1. Cell Biology
  2. Developmental Biology
Download icon

Coordination of planar cell polarity pathways through Spiny-legs

  1. Abhijit A Ambegaonkar
  2. Kenneth D Irvine  Is a corresponding author
  1. Howard Hughes Medical Institute, Rutgers University, United States
  2. Rutgers University, United States
Research Article
  • Cited 23
  • Views 1,548
  • Annotations
Cite this article as: eLife 2015;4:e09946 doi: 10.7554/eLife.09946


Morphogenesis and physiology of tissues and organs requires planar cell polarity (PCP) systems that orient and coordinate cells and their behaviors, but the relationship between PCP systems has been controversial. We have characterized how the Frizzled and Dachsous-Fat PCP systems are connected through the Spiny-legs isoform of the Prickle-Spiny-legs locus. Two different components of the Dachsous-Fat system, Dachsous and Dachs, can each independently interact with Spiny-legs and direct its localization in vivo. Through characterization of the contributions of Prickle, Spiny-legs, Dachsous, Fat, and Dachs to PCP in the Drosophila wing, eye, and abdomen, we define where Dachs-Spiny-legs and Dachsous-Spiny-legs interactions contribute to PCP, and provide a new understanding of the orientation of polarity and the basis of PCP phenotypes. Our results support the direct linkage of PCP systems through Sple in specific locales, while emphasizing that cells can be subject to and must ultimately resolve distinct, competing PCP signals.


eLife digest

Animals have many asymmetric organs. Wings, for example, are aerodynamically shaped and have a clear front, back, top and bottom, and even additions to these organs, such as feathers on the wing, often need to be oriented in a specific manner.

This kind of orientation arises when cells divide and grow asymmetrically in a flat plane. The asymmetry is established at the level of single cells when proteins are not equally spread throughout a cell, but rather asymmetrically distributed. Such cells are said to be ‘planar polarized’; and many experiments addressing this so-called planar cell polarity have been conducted in fruit flies, because they can be genetically altered easily. Previous studies have shown that two signaling pathways—called Frizzled and Dachsous-Fat—regulate how individual cells orient themselves within a flat sheet of cells that forms fruit fly’s wing. The two pathways are not independent, but it is unclear how they are linked. In particular, there has been conflicting evidence as to whether the Dachsous-Fat pathway controls the Frizzled pathway or whether the two act in parallel.

Now, Ambegaonkar and Irvine have discovered new roles for a protein that is involved in both pathways, called 'Spiny-legs'. This protein was known to be important in the Frizzled pathway, but, when it was tracked with a fluorescent tag in developing wing cells it also accumulated in areas where two proteins that make up part of the Dachsous-Fat pathway were located. Biochemical experiments showed that both of these proteins (which are called Dachs or Dachsous) could physically interact with Spiny-legs. Ambegaonkar and Irvine therefore deleted the genes for Dachs or Dachsous in fruit flies and observed that Spiny-legs no longer organized itself in the proper way, implying that Dachs and Dachsous control where Spiny-legs goes within cells.

When this analysis was extended to other fruit fly organs, such as the eyes, Ambegaonkar and Irvine found that Dachsous was more important than Dachs for the correct localization of Spiny-legs. Additionally, the Frizzled and Dachsous-Fat pathways seemed to compete for interactions with Spiny-legs. This connection between the two pathways helps to explain how cells behave when several different signals reach them. It also shows how different organs can reuse conserved components of the pathways to make different end products. Future studies should aim to work out the number of systems that polarize cells and how they are connected in different tissues.



Planar cell polarity (PCP) is the coordinated orientation of cell structures and behaviors within the plane of a tissue. Manifestations of PCP include the orientation of hairs, bristles, stereocilia, and ommatidia, as well as orientated cell divisions and cell movements. Two conserved molecular systems play key roles in the establishment and maintenance of PCP: the Frizzled (Fz) PCP pathway and the Dachsous (Ds)-Fat PCP pathway (Goodrich and Strutt, 2011; Matis and Axelrod, 2013). These involve distinct components, but share common features, including the polarized localization of key components within cells, and the existence of asymmetric intercellular interactions that enable this polarity to be propagated from cell to cell. Many processes are influenced by both PCP systems, but the relationship between them has been controversial.

The Drosophila Ds-Fat PCP pathway includes the cadherin family proteins Ds and Fat, which interact between neighboring cells (Ma et al., 2003; Matakatsu and Blair, 2004; Strutt and Strutt, 2002). Binding between Ds and Fat is modulated by Four-jointed (Fj), a Golgi-localized kinase that phosphorylates their cadherin domains (Brittle et al., 2010; Ishikawa et al., 2008; Simon et al., 2010). Ds and Fj are expressed in opposing gradients, which orient Ds-Fat PCP (Casal et al., 2002; Mao et al., 2006; Strutt and Strutt, 2002; Yang et al., 2002; Zeidler et al., 1999; 2000). Fat protein in a cell within a Ds-Fj gradient preferentially accumulates along the side where it contacts cells with higher Ds and lower Fj; Ds protein localizes in a complementary orientation (Figure 1A) (Ambegaonkar et al., 2012; Bosveld et al., 2012; Brittle et al., 2012). How polarization of Ds and Fat proteins establishes PCP is incompletely understood, but it is achieved in part through the unconventional myosin Dachs, whose membrane localization is regulated by Fat (Mao et al., 2006). Mammalian homologues of Ds and Fat, Dchs1 and Fat4, also influence PCP (Mao et al., 2011a; Saburi et al., 2008; Zakaria et al., 2014), and human FAT4 can rescue PCP phenotypes of Drosophila fat mutants (Pan et al., 2013).

Figure 1 with 2 supplements see all
Localization of Pk and Sple in wing discs, and their interaction with Dachs and Ds.

(A) Schematic diagram illustrating the general direction of PCP protein polarity (arrows), expression gradient of Ds (magenta) and organization of Ds-Fat and Fz PCP pathway components in the Drosophila wing disc. (B) Western blots, using antibodies indicated on the right, showing the results of co-immunoprecipitation experiments between V5-tagged Dachs (lanes 1–3,7), Ds-ICD (lanes 4–6,8) or GFP (lanes 9–11) of Flag-tagged Sple (lanes 1,4,9), Sple-N (lanes 2,5,10), Pk (lanes 3,6,11) or GFP (lanes 7,8). Upper panels (Input) show blots on lysates of S2 cells, lower panels (IP-V5) show blots on proteins precipitated from these lysates by anti-V5 beads. Similar results were obtained in three independent biological replicates of this experiment. (C–G) Portions of wing imaginal discs with clones of cells expressing GFP:Sple (C,E,F) or GFP:Pk (D,G) (green), stained for expression of E-cadherin (blue), and showing either anti-Wg (CE) or hh-Gal4 UAS-mCD8-RFP (F,G) (red). White arrows indicate direction of polarization of Sple or Pk.


