1. Biochemistry and Chemical Biology
  2. Structural Biology and Molecular Biophysics
Download icon

The role of Cdc42 and Gic1 in the regulation of septin filament formation and dissociation

  1. Yashar Sadian
  2. Christos Gatsogiannis
  3. Csilla Patasi
  4. Oliver Hofnagel
  5. Roger S Goody
  6. Marian Farkašovský
  7. Stefan Raunser  Is a corresponding author
  1. Max Planck Institute of Molecular Physiology, Germany
  2. Institute of Molecular Biology SAS, Slovak Republic
Research Article
  • Cited 40
  • Views 1,834
  • Annotations
Cite this article as: eLife 2013;2:e01085 doi: 10.7554/eLife.01085


Septins are guanine nucleotide-binding proteins that polymerize into filamentous and higher-order structures. Cdc42 and its effector Gic1 are involved in septin recruitment, ring formation and dissociation. The regulatory mechanisms behind these processes are not well understood. Here, we have used electron microscopy and cryo electron tomography to elucidate the structural basis of the Gic1-septin and Gic1-Cdc42-septin interaction. We show that Gic1 acts as a scaffolding protein for septin filaments forming long and flexible filament cables. Cdc42 in its GTP-form binds to Gic1, which ultimately leads to the dissociation of Gic1 from the filament cables. Surprisingly, Cdc42-GDP is not inactive, but in the absence of Gic1 directly interacts with septin filaments resulting in their disassembly. We suggest that this unanticipated dual function of Cdc42 is crucial for the cell cycle. Based on our results we propose a novel regulatory mechanism for septin filament formation and dissociation.


eLife digest

Septins are proteins that provide structural support for cells as they divide. Yeast cells are known to have seven types of septins, which have been widely studied, and 13 different septins have been identified in human cells, although they all seem similar to those found in yeast. Mutations in the genes that carry the genetic code for septins lead to a range of debilitating conditions in humans, including neurodegenerative diseases and male infertility.

An enzyme called Cdc42 is thought to have a key role in the formation of ring-like structures by septins before a cell divides, and in the subsequent dismantling of these rings after the cell has divided. A pair of proteins, called Gic1 and Gic2, is known to be critical for the formation of the septin rings, but the details of the interactions between these two proteins, Cdc42 and the septins are sketchy.

Now Sadian et al. have used two imaging approaches—electron microscopy and cryo-electron tomography—to scrutinise the role of Gic1 in greater detail in yeast cells. Gic1 interacts with specific subunits within adjacent septins, and these interactions have the effect of crosslinking the septins and stabilizing them in long filaments. However, high concentrations of the enzyme Cdc42 block the interaction between the Gic1 proteins and the subunits, causing the filaments to be dismantled. A future challenge will be to elucidate the interaction of these proteins in molecular detail using other techniques, in particular X-ray crystallography.



Septins are ubiquitous guanine nucleotide-binding proteins that have been implicated in many cellular processes such as cytokinesis, spindle positioning, morphogenesis, and exocytosis, and their mutation or overexpression is associated with neoplasia, neurodegenerative diseases and male infertility (Hall and Russell, 2004).

In yeast, four essential septins (Cdc3, Cdc10, Cdc11 and Cdc12) are found at the bud neck (Haarer and Pringle, 1987; Ford and Pringle, 1991; Kim et al., 1991), where they form an ordered ring composed of membrane-adjacent filaments (Hartwell, 1971; Byers and Goetsch, 1976). In total seven different septins were identified in S. cerevisiae, where they form filaments of variable size and combinations. Whereas the human genome encodes thirteen septins, C. elegans has only two and plants are devoid of septin genes (Hall and Russell, 2004; Ihara et al., 2005; Kinoshita, 2006). Despite the genetic variability, all septins share defined structural features. A recent crystallographic study on the human SEPT2-SEPT6-SEPT7 complex has shed light on the structural organization of human septins at the atomic level, which differs profoundly from that of other cytoskeletal structures (Sirajuddin et al., 2007, 2009). Septins interact via their central guanine nucleotide-binding domains (G-domains) and/or the N- and C-terminal extensions forming oligomers and non-helical filaments.

The basic structural unit of the yeast septin complex is an octamer, composed of four subunits, namely Cdc10, Cdc3, Cdc12 and Cdc11, arranged into two tetramers with two-fold rotational symmetry (Bertin et al., 2008).

Cdc42 has been identified as a central regulator of septin ring assembly and disassembly during different stages of the cell cycle (Gladfelter et al., 2002; Kozminski et al., 2003). Mutations that affect the GTPase activity of Cdc42 impair the initial assembly of septin rings, while after bud emergence, septin rings are maintained independently of Ccd42 (Gladfelter et al., 2002). It was also reported that the activity of Cdc42’s guanine nucleotide exchange factor (GEF) and GTPase activating protein (GAP) are required for proper septin ring formation and localization, implying that one or more cycle(s) of nucleotide binding and hydrolysis are required for Cdc42 at the beginning of budding (Gladfelter et al., 2002; Caviston et al., 2003).

Among the essential effectors of Cdc42 in yeast are the two structurally homologous proteins Gic1 and Gic2, which are functional homologues of the human Borg protein (Joberty et al., 2001; Sheffield et al., 2003). It has been shown that Gic1 and Gic2 play an essential and overlapping role in cytoskeletal polarization (Brown et al., 1997; Hall and Russell, 2004) and septin recruitment (Iwase et al., 2006). However, the complex interplay between Cdc42, Gic1 and septins at the molecular level and its role during the cell cycle is not yet understood.

In this study, we have used electron microscopy and cryo electron tomography (cryo-ET) to describe the structural basis for the direct interaction of Gic1 and Cdc42 with septin filaments. Gic1 interacts with Cdc10 subunits of adjacent septin filaments and cross-links them. Because of this scaffolding, septin filaments are stabilized and form long railroad-like ordered filament cables. Cdc42-GTP directly binds to Gic1 and at higher concentrations inhibits the Gic1 interaction with Cdc10, resulting in the dissociation of the Gic1-septin complex. In its GDP-state, however, in absence of Gic1 Cdc42 interacts directly with Cdc10 and thereby mechanically disassembles septin filaments. Gic1 and Cdc42-GDP therefore compete for the same septin subunit. Finally, based on our results we propose a novel regulatory mechanism for septin ring formation and dissociation involving Cdc42 and Gic1.

Results and discussion

EGFP-labeled septins without Gic1 (Cdc3-EGFP, Cdc10, Cdc11 and Cdc12) form relatively short and straight filaments (Figure 1A). Interestingly, when Gic1 is added during septin polymerization, long filaments that cluster together in large bundles are formed (Figure 1B). Studying the same but not EGFP-labeled samples using electron microscopy (EM), we found that in contrast to blank septin polymers that form long, often pairwise arranged filaments (Figure 1C), Gic1-septin complexes display a regular railroad-like structure with many cross-linked filaments bundled together (Figure 1D). Gic1 forms cross-bridges between at least two filaments, keeping them at a distance of about 20 nm (Figure 1E). At each cross-bridge, Gic1 binds to at least two adjacent septin subunits on each filament (Figure 1F), leaving a gap of six free subunits between individual Gic1 molecules (Figure 1G). The structure of Gic1 is not well defined (Figure 1F) indicating that Gic1 is flexible and oriented differently at each cross-bridge.

Gic1 scaffolds septin filaments resulting in long and flexible filament cables.

(A and B) Yeast septin octamers containing Cdc3-EGFP polymerized by dialysis alone (A) or together with Gic1 (B) and imaged using fluorescence microscopy. Scale bar, 0.5 µm. (C and D) Representative EM image of negatively stained septin filaments (C) and septin-Gic1 complexes (D) without EGFP. Scale bar, 100 nm. (EG) Representative class averages with focus on the overall structure of the septin-Gic1 complex (E), the Gic1 cross-bridges (F) and the septin filaments (G); arrows indicate single septin proteins. Scale bars, 10 nm.


To determine which septin subunit interacts with Gic1, we labeled septin-Gic1 complexes with antibodies against Cdc11 and observed that it sits exactly in the middle of a septin filament between two Gic1 cross-bridges (Figure 2A,B). Based on the known sequential order of septin filaments, this suggests that Gic1 binds to Cdc10 (Figure 2C).

Gic1 binds specifically to septin Cdc10.

(A and B) Representative EM image (A) and class averages (B) of septin-Gic1 complexes labeled with antibody against Cdc11. Arrow indicates the antibodies. The class average in (B) contains 15 single particles. Scale bars, 100 nm and 10 nm in (A) and (B), respectively. (C) Model of the septin-Gic1 complex based on the known sequential order of septin filaments (Bertin et al., 2008). The G- and the N/C-interfaces are indicated by straight and circular interfaces between circles, respectively. Antibodies are indicated as Y shapes. (D and E) Representative EM images of septin-Cdc10Δ filaments without (D) and with Gic1 (E). (F and G) Representative EM images of septin-Cdc11Δ filaments (F) and septin-Cdc11Δ-Gic1 complexes (G). (H) Representative class average of the septin-Cdc11Δ-Gic1 complex with focus on the septin filament. Arrows indicate single septin proteins. Scale bar, 10 nm. (I) Model of the septin-Cdc11Δ-Gic1 complex. (J) Yeast two-hybrid assay of different septin proteins, namely Cdc3, Cdc10, Cdc11, and Cdc12 with Gic1.


However, previous yeast two-hybrid, in vitro interaction and coimmunoprecipitation data indicated that Gic1 directly interacts with Cdc12 (Iwase et al., 2006). Therefore, we performed additional experiments to further corroborate our findings and prepared septin-Gic1 complexes devoid of either Cdc10 or Cdc11 (Figure 2D–I).

As expected from the results of antibody labeling, septin-Cdc10Δ, which formed short filaments, did not bind to Gic1 (Figure 2D–E). Septin-Cdc11Δ, however, which in accordance with previous studies (Bertin et al., 2010) does not polymerize (Figure 2F) produced a similar track-like structure as the wildtype when Gic1 was added (Figure 2G). Thus, addition of Gic1 resulted not only in the binding of the protein to the septin complex but also induced septin polymerization. We then performed single particle analysis (SPA) of the septin filaments and observed that only four subunits were located between Gic1 cross-bridges of Cdc11Δ filaments, ruling out an interaction with Cdc12 (Figure 2H–I).

In addition, yeast two-hybrid studies supported our in vitro data, showing that Gic1 only interacts with Cdc10 (Figure 2J). Notably, Cdc10 is mainly responsible for the specific interaction of septin filaments with PIP2, localizing them to membranes and promoting filament polymerization and organization (Bertin et al., 2010). For Gic2, which is a homologue of Gic1, a direct interaction through its polybasic region with PIP2 was also reported (Orlando et al., 2008). Together with our findings, this suggests that the organization and polymerization of septin filaments is controlled by the interaction of Gics with Cdc10 and the interaction of both proteins with PIP2.

Bertin et al. reported that septin filaments are cross-linked by overlapping C-terminal extensions of Cdc3 and Cdc12 (Bertin et al., 2008). Depending on the stain thickness we also observed these thin cross-links between bare septin filaments. However, in septin-Gic1 complexes, the large Gic1 cross-bridges are very prominent, causing stain to accumulate between the Gic1 cross-bridges. This makes it impossible to visualize the thin coiled-coils between Cdc3 and Cdc12, although they are probably still there.

To study the native three-dimensional structure of the filaments, we vitrified septin-Gic1 complexes and determined their structure using cryo electron tomography (cryo-ET) (Figure 3; Videos 1–4). We observed that Gic1, instead of cross-bridging only two filaments, simultaneously interacted with up to six septin polymers, forming long filament cables (Figure 3E–G). The organization of these cables is such that Gic1 forms a central scaffold to which septin filaments attach. Remarkably, individual septin filaments do not start at the same position and run along in parallel rigid lines. The septin-Gic1 cables are rather composed of many filaments of variable lengths that start at random positions, sometimes bypassing a Gic1 cross-bridge or changing place with another filament (Figure 3H–I). Filaments are often only attached to adjacent filaments for several nanometers. This gives the septin-Gic1 cables a certain flexibility that on the one hand allows them to bend and adjust to membrane curvature (Figure 3C). On the other hand it enables the interaction between cables, resulting in mesh-like structures (Figure 3D). Because of the limited resolution of the reconstructions, the additional thin connections described by Bertin et al. (Bertin et al., 2008) are not visible.

