A population modification gene drive targeting both Saglin and Lipophorin impairs Plasmodium transmission in Anopheles mosquitoes

Abstract

Lipophorin is an essential, highly expressed lipid transport protein that is secreted and circulates in insect hemolymph. We hijacked the Anopheles coluzzii Lipophorin gene to make it co-express a single-chain version of antibody 2A10, which binds sporozoites of the malaria parasite Plasmodium falciparum. The resulting transgenic mosquitoes show a markedly decreased ability to transmit Plasmodium berghei expressing the P. falciparum circumsporozoite protein to mice. To force the spread of this antimalarial transgene in a mosquito population, we designed and tested several CRISPR/Cas9-based gene drives. One of these is installed in, and disrupts, the pro-parasitic gene Saglin and also cleaves wild-type Lipophorin, causing the anti-malarial modified Lipophorin version to replace the wild type and hitch-hike together with the Saglin drive. Although generating drive-resistant alleles and showing instability in its gRNA-encoding multiplex array, the Saglin-based gene drive reached high levels in caged mosquito populations and efficiently promoted the simultaneous spread of the antimalarial Lipophorin::Sc2A10 allele. This combination is expected to decrease parasite transmission via two different mechanisms. This work contributes to the design of novel strategies to spread antimalarial transgenes in mosquitoes, and illustrates some expected and unexpected outcomes encountered when establishing a population modification gene drive.

Editor's evaluation

This study presents the generation of a two-component gene drive for population modification in Anopheles coluzzii, a major malaria vector in Africa. By testing multiple elegant drive designs, the authors convincingly achieve the spread of antimalarial cargos in caged mosquito populations. Overall, this work represents a significant advance towards a possible application of genetic technologies for malaria control.

https://doi.org/10.7554/eLife.93142.sa0

Introduction

Malaria-transmitting mosquitoes cause over 245 million malaria cases and about 620,000 deaths annually (WHO, 2021). Vector control, mainly in the form of insecticide indoor residual spraying and insecticide-treated bed nets, has permitted a steady decrease in malaria cases during the last decades. However, this decline is stalling as mosquitoes become increasingly resistant to insecticides and as malaria parasites continue to evolve resistance to drugs. These ongoing genetic changes in vectors and parasites, under the selection pressure of two major pillars of malaria control, jeopardize the hard-won successes in the fight against malaria. To address the need for complementary malaria control approaches, intervention strategies based on intentional genetic changes in mosquitoes to decrease malaria transmission are under development. Recent advances in the field of gene drive (GD) provide a mean to push desirable transgenes to invade a target population of insects (Carballar-Lejarazú and James, 2017; Gantz and Akbari, 2018; Quinn and Nolan, 2020; James and Santos, 2023).

GD interventions against malaria mosquitoes are still in the laboratory phase of their development, and can be subdivided in two classes: (a) population suppression GDs that spread either female sterility or female killing in mosquito populations with the aim to eliminate them (Hammond et al., 2016; Kyrou et al., 2018; Simoni et al., 2020); (b) population modification GDs that leave mosquito populations in place, but genetically alter them to reduce their disease transmission capacity (Gantz et al., 2015; Pham et al., 2019; Carballar-Lejarazú et al., 2020; Carballar-Lejarazú et al., 2023). Both approaches raise ethical, safety and ecological concerns, and trigger controversy (e.g., National Academies of Science, Engineering and Medicine, 2016; Courtier-Orgogozo et al., 2017; de Graeff et al., 2021). One concern raised by elimination approaches is their possible consequences on the food web and ecosystems, even where dozens of sympatric mosquito species are potentially available to compensate for the loss of the target species. In some regions, elimination of one species could favor the installation of competing species that could also act as vectors, as can be feared for the Aedes aegypti / Ae. albopictus mosquito dyad vectoring dengue, Zika, and chikungunya viruses. Modification approaches alleviate these concerns by leaving the target species in its ecological niche, but in turn, the indefinite persistence of transgenes utilized in modification drives could have long-term secondary effects, so that both approaches should be planned with utmost caution. However, the option of rejecting gene drive technologies as a complementary tool to fight mosquito-borne pathogens also raises ethical issues, by ignoring a chance to curb the immense mortality and morbidity caused by mosquito-borne infections.

Anopheles gambiae (sensu lato), the major mosquito vector of malaria in Sub-Saharan Africa, is widely distributed, locally abundant during rainy seasons and its biomass might significantly contribute to the food chain, in a temporal fashion. Besides their possible negative impact on food webs, elimination approaches for this mosquito are likely to be complicated by re-colonization from residual pockets of surviving isolated populations, resulting in chasing dynamics of gene drive (Champer et al., 2021; Champer et al., 2022). For this species in its native ecosystem, population modification to decrease vector competence and preserve ecological functions could be a meaningful gene drive approach. Here, we present the engineering of the Lipophorin (Lp) essential gene in Anopheles coluzzii, a prominent member of the A. gambiae species complex and a major malaria vector in sub-Saharan Africa.

Lp naturally encodes an abundant lipid transport protein secreted in mosquito hemolymph. We modified Lp to co-express a single-chain antibody (ScFv) derived from 2A10, a well-established mouse monoclonal antibody that binds the Plasmodium falciparum circumsporozoite protein (CSP) (Zavala et al., 1983). Sporozoites are the parasite stage that mosquito females inject in vertebrate hosts while aquiring a blood meal. Once in the host, sporozoites quickly infect the liver and multiply to produce merozoites with a tropism for red blood cells. Through its binding to CSP (the major sporozoite surface antigen), 2A10 was shown to decrease sporozoite infectivity to cultured human hepatocytes (Hollingdale et al., 1984). Transgenic expression of a 2A10 ScFv, fused to the antimicrobial peptide Cecropin A and expressed under the control of the Vitellogenin promoter, decreased the number of salivary gland sporozoites in Anopheles stephensi (Isaacs et al., 2011; Isaacs et al., 2012) and in A. gambiae/coluzzii (Carballar-Lejarazú et al., 2023). Expression of a 2A10 ScFv directly in the salivary glands of An. stephensi reduced sporozoite infectivity to cultured hepatocytes, and transmission to mice of chimeric Plasmodium berghei expressing CSP from P. falciparum (Sumitani et al., 2013). Likewise, expression of a different CSP-binding ScFv in transgenic A. coluzzii decreased the sporozoite’s ability to infect cultured hepatocytes and to cause malaria in mice (Triller et al., 2017).

We inserted the 2A10 ScFv coding sequence within the endogenous open-reading frame of the essential Lp gene, preserving Lp function and exploiting a natural proteolytic cleavage site to separate the fusion protein moieties during their secretion. Using a mouse model of malaria, in which a transgenic rodent Plasmodium berghei strain expresses CSP from P. falciparum, we show a strong decrease in the ability of the genetically engineered mosquitoes to transmit Plasmodium. In a second step, we tested different CRISPR/Cas9-based GD designs to force the spread of the Lp::Sc2A10 transgene in laboratory mosquito populations. A first, suppression GD disrupting the wild-type (WT) Lp locus revealed haploinsufficiency of the Lp gene, precluding this approach. Other GD versions were designed to home into and disrupt the Saglin pro-parasitic gene on the X chromosome. These GD also expressed guide RNAs targeting WT Lp, promoting homing of Lp::Sc2A10 on the second chromosome. This dual homing at both the Saglin and Lp loci resulted in the simultaneous spread of the two transgenes in caged mosquito populations. In modified mosquitoes, sporozoite transmission should be reduced by two distinct mechanisms, i.e., depriving Plasmodium from its Saglin agonist plus attacking sporozoites with the ScFv. Each of the Saglin and the Lp loci were targeted with multiplexes of three gRNAs, to increase the chance that failed homing events result in loss-of-function Lp mutations that would be eliminated by natural selection, and loss-of-function, GD-resistant Saglin alleles that should still contribute to decrease vector competence. One homing-refractory functional allele was however observed at the Lp locus.

Results

Development of an engineered Lp allele encoding an anti-sporozoite factor while preserving Lp function

The two most abundant proteins secreted in Anopheles hemolymph are the nutrient transporters Lipophorin (Lp) and Vitellogenin (Vg), as illustrated by Coomassie staining of electrophoresis gels revealing both proteins as the major visible bands in hemolymph extracts (Figure 1A and Rono et al., 2010). While Vg is induced in mosquito females only upon blood feeding and wanes within 3 days as eggs develop, Lp is expressed constitutively, with a further spike of expression after blood feeding (Attardo et al., 2005; Rono et al., 2010). We reasoned that Lp protein abundance, secretion in hemolymph and persistence of expression outside gonotrophic cycles make Lp a particularly attractive host gene to co-express and secrete high levels of synthetic anti-Plasmodium factors. Here we tested a 2A10 scFv version without fusion to Cecropin as antimalarial effector, and hereinafter refer to this effector as Sc2A10. Using the CRISPR-Cas9 system, we knocked-in codon-optimized Sc2A10 in frame after the endogenous first Lp coding exon, which encodes the Lp secretion signal peptide (Figure 1B, for sequence of the plasmid used for knock-in see Supplementary file 1A). As a result, transcription of the chimeric Lp::Sc2A10 mRNA encodes the natural Lp signal peptide followed by Sc2A10 fused to the remainder of the Lp protein sequence. A natural furin proteolytic cleavage site located between the ApoLpII and ApoLpI subunits of the Lp polypeptide allows their separation during maturation in the Golgi apparatus (Smolenaars et al., 2005). We duplicated this motif to detach Sc2A10 from ApoLpII during protein maturation. The knock-in design also introduced silent mutations in the majority of possible Cas9 sgRNA target sites within Lp exon 1 and the beginning of intron 1, to facilitate selection of multiple sgRNAs targeting WT Lp, but not its engineered allele, when designing subsequent GDs. Finally, the 1644-bp first intron immediately following Lp exon 1 offered an ideal location to host a fluorescent selection marker to identify and track the modified gene. We placed a GFP marker gene under control of the synthetic 3xP3 promoter (Horn and Wimmer, 2000) and D. melanogaster Tubulin56D terminator in this intron, with care taken to preserve the intron splice junctions and in reverse orientation relative to Lp transcription so that the Tub56D terminator would not cause premature arrest of Lp mRNA transcription. The Lp promoter is active in the fat body, while the 3xP3 promoter is active in the nervous system. These synthetic modifications in the Lp locus are schematized in Figure 1B and annotated in the provided sequence file (Supplementary file 1B).

Characterization and modification of the endogenous Lipophorin gene.

(A) Coomassie staining of electrophoresed hemolymph proteins. Mosquitoes were injected with the indicated double-stranded RNA to silence either Vg or Lp as described (Rono et al., 2010) and offered a blood meal after 2 days. Hemolymph was collected 42 hr post blood feeding. (B) Scheme (not to scale) depicting the insertion of synthetic sequences into the Lp gene and secretion of the Sc2A10 single chain antibody from fat body cells. The Signal Peptide (SP) was recoded to remove gRNA target sites. Sc2A10 immediately follows the SP and ends with a RFRR furin cleavage site (red arrow) for separation from ApoLpII in the secretory pathway. This site is duplicated from the ApoLpI/II natural furin cleavage site found downstream. Fat body cells of mosquitoes bearing the Lp::Sc2A10 transgene are thus expected to constitutively secrete Sc2A10, ApoLpII and ApoLpI in the hemolymph. (C) Spontaneous dynamics of Lp::Sc2A10 transgene frequency over 17 generations. Between 1200 and 9100 neonate larvae in generations 1, 2, 3, 4, 7, 10, 11, 12, and 17, and 522 larvae in generation 16, were analysed by COPAS flow cytometry. The proportions of homozygotes (Hom, highest eGFP intensity), heterozygotes (Het, intermediate eGFP intensity) and eGFP negative (Neg) were estimated for each analyzed generation by gating each larval population in the COPAS software. Counts are provided in Supplementary file 2. (D) Western blot with anti-ApoLpII antibody on hemolymph samples from 10 female mosquitoes. First and last lanes: protein size ladder (molecular weights indicated), second lane: hemolymph from WT mosquitoes. Lanes c, d: hemolymph from homozygous Lp::Sc2A10 mosquitoes. Failed cleavage between scFv and ApoLpII would result in a 13 kDa molecular weight upshift compared to the control. Lanes a, b: hemolymph from mosquitoes expressing a distinct Lp::ScFv fusion not further discussed in this work.

Figure 1—source data 1

Coomassie staining of an SDS-PAGE gel with electrophoresed hemolymph proteins.

Mosquitoes were injected with the indicated double-stranded RNA to silence either Vg or Lp and offered a blood meal after 2 days. Hemolymph was collected 42 hr post blood feeding.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig1-data1-v3.pdf
Figure 1—source data 2

Coomassie staining of an SDS-PAGE gel with electrophoresed hemolymph proteins.

Unlabelled version of Figure 1—source data 1.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig1-data2-v3.pptx
Figure 1—source data 3

Western blot with anti-ApoLpII antibody on hemolymph samples from 10 female mosquitoes.

First and 7th lanes: protein size ladder, second lane: hemolymph from WT mosquitoes. Lanes c, d: hemolymph from homozygous Lp::Sc2A10 mosquitoes. Lanes a, b: hemolymph from mosquitoes expressing a distinct Lp::ScFv fusion not further discussed in this work.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig1-data3-v3.pdf
Figure 1—source data 4

Western blot with anti-ApoLpII antibody on hemolymph samples from 10 female mosquitoes.

Unlabelled version of Figure 1—source data 3.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig1-data4-v3.zip

Using automated flow cytometry-based (COPAS) selection of live neonate larvae, based on differential GFP expression between homozygotes and heterozygotes (Marois et al., 2012), we established two stocks of Lp::Sc2A10 mosquitoes, one heterozygous, the other homozygous. The homozygous stock was fertile and viable, devoid of obvious fitness cost. This indicates that the transgenic insertion into Lp did not disrupt its essential functions in development, physiology, flight, or reproduction. A more careful evaluation of Lp::Sc2A10 fitness costs was conducted by following the dynamics of the transgene in the heterozygous population over 17 generations. This revealed slow disappearance of the transgene over time (Figure 1C and Supplementary file 2) indicative of a subtle fitness cost that decreased transgene frequency by an average of 2.3% each generation. In fertility assays comparing WT and homozygous transgenic females, the latter consistently engendered fewer progeny than their WT sisters, pointing to a negative impact of the Lp modification on their reproductive capacity (Supplementary file 3).

The Lp::Sc2A10 transgene directs Sc2A10 secretion into mosquito hemolymph

To test whether the Sc2A10 single-chain antibody was expressed and secreted in hemolymph via the Lp signal peptide, we extracted hemolymph from transgenic female mosquitoes and analyzed its protein content by mass spectrometry. Because the Lp::Sc2A10 gene fusion produces a single mRNA, with the endogenous Lp signal peptide addressing the entire fusion protein to the secretory pathway, the Sc2A10 protein fragment must initially be stoichiometric to the Lp subunits ApoLpI and ApoLpII. Upon proteolytic cleavage dissociating Sc2A10, ApoLpII, and ApoLpI and after their secretion into the hemolymph, each moiety possibly follows a different fate. In two mass spectrometry samples from the hemolymph of homozygous transgenic mosquitoes, for a total of 2629 peptides from the largest Lp subunit ApoLpI, we detected 672 peptides from smaller ApoLpII and 18 from Sc2A10 (Table 1). Corrected for size, this suggests that Sc2A10 molecules are 10- to 20-fold less abundant in the hemolymph compared to ApoLpI and ApoLpII. This observation suggests that while Sc2A10 is made and secreted into hemolymph, its disappearance by degradation, uptake in cells or stickiness to tissue, is faster than that of its sister Lp proteins. Of note, western blots using anti-ApoLpII antibodies on hemolymph samples from homozygous transgenic mosquitoes showed no size upshift for ApoLpII, confirming that Sc2A10 is properly released from ApoLpII (Figure 1D). Overall, we observed higher Lp concentrations in heterozygous compared to homozygous mosquitoes, and a three to fourfold lower Sc2A10: Lp ratio in heterozygotes compared to homozygotes, indicating that the chimeric proteins from Lp::Sc2A10 are less expressed than from WT Lp.

Table 1
Mass spectrometry identification of peptides from Lipophorin and Sc2A10 in hemolymph from transgenic mosquitoes and wild-type sibling controls.

The table shows the total number of peptide spectra detected in each hemolymph sample for the two Lp subunits and for Sc2A10. Hemolymph was collected from homozygous (hom) and heterozygous (het) transgenic mosquitoes. Relative, normalized abundance of these peptides in the protein sample, calculated by dividing their spectral count by the respective protein’s molecular weight (kDa) and by the total spectral counts from known abundant hemolymph proteins found in the sample (ApoLpIII, APL1C, LRIM1, Nimrod, Phenoloxidase, and TEP1), is indicated in parentheses. Resulting values were multiplied by a constant factor equal to the average number of spectra from these control proteins across samples.

SampleApoLpIApoLpIISc2A10
WT control2075 (5.8)486 (5.1)0 (0)
hom Sc2A10, sample 11627 (5.1)405 (4.8)11 (0.4)
hom Sc2A10, sample 21002 (4.4)267 (4.4)7 (0.3)
het Sc2A10, sample 11557 (10.1)351 (8.7)2 (0.1)
het Sc2A10, sample 22290 (6.0)664 (6.7)2 (0.1)

The Lp::Sc2A10 transgene decreases Plasmodium transmission

To assess whether the amount of Sc2A10 present in hemolymph can affect Plasmodium transmission, we infected homozygous transgenic mosquitoes and their control wild-type siblings and allowed parasites to develop for 16–20 days, before exposing naïve mice to be bitten by groups of 10 infected mosquitoes per mouse. The Plasmodium berghei strain we employed, Pb-PfCSPhsp70-GFP, expresses GFP at a high level under control of the constitutive hsp70 promoter and has its native CSP substituted with that from P. falciparum (Manzoni et al., 2014; Triller et al., 2017 and see Materials and methods), which is the antigen recognized by 2A10. Only mosquitoes displaying GFP parasites visible through the cuticle were used to infect mice. We controlled that each mouse was bitten by at least six infected mosquitoes, with exceptions indicated in Supplementary file 4, by counting the blood-engorged females.

Consistent with previous reports (Isaacs et al., 2011; Isaacs et al., 2012; Sumitani et al., 2013), Sc2A10 significantly reduced transmission of Pb-PfCSP (p<0.0001). Only 29.7% (11/37) of mice exposed to Lp::Sc2A10 homozygous infected mosquitoes developed parasitemia, compared to 97.1% (33/34) exposed to infected control mosquitoes (Figure 2A and Supplementary file 4A). Additionally, 6 of the 11 mice that did become infected by transgenic mosquitoes experienced a 1 day delay in the development of detectable parasitemia in the blood (Supplementary file 4A), indicative of reduced liver infection (Reuling et al., 2020).

