetic circuit in which MYRF-1’s activity may either enhance or dampen the expression of select microRNA species.

Figure 7

Download asset Open asset

Figure 7—source data 1

The source data for microRNA read counts, as illustrated in Figure 7A.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig7-data1-v1.xlsx

Download elife-89903-fig7-data1-v1.xlsx

Figure 7—source data 2

The detailed statistical analysis of the fluorescence intensity for the mir-48, mir-73, and mir-230 transcriptional reporters is illustrated in Figure 7D.

https://cdn.elifesciences.org/articles/89903/elife-89903-fig7-data2-v1.xlsx

Download elife-89903-fig7-data2-v1.xlsx

While the tandem DNA array of the lin-4 promoter can sequester MYRF-1 proteins in vivo, forming discrete nuclear loci, we have not yet obtained further direct evidence for MYRF-1’s binding to the endogenous lin-4 promoter. Chromatin immunoprecipitation (ChIP) is commonly utilized to determine whether a transcription factor binds to a DNA element in vivo. However, we have not yet obtained conclusive ChIP results, noting that MYRF is present in low quantities and highly susceptible to degradation. These experiments remain part of our ongoing pursuit to identify MYRF’s transcription targets.

Wild-type C. elegans were Bristol N2 strain. Strains were cultured on NGM plates using standard procedures (Brenner, 1974). Unless noted, animals were cultured at 20 °C for assays requiring specific developmental stages. Animals analyzed in this paper were hermaphrodites.

All alleles generated in Y.B.Q. lab are designated as ‘ybq’ alleles, and all strains, as ‘BLW’ strains. ‘Ex’ denotes transgene alleles of exchromosomal array. ‘Is’ denotes integrated transgene. ‘Si’ denotes single-copy integrated transgene. ‘syb’ alleles (in ‘PHX’ strains) are generated by genomic editing using CRISPR-Cas9 technique. ‘syb’ alleles were designed by Y.B.Q. and produced by SunyBiotech (Fuzhou, China).

For the following described alleles generated by CRISPR-Cas9 editing, Cas9 and gRNA were expressed from plasmids. The positive clones were identified using PCR screening to test singled F1 resulted from microinjection. GFP::myrf-1(LoxP) (ybq98) alleles was generated in the background of strain BLW889 [GFP::myrf-1::3xFlag(ybq14)]. Two artificial introns are inserted into the third exon of myrf-1 gene and each intron carries one LoxP site.

gRNA target: sgRNA1: TCAAGTCGGCTTCTCTTACGTGG

sgRNA2: TACGTGGCATCTCCAAAACAGGG

ybq14(background): …GGAATGCCAAGCCCTGTTTTGGAGATGCCACGTAAG - (insertion point) -AGAAGCCGACTTGACACCCCGTGTGAAACGCCAAGAATCGCTCCAAGCTTTGCTGGTATTGACGGATTTCCAGATGAGAATTACAGTCAGCAACAGGCAATCAG - (insertion point) - ATTCTCAAAGTTTCAAGAAGAACAGTGGAGTCCACTGTATGACATCAACGCTCAACCGCTACAACAACTTCAA...

ybq98: …GGAATGCCAAGCCCTGTCTTAGAAATGCCACGCAAG -(gtatgtttcgaatgatactaataATAACTTCGTATAGCATACATTATACGAAGTTATaacataacatagaacattttcag) – AGAAGCCGACTTGACACCCCGTGTGAAACGCCAAGAATCGCTCCAAGCTTTGCTGGTATTGACGGATTTCCAGATGAGAATTACAGTCAGCAACAGGCAATCAG - (gtaagtttaaactttctcatactaataATAACTTCGTATAGCATACATTATACGAAGTTATattaactaacgcgctctatttaaattttcag) – ATTCTCAAAGTTTCAAGAAGAACAGTGGAGTCCACTATACGATATTAACGCTCAACCGCTACAACAACTTCAA...