Cryo-ET of the septin-Gic1 complex.

(A) Central slice of a cryo electron tomogram (for full tomogram see Videos 1–3). Arrow indicates a septin-Gic1 cable. Scale bar, 200 nm. (B) Segmentation of the tomograms. (C and D) Extracts from tomograms that show the flexibility and bending of the septin-Gic1 complex (C) as well as its ability to form mesh-like structures (D). Scale bar, 20 nm. (E–G) Side (E) and top view (F) of a septin-Gic1 complex. The septin filaments and Gic1 cross-bridges are depicted in gold and green, respectively. Scale bar, 20 nm. (G) The crystal structure of the human SEPT2/6/7 complex (PDB 2QAG) was manually fit into the EM structure. Scale bar, 5 nm. (H and I) Side views of the septin-Gic1 3D models. To allow a better observation of the septin filament interaction with Gic1, part of the septin filaments have been omitted. Scale bar, 20 nm. (J) Model of the septin-Gic1 complex based on the known sequential order of septin filaments (Bertin et al., 2008). The G- and the N/C-interfaces are indicated by straight and circular interfaces between circles, respectively.

Video 1
Video through a cryo electron tomogram of the septin-Gic1 complex with bundles running perpendicular to the beam.
Video 2
Video through a cryo electron tomogram of the septin-Gic1 complex with bundles running parallel to the beam (indicated by an arrow).
Video 3
Close-up on a septin-Gic1 complex running parallel to the beam (full tomogram see Video 2).
Video 4
Video of the 3D reconstruction of the septin-Gic1 complex derived from tomograms of vitrified samples.

Both in three-dimensional reconstructions and two-dimensional class averages, the density corresponding to Gic1 is poorly defined, suggesting a flexible structure of Gic1. Gic1, which based on its sequence has a molecular weight of 23 kDa (Gic1(104-314)) (Figure 4A), elutes at about 49 kDa from a gel filtration column corresponding roughly to a dimer (Figure 4B). In a typical Gic1 cross-bridge up to 12 Cdc10 subunits are involved (two per filament) (Figure 3E). If we assume that each of them binds independently to a Gic1 dimer, we would expect that 12 Gic1 dimers assemble into a large cross-bridge of 600 kDa. Although we cannot exclude that the density corresponding to Gic1 appears more spread out due to missing wedge artifacts in our tomograms, the average large volume of the Gic1 density in the electron tomograms (Figure 3E–I) indicates that it must contain multiple Gic1 molecules. In addition, the heterogeneity of the Gic1 cross-bridges suggests that the number of Gic1 molecules varies between cross-bridges.

Purification of Gic1.

(A) SDS-PAGE of the Gic1(104-314) purification. (1) Flow through Ni-NTA, (2) wash Ni-NTA, (3) elution Ni-NTA, (4) elution from gel filtration after cleavage with prescission protease. (B) Gel filtration chromatography of purified Gic1(104-314). The calculated molecular weight of Gic1(104-314) is 23.38 kDa. The protein elutes from the gel filtration chromatography at a volume that corresponds to a molecular weight of 49 kDa, suggesting that it forms dimers. Protein standards for gel filtration: 1, ferritin (440 kDa); 2, aldolase (158 kDa); 3, conalbumin (75 kDa); 4, ovalbumin (43 kDa); 5, carbonic anhydrase (29 kDa); 6, RNase A (13.7 kDa); 7, aprotinin (6.5 kDa).


It was previously reported that Gic1 and its homologue Gic2 are effectors of Cdc42, which bind via their CRIB motif to the GTP-bound form of the Rho GTPase in cells (Brown et al., 1997; Chen et al., 1997). We made similar observations when studying the interaction of purified Gic1 and Cdc42 in vitro. Gic1 formed a stable complex with Cdc42-GppNHp (non-hydrolysable GTP analogue), but did not bind to Cdc42 in the GDP-state (Figure 5). On producing septin-Gic1 complexes in the presence of Cdc42-GppNHp, we found the same railroad-pattern as for the septin-Gic1 complexes, however, in this case with much bulkier cross-bridges (Figure 6A).

Cdc42-GppNHp binds specifically to Gic1.

(A and B) Gel filtration chromatography and SDS-PAGE of Gic1 with Cdc42-GppNHp (A) and Cdc42-GDP (B), respectively.

Cdc42-GppNHp binds specifically to Gic1 and dissociates septin-Gic1 complexes.

(A) Representative EM image of negatively stained septin-Gic1-Cdc42-GppNHp complexes. The concentration of Gic1 and Cdc42-GppNHp used for filament preparation is 0.5 µM. Scale bar, 100 nm. (B and C) Representative class averages of negatively stained septin-Gic1-Cdc42-GppNHp complexes with focus on septin filaments and the cross-bridges, respectively. Arrows indicate single septin proteins. Scale bar, 10 nm. (D) Same as (A) but at 10× higher concentration of Cdc42-GppNHp. (EG) Side (E) and top view (F) of a septin-Gic1-Cdc42-GppNHp complex. The septin filaments and Gic1-Cdc42-GppNHp cross-bridges are depicted in gold and green, respectively. Scale bar, 20 nm. (G) The crystal structure of the human SEPT2/6/7 complex (PDB 2QAG) was manually fit into the EM structure. Scale bar, 5 nm. (H and I) Side views of the septin-Gic1-Cdc42-GppNHp 3D structures. To allow a better observation of the septin filament interaction with Gic1, part of the septin filaments have been omitted. Scale bar, 20 nm. (J) Model of the septin-Gic1-Cdc42-GppNHp complex. Cdc42-GppNHp is depicted as yellow ovals.


SPA and cryo-ET of the Gic1-Cdc42-septin complex revealed that the cross-bridges were almost one and a half times larger in size, spanning not only two but four septin subunits, leaving only four septins unoccupied (Figure 6B–I, Video 5). This suggests a direct interaction of Cdc42-GppNHp with Gic1 on septin filaments (Figure 6J).

Video 5
Video of the 3D reconstruction of the septin-Gic1-Cdc42-GppNHp complex derived from tomograms of vitrified samples.

Unexpectedly, an increase of the Cdc42-GppNHp concentration resulted in dissociation of the septin-Gic1-Cdc42 complex (Figures 6D and 7). Smaller in size, but still filamentous, the septin filament structure deteriorated somewhat as a result of this dissociation. Gic1 and Cdc42, however, formed protein aggregates (Figure 7C,F). A possible explanation for this observation is that full decoration of Gic1 with Cdc42 destabilizes the Gic1 interaction with septins, resulting in dissociation of the septin-Gic1-Cdc42 complex. In contrast, Cdc42-GDP did not bind to septin-Gic1 complexes even at 10 times higher concentrations (Figure 8). Similar behavior was reported for the functionally related human protein Borg (Joberty et al., 1999; Sirajuddin et al., 2007). Borg binds with its BD3 domain to SEPT7/SEPT6 dimers and induces the formation of long and thick septin filament fibers (Joberty et al., 2001; Sheffield et al., 2003). In accordance with our observations with Cdc42-GTP, Gic1 and septin, the human Cdc42-GTP negatively regulates this process and after binding to Borg inhibits the Borg–septin association.

Time- and concentration-dependent interaction of Cdc42-GppNHp with the septin-Gic1 complex.

(AC) Representative EM images of the septin-Gic1 complex incubated for 60 min with (A) 0.25 μM, (B) 1.5 μM or (C) 5 μM of Cdc42-GppNHp. (DF) Representative EM images of the septin-Gic1 complex incubated with 5 µM of Cdc42-GppNHp for (D) 2 min, (E) 15 min and (F) 60 min. Scale bar, 100 nm.

Cdc42-GDP does not interact with septin-Gic1 complexes.

(A) Representative EM image of negatively stained septin-Gic1-Cdc42-GDP complexes. Scale bar, 100 nm. (B) Same as (A) but at 10× higher concentration of Cdc42-GDP. (C and D) Representative class averages of negatively stained septin-Gic1-Cdc42-GDP complexes with focus on septin filaments and the cross-bridges, respectively. Arrows indicate single septin proteins. Scale bar, 10 nm.


To determine whether Cdc42 interacts directly with septins in the absence of Gic1, we produced septin filaments in the presence of Cdc42-GppHNp and Cdc42-GDP, respectively. Although Cdc42 in its GTP-state bound to septin filaments, no regular pattern as in the case of Gic1 was observed, indicating non-specific interaction (Figure 9A). Surprisingly, Cdc42-GDP bound more specifically to septin filaments, and formed, in contrast to Cdc42-GppNHp, railroad track-like structures (Figure 9B). Even more surprising was that Cdc42-GDP completely dissociated septin filaments at higher concentrations in less than an hour (Figures 9C and 10). We then analyzed the oligomers by size-exclusion chromatography, which showed that Cdc42-GDP binds to septin complexes (Figure 9D). SPA of the dissociated septins clearly identified either octamers with an extra density at their ends (90%) or hexamers without additional density (10%) (Figure 9E–F). Cdc3 sits at the ends of the hexamers, and at the second outer position of the octamers (Figure 9G–H). Considering the sequential order of septin oligomers, this indicates that Cdc42-GDP directly binds to Cdc10 (Figure 9I), which is also the binding partner of Gic1 (Figure 2), thereby causing dissociation of the filaments. Consequently, the resulting septin octamers differ from the ones observed under high-salt conditions (Figure 11). Instead of Cdc11, which is now in the center, Cdc10 forms the cap of the octamers at both ends. In addition, binding of Cdc42-GDP to Cdc10 probably influences its interaction with Cdc3 at the G interface resulting in the formation of Cdc42-GDP-Cdc10 dimers and hexameric (Cdc3-Cdc12-Cdc11) complexes. A direct interaction of a protein with Cdc42-GDP is unusual, since in most reported cases Cdc42, like other small G proteins, binds to its effectors in its active, that is GTP-bound state. However, also other proteins such as Msb3 and Msb4, which are GAP proteins, that are, like Gic1, involved in cell polarization, were shown to directly interact with Cdc42-GDP (Tcheperegine et al., 2005).

Cdc42-GDP binds specifically to Cdc10 and dissociates septin filaments.

(A) Representative EM image of negatively stained septin complexes incubated with Cdc42-GppNHp. Scale bar, 100 nm. (B) Representative EM image of negatively stained septin-Cdc42-GDP-complexes. (C) Same as (B) but at 10× higher concentration of Cdc42-GDP. (D) Gel filtration chromatography and SDS-PAGE of the septin-Cdc42-GDP complex. (E and F) Representative class averages of septin-Cdc42-GDP complexes. The asterisk indicates the additional density corresponding to Cdc42-GDP. Arrows indicate single septin proteins. Scale bar, 10 nm. (G and H) Representative class averages of the septin-Cdc42-GDP complex labeled with antibody against Cdc3. The asterisk indicates the additional density corresponding to Cdc42-GDP. Arrows indicate single septin proteins. The triangle indicates the antibody. (I) Model of the septin-Cdc42-GDP complex. Cdc42-GDP is depicted as yellow circle.

Time- and concentration-dependent interaction of Cdc42-GDP with septin filaments.

(AC) Representative EM images of septin filaments incubated for 60 min with (A) 0.25 μM, (B) 1.5 μM or (C) 5 μM of Cdc42-GDP. (DE) Representative EM images of septin filaments incubated with 5 µM of Cdc42-GDP for (D) 2 min, (E) 15 min and (F) 60 min. Scale bar, 100 nm.

Septin polymerization depends on the ionic strength.

(A and B) Representative EM images and class averages of septin complexes at high-salt (500 mM NaCl) labeled with antibody against Cdc3 (C) and low-salt (100 mM NaCl) (D) conditions. Arrows indicate single septin proteins. Scale bars, B = 100 nm, D = 10 nm. (E) Model of the septin complex based on the known sequential order of septin filaments. The G- and the N/C-interfaces are indicated by straight and circular interfaces between circles, respectively.