The Drosophila Fz PCP pathway includes the asymmetrically distributed transmembrane proteins Fz and Van Gogh (Vang, also known as Strabismus), which act together with the cadherin family protein Starry night (Stan, also known as Flamingo) (Figure 1A) (Chae et al., 1999; Goodrich and Strutt, 2011; Park et al., 1994; Shimada et al., 2001; Strutt, 2001; Usui et al., 1999; Vinson and Adler, 1987). Stan interacts with Stan-Fz heterodimers in neighboring cells (Chen et al., 2008; Struhl et al., 2012; Strutt and Strutt, 2008); interactions between Vang and Fz have also been reported (Wu and Mlodzik, 2008). Each of these transmembrane complexes is associated with distinct cytoplasmic proteins, Fz-Stan associates with Dishevelled (Dsh) and Diego (Dgo) (Axelrod, 2001; Feiguin et al., 2001; Shimada et al., 2001; Strutt, 2001). Vang-Stan associates with Prickle-Spiny legs (Pk-Sple) (Bastock et al., 2003; Jenny et al., 2003). Polarization of these protein complexes can propagate from cell to cell through heterophilic intercellular interaction between Stan and Fz-Stan complexes (Chen et al., 2008; Goodrich and Strutt, 2011; Struhl et al., 2012). Polarization of complexes within a cell is reinforced by inhibitory intracellular interactions between asymmetrically localized components (Goodrich and Strutt, 2011). Mutation of any of the core members of the Fz PCP system will impair the polarization of all of the others, emphasizing their mutual dependency for polarization (Strutt and Strutt, 2009).

Genetic interactions between Ds-Fat pathway genes and Fz pathway genes, together with observations of altered Fz pathway protein localization in Ds-Fat pathway mutants, led to suggestions that the Ds-Fat pathway acts upstream of the Fz pathway (Ma et al., 2003; Yang et al., 2002). According to this hypothesis, the Ds-Fat pathway acts as a ‘global module’ that provides long-range directional information through tissue-wide Fj and Ds gradients, whereas the Fz pathway acts as a ‘core module’ that establishes robust polarization that can propagate locally, and effects cellular polarity. This suggestion was challenged by observations that clones of cells mutant for or over-expressing ds, fj or fat in the abdomen can affect PCP non-autonomously even in the absence of Fz pathway components (Casal et al., 2006). Additionally, in the abdomen, combining mutations in both Ds-Fat and Fz pathway genes can have more severe effects on PCP than single mutants, suggesting that these pathways can act in parallel (Casal et al., 2006; Donoughe and DiNardo, 2011; Repiso et al., 2010). There are also some manifestations of PCP, such as oriented cell divisions in the developing wing, which are influenced by the Ds-Fat pathway and not the Fz pathway (Baena-Lopez et al., 2005).

Nonetheless, other studies have provided evidence of cross-talk between PCP systems, and implicated the Pk-Sple locus in helping to mediate this cross-talk. The Pk-Sple locus produces two functional isoforms: Prickle (Pk) and Spiny-legs (Sple), which share a common, LIM-domain containing C-terminus, but unique N-termini (Figure 1—figure supplement 1) (Gubb et al., 1999). These isoforms have distinct roles: for example, mutations that only affect pk disrupt PCP in the wing and notum, but not in the eye and leg, whereas mutations that only affect sple exhibit a complementary specificity. The observations that mutations that affect both isoforms (pk-sple) have milder effects on PCP than isoform-specific alleles in the wing, notum, and leg, and that over-expression of Sple or Pk leads to PCP phenotypes reminiscent of loss-of-function of pk, or sple, respectively, led to the suggestion that a balance between Pk and Sple isoforms is necessary for normal PCP (Gubb et al., 1999). Studies of PCP establishment in the pupal wing revealed that it occurs in distinct phases, and suggested that influences of Sple are correlated with influences of the Ds-Fat pathway (Hogan et al., 2011; Merkel et al., 2014). Moreover, examination of PCP protein localization revealed that a coupling between the polarization of components of the Ds-Fat and Fz systems could be induced by expression of Sple (Merkel et al., 2014). Additionally, in the abdomen, the Fj and Ds gradients are oriented oppositely within anterior (A) versus posterior (P) compartments of each segment (Casal et al., 2002). Since hairs always point posteriorly, this led to the suggestion that there could exist a ‘rectification’ mechanism, which would reverse the influence of these gradients on hair polarity. The observations that Sple over-expression reverses polarity in P compartments, and that pk-sple mutants reverse polarity in part of the A compartment, led to the suggestion that Pk and Sple might be involved in this rectification (Lawrence et al., 2004).

Two potential mechanisms by which Pk-Sple might influence the relationship between PCP pathways have recently been suggested. It was reported that Dachs could directly interact with Pk and Sple, and that Ds and Dachs could influence Sple localization in wing discs (Ayukawa et al., 2014). It has also been proposed that Pk-Sple could connect PCP pathways through an influence on microtubule orientation (Olofsson et al., 2014). Vesicles containing Fz and Dsh have been observed to move along apical non-centrosomal microtubules towards the distal side of wing cells, with the proximal-distal alignment of microtubules and consequent directional transport of Fz pathway components dependent upon the Ds-Fat pathway (Harumoto et al., 2010; Matis et al., 2014; Olofsson et al., 2014; Shimada et al., 2006). Pk and Sple also influence the orientation of apical microtubules, such that the plus ends of microtubules are preferentially found at either the high end or the low end of the Ds gradient, depending on whether Pk or Sple, respectively, is the predominant isoform (Matis et al., 2014; Olofsson et al., 2014). Relative differences in expression of isoforms consistent with their distinct requirements have also been reported: Pk at higher levels than Sple in larval wing discs, and Sple at higher levels than Pk in eye discs (Ayukawa et al., 2014; Merkel et al., 2014; Olofsson et al., 2014). While these studies are suggestive of a key role for Pk-Sple in linking PCP pathways, the extent to which these or other mechanisms link PCP pathways, and their contribution to orienting PCP, remain unclear.

