In order to test whether TAPBPR has peptide editing functionality we chose an approach analogous to that previously established for tapasin, namely a cell free in vitro assay that allows monitoring of peptide binding to MHC class I in real time via fluorescence anisotropy (Chen and Bouvier, 2007). Due to the intrinsically low affinity between tapasin and MHC class I molecules in vitro, soluble tapasin function on MHC class I is only measurable when the two molecules are brought into close proximity via a Jun/Fos leucine zipper (Chen and Bouvier, 2007) or when tapasin is conjugated to ERp57 (Wearsch and Cresswell, 2007). Since TAPBPR is not integrated into the PLC and can be co-immunoprecipitated with MHC I (Boyle et al., 2013, Hermann et al., 2013), it is likely that TAPBPR has a higher affinity for MHC class I than tapasin. We therefore tested whether TAPBPR functioned in vitro without the need for an artificial intermolecular tether.

To this end, the luminal domains of TAPBPR were cloned into the pHLsec expression vector and transiently transfected into HEK293F cells. This resulted in the efficient production of a secreted form of TAPBPR with a C-terminal His-tag, allowing for purification from the culture supernatant using Ni-affinity and size exclusion chromatography. TAPBPR protein eluted as a single major peak of high purity as verified by Coomassie staining following sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Figure 1A). TAPBPR^TN5 in which the isoleucine at position 261 was mutated to lysine, which inhibits the interaction of TAPBPR with MHC class I (Hermann et al., 2013), was produced in the same manner and was also efficiently expressed and produced a major single protein peak following size-exclusion chromatography (Figure 1B). Differential scanning fluorimetry revealed melting temperatures for TAPBPR and TAPBPR^TN5 to be between 51.5°C and 52.5°C indicating that the single point mutation did not adversely affect TAPBPR folding (Figure 1C). These mammalian-expressed, purified TAPBPR proteins were used in subsequent fluorescence anisotropy experiments to characterise the equilibrium and kinetic parameters between MHC class I and different peptide ligands.

Figure 1

Download asset Open asset

To investigate if TAPBPR is able to directly edit peptides on MHC class I molecules in a manner similar to that attributed to tapasin, we adapted the in vitro peptide exchange assay previously developed for measuring tapasin function (Chen and Bouvier, 2007). Using fluorescent polarisation we tested whether TAPBPR enhanced peptide dissociation from HLA-A2, an allomorph that co-immunoprecipitates readily with TAPBPR (Hermann et al., 2013). HLA-A*02:01 molecules were loaded with the fluorescent peptide FLPSDC*FPSV (C* indicates the position of the fluorophore) before excess unlabelled FLPSDCFPSV peptide was added in the presence or absence of TAPBPR. Dissociation of FLPSDC*FPSV was only apparent in the first six hours in the presence of competitor peptide and TAPBPR (Figure 2A). Dissociation of FLPSDC*FPSV was also observed when a vast excess of unlabelled NLVPMVATV was used in the presence of TAPBPR (Figure 2B). To ensure the enhancement of peptide dissociation was a consequence of direct interaction between TAPBPR and HLA-A2, we repeated the peptide dissociation assays using TAPBPR^TN5 (I261K) which inhibits the ability of TAPBPR to bind to HLA-A2 (Hermann et al., 2013). No enhancement in the dissociation of FLPSDC*FPSV was observed in the presence of TAPBPR^TN5 (red line Figure 2B). Thus the ability of TAPBPR to enhance peptide dissociation is a direct consequence of TAPBPR binding to HLA-A2.

Figure 2 with 1 supplement see all

Download asset Open asset

Next we examined the effect that TAPBPR has on the kinetics of peptide association with HLA-A2. To test this, HLA-A*02:01 molecules refolded with a UV conditional ligand were made peptide-receptive by photolysis and the binding of the fluorescent peptide FLPSDC*FPSV was monitored by fluorescence polarisation in the absence or presence of TAPBPR. We found that TAPBPR catalysed binding of FLPSDC*FPSV to peptide-receptive HLA-A*02:01 (Figure 2C). In contrast, no enhancement in the association of FLPSDC*FPSV with HLA-A2 was observed in the presence of TAPBPR^TN5 (Figure 2C), further demonstrating that a direct association between TAPBPR and HLA-A2 is required for TAPBPR to influence HLA-A2 peptide binding characteristics.

To ascertain whether TAPBPR is able to discriminate between peptides, competition assays were performed in which peptide-receptive HLA-A*02:01 molecules were incubated with a mix of two peptides; 0.125 µM of the high affinity labelled peptide FLPSDC*FPSV, and a variable concentration of the peptide NLVPMVATV, which binds HLA-A*02:01 with lower affinity than FLPSDCFPSV. In the presence of TAPBPR, NLVPMVATV became a poorer competitor (Figure 2D). TAPBPR^TN5 had no effect on peptide competition (Figure 2D). These results suggest that, like tapasin (Chen and Bouvier, 2007), TAPBPR can enhance the selection of high affinity peptides for binding to MHC I in vitro.