To identify the Cdc42 binding site on Cdc10, we calculated homology models of Cdc3, Cdc10, Cdc11 and Cdc12 using the SEPT2 structure (PDB 2QA5) as a reference and mapped regions of conservation between the four structures on their surfaces. Examining the Cdc10-Cdc10 interface, which is an N/C interface, we found that the N-terminal region is the least conserved, and would therefore present an ideal site for specific Cdc42-GDP binding (Figure 12A–B). We deleted the N-terminal 29 residues of Cdc10 and produced complexes whose Cdc10 was replaced by Cdc10(30-322). It was previously shown that deletion of the N-terminal residues of Cdc10 results in non-polymerizing septin complexes forming tetramers and inside-out octamers (Bertin et al., 2010). We analyzed the particles by EM and SPA, which showed that most of the complexes were indeed tetramers or octamers, and that the polymerization of the complexes was clearly impaired, as we did not observe filaments at low-salt conditions (Figure 13A–C). We then incubated the oligomers with high concentrations of Cdc42-GDP and looked for additional densities corresponding to Cdc42-GDP by EM and SPA. However, no additional protein was bound to the tetramers or octamers (Figure 13D–F). Gel filtration experiments corroborated this result and showed that indeed Cdc42-GDP does not bind to Cdc10(30-322) (Figure 13G). This indicates that the N-terminal region of Cdc10 is essential for the binding of Cdc42-GDP to septin filaments. Interestingly, the same region on Cdc10 was shown to be important for the interaction of septin filaments with PIP2 (Bertin et al., 2010).

Conservation of the N/C interface between Cdc3, Cdc10, Cdc11 and Cdc12.

(A and B) Side (A) and end-on views (B) of the N/C interface between two Cdc10 septins. Homology models of Cdc3, Cdc10, Cdc11 and Cdc12 using the SEPT2 structure (PDB 2QA5) as reference were calculated using Phyre2 (Kelley and Sternberg, 2009). The models were aligned in Chimera (Pettersen et al., 2004) using the SEPT2/6/7 complex (PDB 2QAG) as reference. The sequences of Cdc3, Cdc10, Cdc11 and Cdc12 were aligned using ClustalW (Larkin et al., 2007) and the conservation between the four septins was mapped on their surfaces.

Gic1 but not Cdc42-GDP binds to polymerization impaired septin complexes.

(AC) Representative EM image and class averages of polymerization-impaired septin complexes containing Cdc10(30-322). Scale bars, 100 nm in (A) and 10 nm in (B). (DF) Representative EM image and class averages of polymerization-impaired septin complexes containing Cdc10(30-322) + Cdc42-GDP. (G) Gel filtration chromatography and SDS-PAGE of septin-Cdc10(30-322) and Cdc42-GDP. (HJ) Representative EM image and class averages of septin-Cdc10(30-322)-Gic1 complexes. The asterisk indicates the additional density corresponding to Gic1. (K) Gel filtration chromatography and SDS-PAGE of the septin-Cdc10(30-322)-Gic1 complex. (L) Model of the septin-Cdc42-GDP complex. Gic1 is depicted as blue oval. Arrows indicate single septin proteins.


From our previous experiments, we know that in septin-Gic1 complexes Cdc42-GDP binds neither to septins nor to Gic1 (Figure 8). Since both Gic1 and Cdc42-GDP bind to Cdc10 and very probably compete for the same binding site, Gic1 must have a higher affinity for Cdc10 than Cdc42-GDP. In order to prove this, we added Gic1 to septin-Cdc42-GDP complexes (Figure 14A–B). As expected, we found long railroad track-like ordered filaments indicating that Gic1 replaced Cdc42-GDP to interact with Cdc10, resulting in septin polymerization.

Gic1 stabilizes septin filaments.

(A–D) Representative EM images of septin-Cdc42-GDP complexes and septin octamers in high-salt buffer before (A and C) and after incubation with Gic1 (B and D), respectively. Scale bar, 100 nm. (E and F) Representative EM images of the septin-Gic1 complex before (E) and after increasing the salt concentration (F), respectively.


We also observed septin-Gic1 filament complexes when we mixed Gic1 with octamers under conditions that normally inhibit polymerization, such as high-salt buffer (Figure 14C–D). This was surprising, since Gic1 binds and crosslinks Cdc10 proteins while high salt weakens the interaction at the N/C-interface between two Cdc11 proteins. Thus, the stabilizing effect of Gic1 must be stronger than the weakening effect of high salt. We confirmed this observation by performing the inverse experiment, that is septin-Gic1 complexes were dialyzed against a high-salt buffer. As expected, septin-Gic1 complexes were stable and did not dissociate (Figure 14E–F). Even septin complexes completely lacking Cdc11, which do not polymerize at low-salt conditions, form filaments when Gic1 is added (Figure 2G). Taken together, we conclude that Gic1 not only scaffolds septin filaments, but also increases their stability.

We then asked whether Gic1 would also stabilize septin filaments whose assembly is weakened at the Cdc10-Cdc10 instead of the Cdc11-Cdc11 interface. As shown above, complexes whose Cdc10 is replaced by Cdc10(30-322) do not polymerize at all and form tetramers or inside-out octamers (Figure 13A–C). Interestingly, Gic1 did not induce filament formation of such impaired septins (Figure 13H), but still bound to Cdc10(30-322) as indicated by an additional density attached to the septin oligomers and by size-exclusion chromatography (Figure 13I–L).

Our data (see Figure 15 for overview) provide important insights into the interaction of Gic1, Cdc42 and septins. Although our analysis focuses on only three proteins that are important for septin recruitment, ring formation and disassembly, which are complex processes involving many proteins (reviewed in Park and Bi, 2007), we think that the new information provided by our study is coherent enough to suggest the following mechanism for the interplay between Gic1, Cdc42 and septins during budding or the cell cycle.

Schematic overview of all results.

(A) At high ionic strength septin filaments disassemble into octamers (Figure 11). However, when Gic1 is added, septin-Gic1 filament cables are formed even at high-salt concentrations (Figure 14). (B) Gic1 binds specifically to Cdc10 and thereby scaffolds and stabilizes septin filaments forming long filament cables (Figures 1 and 2). Cdc42-GTP binds specifically to Gic1 resulting in a Cdc42-GTP-Gic1 complex (Figures 5 and 6). However, at higher Cdc42-GTP concentrations, the Gic1-septin interaction is negatively influenced and results in the dissociation of the complex (Figure 6). (C) Cdc42-GDP interacts with Cdc10 and binds specifically to septin filaments (Figure 9). However, at higher Cdc42-GDP concentrations, the complex dissociates into octamers with Cdc42-GDP bound to Cdc10 and Cdc10-less hexamers (Figure 9). Gic1 displaces Cdc42-GDP and septin-Gic1 filament cables are formed (Figure 14). (D and E) The polymerization of septin complexes containing Cdc10(30-322) is impaired. (D) Gic1 still binds to Cdc10, however, does not cross-bridge complexes and septins do not polymerize (Figure 13). (E) Cdc42-GDP does not bind to septin-Cdc10(30-322) (Figure 13). (F) Gic1 does not bind to polymerization-impaired septin-Cdc10Δ complexes (Figure 2). (G) Gic1 binds to polymerization-impaired septin-Cdc11Δ complexes resulting in septin polymerization and formation of septin-Gic1 filament cables (Figure 2). Septins are depicted as orange rods. Green caps indicate Cdc11. Gic1 is depicted as blue rectangle. Cdc42-GTP and Cdc42-GDP are depicted as red and yellow rectangles, respectively. The N-terminal truncation of Cdc10 is marked by a cross and the destabilization of the Cdc11-Cdc11 N/C interface is indicated by a black block.


Because Cdc42-GDP binds to Cdc10 in septin complexes and prevents their polymerization, we propose that Cdc42-GDP rather than Gic1 recruits septin octamers (with Cdc10 at the caps) to the bud site (Figure 16A). At the bud site Cdc42 interacts with its GEF Cdc24, which catalyzes the exchange of its nucleotide (Figure 16B). As a result, Cdc42 dissociates from the septin complexes, which in turn polymerize. Besides activating many other proteins involved in septin recruitment and ring formation Cdc42-GTP recruits its effector Gic1 to the bud site (Figure 16C). Gic1, which has a high affinity for Cdc10, binds, scaffolds and stabilizes septin filaments (Figure 16D). Gic1-Cdc42-GTP-septin cables generated in this manner form a ring at the bud neck. Since our data show that the process of Gic1-septin cable formation does not necessarily require Cdc42-GTP, we propose that upon GAP-supported GTP hydrolysis, Cdc42-GDP, which has a much lower affinity to Gic1 than Cdc42-GTP, dissociates from the Gic1-septin complex (Figure 16E) and recruits more septin octamers to the bud site (Figure 16F).

Model for septin recruitment, ring formation and disassembly.

(A) Cdc42-GDP recruits septin complexes to the bud site. (B) At the bud site Cdc24 catalyzes the nucleotide exchange of Cdc42, which recruits its effector Gic1. (C) Septins polymerize. (D) Gic1 scaffolds and stabilizes septin filaments and forms septin-Gic1-Cdc42-GTP filament cables that are used for building the septin ring. (E) Cdc42-GTP is not necessary for the stability of the filament cables and upon GTP hydrolysis dissociates from the septin-Gic1 complexes. (F) Cdc42-GDP recruits more septin complexes to the bud site. (G) During cell division the local concentration of Cdc42-GTP increases by the up-regulation of Cdc24. This leads to a dissociation of the septin-Gic1-Cdc42-GTP filament cables and the septin ring disassembles. (H) After Cdc42-GAP catalyzed hydrolysis, Cdc42-GDP binds to the septin filaments and disassembles them to octamers. Septins are depicted as orange rods. Green caps indicate Cdc11. Gic1 is depicted as a blue rectangle. Cdc42-GTP and Cdc42-GDP are depicted as red and yellow rectangles, respectively.


At later stages of the cell cycle the local Cdc42-GTP concentration increases at the bud neck, probably caused by an up-regulation of Cdc24 and/or identical spatial localization (Butty et al., 2002; Goryachev and Pokhilko, 2008). As a result, Cdc42-GTP binds to Gic1-septin complexes and competes with Cdc10 for Gic1, which finally results in the disassembly of the complex and thereby septin ring rearrangement (Figure 16G). Gic1 will then be either degraded or relocated. After GTP hydrolysis, Cdc42-GDP in the absence of Gic1 specifically binds to septin filaments and dissociates them (Figure 16H). Thus, septins can be reassembled and reused for the next cycle, as was observed by McMurray and Thorner when tracking labeled septins through several cell divisions (McMurray and Thorner, 2009). The model elegantly explains the cycles of GTP loading and hydrolysis by Cdc42 that were observed by Gladfelter et al. during budding (Gladfelter et al., 2002). In conclusion, Gic1 and Cdc42 in combination with many other factors, such as the nucleotide state of septins, specific interaction with lipids and protein posttranslational modifications regulate septin recruitment, ring formation and disassembly. Most importantly, Cdc42 does not only act as a regulator, but seems to be also involved in septin recruitment.

Materials and methods

Plasmid construction

Request a detailed protocol

Construction of yeast two-hybrid plasmids of septins were previously described (Farkasovsky et al., 2005). In order to construct plasmids coding for the LexA and AD fusions with Gic1 fragments of different size, gic1(310-942) (primers GIC1-N3: CCAAGGATCCATGTTCAAAAAAAAGGACCTGTTGTCGAGG and GIC1-C1: CCAAGTCGACGGTATTTCGAGGAGTACTAGTTTC) and gic1(670-942) (primers GIC1-N4: CCAAGGATCCGATTTGGAAATGACCTTGGAAGAC and GIC1-C1: CCAAGTCGACGGTATTTCGAGGAGTACTAGTTTC) were amplified by using yeast chromosomal DNA as a template and the Expand High Fidelity PCR system (Roche, Mannheim, Germany). The PCR products were digested with BamHI and SalI and fragments were introduced between the BamHI and SalI sites of pEG202 or pJG4-5 vectors. The same PCR products were also used in the construction of expression plasmids pFM812 (gic1(310-942) in pEGST with C-terminal His6-tag) or pFM562 (gic1(670-942) in pGEX4T-3). All plasmid constructs were confirmed by sequencing.