GFP::Degron::myrf-1::3xFlag(ybq133) was generated in the background of BLW889 [GFP::myrf-1::3xFlag(ybq14)]. Degron is inserted after the last amino acid of GFP (Lys).

sgRNA: CAATCAACCTACAAACACCCTGG

ybq14(background): …GGGATTACACATGGCATGGATGAACTATACAAA - (insertion point) – GCAGTCAATCAACCTACAAACACCCTGGCTCAACTCAA...

ybq133: …GGGATTACACATGGCATGGATGAACTATACAAA - DEGRON GCAGTCAATCAACCTACAAACACCCTTGCTCAACTCAA...

Pmyo-3-MYRF-1 transgene: The vector pQA1094 [Pmyo-3-myrf-1] was injected to BLW1424 [myrf-1(ju1121)/mIn1 II; lin-4p::GFP +unc-119(maIs134)] at concentration of 0.5 ng/µl. The resulting strain is BLW1579 [myrf-1(ju1121)/mIn1 II; lin-4p::GFP +unc-119(maIs134); Pmyo-3-myrf-1(ybqEx746)]

Pdpy-7-MYRF-1 transgene: The vector pQA1511 [Pdpy-7-gfp::myrf-1] injected to N2 at concentration of 0.5 ng/µl to generate BLW1562 [Pdpy-7-gfp::myrf-1(ybqEx721)]. ybqEx721 was crossed into VT1072 [unc-119(ed3) III; lin-4p::GFP +unc-119(maIs134)] to generate BLW1578 [lin-4p::GFP +unc-119(maIs134); Pdpy-7-gfp::myrf-1(ybqEx721)]. BLW1578 was crossed with BLW1424 [myrf-1(ju1121)/mIn1 II; lin-4p::GFP +unc-119(maIs134)] to generate BLW1580 [myrf-1(ju1121)/mIn1 II; lin-4p::GFP +unc-119(maIs134); Pdpy-7-gfp::myrf-1(ybqEx721)].

Overexpress GFP::MYRF-1 (delete 601–650): The vector pQA1922[Prpl-28-GFP::myrf-1(delete 601–650)] were injected into CGC177 lin-4 umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858–3'UTR::lox2722] /mIn1[dpy-10(e128) umnIs33] at 10 ng/µl.

Tandem DNA array of Plin-4(2412 bp) DNA: The vector pQA1881 [Plin-4(2412 bp) -unc-54–3'UTR] was injected into BLW1827 [gfp::myrf-1](ybq14); glo-1(zu391)] at 50 ng/µl.

Tandem DNA array of 7xTetO: The vector pQA1961 [7xTetO] was injected into BLW2170 [gfp::myrf-1(ybq14)]; glo-1(zu391); [Prpl-28-TetR-DBD::TagRFP(ybqSi233)] at 50 ng/µl.

Tandem DNA array of Plin-4 DNA +7xTetO: The vector pQA1960 [Plin-4(2412 bp) -unc-54–3'UTR - 7xTetO] were injected into BLW2170 [gfp::myrf-1(ybq14)]; glo-1(zu391); [Prpl-28-TetR-DBD::TagRFP(ybqSi233)] at 50 ng/µl.

Pmir-48-gfp single copy transgene: The pQA1861 [Pmir-48-GFP miniMos_vector] at 50 ng/µl and standard components of miniMos system (see below) was injected into N2 animals to make single copy transgene Pmir-48-GFP(ybqSi206).

Pmir-73-gfp single copy transgene: The pQA1863 [Pmir-73-GFP miniMos_vector] at 50 ng/µl and standard components of miniMos system (see below) was injected into N2 animals to make single copy transgene Pmir-73-GFP(ybqSi208).

Pmir-230-GFP single copy transgene: The pQA1864 [Pmir-230-GFP miniMos_vector] at 50 ng/µl and standard components of miniMos system (see below) was injected into N2 animals to make single copy transgene Pmir-230-GFP(ybqSi209).

TetR-TagRFP single copy transgene: The pQA1896 (Prpl-28-TetR-DBD::TagRFP miniMos_vector) at 50 ng/µl and standard components of miniMos system (see below) was injected into N2 animals to make single copy transgene Prpl-28-TetR::TagRFP (ybqSi233).