Next we compared the ability of TAPBPR or tapasin-jun to enhance dissociation of FLPSDC*FPSV and a panel of six additional peptides bound to HLA-A2. The dissociation rates of all peptides were enhanced in the presence of TAPBPR and in the presence of tapasin-jun as compared to competing peptide alone (Figure 2—figure supplement 1). However, peptide specific differences were apparent in the ability of tapasin-jun and TAPBPR to enhance dissociation. As different concentrations of active tapasin-jun and TAPBPR proteins were present in these assays, it was not possible to directly compare the dissociation half-lives of specific peptides in the presence of tapasin-jun with TAPBPR. Therefore we compared the hierarchies of dissociation relative to one peptide (KLWEAESK*L) over four independent experiments. This revealed reproducible differences in the hierarchies of peptide dissociation between tapasin-jun and TAPBPR on HLA-A2 (Figure 2E–G). Interestingly the half-life hierarchy for tapasin was similar to the hierarchy observed in the absence of either cofactor (competitor only) (Figure 2E,F), with the exception of the dissociation of GLDDIKDLK*V whose dissociation was relatively much slower in the presence of tapasin-jun compared to the other peptides than was observed in the presence of competitor only. This suggests that tapasin enhancement of peptide dissociation generally parallels peptide-MHC complex stability, as previously reported (Howarth et al., 2004). However, the half-life of peptides in the presence of TAPBPR does not follow this trend (Figure 2G). Specifically we observed that in comparison to the other peptides, TAPBPR enhanced dissociation of KLVK*EVIAV to a much smaller extent than was apparent in the presence of tapasin-jun or absence of either cofactor (competitor only) (Figure 2E–G). The same was also true of FLPSDC*FPSV (Figure 2E–G). Taken together our results suggest firstly that both tapasin and TAPBPR enhance peptide dissociation, and secondly that there are subtle differences in regard to their peptide specificity.

We previously reported that TAPBPR has preference for HLA-A68 over HLA-B15 expressed in HeLa cells (Boyle et al., 2013). We wondered if TAPBPR generally exhibited preference for HLA-A allomorphs or whether TAPBPR might interact with HLA-B allomorphs. To explore this, we expressed a small panel of individual HLA allomorphs in the MHC class I negative cell line 721.221, and determined their interaction with endogenous TAPBPR, in a system in which competition between MHC class I allomorphs is absent. Immunoprecipitation of TAPBPR, followed by western blotting for MHC class I, confirmed the strong association between TAPBPR and the HLA-A allomorphs HLA-A2 and HLA-A68 (Figure 3). However, an association between TAPBPR and HLA-B allomorphs was also detected, although this was weaker (HLA-B8 and -B15), or below the limits of detection (HLA-B40), compared to that for HLA-A2 (Figure 3). Therefore, although there is clearly a strong association with those HLA-A allomorphs tested, TAPBPR interacts with a broader range of HLA molecules than originally appreciated (Boyle et al., 2013).

Figure 3

Download asset Open asset

Given the interactions detected between TAPBPR and the studied HLA-B allomorphs, we asked whether TAPBPR was involved in peptide selection on HLA-B*08:01, an allomorph which interacts weakly with TAPBPR (Figure 3) and which is well-characterised in regard to tapasin function (Greenwood et al., 1994; Lehner et al., 1998; Peh et al., 1998; Chen and Bouvier, 2007; Wearsch and Cresswell, 2007). We first asked whether TAPBPR enhanced peptide dissociation from HLA-B*08:01fos molecules. We found that dissociation of EIYK*RWIIL was enhanced in the presence of TAPBPR (Figure 4A and Figure 4—figure supplement 1A). No enhancement of the dissociation of EIYK*RWIIL was observed in the presence of TAPBPR using HLA-B8:01-T134K in which the T134 residue had been mutated to lysine, which abrogates binding of TAPBPR to MHC I (Hermann et al., 2013) (Figure 4B and Figure 4—figure supplement 1B), demonstrating that the enhanced peptide dissociation was dependent on a direct interaction between TAPBPR and HLA-B8. We also tested the ability of TAPBPR to enhance dissociation of two additional peptides, ELRSRK*WAI and FLRGRK*YGL from HLA-B*08:01. The dissociation of ELRSRK*WAI was not altered in the presence of TAPBPR (Figure 4C and Figure 4—figure supplement 1C) and only a very slight change in dissociation of FLRGRK*YGL was observed in the presence of TAPBPR (Figure 4D and Figure 4—figure supplement 1D). Therefore, our results suggest that TAPBPR can enhance peptide dissociation from HLA-B8 but that this effect is peptide specific. Tapasin has also been reported to exhibit peptide specificity in regard to peptide dissociation (Chen and Bouvier, 2007). Like TAPBPR, tapasin-jun accelerated dissociation of fluorescein isothiocyanate (FITC) labelled versions of both EIYK*RWIIL and FLRGRK*YGL from HLA-B*08:01fos, while the dissociation of ELRSRK*WAI was insensitive to tapasin-jun (Chen and Bouvier, 2007).

Figure 4 with 1 supplement see all

Download asset Open asset

As with HLA-A2, we observed that TAPBPR could enhance peptide binding to peptide-receptive HLA-B*08:01fos molecules. However, this was only observed with EIYK*RWIIL (Figure 4E) and the binding of ELRSRK*WAI or FLRGRK*YGL to peptide receptive HLA-B*08:01fos was not altered in the presence of TAPBPR (Figure 4F,G). This contrasts with the results previously published by Chen and Bouvier, who observed that tapasin-jun enhanced binding of FITC labelled versions of ELRSRK*WAI and FLRGRK*YGL to peptide-receptive HLA-B*08:01fos molecules (Chen and Bouvier, 2007). Taken together the data indicate that TAPBPR can enhance the loading of peptide onto HLA-B*08:01, and that this is peptide specific. Furthermore, there are differences in peptide specificity between tapasin and TAPBPR with respect to HLA-B*08:01 peptide-loading.

Finally we showed that, like tapasin (Chen and Bouvier, 2007), TAPBPR increased peptide exchange on HLA-B*08:01 since the low affinity peptide EIYKRWIIL became a poorer competitor against the high affinity labelled peptide ELRSRK*WAI in the presence of TAPBPR (Figure 4H).