Here, we demonstrate that Dachs and Ds can each physically interact with Sple, and control its localization in the wing, eye and abdomen. Our studies complement observations of Ayukawa et al. (2014) in identifying requirements for Dachs and Ds in Sple localization, but differ regarding the nature of these requirements. We also extend understanding of the relationship between Ds-Fat and Fz PCP pathways by identifying organ and region-specific differences in their interactions, and illustrate how this relationship between pathways can explain poorly understood features of PCP mutant phenotypes. Our results establish control of Sple localization as a key mechanism by which the Ds-Fat pathway coordinates with Fz to influence PCP, and enhance our understanding of how PCP is coordinated in developing tissues.


Distinct localization of Pk and Sple in wing imaginal discs

Components of each of the two major PCP pathways are polarized along the proximal-distal axis of the larval wing imaginal disc and pupal wing (Figure 1A) (Goodrich and Strutt, 2011; Matis and Axelrod, 2013). Components of both pathways are required for the normal distal orientation of wing hairs. Motivated by observations implicating the pk-sple locus in modulating the influence of the Ds-Fat pathway on wing hair and ridge polarity (Hogan et al., 2011), we initiated experiments to examine the localization of the distinct Pk and Sple isoforms and their potential regulation by Ds-Fat PCP. This was achieved by expressing GFP-tagged isoforms in clones of cells. Consistent with recent studies examining isoform-specific localization (Ayukawa et al., 2014; Sagner et al., 2012; Strutt et al., 2013), we observed that GFP:Pk was polarized towards the proximal sides of cells, except just anterior to the anterior-posterior compartment boundary, where GFP:Pk was instead polarized towards the anterior sides of cells (Figure 1D,G, 2I). By contrast, GFP:Sple was polarized towards the distal sides of cells throughout the wing disc (Figure 1C,E,F, 2I). The distinct localization of Pk and Sple expressed in wing discs indicates that they can respond to distinct spatial cues.

Localization of Sple in Ds-Fat pathway mutants.

(A–H) Portions of wing imaginal discs with clones of cells expressing GFP:Sple (green) in dGC13/ d210 (A and B), ft8/ ftG-rv (C), ds36D/ dsUA071 (D), dGC13 ds36D/ dGC13 dsUA071 (E and F) and dGC13 ft8/ dGC13 ftG-rv (G and H) mutants. Discs were stained for E-cad (blue) and Wg (red). Wg is expressed along the D-V boundary and in proximal rings, the locations of Wg expression shown are indicated. White arrows indicate general direction of Sple polarization. (I) Rose plots summarizing orientation of Sple or Pk in the indicated genotypes, with proximal at left, distal at right, and in the central row, anterior at top. Orientations were scored separately in the three regions depicted in the cartoon, the number of cells scored is indicated by N.


Dachs and Ds can physically interact with Sple

The localization of Sple to the distal side of wing disc cells is similar to that of Dachs and Ds (Figure 1—figure supplement 2) (Ambegaonkar et al., 2012; Brittle et al., 2012; Mao et al., 2006; Rogulja et al., 2008). To investigate whether this shared localization could reflect physical association, we assayed for co-immunoprecipitation of epitope-tagged proteins expressed in cultured Drosophila S2 cells (Figure 1—figure supplement 1). Indeed, V5-tagged Dachs could co-immunoprecipitate Flag-tagged Sple (Figure 1B, lane 1). Dachs and Sple interact through the unique N-terminus of Sple, because Dachs also co-precipitated a construct comprising only the Sple N-terminus (Sple-N), but did not co-precipitate a full length Pk construct (Figure 1B, lanes 2 and 3). Interaction with Ds was investigated by expressing a construct comprising the entire intracellular domain of Ds (Ds-ICD). Both Sple and Sple-N also interacted with Ds-ICD, whereas Pk did not (Figure 1B, lanes 4–6). We note that Ayukawa et al. (2014) similarly reported an ability of Dachs to interact with Sple, based on co-immunoprecipitation of proteins expressed in human HEK293 cells. However, our results differ in that they reported that Dachs could also interact with Pk, whereas we could not detect any interaction between Pk and Dachs above non-specific background (defined by precipitation observed using GFP:V5 instead of Dachs:V5, Figure 1B, lane 11). Also, Ayukawa et al. (2014) reported that they could detect an interaction between Sple-N and Ds-ICD, but could not detect an interaction between Ds-ICD and full length Sple, leading them to suggest a requirement for other components such as Dachs, whereas we did detect this interaction (Figure 1B, lane 4). Altogether, our results establish that Dachs and Ds can each independently interact with Sple, and that they do so through its unique N-terminal region.

Influence of Dachs and Ds on Sple localization in wing discs

To determine whether the shared distal localization and physical interaction between Dachs and Sple are reflective of a functional role for Dachs in localizing Sple, we examined GFP:Sple in dachs mutant wing discs. Indeed, GFP:Sple localization was altered, as throughout most of the developing wing disc its localization became similar to that of Pk: on the proximal side of cells, and in fewer, more discrete puncta (Figure 2A,I). Along the A-P compartment boundary, GFP:Sple was instead localized towards anterior side of cells, as is GFP:Pk (Figures 2I, 3A) (Sagner et al., 2012). Intriguingly, however, in the most proximal part of the wing pouch, GFP:Sple generally maintained a distal localization (Figure 2B,I). Thus, Dachs is required for the distal localization of GFP:Sple throughout most of the wing pouch, but not in the proximal wing.

Additional characterization of Pk and Sple localization in mutants.

Portions of wing discs with clones of cells expressing GFP:Sple (A,F,G) or GFP:Pk (B–E) (green) in dGC13/ d210 (A–C), ft8/ ftG-rv (D), ds36D/ dsUA071 (E), dGC13 pk30 (F), and vangstbm6(G) mutants. Discs were stained for E-cad (blue) and Wg (red) (B,D,E,F and G) or hh-Gal4 UAS-mCD8-RFP (red) (A,C). The white arrows indicate direction of polarization.