The procedure for generating single-copy integrated transgenes using miniMos technology in this study followed the protocol established by Frøkjær-Jensen et al., 2014. The injection mixture contained 10 ng/µl pGH8 [Prab-3::mCherry], 2.5 ng/µl pCFJ90 [Pmyo-2::mCherry], 50 ng/µl pCFJ601 [Peft-3-Mos1-transposase], and 50 ng/µl miniMos plasmid harboring the target gene. The mixture was injected into the gonads of N2 animals. After injection, the nematodes were transferred onto NGM medium and incubated at 25 °C for approximately 48 hr. Subsequently, 500 µl of 25 mg/mL G418 solution was added to each plate to screen for nematodes carrying the target transgene. After 7–10 days, healthy nematodes without mCherry co-markers were selected from the medium where all the food was consumed. Candidate single-copy integrators were grown on G418-containing plates and analyzed for target protein expression. Homozygous nematodes carrying a single-copy transgene were identified by their 100% resistance to G418 toxicity and expression of the target protein.

Samples for Taqman Real-Time PCR Assays were prepared from wild-type N2 and BLW252 [myrf-1(ju1121)/mIn1] strains at three stages: Early L1 (0 h), Late L1 (16 h), and Early L2 (21 h). The worms were screened for size and fluorescence marker of the desired transgene using Biosorter. myrf-1(ju1121) mutants lack the pharyngeal GFP, which serves as a transgene marker of balancer mIn1, as a criterion in sorting process. More than 2000 worms were collected for each sample after the Biosorter process.

RNA extraction was carried out using RNAiso Plus (TaKaRa, Dalian, China) following the manufacturer’s instructions with some modifications. Briefly, 1 ml of RNAiso Plus was added to each sample, which was homogenized using a pre-cooled grinder. The homogenization buffer was then transferred to a 1.5 ml microcentrifuge tube and allowed to stand at room temperature (15–30 °C) for 5–10 min. The supernatant was discarded, and 200 µl of chloroform was added and shaken for 30 s until the mixture turned milky. The mixture was then centrifuged at 12,000 g at 4 °C for 15 min, and the supernatant was transferred to a new microcentrifuge tube. To the supernatant, 0.5 ml of isoamylol was added and left to stand for 10 min at room temperature, then centrifuged at 12,000 g at 4 °C for 60 min. After discarding the supernatant, the pellet was washed with 75% ethanol at 12,000 g, 4 °C for 60 min, and then dissolved in 20 µl of DEPC-treated water. The concentration of miRNA was determined using Nanodrop, and its quality was assessed through electrophoresis. Each experiment was performed using at least three replicates.

The TAKARA RNA reverse transcription kit (6110 A) was used to perform RNA reverse transcription following the manufacturer’s instructions. The concentration of the resulting product was measured using Nanodrop, and its quality was evaluated through electrophoresis.

The Taqman real-time PCR was conducted according to the TaqMan small RNA assay protocol. Initially, the concentration of each sample was diluted to below 10 ng/µl, followed by reverse transcription PCR using the TaqMan microRNA RT kit (4366596). Subsequently, the Taqman real-time PCR mixture was prepared using Taqman small RNA assay (20 X) with lin-4a (21nt) (ID: 000258) and sn2323 (ID: 001760) as the internal control. Each sample was tested using at least three technical replicates and three biological replicates. The TaqMan real-time PCR was carried out using Applied Biosystems QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher), and all the procedures were followed as per the instructions. To determine the relative changes of each sample in each assay, the lin-4 Ct of technical replicates was averaged and then subtracted by the average sn2323 Ct to obtain the △CT value for each sample. Within each biological replicate and assay, the difference between the △CT of each sample and the △CT of wild-type at Early L1 was calculated to obtain △△CT. The 2 to the power of △△CT was then calculated to obtain the fold change in each sample compared to the wild-type at Early L1. The fold changes were plotted in Figure 1.

BLW53 [Phlh-8-GFP(ayIs6)] and BLW1555 [myrf-1(ju1121)/ mIn1; Phlh-8-GFP(ayIs6)] strains were utilized for sample preparation. To isolate myrf-1 mutants, late L1 stage worms were selected based on size and lack of pharyngeal GFP (a balancer mIn1 marker) using Biosorter. Over 10,000 worms were collected for each sample for further experimentation. Three biological replicates for myrf-1 mutants and control animals were included. Total RNA was extracted and assessed for quality and quantity using Nanodrop and Agilent 2100, respectively. Samples with a total quantity of 3–5 µg and high quality (RIN >10) were selected for miRNA library construction. The miRNA libraries were established and sequenced by Novogene Technology Co., Ltd. (Beijing, China).