Given that TAPBPR functions as a peptide exchange catalyst for MHC class I in vitro, we next determined if TAPBPR expression had any effect on the peptide repertoire expressed by MHC class I molecules in cells. To do this, we created a HeLa cell line in which TAPBPR was knocked out using the clustered regularly interspaced short palindromic repeats (CRISPR) system. We found that upon treatment with IFN-γ, TAPBPR expression was induced in HeLa, but not in the HeLa-TAPBPR KO line (Figure 5A). Tapasin expression was not affected by the sgRNA targeted to TAPBPR (Figure 5A). In the absence of TAPBPR, cell surface expression of MHC class I in IFN-γ treated HeLa did not significantly change as determined by W6/32 staining and flow cytometry (Figure 5B). When the amino acid sequences of the peptides eluted from MHC class I molecules from IFN-γ treated HeLa and HeLa-TAPBPR KO cells were compared, the most noticeable difference was a change in the diversity of peptides isolated (Figure 5C). In IFN-γ treated HeLa cells, we isolated 1607 different peptides on MHC class I, compared with 2074 in IFN-γ treated HeLa-TAPBPR KO cells (Figure 5C). 1398 peptides were shared between the two cell lines, but 209 peptides were unique to HeLa and 676 were unique to HeLa-TAPBPR KO (Figure 5C). When the peptides were subdivided into those predicted to bind to HLA-A*68:02 or HLA-B*15:03 based on anchor sequences, an increased repertoire was observed for both allomorphs in the absence of TAPBPR (Figure 5C). Consistent with these findings, a similar pattern of increased peptide diversity was also observed in IFN-γ treated HeLa-S cells upon TAPBPR depletion using shRNA to TAPBPR (Figure 5—figure supplement 1).

Figure 5 with 2 supplements see all

Download asset Open asset

Figure 6

Download asset Open asset

To complement these findings we compared the amino acid sequences of peptides eluted from MHC class I molecules isolated from HeLa and HeLa cells over-expressing TAPBPR by mass spectrometry. Again the most obvious difference was a change in the diversity of peptides isolated (Figure 5D). We found the total number of different peptides isolated from MHC class I was decreased in cells over-expressing TAPBPR, from 819 MHC class I restricted peptides from HeLa cells down to 296 MHC class I restricted peptides isolated from HeLa cells over-expressing TAPBPR. 210 peptides were shared between the two cell lines (Figure 5D). Again, when these peptides were further sub-divided into those predicted to bind to HLA-A*68:02 and -B*15:03 based on their motif, an increased repertoire was observed for both allomorphs in the absence of TAPBPR (Figure 5D). Taken together, these results suggest that TAPBPR restricts the peptide repertoire presented on MHC class I molecules. We compared the anchor residues found at the P2 and C-terminal (PΩ) position of the shared peptides, eluted from either TAPBPR negative or TAPBPR expressing cells, which will presumably be permitted release in TAPBPR expressing cells, with unique peptides exclusively eluted from TAPBPR negative cells (HeLa or HeLa-TAPBPR KO+IFN-γ), which are therefore usually removed or restricted by TAPBPR. We found there was an enhancement of canonical anchor residues in the peptides eluted from TAPBPR expressing cells (Figure 5E–H). For example, in IFN-γ treated HeLa cells 53% of the shared peptides predicted to be bound to HLA-A*A68:02 (which had presumably been subjected to TAPBPR function) had classic anchor residues (P2 = threonine or valine, PΩ = valine or leucine) compared to 43% of the peptides found exclusively in TAPBPR deficient cells which are the peptides that TAPBPR usually restricts (Figure 5E). More striking was the restriction of peptides predicted to be bound by HLA-B*15:03 in cells over-expressing TAPBPR (Figure 5H) with only 5% of the peptides eluted exclusively from TAPBPR deficient cells (i.e. the TAPBPR restricted peptides) containing classical anchor motifs (P2 = glutamine or lysine, PΩ = tyrosine or phenylalanine) compared to 24% of the peptides eluted from TAPBPR over expressing cells (i.e. the TAPBPR permitted peptides). This suggests TAPBPR restriction in vivo helps to remove some peptides of lower affinity and therefore assists in improving peptide selection on MHC class I. We found TAPBPR expression did not have a dramatic effect on peptide length (Figure 5—figure supplement 2).

We also compared the effect of TAPBPR depletion with tapasin deficiency on the MHC class I peptide repertoire from IFN-γ treated KBM-7 cells (see [Hermann et al., 2013] for knockdown efficiency). Surface expression of HLA-A2 was similar in IFN-γ treated wild-type (WT), TAPBPR depleted and tapasin deficient KBM-7 cells (Figure 6A). While TAPBPR depletion resulted in increased peptide diversity on HLA-A2 (Figure 6B), tapasin deficiency did not significantly change the total number of peptides presented on HLA-A2 (Figure 6B), although the peptide repertoire was significantly different between IFN-γ treated WT and tapasin deficient KBM-7 cells (Figure 6C). Surface expression of HLA-B40 was similar in IFN-γ treated WT and TAPBPR depleted cells, but was reduced in tapasin deficient KBM-7 cells (Figure 6D). TAPBPR depletion and tapasin deficiency produced different effects on peptides presented by HLA-B40 and -C03 in IFN-γ treated KBM-7 cells, with TAPBPR depletion increasing peptide diversity and tapasin deficiency decreasing the number of peptides presented (Figure 6E,F). A similar effect of tapasin deficiency decreasing peptide number has recently been reported for the mouse MHC I molecule H-2D^b and K^b (Kanaseki et al., 2013). Therefore, although in vitro TAPBPR and tapasin both function as peptide exchange catalysts, within the cellular environment the two molecules shape the peptide repertoire in distinct ways.