Infection status of mice bitten by Sc2A10-expressing vs. WT mosquitoes infected with Plasmodium.

Mosquito genotype and number of mice exposed to infectious mosquito bites is indicated below the bar for each condition. (A) Comparison of the percentages of infected mice after exposure to the bites of homozygous transgenic Lp::Sc2A10 mosquito females or their wild-type siblings, infected with a Plasmodium berghei strain expressing P. falciparum CSP. Aggregated data from 11 independent experiments performed over a period of two years were analyzed using Fisher’s exact test with a two-tailed p-value (p<0.0001). (B) Comparison of mouse infection upon exposure to heterozygous transgenic Lp::Sc2A10 mosquito females or their wild-type siblings, aggregated data from 5 independent experiments (p=0.0006). (C) Mice exposed to WT or homozygous Lp::Sc2A10 mosquitoes infected with either P. berghei expressing P. falciparum CSP or P. berghei expressing endogenous P. berghei CSP (single experiment, p=0.0286). (D) Mice exposed to WT or to SagGDvasa Gene Drive and Lp::Sc2A10 carrying mosquitoes, infected with a Plasmodium berghei strain expressing P. falciparum CSP (single experiment, p=0.0082).

We examined if the transmission-reducing activity of the Lp::Sc2A10 transgene is dependent on the dosage of Sc2A10, that is whether a single copy of the transgene would be as efficient as two. For this we exposed naive mice to groups of 10 infected mosquitoes carrying zero, one or two Lp::Sc2A10 copies. While 17 out of 18 mice bitten by control mosquitoes became infected, only 4 out of 12 mice bitten by heterozygous mosquitoes became infected (Figure 2B and Supplementary file 4B). Two-tailed Fisher’s exact test shows a statistically significant reduction when comparing wild-type and heterozygous (p=0.0006) mosquitoes regarding their Plasmodium-transmitting capacity. Therefore, heterozygous mosquitoes showed a transmission blocking activity comparable to that seen in homozygotes.

To verify that the transmission-blocking phenotype of the Lp::Sc2A10 transgene was specific to CSP from P. falciparum, we performed a control bite-back experiment comparing Pb-PfCSPhsp70-GFP to its Pb-hsp70-GFP parental parasite strain expressing endogenous PbCSP. While Lp::Sc2A10 and wild-type mosquitoes transmitted the control P. berghei strain to mice with equal efficiencies (n=5/5 and 4/4 mice infected, respectively), only the WT mosquitoes transmitted Pb-PfCSPhsp70-GFP (n=3/3 mice infected), whereas Lp::Sc2A10 mosquitoes blocked transmission of the PfCSP-expressing strain (n=0/4 mice infected). This indicates that the transmission blocking capacity of the Sc2A10 transgene is indeed PfCSP-specific (Figure 2C and Supplementary file 4C).

Testing a suppression gene drive homing into wild-type Lp to push Lp::Sc2A10 toward fixation

To push the Lp::Sc2A10 anti-Plasmodium gene towards fixation in a mosquito population, our first strategy was to employ a transiently acting Cas9-based GD destroying the wild-type Lp gene (Figure 3A). This aimed to exploit the natural tendency of suppression GDs that target an essential gene to initially spread in the population only to be supplanted, over time, by GD-immune functional mutants of the target gene (Hammond et al., 2017; Champer et al., 2018; Carballar-Lejarazú et al., 2022). Here Lp::Sc2A10 itself, lacking the gRNA target sites, would play the role of a GD-immune, functional Lp mutant allele. The advantage of this approach was that a Cas9 and gRNA-carrying transgenic GD cassette inserted in Lp need not persist indefinitely in the population, being supplanted by the technologically more benign Lp::Sc2A10 transgene. To minimize the spontaneous emergence of undesirable additional GD-immune and functional Lp alleles, we used a multiplex of 4 gRNAs targeting Lp. The rationale was that in cases of failed GD homing, multiple Cas9 cuts repaired by non-homologous end joining (NHEJ) would mainly generate loss-of-function alleles in the essential Lp gene (e.g. deletions between Cas9 cut sites, frameshifts at several individual cut sites) doomed to be eliminated by natural selection. We constructed a DsRedNLS-marked Lp suppression GD (Figure 3A and annotated sequence in Supplementary file 1C), in which an array of 4 gRNAs separated by tRNAs (Xie et al., 2015; Port and Bullock, 2016), targeting Lp but not Lp::Sc2A10, were expressed under control of a single U6 promoter. Cas9 was placed under the control of zpg regulatory elements, currently considered best for use in suppression GDs due to tighter restriction of Cas9 activity to the germ line (Kyrou et al., 2018; Hammond et al., 2021). Knocking-in this GD into the Lp locus was achieved by injecting this plasmid into >800 mosquito eggs carrying a heterozygous copy of GFP-marked Lp::Sc2A10, in order to retain a protected functional copy of Lp during the disruption of wild-type Lp by Cas9. Genomic insertion in injected embryos relied on expression of the construct’s own CRISPR/Cas9 components supplemented with an additional heterozygous copy of a YFP-marked vasa-Cas9 transgene in the embryos.

Insertion of a Lipophorin suppression gene drive and its expected and unexpected outcomes.

(A) Scheme of the suppression drive construct. Upon chromosome cleavage by Cas9 (shown by scissors), homologous recombination (gray shading) via 5’ and 3’ regions of homology (HR) is expected to insert the intervening elements (gRNA-encoding array, zpg-Cas9 expression cassette, DsRedNLS marker cassette) into the beginning of the Lp gene, disrupting its function. Note that this recombination event knocking out the essential Lp gene was designed to occur in the presence of an intact Lp::Sc2A10 sister chromosome, not shown in the scheme but that contributed to the unexpected outcome shown in B. (B) Most knock-in events unexpectedly arose from compound recombinations between the cleaved WT chromosome and both the repair template plasmid and the intact Lp::Sc2A10 sister chromosome, resulting in insertion of the gene drive elements genetically linked to the Lp::Sc2A10 transgene. A hypothetical scheme interpreting the compound insertion is shown. It was inferred from the genetic linkage observed between GFP and DsRedNLS, and from sequencing a PCR product obtained with primers AG105 and EM890 (indicated). ∆ indicates a 500 bp deletion in the cloned Lp 3’region, which arose following micro-injection of the plasmid because one of the gRNA target sites was retained by error in this part of the construct (indicated by scissors). Presence of the gRNA-tRNA array (green boxes +yellow arrows) was confirmed by drive activity in presence of a vasa-Cas9 transgene.

By screening for the presence of red fluorescence in the G1 progeny of about 140 surviving injected G0 mosquitoes, we recovered several dozens of knock-in G1 larvae (most of which were DsRedNLS and GFP positive) and examined transgene inheritance by crossing them to wild-type mosquitoes. In this cross, DsRedNLS marking the Lp-GD construct was expected to strictly segregate away from GFP marking the Lp::Sc2A10 allele. Puzzlingly however, the majority of knock-in larvae contained a compound Lp locus harboring the DsRedNLS-marked GD cassette strictly linked to the GFP-marked Lp::Sc2A10 transgene. Sequencing PCR products spanning parts of this insertion confirmed that, instead of the expected insertion of the Lp-GD cassette, a complex chromosomal rearrangement (Figure 3B) had repaired the Cas9-cleaved wild-type chromosome by incorporating the entire injected plasmid, and by recombining with the intact sister chromosome bearing the Lp::Sc2A10 transgene. The resulting unintended transgenic modification at the Lp locus harbored all the components of a classical payload-bearing GD that we hereinafter refer to as GFP-RFP. Similarly to the Lp::Sc2A10 allele, the GFP-RFP Lp allele was homozygous viable, functional Lp protein being expressed from its Lp::Sc2A10 moiety. In spite of the presence of the zpg-Cas9 and gRNA-encoding cassettes in the GFP-RFP allele, it was inherited in about 50% of male or female progenies, demonstrating little homing activity of the GFP-RFP locus after crosses to WT, except for the appearance of rare GFP-only or RFP-only progeny larvae, raising concern about the efficiency of the zpg-Cas9 and/or the gRNA-expressing cassettes. Providing an independent copy of vasa-Cas9 on a different chromosome rescued this defect and resulted in high homing rates of various segments from the GFP-RFP cassette (mostly GFP alone, more rarely DsRedNLS alone or both) (Figure 4A), indicating that at least some of the gRNAs in the tRNA-spaced array were active and that the defect was in zpg-Cas9 expression.

Characterization of the two types of Lp-GD integration events.

(A) The GFP-RFP line showed high homing rates when complemented with an independent vasa-Cas9 transgene. COPAS diagrams show the fluorescence of progeny neonate larvae from heterozygous GFP-RFP mosquitoes (third chromosome) that also carried a non-fluorescent, puromycin resistance-marked vasa-Cas9 transgene (second chromosome, heterozygous), crossed to non-fluorescent partners (WT* indicates non-fluorescent partners actually carrying one copy of the puromycin resistant vasa-Cas9 transgene, not influencing the crossing outcome). N indicates the total number of larvae analyzed in the diagrams; percentages of larvae of each fluorescence are indicated. Non-fluorescent progeny would amount to 50% in the absence of homing. Note that the percentage of GFP-RFP is close to 50%, mainly reflecting Mendelian inheritance of the parental transgene. Thus most homing events involved only a GFP-containing segment from the parental GFP-RFP transgene. Rarer instances of RFP-only segment homing (arrows) were accompanied by a decrease of DsRed fluorescence intensity, indicating that the 3xP3 promoter is less active than in the GFP-RFP context. Total homing amounts to ((40.7+53.1 + 1.8)–50) x2=91.2% in males, ((33.5+52.6 + 0.5)–50) x2=82.2% in females. (B) Haploinsufficiency at the Lipophorin locus. Photograph shows larval and pupal progeny from heterozygous Lp-GD crossed to heterozygous Lp::Sc2A10. Right panel focuses on a subset of larvae observed under fluorescent light. Larvae that inherited one copy of the Lp-GD loss-of-function allele (red eyes) and one copy of Lp::Sc2A10 (green eyes/brain) are developmentally delayed and will die before adulthood. Individuals that inherited a WT Lp copy and either modified allele will complete development, with strong loss of fitness for WT/Lp-GD individuals (red-eyed pupa).

Fortunately, we also recovered a minority of knock-in larvae that had integrated the Lp-GD construct as expected, marked with DsRedNLS only (Figure 3A). However, no evidence of gene drive was observed in further generations, as DsRed inheritance did not exceed 50% when crossing heterozygotes to WT. On the contrary, DsRed frequency dropped rapidly in F2 and F3 generations, indicating that the non-functional GD cassette inserted in Lp conferred a strong fitness cost. Most heterozygous mosquitoes carrying one copy of Lp-GD and either GFP-RFP or Lp::Sc2A10 (both of which should be refractory to homing of the GD construct) showed a striking developmental delay and died before adulthood (Figure 4B). Heterozygous mosquitoes carrying Lp-GD / WT survived to adulthood but were small and short-lived. These observations indicate that WT Lp is largely haplo-insufficient in presence of a Lp loss-of-function allele, even more so if WT Lp is replaced by Lp::Sc2A10. This last point is consistent with the observed fitness cost and lower Lp expression from the Lp::Sc2A10 allele, that already suggested that albeit functional, this allele is inferior to the wild-type.

From the haplo-insufficiency of Lp we concluded that it was impossible to create a loss-of function GD in this locus, precluding an indirect same-locus GD approach. In addition, the zpg promoter appeared to have low activity when integrated in the Lp locus.

Driving Lp::Sc2A10 distantly from Saglin with a zpg-Cas9 gene drive

To host a GD promoting the spread of Lp::Sc2A10, we turned our attention to the mosquito Saglin locus, which encodes a Plasmodium agonist (Okulate et al., 2007; Ghosh et al., 2009; O’Brochta et al., 2019; Klug et al., 2023). Indeed, while not leading to complete Plasmodium transmission blockage, the loss of Saglin reduces parasite prevalence and loads, reduces transmission, is homozygous viable and has no obvious fitness cost at least in laboratory conditions (Klug et al., 2023). Similar to an antimicrobial combination therapy, combining Sc2A10 expression with the knockout of Saglin can be expected to reinforce the transmission-blocking properties of each strategy taken alone. Therefore, we sought to disrupt Saglin with a gene drive cassette that would home into wild-type Saglin and concomitantly promote Lp::Sc2A10 homing into the Lp locus (Figure 5A).

Designs of Saglin-based gene drives that also promote Lp locus modification and scheme of the chromosome conversion process.

(A) Gene drive cassette comprising Cas9 (under control of the zpg promoter) and an array of 7 gRNA-coding modules, inserted disruptively in the endogenous Saglin open reading frame on chromosome X along with a 3xP3-DsRedNLS fluorescence marker used to track the genetic modification. Three gRNAs, each expressed under control its own U6 promoter, target wild-type Saglin (purple arrow) and promote homing of the gene drive cassette. Four gRNAs separated by a repeated glycine tRNA are expressed under control of one U6 promoter, and target wild-type Lipophorin on chromosome 2 R (symbolized by yellow arrow) to promote Lp::Sc2A10 homing. (B) Updated SagGDvasa gene drive construct comprising six gRNAs, each under control of its own U6 promoter, and Cas9 under control of the vasa promoter and SV40 terminator sequences. (C) Western-blot using Saglin antibodies showing the absence of Saglin protein in the salivary glands of dissected SagGDvasa homozygous females. The same membrane was re-probed with serum from a human volunteer regularly bitten by mosquitoes, providing a loading control with salivary and carcass protein signals.

Figure 5—source data 1

Western-blot using Saglin antibodies showing the absence of Saglin protein in the salivary glands of dissected SagGDvasa homozygous females (left image).

The same membrane (right image) was re-probed with serum from a human volunteer regularly bitten by mosquitoes, providing a loading control with salivary and carcass protein signals.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig5-data1-v3.pdf
Figure 5—source data 2

Western-blot using Saglin antibodies showing the absence of Saglin protein in the salivary glands of dissected SagGDvasa homozygous females.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig5-data2-v3.zip
Figure 5—source data 3

Western blot using serum from a human volunteer regularly bitten by mosquitoes, providing a loading control with salivary and carcass protein signals.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig5-data3-v3.zip

The zpg promoter still seemed an attractive choice to build a GD dually targeting Saglin and Lp, to avoid drawbacks from other characterized germline promoters (high maternal Cas9 deposition resulting in failed homing events in the zygote accompanied by the formation of GD refractory alleles; possible somatic mosaic loss-of-function of wild-type Lp leading to haplo-insufficiency in heterozygous [Lp::Sc2A10 /+] mosquitoes). To exclude that the low zpg-Cas9 activity we previously observed at the Lp locus was due to overlooked mutations in our construct, we subcloned the zpg-Cas9 cassette from a validated GD construct (Kyrou et al., 2018) and incorporated it in a Saglin knock-in plasmid expressing Cas9, DsRedNLS, 3 gRNAs directed against Saglin and 4 gRNAs against Lp (Figure 5, and annotated sequence of this plasmid in Supplementary file 1D). Multiplexing the gRNAs was intended to promote the formation of loss-of-function alleles in case of failed homing at the Lp and Saglin loci: non-functional alleles of the essential Lp gene would be eliminated by natural selection, while non-functional Saglin alleles would reduce vector competence. From injection of this plasmid into heterozygous Lp::Sc2A10/WT embryos, we crossed 36 G0 male survivors to WT, and recovered more than 60 transgenic G1 individuals. The sole source of Cas9 in this injection was the knock-in GD plasmid itself, showing that zpg-Cas9 was efficiently active at least for initial insertion. 100% of the G1 transgenics arising from injected males were females, an indication that the construct had correctly homed onto the X chromosome, where Saglin is located. In addition, all G1 transgenics had also inherited a copy of Lp::Sc2A10 (GFP positive), instead of the expected 50%. This suggests that the GD construct acted on the Lp locus, causing either efficient Lp::Sc2A10 homing already in the germ line of G0 males, and/or the death of larvae that did not inherit a protected Lp copy due to the toxicity of the construct’s Lp gRNAs.

In spite of the efficiency of zpg-Cas9 for initial integration, this first Saglin GD (termed SagGDzpg) showed disappointingly modest homing levels at both the Saglin and Lp loci in the G2 generation (Figure 6A). Using COPAS flow cytometry, we examined GFP and DsRed inheritance in 2327 larvae that arose from the pooled G1 females crossed to WT males. It showed 57.7% GFP inheritance (Lp::Sc2A10 locus) compared to 50% expected in the absence of homing. DsRed inheritance was more difficult to assess, as the low intensity of red fluorescence did not allow accurate gating to separate red fluorescent from negative larvae on COPAS diagrams. Approximate gating completed with visual examination of a sample of 200 larvae suggested 54.1% DsRed inheritance at the Saglin locus, an even more modest inheritance bias than for GFP at the Lp locus. Mild homing could be explained by position effects affecting the activity of the zpg promoter, by a lack of recombination at the target loci, or by inefficiency of gRNAs. To distinguish among these possibilities, we generated females carrying single heterozygous copies of the three unlinked transgenes SagGDzpg, Lp::Sc2A10 and a non-fluorescent (puromycin resistance-marked) vasa-Cas9. The progeny of these triple-transgenic females crossed to WT males showed markedly better homing rates (>79% GFP inheritance) (Figure 6B). Thus, vasa-Cas9 was able to significantly rescue the modest homing rate of zpg-Cas9 from SagGDzpg, resulting in an efficient split GD. This suggests that the cloned zpg promoter sequence is sensitive to positional effects, being poorly active when inserted in Saglin or Lp in contrast to other previously reported host loci such as DSX or Nudel (Kyrou et al., 2018; Hammond et al., 2021).

Sag-GDzpg triggers modest homing at the Lp locus, which can be rescued by vasa-Cas9.

(A) COPAS analysis of the progeny from [SagGDzpg/+; Lp::Sc2A10/+] females crossed to WT. Weak DsRed fluorescence does not allow accurate separation of DsRed +and DsRed- larvae. Note that GFP inheritance is only slightly higher than the 50% expected in the absence of homing. (B) COPAS analysis of the progeny from triple transgenic [SagGDzpg /+; Lp::Sc2A10/+; vasa-Cas9/+] females crossed to WT. Note the higher GFP homing rate. 6% of individuals appeared to be homozygous, revealing either unexpected homing in early embryos due to maternal Cas9 deposition, or accidental contamination of the cross with a few transgenic males. DsRed positive and negative larvae were indistinguishable with the COPAS settings used for this experiment.