In this study, the C. elegans Assembly WBcel235/ce11 was used as the reference genome for bioinformatic analysis of the sequencing data. The reference genome and gene annotation database were obtained from the Ensembl database and used for downstream analysis. The sequencing data was initially assessed for quality using the software FASTQ, followed by alignment of each miRNA sequencing dataset independently to the reference genome using HiSAT2. Transcriptome from each RNA-sequencing dataset was then extracted using the StringTie software. Differential miRNA cluster analysis was performed to compare miRNA expression of control and myrf-1(ju1121) mutant using DESeq2. Data normalization was done using the TPM method. A P-value was assigned to each gene and adjusted using the Benjamini and Hochberg method. Genes with P_ adj <0.05 were considered differentially expressed.

For the analysis and visualization of miRNA expression, read counts (TPM values) were first normalized to account for library size. Subsequently, variance stabilization was performed using the rlog function from DESeq2 (Love et al., 2014). The data were then clustered based on a Euclidean distance metric.

Live animals were anesthetized using 0.5% 1-Phenoxy-2-propanol in ddH₂O and mounted on 3% Agar gel pad. The animals were examined under 20x, 40x, or 60x oil objective on OLYMPUS BX63 microscope. The wide-field DIC or fluorescence images (single plane images or Z-focal stacks) were taken by a sCMOS camera PrimΣ Photometrics camera (model 2) mounted on OLYMPUS BX63, which is driven by CellSens Dimension software (Olympus). Images of live animals were also acquired on Zeiss LSM880 with Airyscan. The thickness of the optical slices was typically 0.8 µm.

For quantification of GFP::MYRF-1 subcellular localization, we conducted three independent rounds of culture, imaging, and scoring. The data were then pooled and presented in percentage column graphs. Regarding quantification of lin-4 transcriptional reporter intensity, we conducted at least two independent rounds of culture and imaging analysis.

To quantify the patterns of GFP::MYRF-1, we acquired images of stage-synchronized animals using wide-field microscopy as described above. The same parameters were used, including the power of excitation light, an identical objective, exposure duration, and screen display setting. The acquired images were examined, and the patterns of GFP::MYRF were categorized based on the consistency of the signals observed at specific subcellular locations throughout the animal body. A ‘weak or unclear signal’ means that either no clear signals are detected or there are some weak signals that are inconsistent throughout the animal body.

To quantify the general Plin-4-GFP(maIs134) transcriptional reporter fluorescence intensity, we opened each acquired image stack in ImageJ and selected a single slice with a focused pharynx for further analysis. A square with sides 20 pixels (3.25 μm) long was drawn to the pharynx isthmus. The intensity of the region of interest (ROI) was measured and presented as Mean ± SEM (t-test, *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

To quantify the pharyngeal Plin-4-GFP(maIs134) transcriptional reporter fluorescence intensity in myrf-1(syb1491) and myrf-1(syb1468) mutants, we opened each acquired image stack in ImageJ and selected a single slice with a focused pharynx bulb for further analysis. The posterior pharynx bulb was selected as the ROI. The intensity of the ROI was measured and presented as Mean ± SEM (t-test, *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

To quantify the neuronal Plin-4-GFP(maIs134) transcriptional reporter fluorescence intensity in myrf-1(syb1491) and myrf-1(syb1468) mutants, we opened each acquired image stack in ImageJ and selected a single slice with a focused head nerve ring for further analysis. The dorsal nerve ring area was selected as the ROI. The intensity of the ROI was measured and presented as Mean ± SEM (t-test, *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

The fluorescence intensity of the lin-4p::nls::mScarlet(umn84) transcriptional reporter across the entire body in pan-1(gk142), myrf-1(syb1313), myrf-1(ju1121), myrf-1(ybq6), myrf-2(ybq42), and myrf-1(ybq6); myrf-2(ybq42) double mutants was quantified by maximally projecting the z-stack into a single image using ImageJ. The ROI was defined as the whole animal area. The measured intensity of this ROI is expressed as Mean ± SEM. Statistical significance was determined using a t-test (*p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