Given our finding that TAPBPR functions as a peptide exchange catalyst in vitro and restricts the peptide repertoire presented on MHC class I on cells, we next asked if the MHC class I molecules bound to TAPBPR in cells were peptide-receptive and whether they could be released from TAPBPR by high-affinity peptide. TAPBPR was isolated in complex with MHC I from IFN-γ induced KBM-7 cells (which are HLA-A2+), then incubated in the presence or absence of 100 μM of the HLA-A2 binding peptide NLVPMVATV. Western blot analysis of the proteins co-immunoprecipitated with TAPBPR revealed a >90% reduction in the amount of HLA-A2 bound to TAPBPR following the addition of the NLVPMVATV peptide (Figure 7). To ensure this was a consequence of direct peptide binding to HLA-A2, we tested NLVPMVATV peptide variants in which the anchor residues at position 2 and 9 were substituted, thus lowering the avidity of the peptide. Less dissociation of HLA-A2 from TAPBPR was observed using NAVPMVATV (Δ2) and NLVPMVATM (Δ9) peptides, in which one anchor residue had been substituted, while the NAVPMVATM (Δ2/9) peptide, in which both anchor residues were substituted was unable to induce any HLA-A2 dissociation (Figure 7). Next we asked whether peptide loaded HLA-A2 molecules were released from TAPBPR following peptide addition by performing a second immunoprecipitation using BB7.2 from the peptide-treated eluates. Peptide loaded HLA-A2 was released from TAPBPR upon incubation with the NLVPMVATV peptide but not in the absence of the peptide (lanes 2 and 1 respectively Figure 7). Only trace amounts of peptide loaded HLA-A2:β2m molecules were released from TAPBPR using the Δ2 and Δ9 peptides (lane 3 and 4, Figure 7), while no peptide loaded HLA-A2 was released from TAPBPR using the Δ2/9 peptide (lane 5 Figure 7). Together these results demonstrate that MHC I molecules bound to TAPBPR are in a peptide-receptive state and that the association between TAPBPR and MHC I is reduced by high affinity peptide resulting in peptide loaded MHC I being released from TAPBPR.

Figure 7

Download asset Open asset

HLA allomorphs differ in their dependency on tapasin for efficient surface expression. Previous studies have reported that, although the quantity of naturally processed peptides stably bound by HLA-A*02:01 is significantly reduced in the absence of tapasin (Barber et al., 2001), surface expression of HLA-A2 is relatively unaffected in the absence of tapasin (Greenwood et al., 1994; Barber et al., 2001). In contrast, HLA-B7 expression is reduced in the absence of tapasin (Rizvi et al., 2014). As TAPBPR is also involved in peptide selection on MHC class I molecules, we sought to examine the effect of TAPBPR depletion on surface expression of both HLA-A2 and HLA-B7 in the presence and the absence of tapasin. To investigate this, 721.221 (tapasin positive, MHC class I negative) (Shimizu et al., 1988) and 721.220 (tapasin negative, HLA-A, -B negative, but HLA-Cw1 positive) (Greenwood et al., 1994) cells were transduced with HLA-A2 and -B7 and then depleted of TAPBPR using shRNA. This resulted in a significant, although not complete, reduction of TAPBPR expression (Figure 8A). Tapasin expression in 721.221 cells was not altered in cells expressing shTAPBPR (Figure 8A). Consistent with our previous findings in tapasin deficient KBM-7 cells (Hermann et al., 2013), we found an increased interaction between HLA-A2 and TAPBPR in the absence of tapasin in the 721 cell line series (compare TAPBPR IP lanes 1 and 3, Figure 8A) which was apparent even though the expression of TAPBPR appeared to be slightly higher in .220 cells compared to .221 cells. This phenomenon does not appear to be restricted to HLA-A2, as we similarly observed an increased interaction between HLA-B7 and TAPBPR in the absence of tapasin (compare TAPBPR IP lanes 1 and 3, Figure 8A). The increased association between TAPBPR and MHC class I occurs despite the fact that the steady state level of both HLA-B7 and HLA-A2 is severely reduced in the absence of tapasin (compare lysate lanes 1 and 3, Figure 8A). We found that the steady state level of HLA-A2 at the cell surface was not affected by TAPBPR depletion in tapasin sufficient cells (left panel Figure 8B). However, the depletion of TAPBPR in tapasin negative cells resulted in a ∼75% decrease in cell surface expression of HLA-A2 (right panel Figure 8B). In contrast, using an antibody to the Bw6 epitope we observed a significant decrease in the surface expression of HLA-B7 upon depletion of TAPBPR, even in the presence of tapasin (left panel Figure 8C). This is despite the poor ability of HLA-B7 to co-immunoprecipitate with TAPBPR, as compared with HLA-A2 with TAPBPR (Figure 8A). Only residual expression of HLA-B7 was observed upon the depletion of TAPBPR in the tapasin negative cell 721.220 (right panel Figure 8C). These results suggest that HLA allomorphs differ in their dependency on TAPBPR, and that tapasin and TAPBPR work together to optimise surface expression of MHC class I molecules.