In ds mutant wing discs, GFP:Sple was in most cases unpolarized (localized to cell membrane on all sides), but sometimes partially polarized (on multiple cell sides but with a clear bias), or polarized in random directions (Figure 2D,I). The observation of unpolarized GFP:Sple is consistent with the inference that Dachs can localize GFP:Sple, because Dachs is localized to all membranes in an unpolarized fashion in ds mutants (Ambegaonkar et al., 2012). Dachs is similarly localized to the membrane in an unpolarized fashion in fat mutants (Mao et al., 2006), and we always observed unpolarized membrane localization of GFP:Sple in fat mutant wing discs (Figure 2C). To confirm that mis-localization of Dachs is responsible for the mis-localization of GFP:Sple in ds or fat mutant wing discs, we examined GFP:Sple in ds dachs and fat dachs double mutants. In both cases, GFP:Sple reverted to a Pk-like localization, including a proximal, punctate orientation throughout most of the wing pouch, and an anterior orientation near the A-P boundary (Figure 2E–I).

One remarkable feature of ds dachs or fat dachs mutant discs is that GFP:Sple localization is preferentially proximal even in proximal regions of the wing pouch, where GFP:Sple localization was preferentially distal in dachs mutants (Figure 2B,F,H,I). This implies that the distal localization of GFP:Sple here in dachs mutants is Ds-dependent, and hence that Dachs and Ds each have the ability to independently localize GFP:Sple. Thus, in proximal cells, where Ds expression is higher, Dachs and Ds could provide redundant localization cues for GFP:Sple. In distal cells, by contrast, we suggest that Dachs could be required for GFP:Sple localization because Ds expression is too low. In ds or fat mutants, Dachs is mis-localized, and Ds is either absent (in ds mutants) or unpolarized with reduced junctional accumulation (in fat mutants) (Ma et al., 2003; Mao et al., 2009; Strutt and Strutt, 2002), and consequently GFP:Sple becomes mis-localized. Finally, in the absence of both Dachs and Ds localization cues, as in fat dachs or ds dachs mutants, GFP:Sple follows Pk localization cues. In principle this could occur either because Sple is able to respond directly to the same cues as Pk through shared motifs, or because Sple can bind to Pk. The observation that GFP:Sple localized proximally in dachs pk mutant wing discs (Figure 3F) indicates that Sple can respond to Pk localization cues even in the absence of Pk. Localization of Pk was not visibly altered within larval wing discs by dachs, ds, or fat mutations (Figure 3). Fz-PCP is not required for distal localization of Sple, as GFP:Sple remains preferentially distal in vang mutant wing discs (Figure 3G). Cytoplasmic levels of Sple were also visibly increased in vang mutants, consistent with studies of the influence of Vang on Pk levels (Strutt et al., 2013).

We note that our studies agree with Ayukawa et al. (2014) in reporting an influence of dachs and ds on Sple localization, but differ in that they reported that in ds mutants Sple polarity was reversed, resembling Pk, whereas we observe either a complete absence, or a randomization, of Sple polarization in ds mutants, consistent with Sple being regulated by Dachs. Also, they did not report observing the difference in localization of Sple between distal and proximal regions of dachs mutants, which we determined reflects a Dachs-independent regulation of Sple by Ds. Nonetheless, our studies agree that a direct connection between the Fz and Ds-Fat PCP pathways can be mediated through Dachs and Ds-dependent control of Sple.

PCP in pk mutant wings reflects Dachs-directed polarity

The link between PCP pathways mediated through Sple has important implications for how PCP is oriented, and suggests explanations for the basis of both pk and fat mutant polarity phenotypes. sple mutation does not result in a hair polarity phenotype in the wing, whereas pk mutants have a characteristic wing polarity phenotype, in which hairs in much of the wing are mis-oriented away from the wing margin, and wing margin bristles can point proximally (Figure 4D,H; Figure 4—figure supplement 1) (Gubb et al., 1999). The observation that Pk and Sple can localize in opposite directions, whereas wing hairs normally point in a single direction, implies that cells must ultimately choose which of these two distinct localization cues to follow. Normally, they choose the Pk cue (Figure 4A), presumably because the Pk isoform is more abundant than the Sple isoform in the wing (Ayukawa et al., 2014; Merkel et al., 2014; Olofsson et al., 2014), and hence it dictates polarization. Indeed, if Sple is over-expressed, then hair polarity is reversed even more strongly than in pk mutants, and can align with Ds-Fat PCP (Ayukawa et al., 2014; Doyle et al., 2008; Gubb et al., 1999; Merkel et al., 2014; Olofsson et al., 2014), and the expression of GFP:Sple in clones is sufficient to alter wing hair polarity (Figure 4—figure supplement 1). These observations suggest that wing hair polarity in pk mutants could be directed by the Ds-Fat pathway dependent polarization of Sple (Figure 4A). As this linkage in most of the wing depends upon dachs (Figure 2I), this hypothesis predicts that the pk wing hair polarity phenotype should be suppressed by dachs mutation (Figure 4A). Indeed, when we tested this by comparing wing hair and bristle orientation in pk versus dachs pk mutants, this suppression was observed (Figure 4C–J). This result can also explain the observation that over-expression of Fat could suppress the pk hair polarity phenotype (Hogan et al., 2011), because over-expression of Fat removes Dachs from the membrane (Mao et al., 2006), which, as Dachs functions at membranes (Pan et al., 2013; Rauskolb et al., 2011), is functionally equivalent to dachs mutation.

Figure 4 with 1 supplement see all
Contribution of Dachs and Sple to PCP mutant wing phenotypes.

(A) Cartoons depicting inferred protein localization and hair orientation (brown) in wing cells of the indicated genotypes to explain rescue of pk by dachs, and rescue of fat by sple. Faint Sple and Ds indicate lower levels. (B) Schematic adult wing to show approximate location of panels shown in close-up, as indicate by letters. (C–N) Close-ups of portions of wings (as indicated in panel B) to show hair and bristle orientation in the indicated genotypes. Arrows indicate general direction of polarity. (C–F) Show wing margin bristles, (G–N) show wing hairs, in wild type (C,G), pk30 (D,H), dGC13/ d210 (E,I), dGC13 pk30 (F,J), UAS-RNAi-fat/+; C765-Gal4/UAS-dcr2 (K,M) and sple1 UAS-RNAi-fat/ sple1; C765-Gal4/UAS-dcr2 (L,N). Suppression of pk polarity phenotypes by dachs was 100% penetrant. For suppression of fat phenotypes by sple, near the proximal anterior wing margin (region K,L) in 10/10 fat RNAi wings scored hairs point predominantly towards the wing margin, whereas in 7/8 fat sple wings scored hairs point predominantly distally, and in 1/8 wings scored a substantial fraction of hairs (∼1/4) point towards the wing margin. Near the anterior cross-vein (region M-N), in 8/9 fat RNAi wings scored hairs point predominantly proximally, and in 1/9 wings scored hairs point predominantly towards the L3 vein, whereas in 5/8 fat sple wings scored hairs point distally, in 2/8 they point towards the L3 vein, and in 1/8 they point proximally.