Protein purification

Request a detailed protocol

The yeast septin complex was expressed and purified as described earlier (Farkasovsky et al., 2005). In order to study the interaction of Gic1 with septin filaments in vitro, we first expressed Gic1 recombinantly in E. coli. Since the full-length protein aggregated during expression, we tested different constructs and could obtain sufficient amounts of stable non-aggregating protein only after deleting the N-terminal 103 amino acids (Figure 4). Gic1(104-314) (in the text referred to as Gic1) contains the CRIB domain, which is essential for its interaction with Cdc42, and the C-terminus, which, because of its homology to the Borg BD3 domain, might be important for Gic1 binding to septins.

For the bacterial expression of Gic1(104-314), the plasmid pFM812 was transformed into the E. coli strain BL21 (DE3) Rosetta (Merck KGaA, Darmstadt, Germany). The cells were grown in TB medium, supplemented with ampicillin and chloramphenicol at 37°C and induced by addition of 0.2 mM IPTG at an optical density of OD600 = 0.6. After 8 hr at 28°C, cells were harvested by centrifugation, resuspended in isolation buffer IB1 (25 mM NaHPO4 pH 7.8, 5% glycerol, 0.3 M NaCl, 1 mM MgCl2, 5 mM ß-mercaptoethanol, 10 mM imidazole, complete protease inhibitors [Roche], 0.2 mM PMSF) and disrupted by using a microfluidizer (Microfluidics Co., Westwood, MA, USA). After high-speed centrifugation at 100000×g, the supernatant was incubated with 50 ml (Vt) Ni-NTA-Sepharose (Qiagen, Hilden, Germany), washed with 300 ml buffer IB2 (25 mM NaHPO4 pH 7.8, 5% glycerol, 0.5 M NaCl, 1 mM MgCl2, 5 mM ß-mercaptoethanol, 50 mM imidazole, 5 mM ATP, complete protease inhibitors, 0.2 mM PMSF) and with 100 ml of buffer IB3 (25 mM NaHPO4 pH 7.8, 5% glycerol, 0.3 M NaCl, 1 mM MgCl2, 5 mM ß-mercaptoethanol). Gic1 was eluted with 300 mM imidazole in buffer IB3 and the GST-tag was cleaved using thrombin at 4°C. Then, the GST and the undigested fusion protein were removed by glutathione sepharose column chromatography (GE Healthcare, Buckinghamshire, UK). Gic1 was concentrated and further purified on a Superdex S200 column (GE Healthcare, Buckinghamshire, UK). Expression and purification of Cdc42(G12V) was performed as previously described (Rudolph et al., 1998). Due its intrinsic GTPase activity, Cdc42 is usually GDP-bound after purification. In order to exchange GDP to GppNHp or to remove residual GTP, 5 mM EDTA (5 times the MgCl2 concentration) and 20 times excess of the desired nucleotide over the protein were added to Cdc42 and incubated at room temperature for 2 hr. Subsequently, the protein was concentrated using Amicon Ultra-4 Centrifugal Filters with a cut-off of 10 kDa and washed with the gel filtration buffer devoid of EDTA and nucleotide (150 mM NaCl, 20 mM Tris-HCl pH 7.5, 1 mM MgCl2).

Filament preparation and antibody labeling

Request a detailed protocol

For septin filament production, septin oligomers in a high-salt buffer (500 mM NaCl, 1 mM MgCl2, 50 mM Tris-HCl pH 7.5, 1 mM DTT) at a final concentration of 0.3 µM were dialyzed overnight at 4°C against a low-salt buffer (100 mM NaCl, 20 mM Tris-HCl pH 7.5, 1 mM DTT). In the case of Gic1-septin complexes, septin oligomers (final concentration of 0.3 µM) were mixed with Gic1 (final concentration of 1.5 µM) in a high-salt buffer and dialyzed as described above. For antibody decoration, 5 μl of polyclonal antibodies against Cdc11 (Santa Cruz Biotech, Heidelberg, Germany) and Cdc3 (gift from Dr Michael Knop, ZMBH, Heidelberg) (1:100) were added to 20 μl of a sample containing the filaments or the septin octamers and incubated overnight at 4°C. For studies involving Cdc42, 0.1 μM of the septin octamer and 0.5 μM of Gic1 were used. Cdc42-GppNHp and Cdc42-GDP were used at the same concentration as Gic1 or at higher concentrations (as indicated in the figures) and incubated for different time intervals (Figures 7 and 10).

Gel filtration chromatography

Request a detailed protocol

For gel filtration analyses of binding between non-polymerizing septin, Gic1 and Cdc42, 1 mg of each protein of the desired complex was mixed and incubated for 15 min at 4°C. Then, 500 μl of the solution was injected into Superdex S200 (GE Healthcare, Buckinghamshire, UK) column. The sample was run at 0.4 ml/min with a buffer containing 100 mM NaCl, 20 mM Tris-HCl pH 7.5, 1 mM DTT and 1 mM MgCl2.

Yeast two-hybrid assay

Request a detailed protocol

Two-hybrid studies were performed using the LexA-based system as described previously (Sirajuddin et al., 2009). The yeast strain EGY48 was co-transformed with pEG202-based and pJG4-5-based plasmids. The reporter plasmid pSH18-34 was used for the quantitative ß-galactosidase assay. Three independent isolates of each strain were tested on minimal medium in absence of leucine or presence of X-gal, respectively.

Adsorption to lipid monolayer

Request a detailed protocol

To obtain more details on the structure of septin-Gic1 complexes, we formed single railroad tracks by untangling the bundles on a lipid monolayer, which we then studied by EM and SPA. Since Cdc3 carries a His6-tag, the filaments can be adsorbed to a lipid monolayer containing Ni-NTA-lipids. To obtain single-stranded filaments, 30 µl of the samples were adsorbed to a lipid monolayer composed of 0.5 mg/ml of DOGS-NTA:DOPC at a molar ratio of 1:3 and incubated for 1 hr at 4°C. The monolayer was transferred to a carbon-coated grid and then negatively stained as described below.

To prove that the His6-tags of the proteins are not responsible for the entangling of the filaments, we performed additional experiments. Both Gics and septins have been reported to interact strongly with PIP2 (Orlando et al., 2008; Bertin et al., 2010). We therefore immobilized septin-Gic1 filaments on lipid monolayers containing PIP2 instead of Ni-NTA lipids. The filaments adsorbed to the grid and bundles were ‘untangled’ comparably to that seen in the experiments with Ni-NTA lipids (Figure 17), indicating that the interaction of the septin-Gic1 filaments, respectively, is not His6-tag-induced.

Septin-Gic1 complexes immobilized on a PIP2-containing lipid monolayer.

(AC) Representative EM image of negatively stained septin-Gic1 complexes immobilized on a PIP2-containing monolayer. Scale bar, 100 nm.


Negative stain electron microscopy and image processing

Request a detailed protocol

Conventional negative staining was performed as previously described (Bröcker et al., 2012). In brief, samples were applied onto freshly glow-discharged, carbon-coated copper grids. The sample was left for 1 min on the grid before blotting and staining with uranyl formate (0.7% wt/vol).

All images of negatively stained samples were taken with a JEOL JEM 1400 electron microscope equipped with a LaB6 filament at an acceleration voltage of 120 kV. Electron micrographs were taken in minimal dose mode at a magnification of 50,000× and a defocus of 1–2 µm. Negatives (Kodak S0-163 film) were scanned with a Heidelberg Tango drum scanner with 2419 dpi resolution yielding a pixel size of 4.5 Å on the specimen level. Alternatively, images were recorded with a 4k × 4k CMOS camera F-416 (TVIPS) at a calibrated magnification of 67,200×, resulting in a pixel size of 2.32 Å/pixel. Single particles were manually selected using boxer (Ludtke et al., 1999). To analyze septins and Gic1 in their non-filamentous state, 4461 particles of septin octamers, 199 particles of septin octamers labeled with anti-Cdc11 antibody and 1282 and 2195 particles of non-polymerizing septin-Cdc10(30-322) tetramers and octamers were selected. In the same way, 14,407 particles of septin-Cdc42-GDP, 451 particles of septin-Cdc42-GDP labeled with anti-Cdc3 antibody, 1152 particles of septin-Cdc42-GDP + GTP were selected. 3,169 particles of septin + GTP, 188 particles of septin + GTP labeled with anti-Cdc3 antibody, 281 particles of septin + GTP and anti-Cdc11 antibody were selected. To analyze septin and Gic1 in filamentous structures, two different sets of particles were selected. The first set focused on the septin filaments (sf) between two Gic1 cross-bridges and the second set in the middle of the Gic1 cross-bridge (gc). 2,228 sf particles and 1471 gc particles of the septin-Gic1 complex, 1971 sf particles and 1561 gc particles of the Cdc11Δ mutant filaments, 3979 sf particles and 3837 gc particles of the septin-Gic1-Cdc42-GppNHp complex and 180 sf particles of the septin-Gic1 complex labeled with anti-Cdc11 antibody were selected, respectively.

Single particles were aligned and classified using reference-free alignment and k-means classification procedures implemented in SPARX (Hohn et al., 2007). Briefly, images were normalized to the same mean and standard deviation and band-pass filtered. Images were then centered, subjected to 2D reference-free rotational alignment (sxali2d) and k-means classification (sxk_means), with approximately 100-150 images per class. The images were then further aligned and classified by several rounds of multireference alignment (sxmref_ali2d), where only high quality classes were used as references, followed by k-means classification. Classification was performed within an elongated mask including the respective septin density, expanded by 5 pixels. For analysis of antibody binding, all members of class averages showing additional density were merged and subjected to further rounds of alignment and classification, with approximately 15-20 images per class. Shown are characteristic class averages with the lowest intra-class variance in the region of antibody binding.

Cryo electron tomography (cryo-ET) and image processing

Request a detailed protocol

For cryo-ET of the septin-Gic1 and septin-Gic1-Cdc42-GppNHp complexes, 2 μM of septins and 10 μM of Gic1 with or without 10 μM Cdc42-GppNHp were used, respectively. The septin-Gic1 and septin-Gic1-Cdc42-GppNHp complexes were mixed with 5 nm colloidal gold particles. 4 μl aliquots of each preparation were applied to a glow discharged C-flat holey carbon grid (Protochips Inc.) and plunge-frozen in liquid ethane using a Cryoplunge3 (Gatan Inc.). Images were collected with a JEOL JEM 3200FSC TEM equipped with an 8k × 8k pixel TVIPS CMOS camera (F-816) at an acceleration voltage of 200 kV and a magnification of 85,470×. An in-column omega energy filter was used to improve image contrast by zero-loss filtering with a slit-width of 15 eV.

Tilt series were collected at a defocus of ∼ 4-5 μm, covering the range of ±60 in 2° increments and a dosage of about 1e2 per image. Images were then reduced by 4 × 4 pixel averaging resulting in a pixel size of 7.3 Å. Data were processed using the IMOD software package (Kremer et al., 1996). Gold particles were tracked as fiducial markers to align the stack of tilted images, and tomograms were reconstructed by weighted back-projection.

Selected sub-tomograms were segmented using Amira (Stalling et al., 2005) and rendering was performed in Chimera (Pettersen et al., 2004). The segmentation of tomographic reconstructions was performed by manually tracing structural features through sequential slices of the tomograms. Regions of high density between filaments were assigned to Gic1 or Gic1-Cdc42 respectively.

After visual inspection of the first tomograms and subsequent careful segmentation, it became immediately clear that septin-Gic1 complexes are highly heterogeneous concerning their overall arrangement, diameters and even number of septin-filaments, which excluded the possibility of subtomogram averaging.

Furthermore, the majority of septin cables reside in a preferred side-view orientation perpendicular to the beam direction (Figure 3; Video 1). Although such tomograms gave us clear hints about the overall arrangement of septin cables and revealed clear differences between septin-Gic1 and septin-Gic1-Cdc42-GppNHp, the missing wedge artifacts caused the broadening of the septin filaments, making their exact tracing difficult in all slice-directions. However, these initial attempts revealed bending as a characteristic feature of the septin-Gic1 cables (Figure 3).