Figure 8

Download asset Open asset

Comparison of the anchor residues in TAPBPR-permitted versus TAPBPR-restricted peptides suggests TAPBPR enhances the selection of peptides with canonical anchor residues and consequently may help reduce the cell surface presentation of peptides with lower affinity (Figure 5E–H). To test directly whether HLA molecules are indeed loaded with low affinity peptides in the absence of TAPBPR, we compared the stability of MHC class I molecules in the presence and absence of TAPBPR. First, the thermal stability of HLA-A2 molecules expressed in TAPBPR-competent and TAPBPR-depleted cells in the presence or absence of tapasin was investigated by heating lysates of radiolabelled cells for a short time, followed by immunoprecipitation with BB7.2 (specific for peptide loaded HLA-A2). We found that the thermal stability of HLA-A2 was reduced in TAPBPR depleted cells (compare grey bar with the red bar in Figure 8D). As the thermal stability of MHC class I correlates with the affinity of its peptide cargo (Williams et al., 2002), these results support the hypothesis that TAPBPR assists in the selection of stable peptides on MHC class I molecules. However, the effect of TAPBPR depletion on HLA-A2 thermal stability was not as severe as that observed in the absence of tapasin (compared red and blue bars in Figure 8B). The thermal stability of peptide loaded HLA-A2 was further decreased when TAPBPR was depleted in tapasin negative cells (green bar in Figure 8B). These results are consistent with the decreased steady state levels of HLA-A2 observed in TAPBPR depleted and tapasin deficient cells as shown in Figure 8A.

Next, to examine whether MHC class I complexes with lower stability are released onto the cell surface in the absence of TAPBPR, we examined the decay rates of MHC class I molecules expressed at the cell surface in TAPBPR-competent and TAPBPR-depleted cells. Both HLA-A2 and –B7 exhibited faster decay rates from the cell surface in TAPBPR-depleted cells (Figure 8E‚F), suggesting that in the absence of TAPBPR MHC class I molecules containing lower affinity peptides can escape to the cell surface. For HLA-A2, tapasin deficiency had a more severe effect than TAPBPR depletion on the rate of decay (compare the blue line with the red line in Figure 8E) while for HLA-B7, tapasin deficiency and TAPBPR depletion had a similar effect on the decay rate (see the overlap of the blue and red line in Figure 8F). For both HLA-A2 and –B7 the loss of both tapasin and TAPBPR had an accumulative effect on MHC class I stability (see green line in Figure 8E,F). Together, these results clearly demonstrate a role for TAPBPR in the selection of stable peptides for MHC class I molecules in vivo and support the hypothesis that TAPBPR can enhance peptide optimisation in the absence of tapasin.

The luminal domains of TAPBPR and TAPBPR^TN5 (I261K) (Hermann et al., 2013) were cloned into pHLsec containing a C-terminal His-tag and an N-terminal signal sequence (Aricescu et al., 2006). To produce secreted TAPBPR and TAPBPR^TN5, 250 μg of the TAPBPR pHLsec plasmids were mixed with 1.5 ml of 1 mg/ml PEI 25K (Sigma, St Louis, MO) in 25 ml phosphate-buffered saline (PBS), followed by incubation at room temperature for 20 min. The solution was added dropwise to HEK293F cell in FreeStyle^TM 293 Expression Medium (Gibco, Thermo Fisher Scientific, UK) seeded at a density of 1 × 10⁶ cells/ml in a volume of 250 ml in a 1 L Erlenmeyer conical tissue flask and incubated for three days at 37°C under constant shaking at 125 rpm. The cell culture supernatant was harvested, filtered and purified using Ni-NTA affinity chromatography (Invitrogen, Thermo Fisher Scientific). Beads were isolated, washed in 20 mM Tris pH 7.4, 200 mM NaCl, 20 mM Imidazole and TAPBPR was eluted with 20 mM Tris pH 7.4, 200 mM NaCl, 300 mM Imidazole. Protein-containing fractions were analysed by SDS-PAGE followed by Coomassie staining, pooled and concentrated. The concentrate was exchanged into 50 mM Tris, 150 mM NaCl pH 8.0 buffer and separated on a Superdex S200 10/300 column (GE Heathcare, UK) by size exclusion chromatography. Protein-containing fractions were analysed by SDS-PAGE followed by Coomassie staining, pooled and further concentrated. The concentrate was snap frozen in liquid nitrogen and stored at -80°C.

DSF experiments were performed in 48-well plates using 50 µL reactions consisting of 2 µg of purified TAPBPR protein and 5x SyPRO orange dye (Invitrogen molecular probes, Thermo Fisher Scientific) in PBS pH 7.4. The melt curve was performed using Bio-Rad MiniOpticon reverse transcription-polymerase chain reaction (RT-PCR) thermal cycler between 20°C and 95°C in 1°C steps with 20 s equilibration time per step. The protein melting temperature (T_m) was taken as the inflexion point of the sigmoidal melting curve, obtained by curve fitting using DSF scripts (Niesen et al., 2007) and GraphPad Prism software.

pHN1+ plasmids encoding the mature human beta 2-microglobulin protein (β2m hereafter) or the ER luminal domains of HLA A*02:01 protein with C-terminal BirA motif were obtained from Prof P Moss (University of Birmingham, UK). pGM-T7 plasmids encoding the ER luminal domains of wild-type HLA B*08:01 or the T134K point mutant, each with C-terminal fos leucine zipper sequences, were provided by Prof M Bouvier (Chen and Bouvier, 2007). The sequence encoding HLA-B*08:01fos or the T134K point mutant were excised by restriction enzyme digestion and sub-cloned into pET22b plasmid (Novagen, Merck Millipore, Germany). DNA encoding the ER luminal domains of HLA A*02:01 with C-terminal Fos leucine zipper sequence was created by PCR: nucleotides encoding the ER luminal domains of A*02:01 were amplified using primers 5'-GATATACCATGGGCTCTCACTCC-3' and 5'-CGGAACCTCCCTCCCATC-3’ and pHN1 A*02:01 DNA; while nucleotides encoding the Fos leucine zipper were amplified from pET22b HLA B*08:01fos using primers 5'- GGAGGTTCCGGCGGTC-3' and 5'-CGCAAGCTTTTAATGGGCGG-3'. The purified products from both PCR reactions were used in a third PCR reaction to create A*02:01fos using primers 5'-GATATACCATGGGCTCTCACTCC-3' and 5'-CGCAAGCTTTTAATGGGCGG-3'.