Sple contributes to Fat PCP phenotypes in the wing

The determination that Ds-Fat and Fz pathways are molecularly linked by physical interaction between Dachs and Sple also provides a new perspective on polarity phenotypes of fat and ds. The altered wing hair polarity in fat or ds mutants has been interpreted as indicating that Fat and Ds have a normal role in directing hair polarity in regions of the wing. Indeed, recent studies have inferred that Ds-Fat PCP influences core protein polarization in the wing by orienting microtubules (Harumoto et al., 2010; Matis et al., 2014; Olofsson et al., 2014). However, as hair polarity in the wing is normally Pk-dependent rather than Sple-dependent, and as we found that Ds-Fat PCP in the wing influences Sple localization but not Pk localization, we considered an alternative model: rather than reflecting a normal role in directing hair polarity, these phenotypes of fat and ds could stem from the inappropriate accumulation of Dachs, leading to inappropriate localization of Sple, which in some contexts could interfere with the normal Pk-dependent polarization cues (Figure 4A). Consistent with this hypothesis, ds hair polarity phenotypes are suppressed by dachs (Brittle et al., 2012), and we confirmed that fat wing hair polarity phenotypes (generated using wing-specific RNAi) are also suppressed by dachs (Figure 4—figure supplement 1). This hypothesis further predicts that fat PCP phenotypes could be suppressed by sple (Figure 4A), and while we did not observe completely normal hair polarity in fat sple wings, we did observe a partial suppression, including restoration of normal, distally oriented polarity in two regions affected by loss of Fat: near the proximal anterior wing margin, and near the anterior cross-vein (Figures 4B,K–N; Figure 4—figure supplement 1). By contrast, when Hippo pathway phenotypes of fat are rescued by Warts over-expression, wing polarity remains abnormal in the proximal wing (Feng and Irvine, 2007) (Figure 4—figure supplement 1). Thus, while Sple is not required for normal wing hair polarity, it mediates a connection between Ds-Fat and Fz pathways that contributes to abnormal hair polarity in the absence of fat.

Control of Sple polarity in eye discs by Ds-Fat PCP

PCP in the eye has been studied for its influence on the organization and orientation of ommatidia (Jenny, 2010). The eight photoreceptor cells within each ommatidia are arranged in a characteristic pattern that comes in two chiral forms. This chirality is determined by which of two neighboring photoreceptors becomes the R3 cell and which becomes R4. This decision is dependent upon Notch signaling, which is biased by Fz PCP such that the cell at the R3-R4 interface with higher Fz becomes R3 (Cooper and Bray, 1999; Fanto and Mlodzik, 1999; Strutt et al., 2002; Tomlinson and Struhl, 1999). The two chiral forms are established in mirror symmetry with respect to the dorsal-ventral compartment boundary, termed the equator (Figure 5—figure supplement 1). In sple mutants, ommatidial chirality is randomized, whereas in pk mutant eyes ommatidial chirality is normal (Gubb et al., 1999). Ds and Fj are expressed in complementary gradients in the eye (Figure 5—figure supplement 1), and experiments manipulating Ds and Fj expression have revealed that these gradients instruct normal polarity (Simon, 2004; Strutt and Strutt, 2002; Yang et al., 2002; Zeidler et al., 1999). However, the relationship between Fz and Ds-Fat PCP pathways in the eye and how this influences polarity has remained unclear. Also, in contrast to the wing and abdomen, where dachs mutation suppresses fat PCP phenotypes, dachs mutation has little effect on fat PCP phenotypes in the eye (Brittle et al., 2012; Mao et al., 2006; Sharma and McNeill, 2013). We hypothesized that the influence of Ds-Fat PCP on ommatidial polarity might be accounted for by an ability of Ds to polarize Sple independently of dachs, as in the proximal wing.

Ommatidia form progressively in a wave of differentiation that sweeps across the eye disc, initiated within a line of cells that form the morphogenetic furrow. We analyzed GFP:Sple localization at the 5-cell precluster stage of ommatidial formation, when R3-R4 specification occurs. GFP:Sple localized to the equatorial side of cells within both R3 and R4, which places it within R4 at the R3-R4 interface (Figure 5A). Equatorial polarization of Sple co-localizes it with Vang (Strutt, 2001), and is consistent with the observation that it interacts with Ds, since Ds is also polarized to the equatorial side of cells in the eye disc (Brittle et al., 2012). This equatorial polarization of Sple was disrupted in ds or fat mutants (Figure 5C,E), but was not affected by mutation of dachs (Figure 5B), nor could dachs mutation prevent the mis-localization of Sple in ds or fat (Figure 5D,F). In ds or fat mutants, Sple localization was partially randomized within R3 and R4, and also partially unpolarized, in that it was often detected on multiple cell junctions. However, it was never detected along the cell junction with the more anterior cells within the ommatidial cluster (R2 and R5) (Figure 5).

Figure 5 with 2 supplements see all
Sple and Pk localization in photoreceptor cells.

Localization of GFP:Sple (A–F) or GFP:Pk (G,H) in cells with expression in R4 or R3 photoreceptor cells in wild type (A,G), dGC13/ d210 (B), ds36D/ dsUA071 (C), dGC13 ds36D/ dGC13 dsUA071 (D), ft8/ ftG-rv (E), dGC13 ft8/ dGC13 ftG-rv (F), and sple1 (H) mutants. Rose plots summarize localization based on the indicated number (N) of examples, with equatorial to the right, polar to the left, and anterior (towards the morphogenetic furrow) at top.


We also examined localization of GFP:Pk within R3 and R4, and found that it too localized to the equatorial side of both cells (Figure 5G). How might Pk localize equatorially if it cannot interact with Ds? We hypothesized that this might arise from an ability of Pk-Sple proteins to multimerize, or from the interactions that lead core components of the Fz pathway to adopt a shared, discrete, polarized localization. In such cases, equatorial polarization of Pk would not come about because it directly responds to an equatorial-polar signal like Ds, but rather because it can interact with Sple and/or Vang, which recruit it to equatorial cell junctions. In support of this, we found that in sple mutants, Pk localization is altered such that it becomes partially randomized, resembling Sple localization in fat or ds mutants (Figure 5H). Thus, equatorial Pk localization in R3 and R4 depends upon Sple.