We maintained one mosquito population of Lp::Sc2A10 combined with SagGDzpg (initial allele frequencies: 25% and 33%, respectively) and measured genotype frequencies after seven generations. This showed an increase in the frequency of both alleles (G7: GFP allelic frequency = 59.2%, phenotypic expression of DsRed in >90% of larvae, n=4282 larvae), indicating that the modest GD strength of SagGDzpg was still able to increase the frequency of the SagGDzpg allele over time and counteract the Lp::Sc2A10 fitness cost.

Driving Lp::Sc2A10 distantly from Saglin with a vasa-Cas9 gene drive

In order to achieve a stronger GD that may push Lp::Sc2A10 to fixation, we re-built the Saglin GD construct, replacing zpg with the vasa promoter to control Cas9 expression (SagGDvasa), in spite of this promoter being known for causing maternal deposition of Cas9 mRNA and/or protein, potentially resulting in undesired zygotic and somatic mutation at gRNA target loci.

We initially made two versions of SagGDvasa: one carrying the complex array of seven gRNAs described above for SagGDzpg (as in Figure 5A); another carrying six tandem U6-gRNA units (Figure 5B; sequence provided in Supplementary file 1E). Both yielded similar results in early generations of the new mosquito lines. We focused all subsequent analyses on the latter version expressing three gRNAs against Saglin and three against Lp, because its fluorescent marker (3xP3-DsRed) proved easier to track in neonate larvae than OpIE2-DsRed marking the tRNA-containing version (the OpIE2 promoter integrated in the Saglin locus only became active late in larval development).

About 35 surviving G0 injected male mosquitoes (which were homozygous for Lp::Sc2A10 to prevent any premature damage on Lp), outcrossed to WT females, yielded about 20 DsRed positive G1 females and no positive male, again an indication of proper insertion of the GD cassette onto the X chromosome, where Saglin is located. These G1 females (heterozygous at both SagGDvasa on the X chromosome and Lp::Sc2A10 on the second chromosome) developed normally to adulthood and were fertile when crossed to wild-type males. High homing rates at both loci were recorded in G2 by examining the progeny of the individual G1 females backcrossed to WT males, a large majority of progeny inheriting both a SagGDvasa copy (DsRedNLS) and a Lp::Sc2A10 copy (GFP) (Table 2).

Table 2
The SagGDvasa GD shows high homing rates in the G2 generation at both the Lp and Saglin loci.

Six individual SagGDvasa G1 females mated to WT males oviposited in individual tubes and their larval progeny was scored visually for GFP and DsRed fluorescence. Homing rates are calculated as the percentage of WT chromosomes converted to transgenic, i.e.: ((inheritance rate)–50%)x2.

Female #Total larvaeNegativesGFP + onlyDsRed + onlyGFP + DsRed +GFP inheritance and homing rate(Lp locus)DsRed inheritance rate, homing rate(Saglin locus)
18900089100 %100 %, 100%
25204048100 %92.3%, 84.6 %
35900059100 %100%, 100 %
45906053100 %89.8%, 79.6 %
55005045100 %90%, 80 %
65703054100 %94,7%, 89.4 %

We then sought to examine the homing rates at the two loci at a larger scale, using COPAS flow cytometry to analyse the progeny from [SagGDvasa/Y; Lp::Sc2A10/+] males backcrossed en masse to wild-type females, and from [SagGDvasa/+; Lp::Sc2A10/+] females backcrossed en masse to wild-type males. The male cross yielded only 405 larvae, of which 391 were GFP positive (GFP inheritance: 96.5%, corresponding to a homing rate of 93%). DsRed on the X chromosome was, as expected, passed on to 50% of the progeny (daughters). The female cross yielded 5197 larvae showing 95.1% GFP inheritance and 80.7% DsRed inheritance, corresponding to homing rates of 90.2% at the Lp locus and 61.4% at the Saglin locus.

Thus, in contrast to zpg, the vasa promoter was highly active in germ cells when inserted in the Saglin locus. The selected gRNAs, or homing at the Lp locus, appeared to be more effective than at the Saglin locus. Efficient homing lifted doubt on the activity of Lp and Saglin gRNAs in the GD construct, or on the propensity of the Saglin locus to undergo homologous recombination.

To verify that SagGDvasa abolished Saglin expression, we dissected salivary glands from control and homozygous DsRed +mosquito females, and subjected them to western blotting using anti-Saglin antibodies. As expected, Saglin was undetectable in SagGDvasa mosquitoes (Figure 5C).

Temporal dynamics of the SagGDvasa and Lp::Sc2A10 transgenes

We split the DsRed and GFP double-positive [SagGDvasa/Y; Lp::Sc2A10/+] G2 males in two groups and crossed them to WT females, to establish two independent mosquito populations with a starting (G0) frequency of the autosomal Lp::Sc2A10 transgene of 25%, whereas X-linked SagGDvasa frequency was 33.3%. We maintained the two populations for >31 generations and, after 10 and 16 generations, derived six additional populations from the basal ones by outcrossing to WT. Populations 3 and 4 were established by mixing randomly selected transgenic mosquitoes (both males and females of generation 10) from populations 1 and 2, respectively, with wild-types, to mimic what may occur in a mixed-sex field release. Populations 5–8 were established by crossing single-sex transgenic mosquitoes to WT of the opposite sex, both to mimic a single-sex field release and to re-assess homing efficiency after 16 generations. To examine the long-term dynamics of both transgenes, we exploited GFP fluorescence from Lp::Sc2A10 and DsRed fluorescence from SagGDvasa to COPAS-analyze successive generations of all populations, with large sample sizes, over a long period of time (>2 years for populations 1 and 2). COPAS analyses allowed not only to distinguish negative from transgenic larvae but also, at least partially, heterozygotes from homozygotes for each transgene. Visual examination of the successive COPAS diagrams provides an accurate sense of the temporal dynamics of both transgenes generation after generation, and an appreciation of sample sizes (see snapshots of COPAS diagrams in Supplementary file 5). Figure 7 offers a graphical representation of the same data, after extracting approximate percentages of larvae of each genotype from the COPAS diagrams. In all populations, mosquitoes lacking Lp::Sc2A10 disappeared rapidly, and all young populations rapidly consisted of a majority of homozygous Lp::Sc2A10 mosquitoes (Figure 7 and Supplementary file 5). Despite the absence of physical linkage between the two transgenes, DsRed-only individuals were strikingly absent from all early populations, indicative of the lethality of the SagGDvasa transgene in the absence of a protected Lp allele. Importantly, toxicity of SagGDvasa was due to its destructive action on the Lp locus rather than to a fitness cost of its disrupted Saglin host locus, since individuals carrying both DsRed and GFP thrived in all populations, and consistent with the reported absence of obvious fitness cost of Saglin mutants (Klug et al., 2023). Several populations (notably populations 1, 3, 4, 5, 6, 7) rapidly seemed fixed for Lp::Sc2A10. A trend for reversal, with Lp::Sc2A10 progressively giving way to GFP negative individuals (presumably functional Lp mutants refractory to homing), was observed from G14 on for population 2, although GFP positive individuals still represented a large majority of the population (>90% from G1 on), while GFP allele frequency reached 0.98 at G8 before decreasing and oscillating between 0.71 and 0.92 after G14. For the Saglin locus, COPAS diagram interpretation must take into account the position of this gene on the X chromosome, with male mosquitoes bearing a single copy and appearing in the same larval cloud as heterozygous females (dosage compensation of the transgene not being apparent at this locus). Drive will be slower as it can occur only in females. While the majority of mosquitoes of all populations rapidly carried at least one copy of SagGDvasa, we observed that a substantial fraction of DsRed negative individuals (up to 30%), likely carrying GD refractory Saglin mutants, persisted in some populations (Figure 7 and Supplementary file 5).

Temporal dynamics of the Sag-GDvasa and Lp::Sc2A10 transgenes in 8 mosquito populations.

Transgenic mosquitoes carrying both transgenes were crossed to wild-type of the other sex (populations 1, 2, 5, 6, 7, 8) or mixed with wild-types (populations 3, 4) as indicated above the diagrams, and the frequency of each transgene in 1000–4000 neonate larvae of successive generations was tracked by flow cytometry (COPAS) using the GFP fluorescent marker of Lp::Sc2A10 and the DsRed fluorescent marker of Sag-GDvasa. Calculated transgene frequency, taking homozygous and heterozygous larvae into account (continous lines), and percentage of fluorescent mosquitoes (dotted lines) are shown on the graphs. For the autosomal transgene, frequency of each genotype in the population was calculated as([2 x(number of homozygotes)+number of heterozygotes]/ 2 x(total number of larvae]). For the X-linked transgene, frequency was ([2 x(number of homozygotes)+number of heterozygotes]/ 1.5 x(total number of larvae]). Numbers of larvae were obtained by gating corresponding clouds of larvae on COPAS diagrams (see Supplementary file 5) and recording the associated percentage measured by COPAS software, or by opening COPAS files and gating in WinMDI software. Gating was approximate due to partial overlap between different clouds of larvae. Supplementary file 5 shows strips of all COPAS diagrams that served to extract this data, which provide a more accurate sense of transgene dynamics over generations.

Detection of homing-refractory Saglin mutants

As a non-essential gene, Saglin is likely to accumulate mutations in evolving mosquito populations due to failed homing events of the GD construct associated with NHEJ repair at the three gRNA target sites. Indeed, DsRed negative mosquitoes (lacking the GD construct in Saglin) persisted at a relatively stable frequency of approximately 30% in populations 2 and 3 (Figure 7). To characterize Saglin mutants, we COPAS-extracted 750 and 150 DsRed-negative larvae from a surplus of larvae from generation 4 of population 1 and generation 3 of population 2. DsRed-negative individuals represented 18 and 31% of these populations, respectively, with the Saglin gene on their X chromosome having been exposed to between one and four rounds of Cas9 activity. We PCR amplified a Saglin fragment spanning the 3 gRNA target sites, and subjected the amplicon to high-throughput sequencing. While the majority of sequenced DsRed negative alleles still corresponded to wild-type Saglin having thus far escaped GD activity, a wide variety of Saglin mutations, different between the two sampled populations, were readily identified (Figure 8a and b). Interestingly, a majority of these Saglin haplotypes were mutated only at the target site of gRNA2, suggesting that this gRNA was the most active of the three and that Cas9, confronted to a pool of three Saglin and three Lp gRNAs, will not necessarily cleave all target sites in a given germ cell. However, combinations of mutations at gRNA1, gRNA2 and/or gRNA3 target sites were also identified. Several haplotypes were consistent with iterative action of Cas9 in lineages of haplotypes, a specific mutation occurring either singly, or associated to one or two additional mutations at the other gRNA target sites. Deletions spanning two gRNA target sites were rare in our samples (one instance of such a haplotype was detected, carrying a deletion between gRNA1 and gRNA2). Overall, Cas9 was not highly active at the Saglin locus, some target sites being missed at each generation and combinations of mutations accumulating iteratively as germ cells were exposed to Cas9 in successive generations. Therefore, the target locus of a multiplex gRNA GD experiencing failed homing at a given generation resulting in mutation of one target site may still undergo successful homing in later generations, as long as all gRNA targets are not yet mutated. Inexorably however, Saglin mutants fully refractory to the GD will form in mosquito populations; we recovered at least one haplotype with mutations in all three target sites after four generations (Figure 8a).

Characterization of mutations in target genes.

(A, B) Characterization of Saglin failed homing mutations. A PCR product spanning the three Saglin gRNA target sites was amplified from 150 DsRed-negative larvae from generation 4 of population 1 (A) or from 750 DsRed-negative larvae from generation 3 of population 2 (B) and subjected to high-throughput amplicon sequencing. The different Saglin mutant haplotypes discovered in each sample are aligned to the WT sequence (top) with target site and protospacer-adjacent motifs (PAMs) indicated. Arrows point to Cas9 cleavage sites. Deleted nucleotides are highlighted in green, inserted nucleotides in blue. // indicates portions of WT sequence not represented on the figure. The distance between two gRNA target sites (number of nucleotides) is indicated above the WT sequence. (C) gRNA target sites and failed homing-induced mutations in the Lp gene. The WT sequence of the 5’ region of the Lp gene shows exon and intron sequences, the position of gRNA target sites with PAMs (red), and the ATG initiator codon (underlined). Nucleotides shown in orange were deleted in twelve sequenced homozygous mutant mosquitoes. An additional, 11 bp deletion in the intron, distant from gRNA target sites (red) was unexpected.

Appearance of a GD-refractory Lp mutant

NHEJ mutants in Lp were expected to emerge at much lower frequency than Saglin mutants in evolving populations, given that Lp is an essential gene under strong selective pressure. While tracking the frequency of transgenes in [SagGDvasa; Lp::Sc2A10] mosquitoes, we noted the appearance of a few GFP negative larvae in populations 2 and 3. These amounted to 2.4% of total larvae in generation 14 of population 2. We COPAS-isolated a sample of these larvae and grew them to adulthood, expecting that they might die during development due to unrescued deleterious mutations in Lp. However, these GFP negative mosquitoes developed to healthy and fertile adults. Sequencing the Lp gene in 12 individuals revealed that all were homozygous for the same array of mutations within two of the three Lp gRNA target sequences (Figure 8c). One mutation deleted three nucleotides before the PAM of gRNA2, removing a single valine from the Lp signal peptide (MWVLGGRRLLWSFLVSLVLIQSVSA, missing valine underlined). The other is a 5-base deletion within the target of gRNA3 in the first Lp intron. Viability of the homozygous mutant indicates that this combination of mutations, while rendering Lp refractory to Cas9-mediated gene conversion, preserved Lp function. This suggested that (i) the first of the three gRNA expressed from the gRNA array did not act; and (ii) combinations of mutations preserving the function of target essential genes can emerge despite the cumulative activity of two gRNAs, which in this case was certainly facilitated by the fact that one of them targeted an intron, more permissive to change.

Genetic instability of the gRNA array

The gRNA array in the SagGDvasa construct being a repetitive tandem of six U6-gRNA units, genetic instability may be expected and observable after several generations of mosquito breeding. We examined transgene integrity in 48 individual mosquitoes of the 32nd generation after transgenesis, by genotyping DsRed-positive males, which possess a single gene drive copy on their X chromosome. PCR primers were chosen to span the gRNA array. Resulting amplicons were examined on agarose gels (Figure 9) and sequenced. Interestingly, two derivative alleles of the gene drive construct dominated the four sampled mosquito populations: a longer version that still retained five of the original six gRNAs, and a shorter version that retained only two gRNAs. The original transgenesis vector used for microinjection was resequenced and verified to contain all six gRNA expression units; therefore, deletions occurred post integration in the mosquito genome. gRNA deletions probably began to occur early in the evolution of the transgenic populations, since the same deletion of the first Lp gRNA was detected in both populations 1 and 2, separated at the third generation following transgenesis and subsequently bred independently for 29 generations before sampling. The larger deletion of 4 gRNAs was not observed among the 12 sampled males from population 2, whereas it was the most frequent allele in population 1 and its two daughter populations 5 and 7. This larger deletion may have arisen from a further loss of gRNA units in the allele carrying 5 gRNAs, since Lp gRNA1 is missing in both alleles, its position occupied by Lp gRNA3 (Figure 9). The early loss of Lp gRNA1 likely explains the lack of any mutation at its target site in the homing-refractory Lp mutant identified above. Regardless of the number of missing gRNA units, the Cas9 part of the transgene appeared to be intact in these mosquitoes (Figure 9C). Interestingly, both deleted versions in principle retain the capability to promote homing at both Saglin and Lp target loci, as even the short form carries one active gRNA against each gene. However, since the single remaining Lp gRNA is targeting the Lp intron, this shorter GD derivative would easily select for novel homing-refractory Lp mutants and this derivative gene drive is likely to be much less durable.

PCR genotyping of 31st generation individual Sag-GDvasa mosquitoes reveals deletions in the gRNA array.

(A) PCR amplicons spanning the six initial gRNAs in Sag-GDvasa were generated from 12 individual male mosquitoes (carrying a single transgene copy) from each of populations 1, 2, 5, and 7, 31 generations after initial transgene integration (corresponding to the indicated generation number for each tracked population) and resolved on agarose gels with 1 kb +DNA ladder (Thermofisher) as a size marker (upper panels). Arrows point to examples of PCR products specific of the transgene as confirmed by Sanger sequencing; other bands are PCR artefacts. Sanger sequencing of amplicons of types A and B showed that they contain only five and two residual gRNA coding units, respectively, as schematized in panel (B). (C) The same deletions were detected again 10 generations later (left panel). PCR primers amplifying Cas9 were used in parallel (right panel), to verify the presence of the Cas9 part of the transgene. ‘–‘ signs indicate control PCRs performed on wild-type genomic DNA. Sample loading order is identical in the two panels.

Figure 9—source data 1

The top part and the bottom part of each gel image was cropped to exclude empty space and re-arranged horizontally to generate Figure 9A.

For labels, see Figure 9A.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig9-data1-v3.pdf
Figure 9—source data 2

The top part and the bottom part of each gel image was cropped to exclude empty space and re-arranged horizontally to generate Figure 9A.

For labels, see Figure 9A.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig9-data2-v3.zip
Figure 9—source data 3

The top part and the bottom part of each gel image was cropped to exclude empty space and re-arranged horizontally to generate Figure 9A.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig9-data3-v3.zip
Figure 9—source data 4

The bottom parts of these gel images was cropped to constitute the left and right panels of Figure 9C.

For labels, see Figure 9C.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig9-data4-v3.pdf
Figure 9—source data 5

The bottom part this gel image was cropped to constitute the left panel of Figure 9C.

For labels, see Figure 9C.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig9-data5-v3.zip
Figure 9—source data 6

The bottom part this gel image was cropped to constitute the right panel of Figure 9C.

https://cdn.elifesciences.org/articles/93142/elife-93142-fig9-data6-v3.zip

Vector competence of [SagGDvasa; Lp::Sc2A10] mosquitoes

We expected that the combination of Sc2A10 expression with Saglin loss-of-function would enhance the Plasmodium transmission-blocking phenotype. To assess this, we mixed [SagGDvasa; Lp::Sc2A10] mosquito larvae from the 20th generation of population 2 with an equal number of non-fluorescent wild-types. The resulting cage of adults was blood-fed on a mouse infected with Pb-PfCSPhsp70-GFP. Seventeen days later, females carrying visible GFP parasites were selected and split into six cups of 10 transgenic, and four cups of 10 WT. All four mice exposed on day 18 to the infected control females developed parasitemia, whereas all six mice exposed to infected transgenics remained negative (Supplementary file 4D). Six additional mice were exposed to 8–12 bites from [SagGDvasa; Lp::Sc2A10] oocyst-carrying females of the 4th generation of population 6, corresponding to the 23rdgeneration since transgenesis. Only two of these six mice developed parasitemia 6 days after infection (Supplementary file 4E). While the small scale of these experiments cannot strictly confirm whether the Saglin knockout enhanced protection against transmission (especially as in these experiments we discarded less-infected mosquitoes, which are expected to result from Saglin loss-of-function), the absence of infection in a total of 10 out of 12 mice, in contrast to 4 mice out of 4 infected when exposed to infected WT mosquitoes (Figure 2D), showed that [SagGDvasa; Lp::Sc2A10] mosquitoes maintained a markedly decreased ability to transmit Plasmodium after >20 generations of existence.