Following agarose gel electrophoresis and digestion of the purified product with restriction enzymes the sequence encoding HLA-A*02:01fos was cloned into pET22b.

DNA encoding His tagged human tapasin-jun (Chen and Bouvier, 2007) was amplified by PCR using 5'-GTCAGATCTGGACCCGCGGTGATCG-3' and 5'-CTCGGTACCCTAATGGTGATGGTGATG-3' primers, and ligated to pMT/BiP plasmid (Invitrogen, Thermo Fisher Scientific) following agarose gel electrophoresis and digestion of the purified product with BglII and KpnI restriction enzymes. The His6 tag present in the Jun leucine zipper portion was then replaced by PCR mutagenesis with an HA epitope using 5'-GTCAGATCTGGACCCGCGGTGATCG-3' and 5'-GTAGGTACCCTAAGCGTAGTCTGGGACGTCGTATGGGTAGTTCATGACTTTCTG-3' primers. The resulting DNA (encoding the luminal domains of human tapasin, GGSGG linker, thrombin cleavage site, Jun leucine peptide, HA tag, and stop codon) was transferred by restriction enzyme digestion to pMT/BiP plasmid modified to encode puromycin resistance. Stable polyclonal transfectants of S2 cells were obtained by transfecting 1 µg of tapasin-jun DNA using Fugene 6 (Roche Applied Science, UK), and puromycin selection. Transfectants were adapted to EX-CELL 420 Serum-Free Medium (Sigma), and tapasin-jun expression was induced with 500 µM CuSO4. Supernatants were harvested 6 days later. Tapasin-jun was captured using anti-HA-agarose (Sigma), washed with 20 mM Tris pH7.4, 150 mM NaCl and eluted using 1 mg/ml HA peptide in 20 mM Tris pH 7.4, 150 mM NaCl. SDS PAGE electrophoresis and Coomassie staining was used to select fractions containing high concentrations of tapasin-jun, which were dialysed against 20 mM Tris-HCl pH 7.5, 150 mM NaCl at 4°C. The protein was snap frozen in liquid nitrogen and stored at -80°C.

The following HLA-A*02:01 binding peptides were used: the UV-labile peptide KILGFVFjV (j represents 3-amino-3-(2-nitro) phenyl-propionic acid), the fluorescent peptides FLPSDC*FPSV, KLWEAESK*L, FLLAEDTK*V, KLVK*EVIAV, YLVAEK*VTV, GLDDIKDLK*V, YLENGK*ETL (C* and K* denotes TAMRA labelled cysteine or lysine), non-labelled peptides FLPSDCFPSV, NLVPMVATV and three variants of this peptide NAVPMVATV (Δ2), NLVPMVATM (Δ9), NAVPMVATM (Δ2/9). The following HLA-B*08:01 binding peptides were used: the UV-labile peptide FLRGRAjGL, the fluorescent peptides ELRSRK*WAI, EIYK*RWIIL or FLRGRK*YGL (K* denotes TAMRA labelled lysine), and the non-labelled peptides ELRSRKWAI, EIYKRWIIL or FLRGRKYGL. Tamra labelled and unlabelled peptides used in fluorescence polarisation were synthesised by GL Biochem Ltd (Minhang, Shanghai). All other peptides were synthesised by Peptide Protein Research Ltd (Funtley, Fareham, UK).

Peptide-loaded MHC I or MHC I-fos complexes were obtained as in (Garboczi et al., 1992) by refolding solubilized inclusion bodies of MHC I or MHC I-fos heavy chains with solubilized inclusion bodies of human β2m and UV-labile MHC class I specific peptides.

Fluorescence polarization measurements were taken using an Analyst AD (Molecular Devices) with 530 nm excitation and 580 nm emission filters and 561 nm dichroic mirror. All experiments were conducted at room temperature in duplicate and used PBS supplemented with 0.5 mg/ml bovine gamma-globulin (Sigma) and 0.5 mM dithiothreitol, in a volume of 60 μl. Binding of TAMRA-labelled peptide is reported in millipolarisation units (mP) and is obtained from the equation, mP = 1000 × (S - G × P)/(S + G × P), where S and P are background-subtracted fluorescence count rates (S = polarised emission filter is parallel to the excitation filter; P = polarised emission filter is perpendicular to the excitation filter), and G (grating) is an instrument- and assay-dependent factor.

The following TAPBPR specific antibodies were used: PeTe4 (a mouse mAb raised against the luminal domains of human TAPBPR which recognise a native conformation of the protein) (Boyle et al., 2013), R014 (a rabbit polyclonal raised against the luminal domains of human TAPBPR), R021 (a rabbit polyclonal raised against the cytoplasmic tail of human TAPBPR), a mouse anti-TAPBPR mAb raised against the membrane distal domain of TAPBPR (ab57411, Abcam, UK). The following MHC class I specific antibodies were used: HC10 (a mouse mAb that recognises a PxxWDR motif at aa 57–62 in the α1 domain of the MHC class I heavy chain, found commonly in HLA-B and –C, and also in a few HLA-A allomorphs) (Stam et al., 1986; Perosa et al., 2003), HCA2 (a mouse mAb that recognises HLA allomorphs containing a xLxTLRGx motif at aa 77–84 on the α1 domain) (Stam et al., 1990 Sernee et al., 1998), 3B10.7 (a rat monoclonal antibody with broad specificity for HLA I independent of conformation) (Lutz and Cresswell, 1987), BB7.2 (a mouse mAb specific for β2m bound and peptide loaded HLA-A2), Bw6 (a mouse mAb specific for MHC class I allomorphs containing the Bw6 epitope SLRNLRG at aa 77–83) (One Lambda, Thermo Fisher Scientific, Canoga Park, CA), BB7.1 (a mouse mAb specific for HLA-B7) (AbDSerotec), W6/32 (a pan MHC I mAb which recognises a conformation epitope on the MHC I α2 domain, dependent on β2m and peptide) (Barnstable et al., 1978), 4E (a mouse monoclonal reactive against HLA-B as well as a limited number of HLA-A molecules (A29, Aw30, Aw31, Aw32) (Yang et al., 1984), B1.23.2 (a mouse mAb that recognises both β2m association and -free HLA-B,-C as well as some HLA-A heavy chains) (Rebaï and Malissen, 1983; Apps et al., 2009). Other antibodies used were Pasta1 (a mAb which recognises native tapasin) (Dick et al., 2002) and Rpg48N (tapasin specific rabbit polyclonal) (both kind gifts from Peter Cresswell, Yale University School of Medicine, New Haven, CT), and rabbit anti-calnexin (Enzo life Sciences, UK). Primary antibodies were detected with horseradish peroxidase (HRP) conjugated secondary antibodies (Dako, UK) and goat-anti-mouse Alexa 647 (molecular probes). In addition isotype control antibodies were also used (Dako).