The posterior bias in Pk localization in sple mutants, and the similar posterior bias in Sple localization within ds or fat mutants, tend to place Pk or Sple towards the side of the cell nearest the morphogenetic furrow (Figure 5). The morphogenetic furrow is a source of local signals for multiple pathways, including Notch, Hedgehog and Decapentaplegic, which might, indirectly at least, influence Fz PCP orientation in these mutant eye discs, as they have been implicated in influencing PCP in other contexts (Sagner et al., 2012; Struhl et al., 1997). Finally, we observed that in front of the morphogenetic furrow, GFP:Sple and GFP:Pk exhibit distinct localization profiles, with GFP:Sple accumulating on the equatorial sides of cells, as it does behind the furrow, but Pk:GFP accumulating on the anterior sides of cells, which in this region is the side closest to the morphogenetic furrow (Figure 5—figure supplement 2). Thus, behind the morphogenetic furrow, Pk and Sple co-localize in an Sple-dependent process, whereas in front of the morphogenetic furrow, Sple and Pk can localize differently.

Our observation that GFP:Pk localizes, like Sple, on the equatorial sides of R3 and R4 behind the furrow was initially unexpected, because abnormal PCP has been reported in adult eyes with clones of cells expressing GFP:Pk (Strutt et al., 2013). However, the observation of a distinct localization for GFP:Pk in front of the furrow suggested that the timing of GFP:Pk expression might be important. Polarization of GFP:Pk or GFP:Sple is examined in clones induced 1 day before dissection, as it is scored in ommatidia in which these transgenes are expressed only in R3 or only in R4. These clones are induced when cells are in or behind the furrow. When we examined PCP in eye discs, using Prospero and Elav to stain ommatidia, PCP appeared unaffected by clones expressing GFP:Pk for one day (Figure 5—figure supplement 2). By contrast, within 3-day-old clones, which would have been initiated in front of the morphogenetic furrow, PCP was disturbed (Figure 5—figure supplement 2). These observations indicate that Pk over-expression can disturb PCP in the eye, but PCP ultimately becomes refractory to Pk over-expression.

Interactions between PCP pathways in the abdomen

Hairs in the Drosophila abdomen point posteriorly; this orientation is influenced by components of both the Fz and Ds-Fat PCP pathways (Casal et al., 2002; 2006; Lawrence et al., 2004). In analyzing the relationship between PCP pathways in the abdomen, we focused on the pleural cells, which form in lateral and ventral regions, but have also examined polarity in tergites, which form on the dorsal side of the abdomen. As the subcellular localizations of Dachs, Sple and Pk within pupal abdominal cells have not been described, we first characterized their distributions in pleural cells of wild-type animals at pupal stages, with posterior compartments marked using hh-Gal4 and UAS-RFP transgenes. Dachs:GFP and Sple:GFP were polarized towards the anterior sides of cells within A compartments, and towards the posterior sides of cells within P compartments (Figure 6A,B,H). This is consistent with their being polarized in response to the Ds and Fj gradients, as the Fj and Ds gradients are oriented oppositely within anterior (A) versus posterior (P) compartments of each segment (Figure 6—figure supplement 1) (Casal et al., 2002), and Dachs and Sple accumulate on the sides of cells that face towards lower Ds levels and higher Fj levels. Pk:GFP, by contrast, was polarized towards the anterior sides of cells within both A and P compartments (Figure 6C,H). Thus, in A compartments Pk:GFP and Sple:GFP polarize in the same direction, whereas in P compartments they polarize in opposite directions.

Figure 6 with 1 supplement see all
Localization of Dachs, Sple and Pk in abdominal pleura.

(A–G) Pleura of wildtype (A–C), ft8/ ftG-rv (D,E), dGC13 ft8/ dGC13 ftG-rv (F) and sple1/sple(G) pupae with clones of cells expressing GFP:Dachs (A,D), GFP:Sple (B,E,F) and GFP:Pk (C,G) (green). Posterior compartments are marked by hh-Gal4 UAS-mCD8-RFP (red). Anterior-posterior body axis is indicated at top. (H) Rose plots depicting polarization of GFP:Dachs, GFP:Sple or GFP:Pk in pleural cells of the indicated genotypes; anterior polarization is to the left and posterior polarization is to the right. For wild type and dachs mutants cells were scored separately in A and P compartments. For fat, ds, fat dachs, and ds dachs the anterior compartment was further subdivided into a front region (A1, anterior-most 8 cells), and the remainder of the A compartment (A*). For sple, the A compartment was subdivided into a front region of 5 cells (Af), a back region of 10 cells (Ab), and a middle region comprising the rest of the compartment (Am); P compartment localization is summarized in Figure 6—figure supplement 1. Scoring of sub-regions of the A compartment in wild-type is shown in Figure 6—figure supplement 1. Apparent variations in cell size are mostly due to the flexibility of the pleura, which is easily stretched or compressed.


Consistent with prior studies (Lawrence et al., 2004), we observed that pk-sple mutants reverse hair polarity within the center of the A compartment, while the P compartment, and the edges of the A compartment, exhibit normal hair polarity (Figure 7B,F). The A compartment in tergites encompasses all of the hairs and bristles in the anterior, pigmented part of each abdominal segment, plus approximately two rows of hairs in the unpigmented region posterior to this (Struhl et al., 1997). The P compartment in tergites encompasses the remaining hairs posterior to the A compartment, plus a region of naked cuticle. In pleura we estimated the A and P compartment regions based on the neighboring tergites, but can not make precise assignments of compartment identity for hairs near compartment boundaries. We extended analysis of pk-sple by examining isoform-specific alleles. pk mutant alleles have normal polarity in A compartments, but mostly reversed polarity in the P compartment within pleura (Figure 7C), although not in tergites (Figure 7G). sple mutant alleles have normal polarity in the P compartment, and abnormal polarity, including hair reversal but also sideways or swirling hair orientations, within the center of the A compartment (Figure 7D,H).

Influence of Pk and Sple on hair polarity in the abdomen.

(A–D) Hair polarity in pleura revealed by F-actin (phalloidin staining) in wild type (A), and in pk-sple14 (B), pk30 (C) and sple1 (D) mutants. Yellow asterisk indicates the position of the spiracle, which forms near the center of the anterior compartment. Yellow arrows indicate the region where hair orientation is normal, and red arrows indicate the region where hair orientation is disrupted. Dashed yellow lines mark approximate boundaries between regions with normal and abnormal polarity. (E–H) Hair polarity in tergites of wild-type (E), pk-sple14 (F), pk30 (G) and sple1 (H) mutant animals. Black arrows indicate regions where hair orientation is normal, and blue arrows indicate the region where hair orientation is abnormal. Dashed blue line mark approximate boundaries between regions with normal and abnormal polarity.