To quantify the pharyngeal lin-4p::nls::mScarlet(umn84) transcriptional reporter fluorescence intensity in myrf-1(ju1121) and myrf-1(syb1313) mutants, we opened each acquired image stack in ImageJ and selected a single slice with a focused pharynx bulb for further analysis. Two posterior pharynx bulb nuclei were selected as the ROI. The intensity of the ROI was measured and presented as Mean ± SEM (t-test, *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

To quantify the neuronal lin-4p::nls::mScarlet(umn84) transcriptional reporter fluorescence intensity in myrf-1(ju1121) and myrf-1(syb1313) mutants, we opened each acquired image stack in ImageJ and selected a single slice with a focused nerve ring for further analysis. Several neuron nuclei were selected as the ROI. The intensity of the ROI was measured and presented as Mean ± SEM (t-test, *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

To quantify the LIN-14::GFP fluorescence intensity, we opened each acquired image stack in ImageJ and selected a single slice with a focused head neurons for further analysis. The head region was selected as the ROI. The intensity of the ROI was measured and presented as Mean ± SEM (t-test, *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

To generate the line plot of TetR::TagRFP and GFP::MYRF-1, we opened each acquired image stack from Zeiss Airyscan in ImageJ and selected a single slice with a focused TetR::TagRFP spot for further analysis. We drew a 2-pixel (~0.1 μm)-thick, 12 μm-long ROI line to cross the center of one bright TetR::TagRFP spot. The middle point of the ROI line was positioned at the center of the spot. We ran the ‘plot profile’ program located in the Analyze menu and recorded plot data in the RFP and GFP channels, respectively. The final graph was generated in GraphPad Prism 8. Each plot line represented the intensity distribution across a single TetR::TagRFP spot from an independent cell.

To generate a multiple line plot of GFP::MYRF-1, each image stack acquired from Zeiss Airyscan was opened in ImageJ, and a single slice with a focused GFP::MYRF-1 spot was selected. When no obviously bright GFP::MYRF-1 spot was found in the set of image slices, we chose a slice with clearly focused GFP::MYRF-1 signals in nucleus. A 2-pixel (~0.1 μm)-thick, 10μm-long ROI line was drawn to cross the center of the GFP::MYRF-1 punctum (or brightest nucleus signal as we could fine). We then ran the program ‘plot profile,’located in the Analyze menu, to record the plot data in the GFP channel. The final graph was generated in GraphPad Prism 8. The maximum intensity position in the ROI line was defined as the ‘0’ position in the X axis. Measurement points within two microns centered at the ‘0’ position were graphed. Each plot line represented the intensity distribution across a single GFP::MYRF-1 spot from an independent cell.

To generate a line plot of epidermal Plin-4-gfp in epidermal knock-out MYRF-1 animals, each acquired image stack was opened in ImageJ and a single slice with a focused seam cell was selected for further analysis. A 2-pixel (~0.1 μm) thick, 12μm-long ROI line was drawn to cross a seam cell in a ventral-to-dorsal direction. The middle point of the ROI line was positioned at the center of the seam cell. The data was recorded by the ‘plot profile’ program located in the Analyze menu. The final graph was generated using GraphPad Prism 8. Each plot line represented the intensity distribution across a single seam cell from an independent animal.

For quantification of miRNA transcriptional reporter fluorescence intensity, each image stack was opened in ImageJ and a single slice with focused head was selected for further analysis. A circle ROI with a diameter of 10 pixels (1.625 μm) was drawn in the head region. For the mir-48 and mir-73 reporter, a circle was drawn on the pharynx bulb. For the mir-230 reporter, a circle was drawn on the first seam cell in the head. The intensity of the ROI was measured and presented as Mean ± SEM (t-test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001).

To assay dauer formation, approximately 30 gravid adults (aged ~60 hr) were transferred to a fresh 3.5 cm NGM plate where they laid eggs for 4 hr. Afterward, all adults were removed, and the synchronized eggs were maintained at 25 ℃ for 50 hr. To analyze the ratio of dauer formation, animals were washed from the NGM plate and treated with 1% SDS for 20 min. Surviving animals were counted and considered as dauer, while dead animals were counted and considered as non-dauer.