On grids with relatively thick ice we observed filaments, which changed their orientation and ran parallel to the beam direction at 0° tilt. In some cases, short cables were completely embedded in ice in a top view orientation (Video 2 and 3). Since the missing wedge artifact in this geometry causes only the elongation of the septin filaments, their exact tracing was straightforward, but the cables were often too short. We therefore scanned thousands of positions in several grids for both samples (septin-Gic1 and septin-Gic1-Cdc42-GppNHp) to find complexes of sufficient length and recorded two tomograms of such regions of septin-Gic1 and three tomograms of septin-Gic-Cdc42-GppNHp complexes. Each tomogram contained 7–10 septin-Gic1 or septin-Gic1-Cdc42-GppNHp cables running parallel to the beam at 0° tilt. We extracted all separate cables as subtomograms and processed them as described above. The quality of these raw subtomograms was extremely good and details that would otherwise require the technique of subtomogram averaging (such as number and shape of filaments, or interaction between filaments) were clearly discernable even without further processing (Figure 18A–B).

Processing of subtomograms.

(A and B) Top and side view of a representative raw subtomogram filtered to 30 Å, respectively. (C and D) Segmentation in Amira (Stalling et al., 2005). Top and side view of representative slices with selected densities, respectively. (E and F) Top and side view of three-dimensionally rendered segments in Amira, respectively. (G and H) Top and side view of masked raw densities filtered to 40 Å using the Amira derived segments as masks.


We segmented the subtomograms using Amira (Figure 18C–F). The resulting segments were then binarized, expanded, gauss filtered and used as masks to extract the respective density from the raw subtomograms. The extracted densities were low-pass filtered to 40 Å (Figure 18G–H). Therefore, the images shown in Figures 3, 6 and 18G–H do not represent the typical renderings of manual segmentations, but the extracted raw densities using masks obtained by manual segmentations.

To prove that the observed organization of septin-Gic1 or septin-Gic1-Cdc42 complexes is independent of the geometry during image recording, we also processed septin-Gic1-Cdc42 complexes running perpendicular to the beam and parallel to the tilt axis (Figure 19A–C). As expected and described above the septin filaments are broadened and flat. However, the structure clearly shows that the septin-Gic1-Cdc42 complexes have the same organization as the complexes depicted in Figure 3E–G and Figure 6E–G, therefore ruling out that our observations are influenced by the geometry of the complexes.

Tomography of septin-Gic1-Cdc42 complexes running parallel to the tilt-axis.

(A) Central slice of representative tomogram of septin-Gic1-Cdc42 complexes. A railroad-like complex running parallel to the tilt axis was extracted (see inset). Scale bars, 200 nm. (B and C) Top (B) and side view (C) of a septin-Gic1-Cdc42-GppNHp complex. The septin filaments and Gic1-Cdc42-GppNHp cross-bridges are depicted in gold and green, respectively. Scale bar, 20 nm.


To determine the effect of the missing wedge on our structure we performed tomography-simulations using an idealized railroad-like structure model. The idealized model of a septin-Gic1-Cdc42-GppNHp complex (Figure 20B–C) was obtained by fitting several copies of the crystal structure of the mammalian septin trimer (PDBid: 2QAG) into the density of septin filaments and placing of GROEL/GROES (PDBid: 1AON) into the density corresponding to Gic1-Cdc42-GppNHp cross-bridges in one of our reconstructions (Figure 20A).

Simulations of electron tomograms of septin-Gic1-Cdc42-GppNHp complexes.

(A) Side view of a septin-Gic1-Cdc42-GppNHp subtomogram. The septin filaments and Gic1-Cdc42-GppNHp cross-bridges are depicted in gold and green, respectively. (B) Model of a septin-Gic1-Cdc42-GppNHp complex obtained by fitting the crystal structure of the mammalian septin trimer (PDBid: 2QAG, gold) and GROEL/GROES (PDBid: 1AON, green) into (A), shown in three different orientations. (C) Simulated EM density map of (B) at a resolution of 45 Å. (GL) Simulations of electron tomograms obtained by tilting the model shown in (C) in the range of ±60 in 2° increments with its long axis running parallel to the beam (D), parallel (G) and perpendicular (J) to our microscope’s tilt axis, respectively. (E, H, and K) Corresponding projections at −60°, 0°, 60° and (F, I, and L) the resulting simulated tomograms, respectively. Note that the tomograms shown in (I and L) are obviously affected by missing wedge artifacts, whereas the tomogram in (F) (long axis of the molecule parallel to the beam axis during tilting) is only slightly stretched in comparison to the original model (C).


We then simulated electron tomograms by tilting the model shown in Figure 20C in the range of ±60 in 2° increments with its long axis running parallel to the beam, and parallel and perpendicular to our microscope’s tilt axis, respectively (Figure 20D,G,J).

All tomograms are affected by missing wedge artifacts. However, the complexes running parallel to the tilt axis are better resolved (Figure 20E–F,H–I) than the ones running perpendicular to the tilt axis (Figure 20K–L). Because of the longitudinal appearance of the septin-Gic1-Cdc42 complexes, tomograms with complexes running parallel to the beam result in a reconstruction that is more similar to the original model (Figure 20E–F) compared to complexes running perpendicular to the beam (Figure 20H–I). The filaments are fully comparable to the filaments of the original model. Only the densities of GROEL/GROES (simulating Gic1-Cdc42 cross-bridges) (Figure 20F, shown in green) show an increase in diameter along the z direction by ∼14%.

Moreover, to simulate a more ‘close to reality’ situation, the same procedure was repeated, this time after adding noise and applying CTF to the projections (Figure 21A–B). The volume was then filtered to 45 Å (Figure 21C) and compared again to the simulated model (Figure 21D). Even without further processing of this simulated tomogram, both volumes show a high degree of similarity in all aspects with a cross-correlation coefficient of 0.95, further suggesting that tomograms taken under similar conditions are fully sufficient to describe the basic architecture of the filaments.

Electron tomogram simulation of septin-Gic1-Cdc42-GppNHp with CTF and noise added.

(A) Projections of the model shown in (B) in the range of ±60° in 2° increments, after applying the CTF at a defocus of 4 µm and addition of noise. Note that at 0°, the long axis of the model was running in the z direction (Figure 19D). (B) Original model used for generating the reprojections (Figure 19F). (C) Reconstruction obtained by back-projecting the images shown in (A). (D) Fitting of the simulated tomographic reconstruction (yellow mesh) into the original model (cyan surface).


Filament preparation and antibody labeling

Request a detailed protocol

For septin filament production, 0.3 µM of septin hetero-oligomers (wild-type, EGFP-tagged, Cdc10Δ, Cdc11Δ or Cdc10(30-322) mutants) in a high-salt buffer (500 mM NaCl, 1 mM MgCl2, 50 mM Tris-HCl pH 7.5, 1 mM DTT) were dialyzed overnight at 4°C against a low-salt buffer (100 mM NaCl, 20 mM Tris-HCl pH 7.5, 1 mM DTT). In order to form the septin-Gic1 complexes, 1.5 µM of Gic1 was included during dialysis. Since Gic1 forms dimers and septin octamers contain two Cdc10 subunits, the molar ratio (Cdc10:Gic1) is 1.25:1. For antibody decoration, 5 μl of polyclonal antibodies against Cdc11 (Santa Cruz Biotechnology Inc.) and Cdc3 (a gift from Michael Knop, DKFZ-ZMBH, Heidelberg, Germany) (diluted 1:100) were added to 20 μl of a sample containing either septin-Gic1 complex or the septin octamers (generated by GTP, Cdc42-GDP or both) and incubated overnight at 4°C to allow efficient binding.

In order to evaluate the effect of Cdc42 on septin complexes, 0.1 μM of septin octamers and 0.5 μM of Gic1 were used. Cdc42-GppNHp and Cdc42-GDP were used at a concentration equal to Gic1 or at 10 times higher concentrations and incubated for different time intervals (Figures 7 and 10). To assess the effect of nucleotides on septin complexes, 2.4 mM of GMP, GDP, GTP or GppNHp were added to 0.5 μM of septin filaments dialyzed alone or with 2.5 μM of Gic1 and incubated for 16 hr at 4°C. The same sample was dialyzed to remove the residual GTP and the generated octamers were incubated with 25 μM of Cdc42-GDP and incubated at 4°C for 16 hr. For cryo-ET of the septin-Gic1 and septin-Gic1-Cdc42 complexes, 2 μM of YSC and 10 μM of Gic1 with or without 10 μM Cdc42-GppNHp were used, respectively.

Data deposition

Request a detailed protocol

The coordinates for the EM structures have been deposited in the EM Data Bank under accession codes EMDB-2504 and EMDB-2505.

Data availability

The following data sets were generated


    1. Haarer BK
    2. Pringle JR
    Immunofluorescence localization of the Saccharomyces cerevisiae CDC12 gene product to the vicinity of the 10-nm filaments in the mother-bud neck
    Mol Cell Biol 7:3678–3687.
    1. Joberty G
    2. Perlungher RR
    3. Macara IG
    The Borgs, a new family of Cdc42 and TC10 GTPase-interacting proteins
    Mol Cell Biol 19:6585–6597.
    1. Rudolph MG
    2. Bayer P
    3. Abo A
    4. Kuhlmann J
    5. Vetter IR
    6. Wittinghofer A
    The Cdc42/Rac interactive binding region motif of the Wiskott Aldrich syndrome protein (WASP) is necessary but not sufficient for tight binding to Cdc42 and structure formation
    J Biol Chem 273:18067–18076.
    1. Stalling D
    2. Westerhoff M
    3. Hege HC
    The visualization handbook
    The visualization handbook.

Decision letter

  1. Axel T Brunger
    Reviewing Editor; Stanford University, United States

eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.

Thank you for sending your work entitled “The Role of Cdc42 and Gic1 in the Regulation of Septin Filament Formation and Dissociation” for consideration at eLife. Your article has been favorably evaluated (subject to revisions outlined below) by a Senior editor and 3 reviewers, one of whom is a member of our Board of Reviewing Editors.

The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.

In this in vitro study with recombinant proteins, the role of the guanine nucleotide binding protein Cdc42 and the regulator Gic1-septin filament formation and dissociation is elucidated. Using a combination of negative stain electron microscopy and cryo electron tomography, along with manipulations of the septin complex or the nucleotide state of Cdc42, a dual role of Cdc42 was discovered. In the GTP-state, Cdc42 leads to disassembly of the Gic1-septin complex, whereas in the GDP-state, Cdc42 leads to further disassembly of the septin complex in absence of Gic1. Moreover, the cryo EM reconstructions show that Gic1 can bind to multiple septin filaments in a heterogeneous fashion, accounting for flexibility of septin filaments during cell division and cytokinesis.

Previous studies have linked Gic1/2 and Cdc42 nucleotide cycling to septin assembly in vivo but really how Cdc42 and its myriad of effectors actually lead to septin ring and collar formation remain mysterious. While Gic1/2 function has been genetically linked to septin organization and shown to physically associate with septin complexes, precisely what the Cdc42 effector does to regulate septins is unknown. Similarly, for Cdc42 itself, which is essential for septin assembly, it has not been determined if Cdc42 can bind septins and directly promotes filament assembly, filament bundling and/or if it simply indirectly recruits septins to the bud site.

The electron micrographs are striking and represent some of the most detailed glimpses at purified septins presented to date. However, there are significant concerns about the quality and resolution of the EM tomograms that need to be addressed, along with the other concerns outlined below, before a decision can be made.

Overall, the data indicate that 1) Gic1 can bundle septins through specific interactions at Cdc10, 2) Cdc42-GDP can bind septin octamers (through a surprisingly differently-ordered octamer than what has been shown for pure septin complex), 3) Cdc42-GTP changes how Gic1 associates with septin filaments and may itself associate with Gic1 bound to filaments, 4) high concentrations of Cdc42-GTP can lead to Gic1 dissociation for filaments and therefore ultimately destabilize the filaments. These are intriguing findings and do represent the first clean reconstitution of regulated septin assembly. Thus, the studies in this work should stimulate future studies to confirm that this is what is happening in vivo.