The influence of pk-sple on polarity in the P compartment of the pleura thus appears reminiscent of the situation in the wing: Pk and Sple can respond to opposing localization cues. In the absence of Pk, cells respond instead to Sple-dependent cues, leading to a reversal of polarity (Sple localized normally in pk mutants, Figure 8I,K). The essential contribution of Sple to the pk phenotype is confirmed by its suppression in pk-sple mutants (Figure 7). The influence of Pk-Sple on polarity in A compartments is reminiscent of the situation in the eye. Sple, not Pk plays the key role in establishing polarity here, and Pk was mis-localized within the central region of A compartments of sple mutants (Figure 6G,H), hence Sple contributes to localization of Pk here.

Localization of Dachs, Sple and Pk in abdominal pleura of additional genotypes.

(A–J) Pleura of ds36D/dsUA071 (A,B,F), dachsGC13/dachs210 (C,G), ds36D dachsGC13/dsUA071 dachsGC13 (D,H), ft8/ftG-rv (E), pk30 (I) and ft8 dachsGC13/ftG-rv dGC13 (D,J) mutant pupae with clones of cells expressing of GFP:Dachs (A), GFP:Sple (B,C,D,I) and GFP:Pk (E-H,J) (green). Posterior compartments are marked by hh-Gal4 UAS-mCD8-RFP (red). (K) Rose plots depicting polarization of GFP:Dachs, GFP:Sple or GFP:Pk in pleural clones of the indicated genotypes; anterior polarization is to the left and posterior polarization is to the right. Clones were scored separately in A and P compartments


In fat or ds mutants, hair polarity is disturbed in much of the A and P compartments, although a small region at the front of the A compartment exhibits normal hair polarity (Figures 9A,E, 10A,E) (Casal et al., 2002). To determine whether the abnormal polarity could be explained by mis-localization of Dachs and/or Ds, and a consequent mis-localization of Sple and/or Pk, we assessed both genetic interactions and protein localization. The disruption of polarity within A compartments in fat or ds mutants was correlated with mis-localization of Dachs throughout the A compartment (mostly uniform Dachs in fat mutants, and randomized Dachs in ds mutants, Figures 6D, 8A,K), and mis-localization of Sple everywhere except the most anterior region of the A compartment (Figure 6E,H, 8B). Moreover, mutation of dachs suppressed the hair polarity phenotypes of fat and ds in A compartments (Figures 9C,F, 10C,G) (Mao et al., 2006), and also suppressed the mis-localization of Sple (Figures 6F,H, 8D). These observations suggest that ds and fat polarity phenotypes in the anterior abdomen can be accounted for by a Dachs-dependent mis-localization of Sple, as we had observed in the wing. Mutation of dachs alone does not disrupt polarity in A compartments (Figures 9B, 10B). It could be that in the absence of Dachs and Ds, Sple is localized by the same cues that localize Pk, as Pk localization remained normal within A compartments of ft or ds mutants (Figure 8E,F,K).

Influence of Ds-Fat PCP on hair polarity in abdominal pleura.

Hair polarity in pleura revealed by F-actin (phalloidin staining) in ft8/ftG-rv (A), dGC13/d210 (B), dGC13 ft8/dGC13 ftG-rv (C), ft8 sple1/ftG-rv sple1 (D), ds36D/dsUA071 (E), dGC13 ds36D/dGC13 dsUA071 (F), ft8 pk30/ftG-rv pk30 (G), ft8 pk-sple14/ftG-rv pk-sple14 (H), dGC13 pk30 (I) and dGC13 sple1 (J) mutant animals. Yellow asterisk indicates the position of the spiracle. Yellow arrows indicate the region where hair orientation is normal, and red arrows indicate the region where hair orientation is disrupted. Dashed yellow lines mark approximate boundaries between regions with normal and abnormal polarity.

Influence of Ds-Fat PCP on hair polarity in abdominal tergites.

Hair polarity in tergites of ft8/ftG-rv (A), dachsGC13/dachs210 (B), ft8 dachsGC13/ftG-rv dachsGC13 (C), ft8 sple1/ftG-rv sple1 (D), ds36D/dsUA071 (E), dachsGC13 sple1/dachsGC13 sple1 (F), ds36D dachsGC13/dsUA071 dachsGC13 (G), and dachsGC13 pk30/dachsGC13 pk30 (H) mutant animals. Black arrows indicate the region where hair orientation is normal, and blue arrows indicate regions where hair orientation is disrupted. Dashed blue line mark approximate boundaries between regions with normal and abnormal polarity.


In P compartments, Dachs is mis-localized in fat or ds mutants, and there is also a partial mis-localization of Sple (, Figures 6, 8). However, mutation of dachs alone causes a reversal of hair polarity in P compartments (Figures 9B, 10B) (Matakatsu and Blair, 2008). This reversal of polarity is associated with a reversal of Pk localization (Figure 8G,K). The P compartment of the abdomen thus differs from other regions we have examined both in that there is a strong PCP phenotype associated with mutation of dachs, and in the mis-localization of Pk in dachs mutants. One potential explanation for this could be that in the absence of Dachs, Pk localization becomes governed by Sple, which retains its normal posterior localization in dachs mutants (Figures 6G, 8C). In dachs sple mutants, Pk was partially randomized, but an overall posterior bias in localization was still observed (Figure 6—figure supplement 1). In dachs sple or dachs pk mutant abdomens, there is still some reversal of hair polarity in P compartments, although the region of reversal appears narrow than in dachs mutants (Figure 10F,H). Pk localization is also disturbed in P compartments of fat or ds mutants (Figure 8E,F,K), as well as in fat dachs or ds dachs double mutants (Figure 8H,J,K). Thus, while there are some similarities in control of PCP between abdominal P compartments and wings, there are also differences, hence distinct mechanisms contribute to the control PCP in each of these body regions.