HEK293T were maintained in Dulbecco's modified eagle's medium (DMEM;Gibco), HeLa-M, HeLa-S, HeLa-S depleted of TAPBPR using shRNA (Boyle et al., 2013), 721.221 and 721.220 cells were maintained in Roswell Park Memorial Institute (RMPI) 1640 media (Gibco), and KBM-7 cells were maintained in Iscove's Modified Dulbecco's Medium (Gibco) all supplemented with 10% fetal calf serum, 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco) at 37°C and 5% CO₂. To induce the expression of endogenous TAPBPR, cells were treated with 50 U/ml of IFN-γ (Peprotech, UK) at 37°C for 48–72 hr.

HLA-A*02:01, -A*68:01, -B*08:01, -B*15:10 and –B*40:02 were cloned into the lentiviral vector pHRSINcPPT-SGW. HLA-B*07:02 was cloned into the lentiviral vector pHRSIN-C56W-UbEM producing HLA-B7 under the spleen focus-forming virus promotor and the green fluorescent protein (GFP)-derivative protein emerald under an ubiquitin promotor. For TAPBPR depletion, the lentiviral shRNA plasmid V2LHS_135531 on the pGIPZ backbone was used (Open Biosystems, GE healthcare). Lentiviral plasmids were transfected into HEK-293T cells along with the packaging plasmid pCMVR8.91 and envelope plasmid pMD-G using TransIT-293 (Mirus, Madison, WI). Forty eight and seventy two hours post-transfection, the filtered supernatants were used to transduce HeLa, 721.221 or 721.220 cells. For HLA molecules transduced into 721.221, the transduction efficiency was determined by the surface expression of MHC class I using W6/32 antibody with flow cytometry. To make the 721.221 and 721.220 expressing both HLA-A2 and –B7, HLA-A2 was first stably transduced into the cell lines with transduction efficiency determined by surface expression of HLA-A2 using BB7.2 antibody with flow cytometry. These HLA-A2 positive cells were subsequently transduced with HLA-B7 pHRSIN-C56W-UbEM with transduction efficiency determined by GFP expression in the cells. To select cells depleted of TAPBPR puromycin selection was used post transduction with V2LHS_135531.

HeLa TAPBPR KO lines were generated using CRISPR as previously described (Ran, et al., 2013). To target TAPBPR expression, sgRNAs were chosen using the CRISPR design tool (http://crispr.mit.edu), which bind in exon 2 of TAPBPR (Crispr7: GCGAAGGACGGTGCGCACCG) and cloned into pSpCas9(BB)-2A-Puro. To generate HeLa TAPBPR KO cell lines, cells were seeded at a confluence of 80% in 6 well format and transfected with TAPBPR-CRISPR plasmids in the absence of serum using Lipofectamine2000 (Invitrogen, Thermo Fisher Scientific). Twenty four hours after transfection, the medium was replaced with complete DMEM containing 4 µg/ml puromycin (Invivogen, San Diego, CA). After 48 hr, the medium was replaced with complete DMEM without puromycin. Subsequently, the clones were selected and the absence of TAPBPR protein was verified by immunoprecipitation/western blot analysis.

Harvested cells were washed in PBS, pelleted, then lysed in either 1% digitonin (Merck Millipore) Tris-buffered saline (TBS) (20 mM Tris-HCl pH7.4, 150 mM NaCl, 5 mM MgCl₂, 1 mM ethylenediaminetetraacetic acid) supplemented with 10 mM N-ethylmaleimide (NEM) (Sigma), 1mM phenylmethylsulfonyl fluoride (PMSF; Sigma) and protease inhibitor cocktail (Roche) for 30 min at 4°C. Nuclei and cell debris were pelleted by centrifugation at 13,000 × g for 10 min and supernatants were precleared on IgG-sepharose (GE Healthcare, United Kingdom) and Protein A Sepharose (Generon, UK) for 1 hr at 4°C with rotation. Immunoprecipitation was performed with the indicated antibody and Protein A Sepharose for 1 hr at 4°C with rotation. Following immunoprecipitation, the beads were washed thoroughly in 0.1% detergent-TBS to remove the unbound protein. All samples were heated at 80°C for 10 min in reducing sample buffer (125 mM Tris-HCL pH 6.8, 4% SDS, 20% glycerol, 0.04% bromophenol blue with 100 mM β-mercaptoethanol). Proteins were separated by SDS-PAGE and transferred onto an Immobilon transfer membrane (Millipore, Billerica, MA). Membranes were blocked using 5% (w/v) dried milk, 0.1% (v/v) Tween 20 in PBS for 30 min, followed by incubation with the indicated primary antibody for 1 hr. After washing, membranes were incubated with species-specific HRP conjugated secondary antibodies, before detection by enhanced chemiluminescence reagent (GE Healthcare).