Discussion

We hijacked an essential gene, Lipophorin (Lp), to force Anopheles coluzzii mosquitoes to co-express an anti-malarial factor. The choice of the Lp gene was motivated by its exceptionally strong expression level (Lp being the most abundant constitutively expressed protein in mosquito hemolymph) and by its endogenous signal peptide, which we could exploit to obtain concomitant secretion of Sc2A10 with Lp protein. The existence of an endogenous proteolytic cleavage site within the Lp protein, that we duplicated to detach Sc2A10 from Lp, was also advantageous, as well as the natural intron immediately following the signal peptide-encoding exon 1 that could accept a visual selection marker for easy tracking of the genetic modification. This approach is related to the integral gene drive strategy (Hoermann et al., 2021) in that anti-malarial factors are expressed together with an endogenous gene, but here the modified endogenous gene does not comprise any component of a gene drive —in the case of integral gene drives, gRNAs are inserted in a synthetic intron. The genetic modification does not disrupt expression or function of the Lp essential gene. On the contrary, Lp protein expression is intended to remain as unaffected as possible, but obligatorily proceeds through translation of the Sc2A10 antimalarial factor inserted between the Lp signal peptide and the rest of the Lp protein. This design minimizes the risk of spontaneous transgene loss by mutation, since frameshift or nonsense mutations in the Sc2A10 coding sequence would prevent Lp expression, resulting in their elimination by natural selection. Furthermore, the absence of repeated motifs in the synthetic sequence decreases the risk of in-frame deletions. The possibility of a loss of the transgene’s anti-Plasmodium activity should therefore be limited to missense mutations or in-frame deletions arising in the Sc2A10 coding sequence, or to Plasmodium evolution, notably under selection pressure imposed by the transgene itself (Marshall et al., 2019). However, the 2A10 antibody targets a highly repeated epitope on the CSP protein (the NANP motif), that, in addition to being repetitive, is also conserved across P. falciparum strains. A combination of mutations leading to the complete loss of this epitope in Plasmodium therefore seems unlikely, and would probably cause a dramatic loss of parasite fitness as CSP is required in several processes in the sporozoite’s journey between two hosts (Coppi et al., 2011; Balaban et al., 2021).

Hijacking Lp and its signal peptide is an approach that could be widely applicable to other possible factors acting in the hemolymph to attack various parasite stages, such as ookinetes, which represent a particularly vulnerable stage of parasite development in the mosquito. To make mosquitoes that express and combine additional secreted factors against parasites, Vitellogenin (AGAP004203) could also be engineered in the same manner, taking advantage of its own signal peptide, extremely high expression level but also transient induction following a blood meal. Blood meal inducibility would be particularly suitable for antimalarial factors specifically targeting ookinetes, as they emerge on the hemolymph-bathed side of the midgut exactly within the short time window when Vitellogenin is expressed. Mosquitoes would not be exposed during their development to a factor expressed from Vg, limiting potential fitness costs. As proposed by Hoermann et al., 2021 Carboxipeptidase (Cp) represents an additional attractive host locus for antimalarial factors, sharing many of the advantages of Vg. A single GD expressing multiplexed gRNAs could stimulate the simultaneous spread of Lp, Vg and Cp modified, anti-parasitic alleles.

In spite of the high Lp protein secretion in mosquito hemolymph, we only detected less than 1/10 of this molecular amount for Sc2A10 in hemolymph by mass spectrometry. Apart from technical limitations in detection sensitity (e.g. biased trypsin digestion of some peptides) this could be explained by faster removal from the hemolymph and /or faster degradation of Sc2A10 compared to Lp. Different, more stable anti-Plasmodium peptides that could accumulate to higher levels may show even better efficacy as transmission-blocking agents compared to Sc2A10. This also highlights the benefit of choosing a strong promoter such as that of Lp to ensure maximal production of antimalarial effectors in the hemolymph. A single copy of the Lp::Sc2A10 transgene still showed a reduction in transmission. Of note, the rodent model of malaria used here (P. berghei expressing CSP from P. falciparum) is characterized by very high infection rates, typically producing dozens of oocysts per midgut, each of which can release hundreds of sporozoites in mosquito hemolymph. The ability of secreted Sc2A10 to decrease sporozoite transmission even in this high infection context is highly encouraging, given the much lower levels of P. falciparum (typically 1 to a few oocysts) in field infections. An even greater anti-Plasmodium activity of Sc2A10 may be reached by fusing it to antimicrobial peptides such as CecropinA, as achieved by Isaacs et al. in conventional transgenic An. stephensi mosquitoes (Isaacs et al., 2011; Isaacs et al., 2012) and subsequently in the first published GD for An. stephensi (Gantz et al., 2015). In these studies, the Sc2A10::CecropinA fusion was expressed intermittently under the control of the blood-meal inducible Vitellogenin promoter, and combined with a second scFv targeting Plasmodium falciparum ookinete Chitinase 1 also expressed after blood meals under the control of the Cp promoter. While the insertion of Sc2A10::CecropinA within Lp coding sequences may further improve the efficiency of our approach, there is a risk that CecropinA expressed at all developmental stages, and an increased complexity of the Lp fusion protein, worsen the fitness cost already observed in Lp::Sc2A10 mosquitoes.

To force the spread of the Lp::Sc2A10 transgene in mosquito populations, we tested several gene drive (GD) designs. A same-locus suppression drive was also installed in the Lp gene, creating a loss-of-function allele. The Lp::Sc2A10 allele was intended to act as an R1-type, gene drive refractory functional allele (Champer et al., 2018) that would supplant the suppression gene drive and invade the population. This was unsuccessful, as Lp proved largely haplo-insufficient. In contrast, distant-locus GDs disrupting Saglin, a non-essential but pro-parasitic gene, were efficient at promoting invasion of both the Saglin, and particularly the Lipophorin, modified alleles. Unlike the first approach, this design may allow Cas9 and gRNA-coding genes to persist indefinitely within the invaded mosquito population (unless nonfunctional resistance alleles outcompete the drive allele in the long run). Although for this reason we initially preferred the same-locus approach in which Lp function disruption by the insertion of CRISPR/Cas9 components caused their gradual disappearance by natural selection, the added benefit of a GD installed in Saglin is that it should further reduce the transgenic mosquitoes’ vectorial capacity, a combination of two distinct mechanisms to decrease sporozoite transmission being more robust to combat Plasmodium durably.

Importantly, we observed that same-locus or distant-locus constructs carrying guide RNAs that target wild-type Lp are inviable, and rapidly go extinct in the absence of a recoded Lp allele such as Lp::Sc2A10 (or spontaneous Lp mutants immune to GD that may arise in GD populations). The genetic design established here can be viewed as a two-component GD in which one component (Lp::Sc2A10) has no drive capacity by itself but (i) rescues the lethality, and (ii) hitchhikes on the drive capacity of the other (SagGDvasa) ensuring its own hyper-Mendelian spread. The two transgenic loci are, therefore, reciprocally dependent on each other: Lp::Sc2A10 depends on SagGD for its long-term persistence and spread in a population, and SagGD depends on Lp::Sc2A10 as a rescue allele of the essential Lp target for its survival. This design can be seen as a two-locus variation of rescue-type GDs (Adolfi et al., 2020; Champer et al., 2020a).

Because Saglin knockout mutants bear no fitness cost at least in laboratory conditions, GD-refractory Saglin alleles generated by failed homing events are certain to accumulate over time (all the more so as their lack of toxicity toward the WT Lp allele confers them a high selective advantage compared to SagGD). If the demise of the Saglin GD occurs sufficiently late, Lp-Sc2A10 could still reach high levels or even fixation in a mosquito population. If, however, GD refractory mutations in Saglin accumulate rapidly and no longer support Lp::Sc2A10 maintenance, the elimination of both SagGDvasa and Lp::Sc2A10 will be inexorable. Thus wild-types alleles are likely to re-establish at both loci once the frequency of active Saglin GDs drops, especially under conditions of strong mosquito immigration from regions adjacent to the initial GD spread range. Still, even as genetic resistance to the GD develops, the resulting high frequency of Saglin loss-of-function mutant alleles arising from failed homing events, with their transient selective advantage while SagGDvasa and wild Lp alleles co-exist, should decrease global vector competence.

Once a GD installed in the Saglin locus is defeated by the accumulation of GD-refractory mutations, new generations of GD installed at different loci could be launched to re-ignite the spread of the Lp::Sc2A10 allele. For instance, GDs built for the same mosquito species in the frame of other projects could also incorporate gRNAs re-igniting the spread of Lp::Sc2A10, promoting antimalarial approaches similar to combination therapies. In this respect, transgenic systems permitting the expression of multiplexes of many gRNAs would be instrumental. Some of the constructs presented here incorporate multiplex gRNAs combining individual U6-gRNA cassettes with a U6-gRNA::tRNA quadruple gRNA expression cassette, with the drawback of displaying many repeated motifs (U6 promoters, multiple units of tRNAglycine, gRNA invariable region). Genetic instability of these constructs, with loss of gRNA expression segments, was prominent in our experiments. This is illustrated by the high prevalence, in our tracked mosquito populations, of a GD derivative allele carrying only two residual U6-gRNA expression units, from the original tandem of six. Luckily, this deletion allele still retains driving potential for both the Saglin and Lp loci, but it would take only one additional recombination event to reduce the array to a single gRNA. This would result either in a Saglin-only, non-lethal, GD allele, which may continue to reduce vectorial capacity of the mosquito population by mutating Saglin, or in a non-driving Saglin mutant still able to promote some Lp::Sc2A10 spread by a split GD effect (but particularly able to generate Lp R1-type mutants given the intronic target of the single residual gRNA). We are currently working to improve gRNA multiplex design by increasing the number and variety of tRNA spacers, so that the 76 bp constant region of each gRNA would be the only remaining repeated element. To further optimize future GD design, modeling studies can now aid in determining the optimal number of gRNAs in a multiplex, depending on the specific GD design and purpose (Champer et al., 2020b).

In addition to this and to the stabilization of multiplex gRNA arrays, other paths to improvement of the system presented here include avoiding gRNAs targeting intronic sequences, and the use of promoters better restricted to the germline to control Cas9 expression and limit GD refractory mutation emergence. Interestingly, the zpg promoter that in theory possesses this advantage showed low activity once inserted in the Lp and Saglin loci, in contrast to the DSX or Nudel loci (Hammond et al., 2016; Kyrou et al., 2018). This suggests that the zpg promoter is more sensitive to the local chromatin context than the vasa2 promoter, similarly to the sds3 promoter in Aedes aegypti (Anderson et al., 2023), and that its usability in GD constructs may be restricted to a subset of genomic loci. The nanos promoter (Gantz et al., 2015; Terradas et al., 2022; but see Hammond et al., 2021) may represent an interesting alternative. Finally, tighter clustering of gRNA target sites at target homing loci, especially Saglin, should improve gene drive performance by reducing the length of DNA sequences flanking the cut site that bear no homology to the repair template on the sister chromosome and need to be resected by the repair machinery to allow homing (López Del Amo et al., 2020).

A simpler design to promote the spread of antimalarial factors such as Sc2A10 in mosquito populations would be a single-locus GD (for example installed in Saglin or other pro-parasitic genes if the idea of consolidating the anti-Plasmodium activity via two mechanisms is retained). Few loci, however, can provide the benefits offered here by Lp that include a suitable expression pattern, high expression, an endogenous secretion signal, endogenous proteolytic cleavage, a natural intron ideally positioned to host a fluorescent marker, and the status of essential gene that a translational fusion exploits to limit spontaneous transgene loss by mutation. Besides, adding the Cas9 and gRNA-coding cassettes to an intron of an essential gene chosen as GD host would add >5 kb of foreign DNA sequence, thereby significantly increasing the complexity of the modification and the risk of affecting functionality of the essential gene. For example, inadvertent intron splice sites in synthetic sequences can preclude proper mRNA splicing (Hoermann et al., 2022); we also encountered this problem when inserting a different anti-Plasmodium ScFv in Lp (Green, 2019).

In conclusion, the Sag-GDvasa transgene presented here constitutes a viable GD only in the presence of an engineered Lp allele, which by itself has no drive capacity but will hitchhike with Sag-GDvasa to spread at hyper-Mendelian rates. In caged mosquito populations, both genetic loci initially spread together and decrease mosquito capacity to transmit Plasmodium parasites expressing CSP from P. falciparum. Mutations at both loci, especially in Saglin that is under low selection pressure, arise due to failed homing events, have a selective advantage over the toxic SagGDvasa allele, and over time should replace the GD, so that the system carries the seeds of its own removal. The anti-Plasmodium Lp::Sc2A10 allele will likely slowly disappear due to its fitness cost, unless its spread is re-ignited by updated distant-locus GDs. Although such a reversibility could be seen as a safety advantage for modification GDs (and may be enhanced by intentionally releasing laboratory-selected resistance alleles), future work should focus on establishing GD constructs in Saglin that limit the emergence of GD refractory alleles to prolong their potential field lives.

Materials and methods

Plasmid construction

Request a detailed protocol

We used Golden Gate Cloning (Engler and Marillonnet, 2014) to assemble all parts of the Lp (AGAP001826) knock-in plasmid shown in Figure 1B in destination vector pENTRR4-ATCC-LacZ-GCTT (Addgene# 173668). The full annotated plasmid sequence is provided in Supplementary file 1B. The recoded beginning of Lp, the Sc2A10 coding sequence and intronic 3xP3-GFP-Tub56D marker cassette were ordered as synthetic DNA gBlocks (IDT DNA, Belgium) flanked by appropriate BsaI restriction sites. The Lp endogenous Furin cleavage site (RFRR) was replicated along with 3 N-terminal and 4 C-terminal flanking amino acids between the Sc2A10 and ApoLpII amino acid sequences. This, and retaining 7 endogenous nucleotides upstream of the intron 5’ splice junction after the Sc2A10 coding sequence, resulted in the addition of 7 non-natural amino acids (GIRESAA) to the N-terminus of the ApoLpII moiety. 1520 bp of 5’ and 1027 bp of 3’ flanking sequence were cloned on either side of the modified Lp sequence to be knocked-in. Adjacent to the 3’ Lp homology arm, we cloned three guide RNA (gRNA) expression modules (U6 promoter — gRNA coding sequence — terminator) that specify Cas9 cleavage within the first exon and intron of the genomic (but not recoded) Lp sequence. The three gRNA-expressing modules were prepared in pKSB-sgRNA1—3 (Addgene #173671—173673) as described (Dong et al., 2018) with gRNAs targeting the motifs: GAATCAGCACTAGCGACACCAGG, GCGTGAAATATCGTCAGGGATGG and GGAACGATGTGGGTCCTCGGTGG (PAMs underlined) in Lp. One gRNA target site (with PAM) was included on the 3’ flanking homology arm’s distal extremity to favor linearization of the donor plasmid after egg microinjection. This donor plasmid was called pENTR R4 3xgRNA Lp::Sc2A10. Plasmids encoding gene drive components for insertion into the Lp and Saglin sequences were assembled by Golden Gate Cloning in the same manner, including promoter-Cas9-terminator and 3xP3 or OpIE2-DsRedNLS-SV40 modules, the sequences of which are provided in the complete plasmid sequence (Supplementary file 1A-D). The first version of the zpg promoter was PCR amplified from A. coluzzii genomic DNA with primers GGTCTCtcagcgctggcggtggggac and GGTCTCccattctcgatgctgtatttgttgttgggctgTttgtta, zpg terminator with GGTCTCCaattGaggacggcgagaagtaatcata and GGTCTCggatatcgcataatgaacgaaccaaagg, and cloned to make BsaI Golden Gate cloning modules. The zpg-Cas9 cassette in SagGDzpg was subcloned from p17410 (Kyrou et al., 2018). The vas2 version of the vasa promoter (Papathanos et al., 2009) was re-amplified from A. coluzzii genomic DNA with primers CggtctcaATCCcgatgtagaacgcgagcaaa and CggtctcaCATAttgtttcctttctttattcaccgg to make a BsaI Golden Gate cloning module.

Cas9-expressing mosquito strains

Request a detailed protocol

Three transgenic mosquito strains with germline Cas9 expression under control of the vas2 promoter (Papathanos et al., 2009) were used as a source of eggs for microinjection or in test crosses described in the text. They were constructed by assembling vasa and Cas9 modules by Golden Gate Cloning into plasmids pDSAY, pDSARN and pDSAP, marked with 3xP3-YFP, 3xP3-DsRedNLS and puromycin resistance, respectively. The pDSARN-vas2-eSpCas9 plasmid encodes the eSpCas9 variant with reduced off-target activity (Slaymaker et al., 2016). Each plasmid was inserted in the X1 attP docking site on chromosome 2 as described (Volohonsky et al., 2015). The DsRedNLS-marked, vas2-eSpCas9 transgene was then introgressed into the Ngousso background of A. coluzzii by 8 successive backcrosses. In the case of the non-fluorescent, puromycin-resistant Cas9 transgene, homozygosity was achieved by first balancing the transgene by crossing to the YFP vasa-Cas9 line, with puromycin selection of the F1 progeny as described (Volohonsky et al., 2015). Counter-selecting YFP fluorescence in the F2 progeny of the self-crossed puromycin resistant F1 yielded the non-fluorescent, vas2-Cas9 homozygous line.