Required revisions:

1) The authors employ cryo-ET to view these fascinating assemblies 3D. However, lack of details precludes confidence in the displayed models. The authors need to detail the number of data sets collected and analyzed, post-processing and segmentation procedures, and should provide slices in X Y directions. Moreover, from reviewing the movies kindly provided the claim of isotropic resolution is inadequate. The resolution in Z direction is severely diminished, and this is the long axis of the bundles used. There is no way of telling what type of artifacts this geometry will introduce. If the authors want to prove that their conclusions are supported by the data, the authors will need to come up with some more convincing arguments. Maybe the authors can apply some simulations with idealized models or make use of the bundles with their long axis running in the other directions (x, y). As it stands there is some probability that the data is over interpreted, at least to some extent. Furthermore, because of the absence of averaging, the authors are looking at single motifs in a fairly noisy background, which is not helping in building confidence for their conclusions.

2) The bundles of septin-Gic complexes were “untangled” by adsorbing them to a lipid monolayer containing NTA-lipids that bind to His6-tags attached to the Cdc3 septin molecule. Do the His-tags themselves cause some aggregation in this system, i.e., could that be the origin of the entangling of the filaments? In other words, were EM studies attempted with a different method to tether them to the surface?

3) Please provide the control polymerization done in absence of fluorophore to establish the lack of interference (artifacts) induced by the addition of the EGFP-tag.

4) What is the estimated resolution of the cryo-EM tomograms in xy and z, respectively (see also point 1)?

5) What is the concentration of Cdc42-GppNHp in Figure 5?

6) The Gic components in the septin-Gic complexes appear rather heterogeneous. Do they consist of multiple Gic molecules or is Gic thought to be a flexible multi-domain protein?

7) Figure 1: The fluorescence in B looks just aggregated rather than bundled: these images raise some concern about what the relevance is of filament cables to normal septin assemblies. There is no scale bar annotation for panels C-F.

8) Figure 2: There are no scale bar annotations. There is only one spot along the fiber that is Cdc11 labeled. Please mention how many particles were used for the averaging in Figure 2B. This is an important potential issue because previous work by Iwase et al. found Gic specifically complexing with Cdc12 not Cdc10.

9) The interpretation of Figure 5C that the bridges get bulkier with Cdc42 added is that Cdc42 is part of enlarged bridging structure with Gic, but this could also be Gic1 oligomerization – without further experiments this can't be excluded.

10) Figure 8D: How does one know that band from gel filtration is Cdc42-GDP and not a contaminant from bacteria? Could a Western blot also be included?

11) It is perplexing that filaments breaking at Cdc10 interface in presence of excess Cdc42. It would be interesting in seeing this result validated in some other manner.

12) For easy reference please keep the color coding of Cdc3-EGFP, Cdc10, Cdc11 and Cdc12 consistent with the one published in Bertin et al. 2008.

13) In Bertin et al. 2008, cross-bridges between pairs of filaments were observed emanating from Cdc12 and Cdc3, suggested to be their CTEs. Here, Sadian et al. only observe cross bridges if Gic or Cdc42 are added (through Cd10). The authors need to discuss the underlying source of the conflicting results.

[Editors’ note: before acceptance, the following revisions were also requested.]

Thank you for resubmitting your work entitled “The Role of Cdc42 and Gic1 in the Regulation of Septin Filament Formation and Dissociation” for further consideration at eLife. Your revised article has been evaluated by a Senior editor, a member of the Board of Reviewing Editors (Axel Brunger), and two reviewers. We thank the authors for addressing many of the concerns raised by the reviewers and the Reviewing editor. The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below.

There are remaining significant concerns about the quality and reliability of the cryo-EM tomography results (see the comments by Reviewer 3 below). The reviewers and editors had considerable discussions about these concerns. They recognize that main conclusion that is drawn from the tomograms is that Gic1 cross-bridges more than two filaments, a result that could not be drawn from the negative stain EM images alone. The potential artifacts that are caused by the missing wedge in the EM data could have affected this particular conclusion, especially the connections between the filaments, as the authors also showed in their simulations.

Ideally, the authors should revisit their existing EM tomograms at the orthogonal orientation to show that these connections are independent of the geometry (see Reviewer 3 comments). The authors (using the geometry in Figure 19G for example) showed that there are clear extra crosslinks visible in tomograms. However, we would be prepared to accept the paper in essentially its current form if the authors would clearly point out the limitations of their current tomography study (including the potential effects of the missing wedge, lack of averaging, the estimated very low resolution of the images). The authors need to make a convincing case that the main conclusion drawn from the tomograms (more than two filaments binding to Gic1) is probably not affected by these concerns. Moreover, the authors must clearly state in the main text, the figure captions, and the conclusions that the images themselves may have gross errors.

Comments from Reviewer 3:

The authors have now given a much clearer picture of the tomography data and processing. Unfortunately, much of what was laid out only confirmed the reviewer's initial concerns. It is not the quality of the reconstruction that improves by changing the relationship between beam direction and tilt axis. The data in the missing wedge is missing, still. The artifacts are just along a different direction. The illusion of “improvement” is actually dangerous because it gives a false sense of quality for the reconstruction.

The authors show themselves with their simulations that the data collection strategy they use generates severe artifacts to thin structures that are perpendicular to the beam. If there are any thin connections between the filaments, it is very likely that they will not appear in the reconstruction with the chosen geometry. The modeling of the cross-links as featureless barrels is not helpful to convince the reviewer. The question is what would happen to finer features that may be attached to these barrels or emanate from/connect between the filaments.

In trying to get a quantitative assessment of the assembly features (filaments and linkers) for this geometrically challenging system, the authors should have generated tomo-series in both orthogonal orientations to provide dual axis tomograms. Such data scheme would allow assessing the extent of the missing wedge and isotropic distortions for the system and thus provide measurable values to the confidence to the described conclusions.

Furthermore it is somewhat concerning that the whole analysis is based on five reconstructions, 2 of septin-Gic1 and 3 of septin-Gic-Cdc42-GppNHp complexes. These numbers are on the lower side to draw robust conclusions, specifically as thousand of such assemblies were viewed.

In summary, the reliability of the features in the reconstructions is questionable and the presentation of the data is misleading by implying that artifacts caused by the missing wedge would be somehow overcome by using a specific geometry.


Author response

1) The authors employ cryo-ET to view these fascinating assemblies 3D. However, lack of details precludes confidence in the displayed models. The authors need to detail the number of data sets collected and analyzed, post-processing and segmentation procedures, and should provide slices in XY directions.

We admit that the description of our approach was not completely adequate, and apologize for this. We now provide more technical details in Materials and methods.

We also provide slices and the corresponding segmentations in XY and Z direction and also included a direct comparison between raw and processed subtomograms in an additional figure (Figure 18), showing that the main features of the septin-Gic1 and septin-Gic1-Cdc42 complexes described in the present study are well defined even in the noisy unprocessed subtomograms.

Moreover, from reviewing the movies kindly provided the claim of isotropic resolution is inadequate. The resolution in Z direction is severely diminished, and this is the long axis of the bundles used. There is no way of telling what type of artifacts this geometry will introduce. If the authors want to prove that their conclusions are supported by the data, the authors will need to come up with some more convincing arguments. Maybe the authors can apply some simulations with idealized models or make use of the bundles with their long axis running in the other directions (x, y). As it stands there is some probability that the data is over interpreted, at least to some extent. Furthermore, because of the absence of averaging, the authors are looking at single motifs in a fairly noisy background, which is not helping in building confidence for their conclusions.

To obtain an optimal coverage of the complexes during a single-tilt tomographic image acquisition, the long axis of the complexes had to run either parallel to the tilt axis or parallel to the beam axis of the microscope. In the first case, the complexes were strongly affected by the missing wedge. The filaments appeared stretched and merged partially with each other and therefore their tracing was difficult. On the other hand, in tomograms with complexes running parallel to the beam, the septin filaments were clearly defined, all filaments around Gic1 had the same diameter and their tracing was straightforward. Furthermore, the densities corresponding to Gic1 and Gic1/Cdc42, respectively were fully comparable respective their overall shape and size to tomograms with complexes running in perpendicular directions, at least at the resolution level of 40-50 Å. Thus, tomograms of complexes running in the z direction provided the best possible 3D reconstructions of these complexes. We added two additional Videos (Videos 2-3) showing cryo electron tomograms with septin-Gic1 complexes running parallel to the beam.

However, we are aware that these tomograms are still affected by the missing wedge along the z direction, as pointed out by the reviewers. In order to show to what extent this results in structural artifacts, we performed tomography-simulations using an idealized railroad-like structure model, as suggested. These simulations are now included in Figures 19-20 and described in detail in the revised manuscript.

In the case of the model running with its long axis parallel to the beam at 0˚, the filaments do not show prominent missing wedge artifacts at a resolution of 45 Å and are fully comparable to the filaments of the original model. Only the density of GROEL/GROES (simulating Gic1-Cdc42) (Figure 19F, shown in green) shows an increase in diameter along the z direction by ∼14 %.

We are confident that this mild anisotropy does not lead to wrong conclusions, especially since we do not describe any specific molecular or mechanistic details and restrict our analysis of 3D-tomograms exclusively to basic low-resolution features of the complexes. Taken together, this rules out that we over-interpret our data.

2) The bundles of septin-Gic complexes were “untangled” by adsorbing them to a lipid monolayer containing NTA-lipids that bind to His6-tags attached to the Cdc3 septin molecule. Do the His-tags themselves cause some aggregation in this system, i.e., could that be the origin of the entangling of the filaments? In other words, were EM studies attempted with a different method to tether them to the surface? Note to authors: the response to our query along with the PIP2 control should be included in the revised paper; no additional experiments are needed.

In a classical EM grid preparation, samples are incubated on carbon coated copper grids to which they absorb non-specifically. In the case of filaments that tend to bundle, the whole grid is often covered with protein making the analysis of single filaments difficult and tedious. Septin filaments only interact with lipid monolayers if the monolayers contain special lipids. His-tagged septin filaments can be immobilized on lipid monolayers with Ni-NTA lipids and by varying the concentration of Ni-NTA lipids the concentration of septin filaments on the grid can be conveniently adjusted. This facilitates the sample preparation and is an established method in electron microscopy (Kelly et al. 2010).

However, in order to prove that the His-tags of the proteins are not responsible for the entangling of the filaments, we performed additional experiments. Both Gics and septins have been reported to interact strongly with PIP2 (Orlando et al. 2008; Bertin et al. 2010). We therefore immobilized septin-Gic1 filaments on lipid monolayers containing PIP2 instead of Ni-NTA lipids. The filaments adsorbed to the grid and bundles were “untangled” comparably to that seen in the experiments with Ni-NTA lipids (Figure 17), indicating that the interaction of the septin-Gic1 filaments, respectively, is not His-tag-induced.

Another good argument against the hypothesis of a His-tag-induced interaction is that we also observed the “entangling” of septin filaments when we studied unmodified wildtype septins purified from yeast (Farkasovsky et al. 2005). The bundling of His-tagged septins is not stronger than that of the wildtype filaments. We can therefore exclude that the His-tag forces the filaments to “entangle”.

In our study, we showed that His-tagged Gic1 interacts with the septin Cdc10 (Figure 2). The His-tag on the septin filaments, however, is attached to a different septin, namely Cdc3. We can therefore also exclude a His-tag induced interaction of Gic1 and septins. In addition, we performed experiments with GST-tagged Gic1 and observed the same railroad structures as for His-tagged Gic1, indicating that the interaction between Gic1 and Cdc10 is not induced by His-tags (Author response image 1).

Author response image 1
Septin-Gic1-GST complexes.

Finally, the His-tags do not aggregate homogeneous Gic1 (Figure 4) or septin octamer samples (Figures 11 & 14). The entangling of septin filaments must therefore be caused by other physical and chemical interactions comparable to the bundling of actin filaments.

In summary, we can exclude artifacts induced by the His-tags.

3) Please provide the control polymerization done in absence of fluorophore to establish the lack of interference (artifacts) induced by the addition of the EGFP-tag.

The only experiments we have done in the presence of a fluorophore are shown in Figure 1A/B. All other experiments were done without additional EGFP-tag. We point this out more clearly in the revised manuscript.