Cells were starved in methionine and cysteine free RPMI for 30 min at 37°C, then labelled using EasyTag Express [35S]-protein labeling mix (Perkin Elmer) for 60 min at 37°C. Cells were lysed in 1% Triton X-100 (Sigma) TBS containing 10 mM NEM, 1 mM PMSF and protease inhibitors for 30 min at 4°C. Equal aliquots of clarified cell lysates were either kept at 4°C or heated at 22, 37 or 50°C for 12 min, before returning to 4°C. Immunoprecipitation and SDS-PAGE were performed as above. Gels were subsequently fixed in 12% acetic acid, 40% methanol and dried. Images were obtained using a phosphor screen (Perkin-Elmer) or on film. PhosphorImager analysis was performed using Typhoon Trio variable mode imager (GE Healthcare) together with ImageQuantTL software. Densitometry of the MHC class I HC band was performed. The amount of recoverable HLA-A2 remaining at each temperature was determined as a percentage of the signal intensity at 4°C. Graphs were generated using GraphPad Prism  software. High-resolution images were obtained using film.

Cells were washed in PBS, then incubated for 20 min at 4°C with W6/32, BB7.2, BB7.1, 4E or a HLA-Bw6 specific antibody. Isotype control antibodies were used as negative controls. Cells were washed in ice-cold PBS, then the bound primary antibody was subsequently detected with species-specific Alexa Fluor 647 secondary antibodies (Molecular Probes). Cells were analysed on a BD FACS Calibur 4-(BD Biosciences, East Rutherford, NJ) colour analyser and data were analysed using FlowJo software. For MHC class I cell surface decay experiments, 5 µg/ml brefeldin A was incubated with cells for 0, 0.5, 3, 6, and 16 hr  followed by staining with BB7.2 or BB7.1.

HLA ligands from 5 × 10⁸ cells per cell line were isolated by immunoaffinity chromatography. Cells were lysed in buffer containing PBS, 0.6% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), and Complete protease inhibitor, shaken for 1 hr at 4°C and subsequently sonicated for 1 min. Following centrifugation for 1.5 hr to remove debris, the supernatant was applied on affinity columns overnight at 4°C. Columns were previously prepared by coupling antibodies to CNBr-activated Sepharose (GE Healthcare, Buckinghamshire, England) (1 mg antibody/40 mg Sepharose). The antibody W6/32 was used to isolate all HLA class I alleles in HeLa cells. For KBM-7 cells, BB7.2 was used to isolate HLA-A2 and B1.23.2 was used to isolate HLA-B and -C molecules.

On the second day the columns were eluted in eight steps using 0.2% trifluoroacetic acid. The eluate was passed through a 10 kDa filter (Merck Millipore, Darmstadt, Germany) to yield the HLA-ligands in solution. The filtrate was desalted with C18 ZipTips (Merck Millipore, Darmstadt, Germany) and subsequently concentrated using a vacuum centrifuge (Bachofer, München, Germany). Sample volume was adjusted for measurement by adding 1% ACN/0.05% TFA (v/v). With an injection volume of 5 µl HLA ligands were loaded (100 µm × 2 cm, C18, 5 µm, 100 Å) and separated (75 µm × 50 cm, C18, 3 µm, 100 Å) on Acclaim Pepmap100 columns (Dionex, Sunnyvale, CA) using an Ultimate 3000 RLSCnano uHPLC system (Dionex). A gradient ranging from 2.4 to 32% of ACN/H2O with 0.1% formic acid was used to elute the peptides from the columns over 140 min at a flow rate of 300 nl/min. Online electrospray ionisation (ESI) was followed by tandem mass spectrometry (MS) analysis in a LTQ Orbitrap XL instrument (ThermoFisher Scientific, Bremen, Germany). Survey scans were acquired in the Orbitrap mass analyzer with a resolution of 60,000 and a mass range of 400–650 m/z. Peptides with a charge state other than 2+ or 3+ were rejected from fragmentation. Fragment mass spectra of the five most intense ions of each scan cycle were recorded in the linear ion trap (top5 CID). Normalised collision energy of 35%, activation time of 30 ms and isolation width of 2 m/z was utilised for fragment mass analysis. Dynamic exclusion was set to 1 s. The rawwere processed against the human proteome as comprised in the Swiss-Prot database (www.uniprot.org, status: Dec12th, 2012; 20.225 reviewed sequences contained) using MASCOT server version 2.3.04 (Matrix Science, Boston, MA) and Proteome Discoverer 1.4 (Thermo Fisher Scientific). Oxidation of methionine was allowed as dynamic peptide modification. A mass tolerance of 5 ppm or 0.5 Da was allowed for parent- and fragment masses respectively. Filtering parameters were set to a Mascot Score<20, search engine rank = 1, peptide length of 8-12 AA, achieving a false discovery rate (FDR) of 5% as determined by an inverse decoy database search. The netMHC programme (http://www.cbs.dtu.dk/services/NetMHC/) was used to predict the binding of peptides to specific HLA allomorphs (Lundegaard et al., 2008a, 2008b). To determine classic peptide anchor conservation, TAPBPR permitted peptides (shared peptides) and TAPBPR restricted peptides (peptides unique to HeLa-TAPBPR KO cells or peptides unique to HeLa cells) were compared and the frequency of classic anchors at P2 or PΩ calculated for both HLA-A*68:02 or HLA-B*15:03.

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

© 2015, Hermann et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.