Mosquito egg microinjection and recovery of transgenics

Request a detailed protocol

Embryo microinjection to obtain the Lp::Sc2A10 transgene by CRISPR-Cas9 knockin was performed as for classical transgenesis (Volohonsky et al., 2015) with 400 ng/µl of donor plasmid DNA and addition of 2 µM of the drug Scr7 (APExBio) to the injected plasmid mix. eSpCas9-expressing Ngousso mosquitoes were used as a source of eggs for microinjection (vas2-eSpCas9, 3xP3-DsRedNLS strain). We injected the knock-in plasmid into 400 eggs, recovered 140 surviving G0 adults and out-crossed them en masse to wild-type mosquitoes. In the G1 progeny of the injected G0 males, about 100 GFP positive, putative knock-in individuals were recovered. We established independent families from ten GFP positive G1 females outcrossed to wild-type, and eliminated the Cas9 transgene (by counter-selecting 3xP3-DsRedNLS) in these families. All 10 founder females were confirmed by PCR to carry the intended transgene insertion in the target Lp locus. We pooled two families to yield the Lp::Sc2A10 line. To avoid confusion between two DsRed markers, injection of the Lp-GD suppression GD construct (DsRedNLS-marked) was performed in eggs expressing wild type Cas9 (vasa-Cas9, 3xP3-YFP G3 background strain). Injection of the SagGDzpg and SagGDvasa constructs encoding their own source of Cas9 was performed in embryos lacking any Cas9 transgene, but respectively carrying a heterozygous or homozygous copy of Lp::Sc2A10. Numbers of injected eggs and recovered transgenics are provided in the main text. Work with genetically modified mosquitoes was evaluated by Haut Conseil des Biotechnologies and authorized by MESRI (agréments d’utilisation d’OGM en milieu confiné #3243 and #3912).

COPAS analyses

Request a detailed protocol

A COPAS Select instrument (Union Biometrica) was used as described (Marois et al., 2012; Bernardini et al., 2014) to quantify fluorescent transgenes in populations of neonate mosquito larvae or to establish mixed cultures of defined proportions. The use of unfed neonate larvae in clean water was crucial for precise gating and sorting. For sorting, flow rate was kept under 20 larvae/second in Pure mode allowing superdrops. PMTs were set at 500 (GFP), 600–900 (RFP). Delay, Width, signal threshold and minimum TOF parameters were set on 8, 6, 100, and 150, respectively.

Plasmodium berghei Pb-PfCSPhsp70-GFP parasite strain

Request a detailed protocol

We generated a novel P. berghei strain combining the strong GFP fluorescence of Δp230p-GFP (Manzoni et al., 2014) with the substitution of endogenous P. berghei CSP for CSP from P. falciparum from strain Pb-PfCSP (Triller et al., 2017), in which GFP fluorescence was too faint for selecting live infected mosquitoes examined under 488 nm light. For this, 150 mosquito females were allowed to blood feed on a mouse co-infected with both parental parasite strains at a ratio of 1 strongly fluorescent Δp230p-GFP for 40 Pb-PfCSP. Sexual reproduction of P. berghei in the mosquito generates hybrid haploid sporozoites, some of which inherit both Δp230p-GFP and Pb-PfCSP. Seventen days after their infective blood meal, live female mosquitoes were screened under 488 nm light to select those displaying visible GFP sporozoites trapped at the base of their wing veins. 20 positive females were offered a blood meal on a naïve mouse. When parasitemia reached 0.1%, 3000 strongly GFP positive blood stage parasites were sorted by flow cytometry and injected intravenously into two naïve mice, only one of which developed parasitemia 11 days after passage. Its blood was then passaged into a new mouse. When parasitemia reached 0.4%, 10 new mice were injected with a blood dilution corresponding to 1 parasite each, although this number was probably underestimated as all 10 mice developed parasitemia. Of these, four mice tested PCR positive for PfCSP (PCR primers GGCCTTATTCCAGGAATACCAGTGCT / GGATCAGGATTACCATCCGCTGGTTG) and negative for PbCSP (PCR primers GAAGAAGTGTACCATTTTAGTTGTAGCGTC / TGGGTCATTTGGGTTTGGTGGTG). We selected one clone for passage into naive mice, confirmed its PCR negativity for PbCSP and positivity for PfCSP, this clone was called Pb-PfCSPhsp70-GFP.

Mosquito infections and bite-back experiments

Request a detailed protocol

Neonate larvae from the heterozygous stock of Lp::Sc2A10 mosquitoes were sorted by COPAS flow cytometry (Marois et al., 2012) to assemble a mix of equal numbers of homozygous GFP +larvae (or heterozygous, in some experiments) and negative control siblings. Maintaining the transgene in a heterozygous population ensured the absence of genetic divergence that otherwise may change vector competence between control and transgenic mosquitoes over time. Following COPAS sorting, transgenic and control larvae were co-cultured and adults kept in the same cage to equalize potential environmental influences (including unequal microbial communities) that could differentially affect the vector competence of the two genotypes if grown separately. Mosquitoes were infected together by blood-feeding from the same 12- to 24-week-old CD1 mouse, with a parasitemia between 2 and 4%. Male and female mice were used indiscriminately. Sixteen to 19 days after infection, and 1 day before biting new naive mice, mosquitoes were cold-anesthetized and examined under 488 nm light. Lp::Sc2A10 females were separated from negative control females based on fluorescence of the transgenesis marker in their eyes. In addition, any mosquito lacking visible GFP parasites (oocysts in the abdomen, sporozoites visible through the cuticle in wing veins or salivary glands) was discarded to ensure that mice were exposed only to Plasmodium-infected mosquitoes. On day 17–20, naive mice were individually exposed to groups of 10 Lp::Sc2A10 or negative control infected mosquitoes. The number of engorged mosquitoes was recorded after infectious feeding, only mice bitten by at least 6 mosquitoes were included in subsequent analyses with the exception of two mice bitten by 5 and 4 highly infected transgenic and control mosquitoes, respectively, as in this experiment the mouse bitten by the 4 control mosquitoes became infected. Mouse parasitemia was monitored by flow cytometry using an Accuri C6 SORP flow cytometer between day 4 and 12 after bite-back. Mice reaching >1.5% parasitemia were sacrificed, and mice remaining negative 12 days post infectious feeding were considered uninfected. Work on mice was evaluated by the CREMEAS Ethics committee and authorized by Ministère de l’Enseignement Supérieur et de la Recherche (MESRI) under reference APAFIS #20562–2019050313288887 v3.

Mass spectrometry analysis of hemolymph

Request a detailed protocol

Hemolymph from 25 to 30 cold-anesthetized female mosquitoes was collected directly into 1 x Laemmli buffer 48 hr post-blood feeding by clipping the proboscis and gently pressing their abdomen. Samples were precipitated and digested with trypsin, and 1/5 of the digestion product was analyzed on a Q Exactive Plus Mass Spectrometer coupled to an Easy-nanoLC1000 (Thermo). The acquired data was searched against the Anopheles UniProt database plus the Sc2A10 protein sequence using Mascot and the total number of spectra corresponding to ApoLpI, ApoLpII, Sc2A10 and a selection of additional hemolymph proteins that served for normalization were counted.

Protein gels and western blotting

Request a detailed protocol

Mosquito salivary glands or carcass were dissected in 20 µl Laemmli buffer, crushed with a pestle and denatured at 65 °C for 5 min. Samples were centrifuged for 3 min at 15,800 g, loaded on a Mini-PROTEAN TGX Stain-Free Precast Gel (BioRad) along with 6 µL of PageRuler Plus Prestained Protein Ladder (ThermoFisher) as standard and electrophoresed at 170 V using the Mini Trans-Blot cell system (BioRad). Gels were blotted on PVDF membranes (Trans-Blot Turbo Mini 0.2 µm PVDF Transfer Pack; BioRad) using the mid-range program of a Pierce Fast blotter (Thermo Fisher Scientific). Membranes were blocked for one hour in PBS + 0.1% Tween (PBST) supplemented with 5% fat-free milk powder, incubated overnight at 4 °C with primary antibody, washed three times in PBST and incubated 1 hr at room temperature in secondary antibody conjugated to horseradish peroxidase (HRP). Antibodies were diluted in PBST, 3% milk. Membranes were then washed three times for 10 min with PBS. Antibody binding was revealed using the Super signal WestPico Plus kit (Thermo Fisher). After a 1–2 min incubation, images were acquired using the Chemidoc software (Bio-Rad). Before incubation with further primary antibodies to visualize additional proteins, membranes were stripped for 20–30 min in Restore PLUS Western Blot Stripping Buffer (Thermo Fisher) and washed three times for 10 min in PBST followed by a new blocking incubation. Human antibodies used to control protein loading of salivary gland samples were obtained from 2 ml venous blood taken from a human volunteer arm-feeding Anopheles cages over several years. Blood was incubated at room temperature for 1 hr to allow coagulation and centrifuged for 10 min at ~16,000 g. Serum supernatant was aliquoted and stored at –20 °C until use. For Coomassie staining of electrophoresed hemolymph samples, hemolymph was collected 42 hr post blood feeding by clipping the proboscis of cold-anesthetized mosquitoes and gently pressing their abdomen, collecting drops of hemolymph into a pipet tip containing protein sample buffer (1 µl of sample buffer per mosquito). Samples were denatured for 2 min at 90 °C and hemolymph from 10 mosquitoes was loaded on each lane of a 4–20% 1.5 mm polyacrylamide gel (Invitrogen). After electrophoresis, gels were rinsed in water and stained in SimplyBlue safeStain solution (Thermo Fisher).

Amplicon sequencing

Request a detailed protocol

A 494 bp region of Saglin encompassing the 3 gRNA target sites was amplified from genomic DNA extracted from 150 and 750 COPAS-sorted, DsRed negative neonate larvae with the Blood and Tissue kit (Qiagen) using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermo Fisher Scientific), an annealing temperature of 68 °C and 32 amplification cycles. Resulting amplicons were gel-purified and sent for sequencing using the Genewiz AmpliconEZ service. Returned paired-end reads (250 nt length each) were assembled to form single contigs using PANDAseq version 2.11 Masella et al., 2012; unmerged reads were manually combined pairwise and added to the assembled contigs. Data was analysed using a Docker Desktop Personal version 20.10.16 (https://www.docker.com) -based CRISPResso2 version 2.2.8 Clement et al., 2019 followed by manual curation.

PCR genotyping of the SagGDvasa gRNA array

Request a detailed protocol

Genomic DNA was extracted from 48 individual pupae taken from populations 1 and 2 G29 and from populations 5 and 7 G14 (corresponding to >32 generations following initial transgenesis). A forward primer (GAAGGCGCTGCAGAAGCAGCTCG) was designed in the Saglin 5’ region and a reverse primer (gccctccatgcgcaccttgaa) in the DsRed cassette (Figure 9). PCR was performed in a total volume of 15 µL using GoTaq (Promega) (94 °C for 5 min then 45 cycles at 95 °C for 1 min, 67 °C for 20 sec, 72 °C for 3.5 min) or Phire polymerase (Thermofisher) (98 °C for 2 min then 45 cycles at 98 °C for 15 sec, 71 °C for 10 sec, 72 °C for 1.3 min), with identical results. PCR products were resolved on 1% agarose gels and the major bands at 3.2 and 1.4 kb (Figure 9, A and B type, respectively) were excised from the gel, purified and sent for Sanger sequencing (Eurofins GATC, Germany) using one PCR primer. The following amplicons were sequenced (Figure 9): two samples of several pooled large -type A- amplicons from Population 2 (pool of samples #2, 3, 4, 5, 6, 8, 9, 11, 12) and from Population 7 (pool of samples #1, 3, 7, 11, 12), as well as 4 small -type B- amplicons of Population 1 individually (samples #1, 2, 4, 6), and a pool of 4 type B amplicons from Population 7 (pooled #2, 4, 5, 6). Sequence alignments to the theoretical original plasmid used for knock-in were performed with SnapGene software. The unique, 20 bp gRNA protospacer sequences in each of the 6 gRNA coding units allowed to pinpoint which of the gRNAs had been deleted. To genotype mosquitoes for the presence of Cas9, a 1661 bp fragment of the Cas9 gene was PCR amplified with primers CAAGAGCAGACGGCTGGAAA and GGGTGGTCTGGTTCTCTCT.

Data availability

All data generated or analysed during this study are included in the manuscript and supplementary files.

References

  1. Thesis
    1. Green E
    (2019)
    Development of genetic control strategies for insect pests using CRISPR/Cas9 (phdthesis)
    Université de Strasbourg.
    1. Hollingdale MR
    2. Nardin EH
    3. Tharavanij S
    4. Schwartz AL
    5. Nussenzweig RS
    (1984)
    Inhibition of entry of Plasmodium falciparum and P. vivax sporozoites into cultured cells; an in vitro assay of protective antibodies
    Journal of Immunology 132:909–913.
  2. Report
    1. WHO
    (2021)
    World Malaria report 2021
    World Health Organization.

Decision letter

  1. Flaminia Catteruccia
    Reviewing Editor; Harvard TH Chan School of Public Health, United States
  2. Dominique Soldati-Favre
    Senior Editor; University of Geneva, Switzerland

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

https://doi.org/10.7554/eLife.93142.sa1

Author response

Point-by-point description of the revisions

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

In this study, the authors made a two-component homing modification gene drive in Anopheles coluzii with a different strategy than usual. The final drive itself targets and disrupts the saglin gene that is nonessential for mosquitoes, but important for the malaria parasite. The drive uses several gRNAs, and some of these target the Lp gene where an anti-malaria antibody is added, fused to the native gene (this native gene is also essential, removing nonfunctional resistance alleles at this locus). In general, the system is promising, though imperfect. Some of the gRNAs self-eliminate due to recombination of repetitive elements, and the fusion of the antimalaria gene had a modest fitness cost. Additionally, the zpg promoter was unable to operate at high efficiency, requiring use of the vasa promoter, which suffers from maternal deposition and somatic expression (the latter of which increased fitness costs at the Lp target). The manuscript has already undergone some useful revisions since its earliest iteration, so additional recommended revisions are fairly modest.

Line 43-45: The target doesn't need to be female sterility. It can be almost any haplosufficient but essential target (female sterility works best, so it has gotten the most study, but others have been studied too).

We agree. However, this paragraph focused on previous achievements in malaria mosquitoes, for which suppression gene drives spreading lethality rather than female sterility have not been reported to our knowledge. Even the targeting of doublesex, which is a sex determination rather than female fertility gene, results in female sterility (Kyrou et al. 2018). However, we inserted the possibility of female killing by X-shredder GD (Simoni et al., 2020).

Line 69: A quick motivation for studying Anopheles coluzii should be added here (since gambiae is discussed immediately before this).

Thank you for drawing our attention to this point. We modified the sentence to:

“Here, we present the engineering of the Lipophorin (Lp) essential gene in Anopheles coluzzii, a prominent member of the A. gambiae species complex and a major malaria vector in sub-Saharan Africa.”

Introduction section: It might be helpful to break up the introduction into additional paragraphs, rather than just two.

We followed this suggestion and broke up the introduction into 5 paragraphs to make it more breathable.

Introduction last part: The last part of the introduction reads more like an abstract or conclusions section. Perhaps a little less detail would fit better here, so the focus can be on introducing the new drive components and targets

We have followed this suggestion and substantially shortened this last part of the introduction.

Line 207-213: This material could go in the methods section. There are some other examples in the results that could be similarly shortened and rearranged to give a more concise section.

We moved the long description from lines 207-213 to the Methods as suggested, and summarized it simply as:

“Only mosquitoes displaying GFP parasites visible through the cuticle were used to infect mice.”

We emphasize this point because in subsequent experiments using Saglin knockout mosquitoes, this enrichment for infected mosquitoes will probably attenuate the Plasmodium-blocking phenotype caused by Saglin KO, since mosquitoes lacking Saglin tend to be less infected (Klug et al., 2023). Elsewhere in the Results, we still provide detailed descriptions of procedures because we believe they aid understanding and assessing the quality of the experiments.

Line 283-287: I couldn't find the data for this.

Indeed we only summarized the data about the progeny of the [zpg-Cas9; GFP-RFP] line crossed to WT, as we didn’t judge these results worth detailing. Here is our record from one such cross:

GFP-RFP females x WT males 486 (50.7%) GFP+ and 472 (49.3%) GFP- larvae

GFP-RFP males x WT females 1836 (48.9%) GFP+ and 1925 (51.1%) GFP- larvae

This shows no significant gene drive. However in these progenies, a few GFP+ and non-RFP larvae, and a few RFP+ non-GFP larvae were noted by visual examination under the fluorescence microscope, without counting them precisely. Their existence testified to some weak homing activity mediated by zpg-Cas9 in the Lp locus.

We modified the sentence as follows to support our conclusion, and we propose to leave these detailed numbers here in our response, which will be published along with the paper.

“In spite of the presence of the zpg-Cas9 and gRNA-encoding cassettes in the GFP-RFP allele, it was inherited in about 50% of male or female progenies, demonstrating little homing activity of the GFP-RFP locus after crosses to WT, except for the appearance of rare GFP-only or RFP-only progeny larvae, …”

Line 291: Replace "lied" with "was".

Done.

Line 356: Homing in the zygote would be considered very unusual and is thus worthy of more attention. While possible (HDR has been shown for resistance alleles in the zygote/early embryo), this would be quite distinct from the mechanism of every other reliable gene drive that has been reported. Is the flow cytometry result definitely accurate? By this, I mean: could the result be explained by just outliers in the group heterozygous for EGFP, or perhaps some larvae that hatched a little earlier and grew faster? Perhaps larvae get stuck together here on occasion or some other artifact? Was this result confirmed by sequencing individual larvae?

We agree with your skepticism, especially given that the same is not seen in Suppl Figure 2A with a similar genotype setup, i.e., the vasa gene drive at the Lp locus, or in the G1 of populations 6 or 8 at the Saglin locus (Suppl. File 2). Unfortunately, it would take too much time at this point to re-create this line (which has been discarded) to re-examine this issue. Therefore, we acknowledge that another explanation than homing in the zygote may account for this result. Based on our empirical experience COPAS outputs are reliable: such outliers from the heterozygous population are usually not seen, and we always sort neonate larvae a few hours from hatching. Those 6% homozygous-looking larvae may come from a contamination with male pupae when female pupae were manually sorted for the cross to WT males, a human error that we cannot exclude. In this case, the true GFP inheritance would be closer to 79% than to 85%. For these reasons, we must back up from our initial statement as follows:

“The progeny of these triple-transgenic females crossed to WT males showed markedly better homing rates (>79% GFP inheritance).”

And edit the figure legend of Figure 4B to account for the alternative possibility of a contamination with males:

“6% of individuals appeared to be homozygous, revealing either unexpected homing in early embryos due to maternal Cas9 deposition, or accidental contamination of the cross with a few transgenic males.”

Results in general: Why is there no data for crosses with male drive heterozygotes? Even if some targets are X-linked, performance at others is important (or did I miss something and they are all X-linked). I see some description near line 400, but this sort of data is figure-worthy (or at least a table).

For the only example of functioning split gene drive at the Lipophorin locus on chromosome III, we do show homing results from heterozygous GD males in Suppl. Figure 2A (91.2% homing in males inferred from ((40.7+53.1+1.8)-50)χ2). We added this calculation of the homing rates in the figure legend. For full drive constructs in the Saglin locus on chromosome X (our final functional design), in addition to the data described in the text near line 400, male data showing “teleguided” homing at the Lipophorin locus on chromosome II is shown in Suppl. File 2 (see G2 of population 7, showing close to 100% homing at the GFP locus); the same data (less easy to assess) being converted into the G2 point of the graphs in Figure5.