We also performed experiments with EGFP-tagged septins (see Author response image 2), but did not include them in the manuscript to prevent confusion. Using EGFP-tagged proteins, we observe the same railroad track structure as in the experiments without the fluorophore. However, the density of Gic1 appears to be much larger, since EGFP localizes directly to Cdc3 and adds density to the cross-bridge between the filaments.

Author response image 2
Complexes between Gic1 and septin filaments containing Cdc3-EGFP.

(A-B) Representative EM images of negatively stained septin filaments containing Cdc3-EGFP polymerized by dialysis alone (A) or together with Gic1 (B). Scale bar, 100 nm. (C-D) Representative class averages with focus on the Gic1 cross-bridges (C) and the septin-EGFP filaments (D). Arrows indicate single septin proteins. Scale bar, 10 nm. (E) Model of the septin-Gic1 complex based on the known sequential order of septin filaments (Bertin et al. 2008). The G- and the N/C-interfaces are indicated by straight and circular interfaces between circles, respectively. EGFP is indicated as light green ovals.

4) What is the estimated resolution of the cryo-EM tomograms in xy and z, respectively (see also point 1)?

Despite much progress in electron tomography, quantitative assessment of resolution in single tomograms remains a problematic issue. A resolution estimate is given for only 25 of the 60 tomograms deposited in the EMDB. For 7 of these 25 tomograms, although a value is given, it is not described how the authors determined it. For 5 tomograms, the resolution was estimated by visual inspection regarding certain known features in the tomograms. For 7 tomograms, the resolution was estimated by the first zero-crossing of the CTF in the 0˚ image (however, this criteria does not distinguish between signal and noise, and is therefore just a measure for how good the resolution could be in principle). For the remaining specimens, the resolution was determined by electron diffraction (this is only possible for ordered structures such as 2D crystals or helices). A cross validation-based criterion exists for electron tomography (Cardone et al. 2005), but because of many problems it extremely underestimates the resolution of the tomograms and is therefore not used by the tomography community.

Therefore, due to the absence of a standard method, we avoid estimating the resolution of our tomograms. However, segmentation of our tomograms was straightforward after filtering down the raw tomograms to 30 Å. The first zero-crossing in the CTF in the 0˚ images of the various tomograms is at about 35-45 Å. Moreover, a visual comparison, between the densities of septin filaments in our tomograms and down-filtered crystal structures of human septin (see also Figures 18-20), suggests a resolution of 40-60 Å. Thus, for our sub-tomograms shown in the present study, we expect a resolution in the xy direction of 40-60 Å (at lower resolutions, septin filaments are expected to appear as featureless straight rods). Furthermore, based on an elongation factor of 1.14 that we derived from our simulation studies, we expect a 5-10 Å decrease of resolution in the z direction.

5) What is the concentration of Cdc42-GppNHp in Figure 5?

As described in the Materials and methods, Cdc42-GppNHp was added at equal concentrations as Gic1 for filament preparation, i.e., 0.5 µM and at 10x higher concentrations, i.e. 5 µM. To prevent any confusion we included the values now in the legend to Figure 6 (formerly Figure 5).

Taken into account that each yeast cell contains around 1000 copies of septin octamers and Gic1 (Ghaemmaghami et al. 2003), the estimated concentration of septins or Gic1 in a yeast cell is around 0.05 µM. However, the local concentration of Cdc42 and Gic1 in yeast (for example at the budding neck) can be much higher (Gladfelter et al. 2002; Goryachev & Pokhilko 2008). We therefore believe that our observations are physiologically relevant.

6) The Gic components in the septin-Gic complexes appear rather heterogeneous. Do they consist of multiple Gic molecules or is Gic thought to be a flexible multi-domain protein?

Gic1, which based on its sequence has a molecular weight of 23 kDa (Gic1(104-314)), elutes at about 49 kDa from a gel filtration column corresponding roughly to a dimer (Figure 4). In a typical Gic1 cross-bridge up to 12 Cdc10 subunits are involved (two per filament) (Figure 6). If we assume that each of them binds independently to a Gic1 dimer, we would expect that 12 Gic1 dimers assemble into a large cross-bridge of 600 kDa. In good agreement with this the average large volume of the Gic1 density in the electron tomograms indicates that it must contain multiple Gic1 molecules. The heterogeneity of the Gic1 cross-bridges indicates that the number of Gic1 molecules varies between cross-bridges. We included an additional paragraph in the revised manuscript.

7) Figure 1: The fluorescence in B looks just aggregated rather than bundled: these images raise some concern about what the relevance is of filament cables to normal septin assemblies. There is no scale bar annotation for panels C-F.

To get a strong signal in the light microscope high concentrations of septin and septin-Gic1 filaments were used. In addition, the images were taken with an epifluorescence microscope not with a confocal microscope. That is why the overlapping septin filaments appear aggregated. However, the extended EM study clearly shows that we observe filament cables and bundles, but no aggregates. The scale bar annotations are included in the revised manuscript.

8) Figure 2: There are no scale bar annotations. There is only one spot along the fiber that is Cdc11 labeled. Please mention how many particles were used for the averaging in Figure 2B. This is an important potential issue because previous work by Iwase et al. found Gic specifically complexing with Cdc12 not Cdc10.

The scale bar annotations are included in the revised manuscript.

As explained in the legend the arrow in Figure 2B does not indicate Cdc11, but the antibodies bound to Cdc11. Since there are two adjacent Cdc11 septins, two antibodies bind instead of one as shown in Figure 2C. We accidentally wrote “antibody” instead of “antibodies”. We changed this in the revised manuscript.

As stated in the Material and methods, we used 199 particles that had clearly antibodies bound for this analysis. Each class average contained 15 single particles. We state that now in the revised manuscript.

However, the number of single particles in the class average is not an important potential issue. Because of the work by Iwase et al. that indicated that Gic would bind to Cdc12, we did three independent studies to prove that Gic1 binds to Cdc10. First, we did the antibody labeling mentioned above. Second, we performed septin-Gic1 complex formation with septin-Cdc10Δ complexes that showed that Gic1 does not bind to septin-Cdc10Δ filaments although they contain Cdc12 (Figure 2D-I). Third, we performed yeast two-hybrid assays that clearly showed that Gic1 binds to Cdc10 (Figure 2J). Notably, in contrast to Iwase et al., who got a signal after 9 days, we obtained a clear-cut signal already after 2 days. We describe our studies of the Cdc10Δ and Cdc11Δ-septins now in more detail in the revised manuscript to make this point clear.

9) The interpretation of Figure 5C that the bridges get bulkier with Cdc42 added is that Cdc42 is part of enlarged bridging structure with Gic, but this could also be Gic1 oligomerization – without further experiments this can't be excluded.

In Figure 5 (formerly Figure 4) we show that Cdc42-GppNHp binds specifically to Gic1. The gel filtration profile in Figure 4B does not indicate any kind of oligomerization of Gic1 and the Gic1-Cdc42-GppNHp complex elutes from the gel filtration column at the expected position (Figure 5). We can therefore clearly state that Cdc42-GppNHp binds to Gic1 and does not induce Gic1 oligomerization. The binding of Cdc42-GppNHp must therefore be the reason for the broadening of the cross-bridges in the case of septin-Gic-Cdc42-GppNHp complexes.

10) Figure 8D: How does one know that band from gel filtration is Cdc42-GDP and not a contaminant from bacteria? Could a Western blot also be included?

The experiment represented in Figure 9 (formerly Figure 8) was performed with pure proteins. The His-tagged proteins (Cdc3 and Gic1) and GST-tagged Cdc42 were recombinantly expressed in E. coli and purified by affinity chromatography to high purity. We prepared septin filaments, added Cdc42-GDP and incubated the mixture overnight prior to gel filtration.

In order to prove the purity of our proteins, we added SDS-PAGE lanes of the purified proteins to Figure 9D in the revised manuscript.

11) It is perplexing that filaments breaking at Cdc10 interface in presence of excess Cdc42. It would be interesting in seeing this result validated in some other manner.

In an additional experiment, we identified the Cdc42 binding site on Cdc10 validating our previous results. The following passage, including figures, has been added to the revised manuscript:

“To identify the Cdc42 binding site on Cdc10, we calculated homology models of Cdc3, Cdc10, Cdc11 and Cdc12 using the SEPT2 structure (PDB 2QA5) as a reference and mapped regions of conservation between the four structures on their surfaces…”

12) For easy reference please keep the color coding of Cdc3-EGFP, Cdc10, Cdc11 and Cdc12 consistent with the one published in Bertin et al. 2008.

We changed the color coding in all figures accordingly.

13) In Bertin et al. 2008, cross-bridges between pairs of filaments were observed emanating from Cdc12 and Cdc3, suggested to be their CTEs. Here, Sadian et al. only observe cross bridges if Gic or Cdc42 are added (through Cd10). The authors need to discuss the underlying source of the conflicting results.

Looking at high concentrations of septin filaments we see the same thin cross-bridges that were described by Bertin et al., 2008 (Author response image 3A). These cross-bridges connect parallel running filaments that lie very close to each other. Using negative stain electron microscopy, they can normally only be seen when many filaments with cross-bridges at the same positions lie exactly on top of each other. Depending on the thickness of the stain, we can sometimes see them connecting two septin filaments also at lower septin filament concentration (Author response image 3B). The Gic1-mediated cross-bridges, however, are much larger and can easily be seen in negative stain electron microscopy. The stain accumulation between the Gic1 cross-bridges makes it impossible to visualize the thin cross-bridges emanating from coiled-coil interactions of the C-terminal extensions of Cdc3 and Cdc12, although they are probably still there. In addition, the resolution of the cryo electron tomography is not sufficient to visualize the thin coiled-coil cross-links between the C-terminal extensions of Cdc12 and Cdc3.

We added a passage discussing this issue in the revised manuscript.

Author response image 3
Cross-bridges between bare septin filaments.

(A) Very high concentration of septin filaments. (B) Low concentration of septin filaments. Note, due to negative staining the thin cross-bridges between bare septin filaments mediated by the C-terminal extensions of Cdc3 and Cdc12 can only rarely be visualized. Scale bar, 100 nm.

[Editors’ note: before acceptance, the following revisions were also requested.]

There are remaining significant concerns about the quality and reliability of the cryo-EM tomography results (see the comments by Reviewer 3 below). The reviewers and editors had considerable discussions about these concerns. They recognize that main conclusion that is drawn from the tomograms is that Gic1 cross-bridges more than two filaments, a result that could not be drawn from the negative stain EM images alone. The potential artifacts that are caused by the missing wedge in the EM data could have affected this particular conclusion, especially the connections between the filaments, as the authors also showed in their simulations.

Ideally, the authors should revisit their existing EM tomograms at the orthogonal orientation to show that these connections are independent of the geometry (see Reviewer 3 comments). The authors (using the geometry in Figure 19 G for example) showed that there are clear extra crosslinks visible in tomograms.

We revisited our EM tomogram at the orthogonal orientation and searched for filaments running parallel to the tilt axis, exactly as simulated in Figure 19G (now Figure 20G) (see also below) and processed the tomograms as described for the other septin-Gic1 filaments (see Material and methods). As expected the septin-Gic1-Cdc42-GppNHp complexes look similar to the structures obtained from bundles that run parallel to the beam (new Figure 19A-C). Despite missing wedge artifacts, there are clear Gic1-Cdc42 cross-bridges (“or extra crosslinks”) that connect several, in this case five, septin filaments. This proves that observation of Gic1 or Gic1-Cdc42 connections is independent of the geometry.

However, we would be prepared to accept the paper in essentially its current form if the authors would clearly point out the limitations of their current tomography study (including the potential effects of the missing wedge, lack of averaging, the estimated very low resolution of the images). The authors need to make a convincing case that the main conclusion drawn from the tomograms (more than two filaments binding to Gic1) is probably not affected by these concerns. Moreover, the authors must clearly state in the main text, the figure captions, and the conclusions that the images themselves may have gross errors.

We hope that our additional reconstructions and our answers to the reviewer’s comments (see below) are convincing. Additionally we included some sentences that explain the limits of cryo-ET, such as missing wedge artifacts, in the revised manuscript.