To assay L2d formation, approximately 30 gravid adults (aged ~60 hr) were transferred to a fresh 3.5 cm NGM plate where they laid eggs for 4 hr. Afterward, all adults were removed, and the synchronized eggs were maintained at 20 ℃ for 48 hr. To analyze the morphology of animals, DIC images of animals were acquired on an OLYMPUS BX63 microscope using a 10x objective. Animals exhibiting a leaner morphology and more condensed intestinal granules were counted and considered as L2d.

To assay dauer formation, synchronized fresh-hatched L1 were seeded at ~200 per 3.5 cm NGM plate and cultured at 20 ℃ for 70 hr. To analyze the morphology of animals, DIC images of animals were acquired on an OLYMPUS BX63 microscope using a 10x objective. Animals exhibiting a leaner and darker morphology were counted and considered as dauer.

To quantify animal length and analyze their growth, DIC images of animals were acquired on an OLYMPUS BX63 microscope using a 10x objective. The lengths of animals in the images were measured using the polyline tool in OLYMPUS imaging software, and the data were further analyzed in GraphPad Prism.

To perform auxin treatment, worms were transferred to OP50-seeded NGM plates containing ~4 mM K-NAA (1-Naphthaleneacetic acid potassium salt). Briefly, fresh OP50-seeded 3.5 cm NGM plates with 3 mL NGM agar and a 25 mM K-NAA solution in ddH2O were prepared. Next, 500 μL of the 25 mM K-NAA solution was added to the NGM plates, and the lid was kept on until the solution dried. For all K-NAA treatment experiments, 500 μL of ddH2O was used as a control.

Phylogenetic analyses were performed using the MEGA 11.0 program. First, all miRNA sequences were imported into MEGA 11.0 and aligned using ClustalX to search for conserved bases and motifs. Pairwise distance was then estimated using the default parameters, except for the bootstrap replication number parameter, which was set to 1000, and the substitution model parameter, which was set to P-distance. The phylogenetic tree for our specific miRNAs was generated using the Neighbor-Joining method and default parameters, with branches corresponding to partitions reproduced in less than 0.1 bootstrap replicates filtered out.

Determining sample size involves multiple factors. Typically, when testing the difference between two samples using t-tests and ANOVA, which generally require smaller sample sizes, we have found that 20–30 samples can often yield significant differentiation between the two groups. Additionally, we take into account practical constraints such as time, budget, and feasibility to avoid unnecessary costs. It’s important to note that even in synchronized populations with similar starting sizes, there may be size variations over a growth period. We only exclude individuals that are clearly in an inappropriate stage, such as young L1 sizes in late L1 populations, which can occur in both mutant and control animals. The images captured are from randomized animals on slice preparations, and there is no particular order to the images when they were analyzed. Since the intensity from each image was measured using ImageJ and is devoid of human errors, we determined it unnecessary to blind the images across distinct genotypes.

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Some strains were provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). We thank the National Bioresource Project for C. elegans for providing some of the strains used in this study. This work was supported by the lab start-up fund from ShanghaiTech University to YBQ; and by the National Science Foundation for Young Scientists of China (grant no. 31900397) to LW. We extend our gratitude to Shouhong Guang and Xinya Huang from the University of Science and Technology of China for their continuous contributions to the chromatin immunoprecipitation experiments. We thank Xiaoting Feng for her assistance with the MYRF-1-AID experiments and Youzhe He at BGI-Shenzhen for providing bioinformatics support. We thank the Molecular and Cell Biology Core Facility (MCBCF) and the Molecular Imaging Core Facility (MICF) at the School of Life Science and Technology, ShanghaiTech University for providing technical support.

1. Sent for peer review: June 12, 2023
2. Preprint posted: June 24, 2023 (view preprint)
3. Preprint posted: August 8, 2023 (view preprint)
4. Preprint posted: February 22, 2024 (view preprint)
5. Preprint posted: April 5, 2024 (view preprint)
6. Version of Record published: July 4, 2024 (version 1)

You can cite all versions using the DOI https://doi.org/10.7554/eLife.89903. This DOI represents all versions, and will always resolve to the latest one.

© 2023, Xu et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.