Lines 362-367: What data (figure/table) does this paragraph refer to?

We apologize for the fact that this sentence was misleading. In this population, the genotype frequencies were not tracked at each generation but measured once after 7 generations. We rephrased (now lines 401-403) and now provide the measured values directly in the text:

“We maintained one mosquito population of Lp::Sc2A10 combined with SagGDzpg (initial allele frequencies: 25% and 33%, respectively) and measured genotype frequencies after 7 generations. This showed an increase in the frequency of both alleles (G7: GFP allelic frequency = 59.2%, phenotypic expression of DsRed in >90% of larvae, n=4282 larvae),”

Lines 405-406: There may be a typo or miscalculation for the DsRed inheritance and homing rate here. Should DsRed inheritance be 90.7%?

Thank you for spotting this. You are right, DsRed inheritance would be 90.7% if the homing rate were 81.4% as we mistakenly wrote. Actually DsRed inheritance was really 80.7% so our mistake was in calculating the homing rate: 61.4% is the correct value ((80.7-50)χ2), now corrected in the manuscript.

Figure 5: The horizontal axis font size for population 8 is a little smaller than the others.

True. Corrected.

Line 454: In addition to drive conversion only occurring in females and the somatic fitness costs, embryo resistance from the vasa promoter would prevent the daughters of drive females from doing drive conversion. This means that drive conversion would mostly just happen with alleles that alternate between males and females.

We agree with this idea, although the impact of this phenomenon will depend on the extent of resistance allele formation in early embryos. We observed (Figure 6) that failed homing mutagenesis in Saglin is not that intense, the sequenced non-drive alleles that were exposed 1-4 times to mutagenic activity in females either being mostly wild-type, or carrying mutations that often still left one or two gRNA target sites intact and vulnerable to another round of Cas9 activity. Therefore, alleles passed on from female to female may still undergo drive conversion to a large extent, that future experiments may be able to quantify.

Line 481: Deletions between gRNAs certainly happen, but I wouldn't necessarily expect this to be the "expectation". In our 2018 PNAS paper, it happened in 1/3 of cases. There were less I think in our Sciences Advances 2020 and G3 2022 paper. All of these were from embryo resistance from maternal Cas9 (likely also the case with your drive due to the vasa promoter). When looking at "germline" resistance alleles, we have recently noticed more large deletions.

We agree that the early embryo with maternally deposited Cas9 is probably the most prominent source of mutations at gRNA target sites. Perhaps naïvely we imagined that it would be easier for cells to repair two closely spaced DNA breaks by eliminating the intervening sequence, rather than stitching each break individually. Given that we sequenced many alleles carrying a single mutation, the lack of larger deletions may be explained by lower rates of Cas9 activity in Saglin, with mostly a single break at a time, due to limiting Cas9 amounts and their partial saturation with Lp gRNAs, and/or lesser accessibility of the Saglin locus compared to Lipophorin… We deleted the phrase “Contrarily to our expectation”.

Figure 6C: It may be nice to show the wild-type and functional resistance sequence side-by-side.

Done

Lines 642-644: This isn't necessarily the case. At saglin, the nonfunctional resistance alleles may still be able to outcompete the drive allele in the long run. This wasn't tested, but it's likely that the drive allele has at least some small fitness costs.

We agree. We inserted this comment in a parenthesis in the text (now lines 644-645):

“Unlike the first approach, this design may allow Cas9 and gRNA-coding genes to persist indefinitely within the invaded mosquito population (unless nonfunctional resistance alleles outcompete the drive allele in the long run).”

A few comments on references to some of my studies:

Champer, Liu, et al. 2018a and 2018b citations are the same paper.

Duplicate in our reference library. Corrected.

For Champer, Kim, et al. 2021 in Molecular Ecology, there was a recent follow-up study in eLife that shows the problem is even worse in a mosquito-specific model (possibly of interest as an alternate or supporting citation): https://elifesciences.org/articles/79121

Citation added (line 68).

One of my other previous studies was not cited, but is quite relevant to the manuscript: https://www.science.org/doi/10.1126/sciadv.aaz0525

This paper demonstrates multiplexed gRNAs and also models them, showing their advantages and disadvantages in terms of drive performance. Additionally, it models and discusses the strategy of targeting vector genes that are essential for disease spread but not the vectors themselves (the "gene disruption drive"), showing that this can be a favorable strategy if gene knockout has the desired effect (nonfunctional resistance alleles contribute to drive success).

Your 2020 study will indeed now be useful to inform the design of multiplex gRNAs for various gene drives designs, in terms of number of gRNAs, distribution of their target sites, necessity to generate loss-of-function rather than functional resistance allele in the target gene (such as our Lp and Saglin pro-parasitic genes). The notion of Cas9 saturation with increasing gRNA numbers is also important. When we initiated this project in 2018, we only had intuitive notions that multiplex gRNAs could improve the durability of GD and increase the chances of resistance alleles to be loss-of-function. We thus arbitrarily maximized the number of gRNAs for each of the two targets: 3 for each target in one design, 3 and 4 in another, which, according to your modelling, is luckily close to the optimal numbers for each locus. We now cite your paper as a GD design tool in the discussion about pathways to optimizing our system:

“To further optimize GD design, modeling studies can now aid in determining the optimal number of gRNAs in a multiplex, depending on the specific GD design and purpose (Champer et al., 2020).

In addition to this and to the stabilization of multiplex gRNA arrays, other paths to improvement (…)”

This one is less relevant, but is still a "standard" homing modification rescue type drive that could be mentioned (and owes its success to multiplexing): https://www.pnas.org/doi/abs/10.1073/pnas.2004373117

The recoded rescue method was also used in mosquitoes (albeit without gRNA multiplexing) by others, so this may be a better one to mention: https://www.nature.com/articles/s41467-020-19426-0

We added the two references on what is now Line 663:

“Lp::Sc2A10 depends on SagGD for its long-term persistence and spread in a population, and SagGD depends on Lp::Sc2A10 as a rescue allele of the essential Lp target for its survival. This design can be seen as a two-locus variation of rescue-type GDs (Adolfi et al., 2020; Champer et al., 2020)”

Referees cross-commenting

Other comments look good. One thing that I forgot to mention: for the 7-gRNA construct with tRNAs, the authors mentioned that it was harder to track, but it sounds like they obtained some data for it that showed similar performance. Even if this one is not featured, perhaps they can still report the data in the supplement?

This GD required examination of the mosquitoes at late developmental stages, such as the pupa, to score red fluorescence under control of the OpIE2 promoter, that is unfortunately late-active when expressed from the Lp locus. We precisely scored only the first 128 pupae arising from the progeny of the first obtained G1 [SagGD/+ ; Lp-2A10/+] females crossed to WT males. Among these:

– 115 were GFP+, DsRed+ (89.8%)

– 12 were GFP+, DsRed- (9.3%)

– 1 was GFP-, DsRed- (<1%)

This allowed us to roughly estimate the homing rates at 98.2% at the Lipophorin locus and 79.7% at the Saglin locus, which is similar to the other construct without tRNA spacers.

These approximate rates were confirmed by visual examination of progenies in two subsequent generations of [SagGD/+ ; Lp-2A10/+] males and females backcrossed to WT.

Reviewer #1 (Significance (Required)):

Overall, this study represents a useful advance. Aside from being the first report for gene drive in A. coluzii, it also is the first that investigates the gene disruption strategy and is the first report of gRNA multiplexing in Anopheles. The study can thus be considered high impact. There are also other aspects of the study that are of high interest to gene drive researchers in particular (several drives were tested with some variations).

We are grateful for your positive, constructive and in-depth analysis of our study!

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

The authors initially created a transgenic mosquito colony expressing the Sc2A10 antibody fused to the lipid transporter Lipophorin, and tested the transmission-blocking activity of this transgene. Building off of previous findings that the Sc2A10 antibody inhibits sporozoite infectivity when expressed in mosquito salivary glands, the authors showed that found it was also efficient at inhibiting sporozoite infectivity when secreted into the hemolymph expressed under the lipophorin endogenous promoter in An. coluzzii. They then designed and tested two different gene drives utilizing the Sc2A10-Lipophorin fusion protein. In the first, the authors used a recoded allele of Lp-Sc2A10 while simultaneously utilizing gRNAs that targeted endogenous Lp in an effort to select for mosquitoes that expressed transgenic Lp-Sc2A10 due to the essential nature of Lp. However, this drive was unsuccessful because recoded Lp is necessarily heterozygous while the GD is entering the population, and Lp proved to be largely haploinsufficient. Further, the zpg promoter expressing cas9 was not effective in promoting homing of the gRNAs. In the second gene drive that was tested, authors made use of the endogenous Saglin locus, which expresses a natural agonist for Plasmodium, and is thus desirable to target for disruption in a gene drive that aims to reduce vector competence for Plasmodium. This gene drive also uses recoded Lp-Sc2A10 to replace the wild-type Lp allele, thus selecting for Sc2A10 expression, however this drive is not dependent on fitness of individuals with only one functional copy of Lp.

The authors discovered that the efficacy of the zpg promoter to drive homing of cas9 is locus-dependent, limiting the success of their gene drive designs. They do show, however, that the Saglin gene drive succeeds at reaching high frequencies in mosquito populations using instead the vasa promoter to express cas9, and that these transgenic mosquitoes are able to reduce infectivity of sporozoites in a bite-back mouse model. However, they observe gene drive refractory mutations in the Lp gene, despite its highly conserved nature, showcasing the difficulty of avoiding drive resistance even in small populations of mosquitoes, and also observed deletions of gRNAs targeting both Lp and Saglin, further highlighting possible shortcomings in gene drive approaches. Together, these findings are useful to the field in walking the readers through an interesting and promising approach for a novel gene drive, and illustrating the challenges in engineering an efficacious and long-lasting drive.

Major comments:

As the authors are able to observe Plasmodium within mosquitoes, it would be useful to have these data in the manuscript pertaining to the prevalence and intensity of infection in mosquitoes prior to bite-back assays. If there are data or images that the authors could include, it would be helpful to show if there is a possibility that infection intensity is a variable that contributes to whether or not mice develop an infection. It would also be interesting to note whether there is a different in infection (oocysts or sporozoites) between transgenic mosquitoes and wild type mosquitoes.

This is a valuable suggestion. Please note that, in order to evaluate the transmission-blocking properties of the Lp-2A10 allele (acting at the sporozoite level), we discarded non-infected mosquitoes prior to bite-back experiments, so that infection prevalence was 100% in the mosquitoes retained for the bite-back. We have not systematically compared parasite loads between transgenic and control mosquitoes. In some experiments comparing Lp-2A10 mosquitoes and their control, we dissected a subset of the mosquito midguts after bite-back to visually ascertain that they showed roughly equivalent oocyst numbers between transgenic and controls. However, we have not precisely recorded these data. It is possible that slightly decreased lipid availability in Lp::2A10 mosquitoes (their lipophorin allele producing slightly less Lp than the WT) negatively affects the parasite, as suggested by previous studies highlighting the role of host lipophorin-derived lipids for parasite development in the mosquito (Costa et al., Nat Commun 2018; Werling et al. Cell 2019; Kelsey et al. PLoS Path 2023).

In the case of Lp-2A10 mosquitoes additionally containing a GD in Saglin, it is expected that they should carry lower parasite numbers than their controls, an effect of the Saglin knockout mutation alone (Klug et al., PLoS Path 2023). Re-inforcing the transmission blocking effect of the 2A10 antibody by reducing parasite loads via the Saglin KO was indeed our intention. Hence, having selected the most infected mosquitoes for our bite-back experiments likely attenuated this desired effect, but we still observed a 90% transmission decrease when the two modifications were combined, compared to a 70% decrease with Lp-2A10 alone. We do not plan to perform additional infections experiments for the current manuscript on Plasmodium berghei expressing Pf-CSP, but we do intend to record parasite counts in a follow-up study with an optimized SagGD transgene and Plasmodium falciparum infections. This will be of high relevance for potential future applications in malaria control.

The authors also go into significant detail in the discussion exploring ideas of how to optimize or improve this specific gene drive design. The authors should also stress further the applicability of their discoveries in other gene drive designs, and emphasize the lessons they learned in the difficulties encountered in this study and how these findings could guide others in their decision making process when choosing targets or elements to include in a potential gene drive approach.

We feel that we already emphasized these lessons in the manuscript, in the discussion and when justifying the chosen strategies in the Results section. Lessons for future designs include:

- inserting an antimalarial factor into an essential endogenous gene, preserving its function, can provide many benefits (high expression level, secretion signal that can be hijacked, endogenous introns can be hijacked to host a marker, inactivation by mutagenesis or epigenetic silencing being more difficult…);

- a distant-locus gene drive (as here in Saglin) could potentially drive several antimalarial cargoes at the same time, inserted in different loci;

- non-essential mosquito genes agonistic to Plasmodium are attractive host loci for a GD, an already old idea illustrated here by the case of Saglin;

- multiplex gRNAs are a viable approach to reduce the formation of GD-resistant alleles in essential genes and/or to increase the frequency of loss-of-function alleles, which will either disappear if the gene is essential or decrease vector competence if the gene is pro-parasitic. Hence gRNAs targeting intron sequences should be avoided in order to preserve this benefit, as illustrated by one of our Lp gRNAs targeting the first intron and that contributed to generate the only Lp viable resistance allele identified in this study;

- To increase long-term stability of the GD construct, repeats should be minimized in gRNA multiplexes through the use of a single promoter and various spacers (tRNAs, ribozymes?) – it remains to be seen if the 76-nucleotide gRNA constant sequence itself, necessarily repeated, will stimulate unit losses in a gRNA multiplex;

- The best promoter to restrict Cas9 expression to the germ line may be zpg in some but not all loci; the vasa promoter causing maternal Cas9 deposition may still be envisaged if resistance allele formation can be prevented by other means (targeting hyper-conserved essential sequence, multiplexing the gRNAs against an essential gene…).

Minor comments:

Line 44 – female sterility but also female killing approaches to crash pop. like X shredder, if authors would like to expand

Female killing citation of Simoni et al., 2020 added (line 45).

Lines 48-60 – Authors should add some references from the literature surrounding ethics and ecology studies related to gene drive release

we added: (e.g., National Academies of Science, Engineering, and Medicine, 2016; Courtier-Orgogozo et al., 2017; de Graeff et al., 2021) on lines 49-51.

Line 114 – Given the only moderate impacts of Saglin's role in Plasmodium invasion, I am not sure this saglin deletion is a convincing benefit for GD as it is probably not impactful enough alone – can the authors soften this statement?

While it’s correct that Saglin KO mosquitoes show a significant decrease only in P. berghei oocyst counts and not in prevalence when mosquitoes are heavily infected, they do show a significant decrease in both counts and prevalence upon infection with P. berghei and, most importantly, P. falciparum when parasite loads are lower —a situation that is more physiological (e.g. prevalence of 65% and 13% in WT and Sag(-)KI mosquitoes, respectively, upon infection with P. falciparum – Klug et al., PLoS Path 2023). Therefore, for human-relevant P. falciparum infections, an impactful decrease in vector competence can be legitimately expected.

Line 126 -Can the authors provide rationale for expressing Sc2A10 with Lp instead of expressing it from salivary glands?

There are three reasons for this. First, we knew from the cited Isaacs et al. papers that the 2A10 antibody was efficient against transmission when expressed in the fat body, and from unpublished work (Maria Pissarev, Elena Levashina and Eric Marois) that anti-CSP ScFvs expressed in the fat body of transgenic mosquitoes blocked sporozoite transmission as efficiently as when expressed from salivary glands. This is certainly favored by the easy sporozoite accessibility to the antibody when both are in mosquito hemolymph. Of note, the transmission blocking results suggest that the binding of ScFv to CSP withstands the crossing of the salivary gland epithelium by sporozoites. Second, we were looking for a host gene expressed as high as possible to produce high levels of Sc2A10 antibody. Third, the host gene must be essential so that resistance alleles would not be viable.

We agree that it would also be possible to use a salivary gene instead of Lp as a host for this antimalarial factor. In this case, a same-locus gene drive may have functioned, but the advantages of the host locus being an essential gene would be lost, at least partially, as genetic ablation of the salivary gland, albeit slowing blood uptake, does not prevent mosquito viability and reproduction (Yamamoto et al., PLoS Path 2016).

Line 140 – Can authors give any comment on why these regions of Lp were chosen to be recoded / targeted with gRNAs?

inserting Sc2A10 just after the cleaved Lp secretion signal, and N-terminally to the rest of the Lp protein, was the goal, so that 2A10 would be secreted together with Lp and separated from both signal peptide and Lp by naturally occurring proteolysis. This constrained the choice of the target site to be at the junction between signal peptide and the remainder of Lp protein. An alternative design could have been to insert it between the two subunits ApoLpI and ApoLpII, with duplication of the protease cleavage site, or on the C-terminal extremity of the protein, but there would have been no intron in the immediate vicinity to knock-in a selection marker at the same time.

Line 171 – "stoichiometric"

Corrected.

Line 186 – Can the authors comment or speculate on why the expression levels of the fusion protein are expected to be lower than endogenous Lp?

We did not expect this. It is hard to predict whether and explain how insertion of exogenous sequences in a gene can alter its expression. Possible explanations include: the existence of harder-to-translate mRNA sequences in the Sc2A10 moiety; the addition of seven exogenous amino acids on the N-terminal side of ApoLpII (mentioned in M&M) possibly modifying the stability of the Lp protein; the modification of the intron sequence perturbing efficient intron excision and/or pre-mRNA expression due to the disruption of regulatory elements or to the new presence of the GFP gene in the antisense orientation (albeit expressed in the nervous system and not in the fat body); the presence of the exogenous Tub56D transcription terminator used to arrest GFP transcription possibly possessing bidirectional termination activity and lowering the mRNA level of the Lp allele…

Line 211 – Why were 6 mosquitoes used for these assays, and 10 mosquitoes used in later assays (Line 223)?

Mice were always exposed to groups of 10 mosquitoes, but not all 10 mosquitoes were necessarily biting the mice. We retained mice bitten by at least 6 mosquitoes for further analysis (M&M, lines 871-873 of the revised file).

Line 212 – I would also suggest using letters (Suppl. Table 2A,B,C etc) to refer the specific experiments and sections in the Table.

Implemented.

Line 225- 228 – The authors should mention in the text that homozygotes and heterozygotes do not differ in infection assays.