Comments from Reviewer 3:

The authors have now given a much clearer picture of the tomography data and processing. Unfortunately, much of what was laid out only confirmed the reviewer's initial concerns. It is not the quality of the reconstruction that improves by changing the relationship between beam direction and tilt axis. The data in the missing wedge is missing, still. The artifacts are just along a different direction. The illusion of “improvement” is actually dangerous because it gives a false sense of quality for the reconstruction.

This reviewer is correct in stating that the missing wedge is always there (i.e., missing), independent of the beam direction and tilt axis. We did not claim that there are no missing wedge artifacts. But dependent on the orientation of the complexes during tomography these artifacts have different effects on the overall computed structures of the complexes.

If the symmetry or pseudo-symmetry axis of an object is running parallel to the tilt axis of the microscope, the overall tomographic coverage of the structure improves. This is a fact that all EM users take seriously into account during the recording of single particles tomograms, especially when averaging is not possible.

From the home page of SerialEM (the most common program to acquire tilt series for electron tomography; http://bio3d.colorado.edu/SerialEM/index.html), Strategies for Cryoelectron Tomography: “There is essentially no dual-axis capability due to the low dose requirements. So, we are left with single-axis reconstructions. If the sample allows you to, taking advantage of sample orientation to the tilt-axis can become very important. The best resolution is parallel to the tilt-axis.”

We were surprised that the reviewer criticized this standard approach in the first review. However, we agreed to provide simulation experiments. They clearly show that the complexes running parallel to the tilt axis are better resolved (Figure 20E-F, H-I) than the ones running perpendicular to the tilt axis (Figure 20K-L). Because of the longitudinal appearance of the septin-Gic1-Cdc42 complexes, tomograms with complexes running parallel to the beam (Figure 20E-F) result in a reconstruction that is more similar to the original model compared to complexes running perpendicular to the beam (Figure 20H-I).

It is not the quality of the reconstruction that improves by changing the relationship between beam direction and tilt axis.

There must be a misunderstanding: the relationship between beam direction and tilt axis does not change during a tomography experiment. It depends on the current microscope setup and if the user does not tilt the beam during image recording (we never tilt the beam!), this relationship will not change.

If there are any thin connections between the filaments, it is very likely that they will not appear in the reconstruction with the chosen geometry.

As described above we revisited our EM tomogram at the orthogonal orientation and calculated a reconstruction of filaments running parallel to the tilt axis (Figure 19A-C). As expected, we do not see any additional thin connections between the filaments.

The thin connections described in Bertin et al (Bertin et al. 2008) are expected to be composed of two interacting thin coiled-coils. They are very thin and cannot be seen in 2D class averages (this work) (Sirajuddin et al. 2007) and 3D reconstructions of negatively stained septin octamers at 27 Å resolution (Lukoyanova et al. 2008).

The resolution of our reconstructions is 40-60 Å at best (as pointed out in our previous rebuttal letter, there is not yet a method to measure precisely the resolution of single tomograms). It is therefore expected that these structures are not resolved in our tomograms. Even if the thin connections were visible, their segmentation would be highly ambiguous, independent of the chosen geometry. This issue is pointed out in the revised manuscript more clearly.

The modeling of the cross-links as featureless barrels is not helpful to convince the reviewer.

We chose GROEL/GROES as a model because it has similar dimensions to Gic1 cross-bridges and has been extensively studied by electron microscopy.

The question is what would happen to finer features that may be attached to these barrels or emanate from/connect between the filaments.

As described above, finer features will not be resolved at a resolution of 40-60 Å. We have used electron tomography to study these complicated structures, not X-ray crystallography. We therefore restrict our description and conclusion to gross features. We agree with the reviewer that this would be worth analyzing in future studies, but with other techniques, in particular X-ray crystallography.

In trying to get a quantitative assessment of the assembly features (filaments and linkers) for this geometrically challenging system, the authors should have generated tomo-series in both orthogonal orientations to provide dual axis tomograms. Such data scheme would allow assessing the extent of the missing wedge and isotropic distortions for the system and thus provide measurable values to the confidence to the described conclusions.

Although dual axis tomography theoretically improves the quality of tomograms, it harbors many technical problems and has therefore not been routinely used by the EM community. Most electron microscopes, including ours, are not equipped with a dual axis tomography holder. Therefore one has to remove the grid from the microscope after recording the first tomogram, turn it by 90˚ and enter it again. After finding the right position the second tomogram is recorded. Besides many obvious technical difficulties such as ice contamination when removing the grid and problems with alignment, the electron dose of such tomograms is doubled, resulting in decreased resolution. Any potential improvement of our tomograms would therefore be questionable. Instead we revisited our EM tomograms at the orthogonal orientation and searched for filaments running parallel to the tilt axis. This showed that the overall structure of the septin-Gic1 complexes is independent of its orientation in the tomogram.

From the home page of SerialEM (the most common program to acquire tilt series for electron tomography; http://bio3d.colorado.edu/SerialEM/index.html), Strategies for Cryoelectron Tomography: “There is essentially no dual-axis capability due to the low dose requirements. So, we are left with single-axis reconstructions.”

From “Cryo-electron tomography: The challenge of doing structural biology in situ” (Vladan Lučić, Alexander Rigort, and Wolfgang Baumeister, JCB:Review, August 5, 2013), Dual-axis tomography: “Tilting around two tilt axes perpendicular to each other reduces missing wedge–induced distortions and improves information content. However, dual-axis tomography has rarely been used in cryo-ET due to the need to acquire an increased number of projections and difficulties with alignment....”

Furthermore it is somewhat concerning that the whole analysis is based on five reconstructions, 2 of septin-Gic1 and 3 of septin-Gic-Cdc42-GppNHp complexes. These numbers are on the lower side to draw robust conclusions, specifically as thousand of such assemblies were viewed.

We could provide hundreds of reconstructions with complexes running in random directions relative to the tilt axis. However, as described above and demonstrated by simulations, only reconstructions with filaments running parallel to the tilt axis or to the beam result in analyzable reconstructions. To find filaments in this orientation is very challenging. We are convinced that the number of reconstructions provided is sufficient to support our conclusions.

In summary, the reliability of the features in the reconstructions is questionable and the presentation of the data is misleading by implying that artifacts caused by the missing wedge would be somehow overcome by using a specific geometry.

We clearly show that we do not overcome the missing wedge artifacts. This is not possible in a single tomogram experiment. However, we show that the orientation of the longitudinal complexes during tomography definitely has an impact on the resolution and overall quality of the reconstructions. We rephrased this passage in the revised manuscript to prevent any misunderstandings.

Due to the overall methodical and resolution limitations our paper focuses exclusively on gross features of the complex. We can clearly determine the number of filaments and we can even fit the crystal structure of human septin into our reconstructions to verify that the overall dimensions are correct. Although we cannot exclude the possibility that the density corresponding to Gic1 appears more stretched due to the missing wedge artifacts, we can state that Gic1 cross-bridges several septin filaments. These are our conclusions from the cryo-ET data.

We are convinced that we have carefully interpreted, and not over-interpreted, the data presented and have avoided any overstatement. Therefore, we are confident that the conclusions we draw from our data, namely that Gic1 scaffolds more than two septin filaments, are robust and justified.


Article and author information

Author details

  1. Yashar Sadian

    Department of Physical Biochemistry, Max Planck Institute of Molecular Physiology, Dortmund, Germany
    YS, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Contributed equally with
    Christos Gatsogiannis
    Competing interests
    The authors declare that no competing interests exist.
  2. Christos Gatsogiannis

    Department of Physical Biochemistry, Max Planck Institute of Molecular Physiology, Dortmund, Germany
    CG, Acquisition of data, Analysis and interpretation of data
    Contributed equally with
    Yashar Sadian
    Competing interests
    The authors declare that no competing interests exist.
  3. Csilla Patasi

    Department of Molecular Microbiology, Institute of Molecular Biology SAS, Bratislava, Slovak Republic
    CP, Acquisition of data, Analysis and interpretation of data
    Competing interests
    The authors declare that no competing interests exist.
  4. Oliver Hofnagel

    Department of Physical Biochemistry, Max Planck Institute of Molecular Physiology, Dortmund, Germany
    OH, Acquisition of data, Analysis and interpretation of data
    Competing interests
    The authors declare that no competing interests exist.
  5. Roger S Goody

    Department of Physical Biochemistry, Max Planck Institute of Molecular Physiology, Dortmund, Germany
    RSG, Analysis and interpretation of data, Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist.
  6. Marian Farkašovský

    Department of Molecular Microbiology, Institute of Molecular Biology SAS, Bratislava, Slovak Republic
    MF, Conception and design, Acquisition of data, Analysis and interpretation of data
    Competing interests
    The authors declare that no competing interests exist.
  7. Stefan Raunser

    Department of Physical Biochemistry, Max Planck Institute of Molecular Physiology, Dortmund, Germany
    SR, Conception and design, Analysis and interpretation of data, Drafting or revising the article
    For correspondence
    Competing interests
    The authors declare that no competing interests exist.


Deutsche Forschungsgemeinschaft (RA 1781/1-1)

  • Stefan Raunser

Max Planck Society

  • Yashar Sadian
  • Christos Gatsogiannis
  • Oliver Hofnagel
  • Roger S Goody
  • Stefan Raunser

VEGA (Vedecká Grantová Agentúra, Ministerstva školstva Slovenskej republiky) (2/0050/11)

  • Csilla Patasi
  • Marian Farkašovský

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We are grateful for A Wittinghofer for initiating the project and for useful comments on the manuscript. We thank I Vetter for stimulating discussions.

Reviewing Editor

  1. Axel T Brunger, Stanford University, United States

Publication history

  1. Received: June 13, 2013
  2. Accepted: October 18, 2013
  3. Version of Record published: November 28, 2013 (version 1)


© 2013, Sadian et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,834
    Page views
  • 245
  • 40

Article citation count generated by polling the highest count across the following sources: Crossref, Scopus, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

  1. Further reading

Further reading

    1. Biochemistry and Chemical Biology
    2. Genetics and Genomics
    Krishna S Ghanta et al.
    Research Article

    Nuclease-directed genome editing is a powerful tool for investigating physiology and has great promise as a therapeutic approach to correct mutations that cause disease. In its most precise form, genome editing can use cellular homology-directed repair (HDR) pathways to insert information from an exogenously supplied DNA repair template (donor) directly into a targeted genomic location. Unfortunately, particularly for long insertions, toxicity and delivery considerations associated with repair template DNA can limit HDR efficacy. Here, we explore chemical modifications to both double-stranded and single-stranded DNA-repair templates. We describe 5′-terminal modifications, including in its simplest form the incorporation of triethylene glycol (TEG) moieties, that consistently increase the frequency of precision editing in the germlines of three animal models (Caenorhabditis elegans, zebrafish, mice) and in cultured human cells.

    1. Biochemistry and Chemical Biology
    2. Structural Biology and Molecular Biophysics
    Paul Fischer et al.
    Research Article

    Enzymerhodopsins represent a recently discovered class of rhodopsins which includes histidine kinase rhodopsin, rhodopsin phosphodiesterases and rhodopsin guanylyl cyclases (RGCs). The regulatory influence of the rhodopsin domain on the enzyme activity is only partially understood and holds the key for a deeper understanding of intra-molecular signaling pathways. Here we present a UV-Vis and FTIR study about the light-induced dynamics of a RGC from the fungus Catenaria anguillulae, which provides insights into the catalytic process. After the spectroscopic characterization of the late rhodopsin photoproducts, we analyzed truncated variants and revealed the involvement of the cytosolic N-terminus in the structural rearrangements upon photo-activation of the protein. We tracked the catalytic reaction of RGC and the free GC domain independently by UV-light induced release of GTP from the photolabile NPE-GTP substrate. Our results show substrate binding to the dark-adapted RGC and GC alike and reveal differences between the constructs attributable to the regulatory influence of the rhodopsin on the conformation of the binding pocket. By monitoring the phosphate rearrangement during cGMP and pyrophosphate formation in light-activated RGC, we were able to confirm the M state as the active state of the protein. The described setup and experimental design enable real-time monitoring of substrate turnover in light-activated enzymes on a molecular scale, thus opening the pathway to a deeper understanding of enzyme activity and protein-protein interactions.