Added: “Therefore, heterozygous mosquitoes showed a transmission blocking activity comparable to that seen in homozygotes.”

Line 249 – Can the author comment on the impacts of population influx / exchange on the idea that the GD cassette need only be transiently in the population?

If Lp::Sc2A10 is fixed in the population and the GD gone, indeed an influx of WT alleles through mosquito immigration will begin to replace the antimalarial factor and drive it to extinction due to its fitness cost. As mentioned in the final paragraph of the discussion, this could be seen as an advantage to restore the original natural state—hopefully after malaria eradication! However, we regard a situation where Lp::2A10 never reaches fixation as more likely, with its spread being re-ignitable by updated GDs (line 741 of the revised file).

Line 273 – Can the authors comment on why this may have occurred more frequently than the expected integration of the GD cassette?

When a chromosome break is repaired, each side of the cut must recombine with the repair template. A possible explanation for our observation is that one side of the break recombined with the injected repair plasmid, while the other recombined with the intact sister chromosome (physiologically probably the preferred option). Since this situation still leaves truncated chromosomes, another repair event can join the plasmid-bearing chromosome end to the sister chromosome. The observation that complex rearrangement occurred frequently suggests that such events can be very common, but will usually go undetected due to the absence of genetic markers. Here, GFP on the intact sister chromosome served as a genetic marker to betray its unexpected involvement in the repair process.

Line 314 – Not all fitness costs are apparent through standard laboratory rearing as was performed in Klug et al. Authors could consider "no known fitness cost" instead.

We agree. This is what we meant by “no fitness cost in laboratory mosquitoes”. We changed this to “no fitness cost at least in laboratory conditions (Klug et al., 2023)” to make clear that this was tested.

Line 407 – don't start new paragraph (same with 409)

We removed these two lines, as we realized they contained an error, and made a correction on line 420 of the revised manuscript.

Line 408 – I'm not sure it's clear why all these populations were kept for a different number of generations – can the authors clarify?

Populations 1 and 2 were the oldest founder populations, therefore maintained for the longest time. As described in the text, all other populations were derived from populations 1 and 2 later in time by outcrossing a subset of individuals to WT mosquitoes. For these derived populations, we reset the clock of generation counting to 0 as we monitored the homing phenomenon “from scratch” in transgenic males crossed to WT, and in transgenic females crossed to WT. Resetting the clock resulted in an apparent lower number of generations for these derived populations. In addition, some of them were discarded early, usually after reaching a stable state, as it was difficult to maintain so many populations in parallel over a long period of time.

Line 558 – "10/12 mice" not immediately clear – the authors could be more specific about how data was combined here

Thank you for pointing out this ambiguity. We replaced by: “the absence of infection in a total of 10 out of 12 mice showed…” (line 561)

Line 586 – Since there do appear to be some fitness costs associated with the Sc2A10 version of Lp, might it be expected that fitness costs imposed by the transgene itself could lead to selection pressures leading to its loss? Or do the authors think that these fitness costs are prevented from causing selection against Sc2A10 due to the design of the transgene such that its translation is a prerequisite for Lp's translation? Is the fact that its removal occurs more rapidly than Lp's any indication that selection against the persistence of Sc2A10 may occur?

Yes, we believe that Lp::Sc2A10 will progressively disappear, replaced by the WT allele, as shown in Figure 1C, in the absence of a GD stimulating its maintenance and spread. In the Lp::Sc2A10 transgene, translation of Sc2A10 is indeed a prerequisite for Lp translation, imposing a degree of genetic stability of this transgene in terms of sequence integrity, but this does not mean that the locus cannot be outcompeted by the WT under natural selection, so that long-term persistence of Lp::Sc2A10 depends on the presence of the GD, as outlined in lines 669-672. As the GD itself can disappear due to the accumulation of resistance alleles, we expect a progressive lift of its pressure to maintain Lp::Sc2A10 and both loci to be progressively lost, a form of reversibility that may be regarded as desirable (lines 773-776 in v2, 741-743 in v3). Alternatively, both transmission blocking alleles could be maintained by releasing an updated version of the dual GD.

Line 659 – add some further detail to this – how do you envision this to occur?

We have deleted this paragraph, as it hypothesized that SagGD could frequently be transmitted to the next generation in the absence of Lp::2A10, which is not the case (it would be lethal, and Lp::2A10 homing is anyway extremely efficient). After a putative field release of [SagGD / Y; Lp::2A10/ Lp::2A10] males, both transgenes should rapidly be introgressed in the field’s genetic background.

Line 635 – Long paragraph, should be broken up or removal of text. Some of these ideas could possibly be made more concise to improve readability. There are many different hypotheticals that are expanded upon in the discussion.

We admit that this paragraph in the discussion was long and dense. We have split it into 4 smaller paragraphs to better separate the concepts that we want to discuss, and have deleted the part mentioned in the above point.

Line 677 – This scenario seems potentially unrealistic considering the only subtle impacts of Saglin deletion on vector competence, and the potential for population exchange in mosquito populations to dilute out these alleles if the drive begins to fail. Can the author comment or potentially decrease emphasis on such scenarios?

While Saglin KO mosquitoes show a moderate decrease of infection prevalence in the context of high infections, the Saglin KO decreases parasite loads in all cases, and most importantly, also prevalence upon physiological infections with P. falciparum (Klug et al., PLoS Path 2023 and see our response to your comment to line 114 above). This yields a higher proportion of non-infected mosquitoes. Therefore, the impact of Saglin mutations should be stronger for the epidemiology of human infections with P. falciparum than in laboratory models of infections where parasite loads are very high.

We agree that mosquito migration in natural populations would progressively dilute out the beneficial alleles once the GD effect ceases. The epidemiological impact is difficult to predict and will strongly depend on the durability of the GD and on the intensity of genetic influx from adjacent mosquito populations.

Line 708 – Can the authors speculate on why zpg is sensitive to local chromatin and elaborate on possible solutions or consequences for other drive ideas? This seems broadly important.

We do not precisely know why the zpg promoter is more sensitive to local influences than the vasa promoter, but this phenomenon seems common for other promoters as well (e.g., the sds3 promoter as opposed to the shu promoter in Aedes aegypti (Anderson et al., Nat Comm 2023)). It is possible that the vasa promoter is better insulated from local repressive influences, perhaps by insulating elements akin to gypsy insulators in Drosophila. Knowledge of genetic insulators active for mosquito genes is lacking as far as we know. Characterization of efficient mosquito insulators, for example if one could be identified within vasa, and their combination with zpg or sds3 promoter elements, could potentially improve the locus-independent activity of such promoters. Alternatively, a natural and ideal promoter may still be found showing both an optimal window of expression of Cas9 in the germline, and little susceptibility to local repression.

Line 737 – The suggestion of releasing laboratory-selected resistance alleles in the absence of further context may be provocative and unnecessary here.

We didn’t intend to sound provocative, but are interested in the idea of simple resistance alleles with limited sequence alteration that could be selected in the lab, and released to block a gene drive that turned undesirable, so we wanted to share it with the reader. Mutations in the Lp and Saglin loci, preserving their functions, can be limited to one or few nucleotide changes in the gRNA target sites, as illustrated by the mutants we sequenced. Lab population of GD mosquitoes can, therefore, be a source of GD refractory mutants that could be leveraged in recall strategies.

Line 850 – unnecessary comma

Corrected.

Line 854 – change to "after infection, moquitoes were "

Changed.

Figure 1 – Not clear what is intended to be communicated by shapes portraying proteins / subunits – consider more detailed illustration of mosquito fat body cells synthesizing and secreting proteins rather than words in text box with arrow to clearly demonstrate the point of this figure.

We propose a new version of figure 1 to better illustrate the fat body origin of Lp and 2A10. We have also re-worked the graphic design to improve several figures.

Figure 3 – I recommend rearranging this figure so that B comes before C, visually. The proportions for the design of in B should also match those used for A.

We have followed these recommendations in the new Figure 3, and also used more logical color codes for the gRNAs and their target genes.

Figure 5 – It is unclear to me why some Populations were maintained for such different lengths of time.

Same point as above for line #408: Populations 1 and 2 are the oldest founder populations, therefore maintained for the longest time. As described in the text, all other populations were derived from populations 1 and 2 later in time by outcrossing to WT mosquitoes, resulting in a lower number of generations for these derived populations. In addition, some of them were discarded earlier, usually after reaching a stable state, as it was not possible to maintain so many populations in parallel for a long period of time.

Figure 7 – Ladder should be labeled on the gel. It may also be helpful for the author to indicate clearly exactly which mosquitoes were shown by sequencing to have these different deletions, as it is occasionally unclear based on band sizing.

We have added the ladder sizes as well as a numbering of individual mosquitoes on Figure 7. We sequenced 4 gel-purified small -type B- amplicons of Population 1 individually (#1, 2, 4, 6), and a pool of 4 type B amplicons from Population 7 (pooled #2, 4, 5, 6) as well as two samples of several pooled gel-purified large -type A- amplicons from Population 2 (pool of samples #2, 3, 4, 5, 6, 8, 9, 11, 12) and from Population 7 ( pool of #1, 3, 7, 11, 12). This information now also appears in the material and methods section (PCR genotyping of the SagGDvasa gRNA array).

Line 996 – given that there is a size band on the right line of this gel also, can authors crop the gel image to eliminate unnecessary lanes a and b from this figure without losing information needed to interpret this blot?

We agree that this would make the message easier to understand, but cropping lanes a and b would place WT control and Lp::Sc2A10 homozygotes on two separate images, even if a size marker is present on each. We prefer keeping the raw image to facilitate direct comparison of the band sizes, making clear that this was a single protein gel.

Line 1070 – 12 out of how many sequenced mosquitoes?

12 mosquitoes from each of these four populations served as PCR templates to generate figure 7. A subset of amplicons were sequenced individually or pooled, as described above and now in Methods. All sequencing reactions of type A and type B amplicons showed consistent results.

Line 1078 – Can remove some detail like % of agarose, and replication of results with different polymerase as these are already in methods.

Done.

Line 1098 – "Unbless"

Corrected

Reviewer #2 (Significance (Required)): This study illustrates a wide range of issues pertinent for gene drive implementation for malaria control, and as such is of value to the field of entomologists, genetic engineers, parasitologists and public health professionals. The gene drive designs explored for this study are interesting largely from a basic biology perspective pertinent mostly to specialists in the field of genetic engineering and vector biology, but highlight challenges associated with this technology that could also be of interest to a broader audience. A transmission blocking gene drive has not yet been achieved in malaria mosquitoes, and is thus a novel space for exploration. As a medical entomologist that works predominantly outside of the genetic engineering space, I have appreciated the detail the authors have provided with regard to their rationale and findings, even when these findings were inconsistent with the authors' primary objectives or expectations.

Thank you for your positive assessment and for this in-depth evaluation of our data.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

The study by Green et al. generated a gene drive targeting both Saglin and Lipophorin in the Anopheles mosquito, with a view to blocking Plasmodium parasite transmission. This is a highly complex but elegant study, which could significantly contribute to the design of novel strategies to spread antimalarial transgenes in mosquitoes.

Overall, this is a complex study which, for a non-specialist reader gets quite technical and heavy in most parts. Despite this, there are key points showing that suppression gene drive may not be the way forward in this instance. However, I would advise explaining certain elements in more detail for the benefit of the general readers. I only have minor points for the authors to address:

1) Please point out for the general reader that Anopheles coluzzii belongs to the gambiae complex, since you explain that gambiae are the major malaria spreaders in sub-Saharan Africa.

Done in the introduction (lines 71-73) also in response to Rev. 1

2) The authors pretty much give all results in the last part of the introduction, could the intro be shortened by removing these parts, or just highlighting in a single paragraph the main take home message?

We have condensed this part to highlight the take home messages in the last paragraph, also in response to Rev. 1.

3) Why is Vg mentioned? It is only mentioned once and doesn't have any other mention through the manuscript.

This introduces the two proteins that are by far the most abundant, and present at similar levels, in the hemolymph of blood-fed females, Vg being also prominent on the Coomassie stained gel of Figure 1. We mention Vg also because it represents another excellent candidate locus to host anti-plasmodium factors, as discussed later on lines 600-610 of the Discussion section.

4) Please make it clearer for non-specialists why Cecropin wasn't used.

On lines 630-636 we explain that we decided to leave out Cecropin to avoid potential additional fitness costs due to expression at all life stages in the fat body, as opposed to solely in the midgut after blood meal (Isaacs et al. PNAS 2012); and to avoid complexifying the anti-Plasmodium Lipophorin locus in a way that could further reduce the functionality of the Lp gene. We also had prior knowledge from unplublished work that Sc2A10 alone was sufficient to block sporozoite infectivity.

5) Why were homozygous and not heterozygous transgenics transfected if there is such as fitness cost to homozygous mosquitoes?

The fitness cost of homozygous mosquitoes is actually mild, unnoticeable if homozygotes are bred in the absence of competing heterozygotes and wild-types (lines 151-156). Microinjection experiments to obtain the different versions of SagGD were, therefore, performed on either the heterozygous or homozygous line. As for infection assays, the anticipated effect of gene drive is to promote homozygosity at the Lp::Sc2A10 locus. For this reason, it made sense to test the vector competence of homozygotes, in addition to the fact that the Plasmodium-blocking phenotype was expected to be stronger (and thus, easier to document) with two copies of the transgene. Only after obtaining a large dataset from infection assays with homozygotes did we test heterozygotes and found that they actually had a similar phenotype.

6) Line 211 – what was the average number of infected mosquitoes used per infection for each mosquito strain?

As described in the text (lines 204-206 of v2; 208-212 of the revision) and in the Methods (lines 868-873), non-infected mosquitoes were discarded prior to performing the experiment using 10 infected mosquitoes per mouse, and we discarded mice bitten by fewer than 6 mosquitoes. So at least 6 infected mosquitoes bit each mouse (often 8-9).

7) Line 219 – please be clearer regarding this being infection detected in the blood.

We replaced « infection » with « detectable parasitemia in the blood »

8) Line 320 – please clarify why the zpg promoter was used.

The advantages of zpg are mentioned in lines 257-258 and 320-322 (revised file).

9) Line 375 – what was the rationale for using so many gRNAs?

3 or 4 gRNAs against Lipophorin and 3 gRNAs against Saglin, amounting to a total of 6 or 7 gRNAs against the two loci. The rationale is explained on lines 249-253 : the goal was to maximize the chance of causing loss-of-function mutations in the essential Lp gene and to favor elimination of GD resistant alleles by natural selection, in case of failed homing. For Saglin which is a non-essential gene, we wanted to ensure loss-of-function of failed homing alleles to achieve a reduction in vector competence, even if GD-resistant alleles accumulate. We sought to make this rationale clearer by adding a sentence on lines 328-332:

“Multiplexing the gRNAs was intended to promote the formation of loss-of-function alleles in case of failed homing at the Lp and Saglin loci: non-functional alleles of the essential Lp gene would be eliminated by natural selection while non-functional Saglin alleles would reduce vector competence.”

Line 555 – please state how long post bite back parasite appears in infected mice.

We changed this sentence to “…two of these six mice developed parasitemia six days after infection” (line 556).

Reviewer #3 (Significance (Required)):

This is potentially a highly significant study that could provide a vital mechanism for generating efficient gene drives. Although highly technical and complex in most parts, with a little clarification in certain areas this manuscript could be of great value to a general readership.

Thank you for your appreciation and thoughtful evaluation of our manuscript.

Reviewer #4 (Evidence, reproducibility and clarity (Required)):

The authors hijacked the Anopheles coluzzii Lipophorin gene to express the antibody 2A10, which binds sporozoites of the malaria parasite Plasmodium falciparum. The resulting transgenic mosquitoes showed a reduced ability to transmit Plasmodium.

The authors also designed and tested several CRISPR-based gene drives. One targets Saglin gene and simultaneously cleaves the wild-type Lipophorin gene, aiming to replace the wildtype version with the Sc2A10 alele while bringing together the Saglin gene drive.

Drive-resistant alleles were present in population-caged experiments, the Saglin-based gene drive reached high levels in caged mosquito populations though, and simultaneously promoted the spread of the antimalarial Lp::Sc2A10 allele.

This work contributes to the design of novel strategies to spread antimalarial transgenes in mosquitoes. It also displays issues related to using multiplexing gene-drive designs due to DNA rearrangements that could prevent the efficient spread of the gene drive in the long term.

This is tremendous work considering how many transgenic lines and genetic crosses are performed using mosquitoes. The conclusions are supported by the data presented, and some modifications regarding the experimental design description through text/figure improvements would facilitate the reading and flow of the paper.

Here some questions/comments:

Line 124-125: Reference?

Added

Line 133-134: Reference?

Added

Table 1: It seems the authors have some issues recovering a good amount Sc2A10 from hemolymph samples. Is this a problem of the antibody per se? Is it the Lp endogenous promoter weak? Could this be improved by placing the antibody in a different genomic region? Alternatives could be discussed.

The 2A10 antibody must be initially produced in the same, very high, amounts as the Lp endogenous protein with which it is co-translated. Therefore, its low relative abundance must result from faster turnover or stickiness to tissue, as hypothesised on lines 176-177. We believe that virtually any other endogenous promoter would be weaker than Lp and produce lower Sc2A10 levels.

Figure 1B: It would be nice to have a representation of the genome after integration. You could add a B' panel or just another schematic under the current one.

In agreement with this suggestion and that of rev. 3, we added a new panel in 1B.

Supplementary Figure 1b: Could the authors explain the origin of the (first) zpg promoter used? Is it from An. Coluzzii? It seems they use a different one in the gene drive designs later (see comments below too).

Yrou et al., from genomic DNA from our colony of A. coluzzii. The resulting promoter fragment harbored several single nucleotide polymorphisms (SNPs) compared to published sequences, as typically observed when cloning genomic fragments due to high genetic diversity in Anopheles species. Such SNPs are not usually expected to affect promoter activity, but are difficult to distinguish from PCR mutations which, in turn, could decrease or abolish promoter activity if mutating an essential transcription factor binding site. For this reason, our next constructs were based on the validated zpg sequences from Kyrou et al. The first cloning strategy was described in the Results section but was missing in the material and method section. This is now corrected (lines 773-779).Figure 3: Please, correct to A, B, C order. Current one is A, C, B.

Done.

Could the authors include a schematic of the final mosquito genome after integration? I can see they are targeting two different locations (Saglin and Lp). It is unclear though from the figure where the Sc2A10-GFP is coming from. I understand this represents the mosquito genome as you injected heterozygous animals already containing the Sc2A10-GFP. Maybe label the Sc2A10-GFP as mosquito genome or similar? A schematic showing mosquito embryos already carrying this and then the plasmid being injected could help.

Figure 3 does not represent the injection of new transgenic constructs. Instead, it shows the conversion process of chromosomes X and II in a germ cell carrying both transgenes in the heterozygous state, to illustrate how the dual gene drive can spread in a population after WT mosquitoes mated with transgenics carrying both the SagGD and Lp-2A10 alleles. We have re-worked the graphic design of this figure and modified its title to make this more clear.

Line 330-331: Do you know the transgenesis efficiency? Did the authors make single or pools for crossing and posterior screening? It would be interesting to know about transgenesis rates to inform the community.

We no longer perform single crosses for transgenesis, as batch crosses ensure higher recovery of transgenics due to the collective reproductive behavior (swarming) in Anopheles. Therefore, we cannot precisely calculate the transgenesis efficiency. However, >60 positive G1s from a pool of 36 G0 males crossed to WT females is indicative of a rather high integration efficiency. We consistently observe high efficiency of transgene integration when using the CRISPR/Cas9 system, that we estimate to be about 5-fold more efficient than docking site transgenesis, and much more efficient than piggyBac mediated transgenesis.

Line 357/Figure 4B: Could the authors explain in the text GFP+ vs. GFP++?

GFP++ was meant to indicate higher intensity of GFP fluorescence than GFP+, due to two copies of the transgene versus one, but see our response to reviewer 1’s comment to line 356 about the questionability of homing in the zygote.

Line 357: Where is the vasa promoter that made the "rescue" coming from? Is it amplified from Coluzzii? Please, include this explanation for clarification. Why the authors think the zpg from Kyrou et al. 2018 works for the cassette integration but not for homing? They discuss positional effects, any references showing that?

We amplified the vasa promoter from A. coluzzii using primers CggtctcaATCCcgatgtagaacgcgagcaaa and CggtctcaCATAttgtttcctttctttattcaccgg (annealing sequence underlined) to have a fragment equivalent to that (vas2) characterized in Papathanos et al., 2009. We have now added this information in the Methods under Plasmid construction. This is the only source of vasa promoter used in this work.

About zpg promoter activity : we have past experience suggesting that promoters, such as the hsp70 promoter from Drosophila, can be sufficient to express enzymatic activities in embryos injected with helper plasmids, even though the same promoters appear to become inactive once integrated in the genome. This may be due to injected “naked” plasmids being readily accessible to the transcription machinery, unlike organized chromatin. A recent reference showing genomic positional influences on promoter efficiency is Anderson et al., 2023, which we have added on line 710 of the Discussion.

Line 362: No reference to figure nor table.

These data (numbers from a COPAS analysis) are provided directly in the text in this sentence (which has been clarified in response to Reviewer 1). See lines 364-369 of the revision.

Line 417: The text brings the reader back to Figure 3C. Could the authors move this panel for easier flow of the paper?

We agree that positioning of this panel in Figure 3 is a bit awkward, but this western blot pertains to the characterization of the insertion shown in Figure 3. Placing it after COPAS analyses would be equally awkward.

Line 472-474: How many WT alleles were recovered? It is not stated unless I missed anything, which is possible.

We refrained from providing a quantification of this, and focussed on qualitative results, as we didn't trust the quantitative representativity of our high-throughput amplicon sequencing results in terms of allele frequency in the sampled mosquito population. A large fraction of sequenced reads corresponded to PCR artefacts such as primer dimers and unspecific short amplicons, potentially affecting the relative frequencies of gene-specific amplicons. However, among the sequenced gene-specific amplicons, WT alleles were the majority (lines 474-475).

Figure 5. Could the authors discuss why the observed DsRed-gene drive drop in population 1 at ~18 generation? The population gets to the point where only 50% of the population carries the Cas9-DsRed cassette. Considering that the Saglin gene drive only converts through females (inserted into the X chr.), and some indels could be generated by generation 20, how do you explain the great recovery until fully spreading into the population?

We agree that this is somewhat puzzling. We don’t have a satisfactory explanation beyond stochastic effects, possibly promoted by population bottlenecks: although we strived to maintain these populations at a high number of individuals at each generation, we cannot exclude that at a given generation only a relatively small fraction of individuals contributed to the next generation, leading to fluctuations in allelic frequencies. This would be possible particularly for populations 1 and 2, which were not monitored frequently between generations 10 and 18, at which point additional populations 5-8 were established and it was decided that close monitoring of all populations was important.

It seems to me populations 3-8 are new cage experiments by randomly picking mosquitoes from populations 1 and 2 (at a specific generation) and mixing them with WT individuals. Could the authors explain the reasoning for these experiments? I believe populations 3-8 deserves a different figure (main or supplementary) describing how they were seeded. It is confusing having everything together as these experiments were performed differently way and for a different reason compared to populations 1 and 2. Some cage schematics and drawings would help in understanding the protocol strategy for populations 3-8.

This is correct for populations 3 and 4 that indeed originated from randomly picking mosquitoes from populations 1 and 2 at generation 10 and mixing them with WT individuals. Populations 5, 6, 7 and 8 are crosses between generation 16 transgenic partners of one sex to WT of the other sex, as indicated above the COPAS diagrams provided in Suppl. File 2. We apologize for having insufficiently described how each population was assembled and now provide more details (lines 422-429, in the figure 5 legend, and G0 crosses spelled out on top of each population diagram). In setting up these populations, we wanted to test the effects of various routes by which the transgenes may be introduced into a wild mosquito population: release of unsorted transgenic males + females, or release of one sex only (probably males in the field, but the crosses with transgenic females as with transgenic males also served to re-quantify homing in the second generation of each cross).

The modified text reads as follows:

“Populations 3 and 4 were established by mixing randomly selected transgenic mosquitoes (both males and females of generation 10) from populations 1 and 2, respectively, with wild-types, to mimic what may occur in a mixed-sex field release. Populations 5-8 were established by crossing single-sex transgenic mosquitoes to WT of the opposite sex, both to mimic a single-sex field release and to re-assess homing efficiency after 16 generations.”

Also, could you add homozygous and heterozygous labels in the figure legend to help understanding the different lines.

As indicated on the side of the figure and in the figure legend, lines don’t represent homozygous vs. heterozygous frequency, but allele frequency (continuous lines), and frequency of mosquitoes carrying the transgene (dotted lines). In the figure legend we now provided the calculation formulas for gene frequency: [ 2 x (number of homozygotes) + (number of heterozygotes)] / 2 x (total number of larvae) for the autosomal Lp::2A10 transgene, and [ 2 x (number of homozygotes) + (number of heterozygotes) ] / 1.5 x (total number of larvae) for the X-linked SagGD transgene.

Figure 6: The authors sequenced non-DsRed individuals from generations 3-4. The authors also mentioned they sequenced mosquitoes from generation 32 (Figure 7). Interestingly, they observed that these mosquitoes were missing a piece of the cassette (they contained 2 gRNAs instead of 7). Since the amplicons only cover the gRNA portion, a PCR covering the Zpg-Cas9 portion would be ideal to confirm that only the gRNAs are missing. Sampling DsRed+ mosquitoes from generations 3, 18 and 31 (populations 1 and 2) and carrying out these experiments is recommended. Although unlikely, I would be worried about the Cas9 being deleted due to unexpected DNA rearrangements; in that case, the cassette would contain the DsRed marker alone.

Thank you for this suggestion. We no longer have DNA samples from the earlier generations. Thus, we genotyped 7 DsRed positive male mosquitoes from each of current populations 1, 2 and 7 (generation 41 since transgenesis) for the presence of Cas9. We detected a Cas9-specific amplicon of 1.6 kb in 21/21 sampled DsRed positive mosquitoes, in parallel to the same shortened gRNA arrays detected in earlier generations. This suggests that the Cas9 part of the transgene was not affected by the loss of gRNA units. We made a panel C in Figure 7 showing these results and mentioned them on lines 537-538. Of note, the Cas9 moiety of the gene drive construct shows no repetitive sequence and should therefore not be as unstable as the gRNA multiplex array. The observed excisions of gRNA expression units were strictly due to recombinations between repeated U6 promoter sequences (Figure 7).

The authors employ 3 different gRNAs that are 43 and 310 nts apart. It has been shown that only 20 nt lack of homology produces an important reduction on gene drive performance (Lopez del Amo et al. 2020, Nat Comms). Also, it has been shown that gRNA multiplexing approaches should be kept with a low number of gRNAs, 2 being maybe the best one depending on the design (Samuel Champer 2020, Sciences Advances). This could be discussed more.

Thank you for this suggestion. These results were not published when this study was initiated, so that our gene drive constructs could only be designed on empirical bases. For gRNA numbers, see the new discussion point and inclusion of a reference to the study by S. Champer et al., on line 700-702. The reduction of drive performance with longer non-homologous stretches is indeed also a very important point, that we now discuss on lines 713-717, citing your study:

“Finally, tighter clustering of gRNA target sites at target homing loci, especially Saglin, should improve gene drive performance by reducing the length of DNA sequences flanking the cut site that bear no homology to the repair template on the sister chromosome and need to be resected by the repair machinery to allow homing (López Del Amo et al., 2020).”

Reviewer #4 (Significance (Required)):

There are different novelty aspects from my point of view in this work. While most of the scientists focus on developing CRISPR-based gene drives in An. Stephensi and gambiae, this work employs An. Coluzzii. Some limitations regarding fitness cost associated with the Lp gene were also noted and discussed by the authors.

To be fair, earlier gene drive studies were performed on the G3 laboratory strain, traditionally named A. gambiae, although it is probably itself a hybrid strain from gambiae and coluzzii. Still, the Ngousso strain from Cameroon that was used in this study is thought to be a bona fide A. coluzzii. We have also added a reference to a recent paper (Carballar-Lejarazu et al., 2023) that also describes a population modification GD in A. coluzzii.

First, they show that An. Coluzzii mosquitoes infect less when containing the antimalarial effector cassette inserted in their genomes. Second, a gene drive is showing super-Mendelian inheritance in An. Coluzzii, which would be the second example of a gene drive in these mosquitoes so far to my knowledge.

I believe this is the first manuscript experimentally using multiplexing approaches (multiple gRNAs) in mosquitoes (all previous works I saw were performed in flies). While previous gene-drive works employ only one gRNA in mosquitoes, this works explores the use of different gRNAs targeting nearby locations to potentially improve HDR rates and gene drive spread. Although they observe gene drive activity, they also show DNA rearrangements due to the intrinsic nature of multiplexing gene drives that can generate multiple DNA double-strand breaks, impeding proper HDR and clean replacement of the wildtype alleles. This is important from a technical point of view as it shows this approach requires optimization. They included 3 gRNAs targeting the Saglin gene, and trying 2gRNAs instead could be interesting for future investigations.

We now discussed optimization with the help of modeling, in response to Reviewer 1, on lines 701-702.

This work will be very useful for the CRISPR-based gene drive field, which seeks to develop genome editing tools to control mosquito populations and reduce the impact of vector-borne diseases such as malaria.

This reviewer intended to understand the work and provide constructive feedback to the best of my abilities. I apologize in advance if I misunderstood anything.

Thank you for your appreciation, insight, and constructive evaluation of our manuscript.

https://doi.org/10.7554/eLife.93142.sa2

Article and author information

Author details

  1. Emily I Green

    Inserm U1257, CNRS UPR9022, University of Strasbourg, Strasbourg, France
    Contribution
    Investigation, Methodology, Writing - original draft
    Competing interests
    No competing interests declared
  2. Etienne Jaouen

    Inserm U1257, CNRS UPR9022, University of Strasbourg, Strasbourg, France
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  3. Dennis Klug

    Inserm U1257, CNRS UPR9022, University of Strasbourg, Strasbourg, France
    Contribution
    Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9108-454X
  4. Roenick Proveti Olmo

    Inserm U1257, CNRS UPR9022, University of Strasbourg, Strasbourg, France
    Contribution
    Data curation, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3849-8591
  5. Amandine Gautier

    Inserm U1257, CNRS UPR9022, University of Strasbourg, Strasbourg, France
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  6. Stéphanie Blandin

    Inserm U1257, CNRS UPR9022, University of Strasbourg, Strasbourg, France
    Contribution
    Formal analysis, Funding acquisition, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4566-1200
  7. Eric Marois

    Inserm U1257, CNRS UPR9022, University of Strasbourg, Strasbourg, France
    Contribution
    Conceptualization, Formal analysis, Supervision, Funding acquisition, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    e.marois@unistra.fr
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4147-3747

Funding

Agence Nationale de la Recherche (ANR-19-CE35-0007-01)

  • Eric Marois

Agence Nationale de la Recherche (ANR-11-LABX-0024)

  • Stéphanie Blandin

Agence Nationale de la Recherche (ANR-11-EQPX-0022)

  • Eric Marois

Deutsche Forschungsgemeinschaft (KL 3251/1-1)

  • Dennis Klug

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank the laboratory of Chris Janse for providing the parental P. berghei-PfCSP strain from which the Pb-PfCSPhsp70-GFP strain was derived. We thank Andrew Hammond, Kyrous Kyrou and Andrea Crisanti for the gift of plasmid p17410 to subclone the zpg-Cas9 expression cassette, and Eric Calvo for the gift of the recombinant Saglin protein and polyclonal Saglin antibodies. We thank Lauriane Kuhn, Johana Chicher and Philippe Hammann of the Strasbourg IBMC Proteomics Platform for the mass spectrometry sample preparation and analysis. We thank Muriel Philipps and Claudine Ebel from the Illkirch IGBMC flow cytometry platform for sorting P. berghei-infected red blood cells. We thank Mallory Kastner and Julie Fimeyer for help during the project. This work was supported by Agence Nationale de la Recherche, through research grant #ANR-19-CE35-0007-01 GDaMO to EM, the Laboratoire d’Excellence (LabEx) ParaFrap #ANR-11-LABX-0024 to SB, equipment grant #ANR-11-EQPX-0022 for insectarium operation and by funding from CNRS, Inserm, the University of Strasbourg, and from Contrat Triennal Strasbourg Capitale Européenne 2018–2020. Additional funding was awarded to DK by the DFG as a postdoctoral fellowship (#KL 3251/1-1).

Ethics

Work on mice was evaluated by the CREMEAS Ethics committee and authorized by Ministère de l'Enseignement Supérieur et de la Recherche (MESRI) under reference APAFIS #20562-2019050313288887v3. Work with genetically modified mosquitoes was evaluated by Haut Conseil des Biotechnologies and authorized by MESRI (agréments d'utilisation d'OGM en milieu confiné #3243 and #3912).

Senior Editor

  1. Dominique Soldati-Favre, University of Geneva, Switzerland

Reviewing Editor

  1. Flaminia Catteruccia, Harvard TH Chan School of Public Health, United States

Version history

  1. Preprint posted: July 8, 2022 (view preprint)
  2. Received: October 2, 2023
  3. Accepted: November 14, 2023
  4. Accepted Manuscript published: December 5, 2023 (version 1)
  5. Accepted Manuscript updated: December 20, 2023 (version 2)
  6. Version of Record published: January 12, 2024 (version 3)

Copyright

© 2023, Green et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 384
    Page views
  • 100
    Downloads
  • 1
    Citations

Article citation count generated by polling the highest count across the following sources: PubMed Central, Crossref, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Emily I Green
  2. Etienne Jaouen
  3. Dennis Klug
  4. Roenick Proveti Olmo
  5. Amandine Gautier
  6. Stéphanie Blandin
  7. Eric Marois
(2023)
A population modification gene drive targeting both Saglin and Lipophorin impairs Plasmodium transmission in Anopheles mosquitoes
eLife 12:e93142.
https://doi.org/10.7554/eLife.93142

Share this article

https://doi.org/10.7554/eLife.93142

Further reading

    1. Evolutionary Biology
    2. Genetics and Genomics
    Thomas A Sasani, Aaron R Quinlan, Kelley Harris
    Research Article

    Maintaining germline genome integrity is essential and enormously complex. Although many proteins are involved in DNA replication, proofreading, and repair, mutator alleles have largely eluded detection in mammals. DNA replication and repair proteins often recognize sequence motifs or excise lesions at specific nucleotides. Thus, we might expect that the spectrum of de novo mutations – the frequencies of C>T, A>G, etc. – will differ between genomes that harbor either a mutator or wild-type allele. Previously, we used quantitative trait locus mapping to discover candidate mutator alleles in the DNA repair gene Mutyh that increased the C>A germline mutation rate in a family of inbred mice known as the BXDs (Sasani et al., 2022, Ashbrook et al., 2021). In this study we developed a new method to detect alleles associated with mutation spectrum variation and applied it to mutation data from the BXDs. We discovered an additional C>A mutator locus on chromosome 6 that overlaps Ogg1, a DNA glycosylase involved in the same base-excision repair network as Mutyh (David et al., 2007). Its effect depends on the presence of a mutator allele near Mutyh, and BXDs with mutator alleles at both loci have greater numbers of C>A mutations than those with mutator alleles at either locus alone. Our new methods for analyzing mutation spectra reveal evidence of epistasis between germline mutator alleles and may be applicable to mutation data from humans and other model organisms.

    1. Evolutionary Biology
    2. Genetics and Genomics
    Ban Wang, Alexander L Starr, Hunter B Fraser
    Research Article

    Although gene expression divergence has long been postulated to be the primary driver of human evolution, identifying the genes and genetic variants underlying uniquely human traits has proven to be quite challenging. Theory suggests that cell-type-specific cis-regulatory variants may fuel evolutionary adaptation due to the specificity of their effects. These variants can precisely tune the expression of a single gene in a single cell-type, avoiding the potentially deleterious consequences of trans-acting changes and non-cell type-specific changes that can impact many genes and cell types, respectively. It has recently become possible to quantify human-specific cis-acting regulatory divergence by measuring allele-specific expression in human-chimpanzee hybrid cells—the product of fusing induced pluripotent stem (iPS) cells of each species in vitro. However, these cis-regulatory changes have only been explored in a limited number of cell types. Here, we quantify human-chimpanzee cis-regulatory divergence in gene expression and chromatin accessibility across six cell types, enabling the identification of highly cell-type-specific cis-regulatory changes. We find that cell-type-specific genes and regulatory elements evolve faster than those shared across cell types, suggesting an important role for genes with cell-type-specific expression in human evolution. Furthermore, we identify several instances of lineage-specific natural selection that may have played key roles in specific cell types, such as coordinated changes in the cis-regulation of dozens of genes involved in neuronal firing in motor neurons. Finally, using novel metrics and a machine learning model, we identify genetic variants that likely alter chromatin accessibility and transcription factor binding, leading to neuron-specific changes in the expression of the neurodevelopmentally important genes FABP7 and GAD1. Overall, our results demonstrate that integrative analysis of cis-regulatory divergence in chromatin accessibility and gene expression across cell types is a promising approach to identify the specific genes and genetic variants that make us human.