Sple can link PCP pathways

Our results implicate interactions between Dachs and Sple, and between Ds and Sple, as a connection point between PCP pathways coordinating polarity in multiple Drosophila organs. We found that both Dachs and Ds can each independently bind to Sple, but not Pk, through the unique N-terminus of Sple. Dachs and Ds also each have the ability to influence Sple localization, and we identified some places where Dachs is necessary and sufficient to localize Sple (i.e. distal wing), and others where Dachs is dispensable but Ds is required (e.g. proximal wing, eye). The influence of Ds on Sple localization is essential for some manifestations of PCP, such as ommatidial polarity in the eye. Indeed, because Fz PCP can propagate from cell to cell, we propose that localization of Sple by Ds could account for the long-range influence of Ds-Fat borders on PCP in the eye (Sharma and McNeill, 2013; Strutt and Strutt, 2002; Yang et al., 2002). The influence of dachs on PCP is generally mild, likely due to partial redundancy with Ds in localizing Sple. However, a strong influence of Dachs is revealed in the context of additional PCP mutations, as it contributes to the disturbed Sple localization and hair polarity in the wing and abdomen of fat and ds mutants, as well as the reversal of wing hair polarity in pk mutants.

Several mechanisms by which Pk-Sple could influence the polarization of components of the Fz-PCP system have been described. These include physically associating with Vang, and promoting clustering, endocytosis, and/or degradation of Vang or other PCP proteins (Bastock et al., 2003; Cho et al., 2015; Jenny et al., 2005; Strutt et al., 2013; Tree et al., 2002). They have also been identified as influencing the orientation of apical non-centrosomal microtubules that can traffic components of the Fz-PCP system, including Fz and Dsh (Matis et al., 2014; Olofsson et al., 2014). The various activities ascribed to Pk-Sple are not mutually exclusive, and it could play multiple roles. However, the only unique functions clearly attributed to Sple as opposed to Pk are its interactions with Ds and Dachs, and distinct localization. Fz and Fat localize to opposite sides of cells in wings, but to the same side in eyes (Matis and Axelrod, 2013) (Figure 1A, Figure 5—figure supplement 1). Because Sple expression is relatively high in eye and low in wing (Ayukawa et al., 2014; Merkel et al., 2014; Olofsson et al., 2014), our studies are consistent with a molecular explanation for ‘rectification’ of this relationship between PCP pathways in which interaction of Sple with Dachs and Ds links PCP pathways in eyes but not in wings; coupling between pathways that depends upon physical interactions with Sple and not Pk could similarly explain the opposite relationships between hair polarity and Ds and Fj gradients in A versus P abdominal compartments. Thus, the solution our results support for the controversy over the relationship between the two PCP pathways is that in some contexts they operate in sequence, with directional information passed from Ds-Fat PCP to Fz PCP via Sple, whereas in other contexts they are uncoupled.

While vertebrates have a Ds homologue that is required for PCP, Dchs1 (Mao et al., 2011a), Dchs1 must influence PCP in mammals through a distinct mechanism, as Pk is conserved in vertebrates, but the Sple isoform is not. Even in flies, the linkage of Dachs and Ds to Sple cannot be the sole mechanism by which Ds-Fat signaling influences PCP, as some manifestations of cell polarity controlled by Ds-Fat, e.g. oriented cell divisions, do not require Sple (Baena-Lopez et al., 2005; Gubb et al., 1999). Moreover, when mis-expressed, Ds and Fat can alter PCP even in flies lacking a functional Fz PCP system (e.g. fz- stan- flies) (Casal et al., 2006). It has also been proposed that PCP in the wing is influenced by shear forces generated by contraction of the wing hinge (Aigouy et al., 2010), and disruption of these shear forces in fat or ds mutants might occur through a mechanism that depends upon dachs but not sple, due either to effects of Dachs on Hippo signaling (Cho et al., 2006) or on cytoskeletal tension (Bosveld et al., 2012; Mao et al., 2011b). Such additional influences of Dachs might explain why fat wing hair polarity phenotypes are more strongly suppressed by loss of dachs than by loss of sple.

Competition between polarizing cues

One revelation from analysis of Pk and Sple localization is that not only can PCP be oriented differently in different places or at different times (Hogan et al., 2011; Sagner et al., 2012), even at one place, cells can be subject to simultaneous, competing, polarity cues. For example, in the wing, where GFP:Sple localizes differently from GFP:Pk, cells must thus choose between competing polarity cues. Normally, they choose Pk localization cues, because Sple expression is low (Ayukawa et al., 2014; Merkel et al., 2014; Olofsson et al., 2014). Nonetheless, the Sple expressed in the wing is functional and able to direct PCP, as evidenced by the dachs- and sple-dependent reversals of hair polarity in pk mutants.

Based on observations that pk-sple alleles could have weaker phenotypes than isoform-specific alleles, and that over-expression of Pk or Sple could result in phenotypes reminiscent of sple or pk alleles, respectively, it was proposed that PCP requires a balance between Pk and Sple (Gubb et al., 1999). However, we suggest that their relationship is better described as a competition. In the wing disc, Pk expression is more abundant than Sple expression, hence Pk ‘wins’, and cells orient in response to cues that are unrelated to Ds-Fat PCP. When Pk is removed, then Sple can direct PCP, and hair polarity becomes governed by Ds-Fat PCP. Wild-type PCP requires Sple in some places, and Pk in others, but we know of no results that would require a balance between these two isoforms at any one place and time.

We further propose that the competition between Sple and Pk is carried out by feedback mechanisms that promote polarization. Positive feedback mechanisms, which reinforce the accumulation of co-localized proteins, together with negative feedback mechanisms, which inhibit the accumulation of oppositely localized proteins, are a staple of PCP systems, and have been widely viewed as a means of amplifying, maintaining, and propagating polarization in response to weak polarity signals. The observation that cells sometimes need to choose between competing polarity signals leads us to emphasize that feedback mechanisms could also have a distinct, fundamentally important role in PCP that has not previously been considered – they enable cells to make a discrete choice between competing polarity signals.

The observation that the relative level of Pk versus Sple influences how cells respond to competing polarity signals, with that choice then amplified by feedback, also has implications for the interpretation of GFP:Pk and GFP:Sple localization profiles. We take the localization of these proteins as indicators of the polarity signals that cells ‘see’ when that isoform predominates. This is not necessarily the same as their localization under endogenous expression conditions. For example, endogenous Pk localization might normally match Sple in the eye even in front of the furrow, because it is recruited to equatorial sides of cells by interactions with Sple and Vang.

Influence of Ds-Fat signaling on PCP in the wing

Analysis of wing hair polarity played a central role in development of the hypothesis that Ds-Fat functions as a ‘global’ PCP module and Fz as a ‘core’ PCP module, with polarity guided by the vectors of Fj and Ds expression (Ma et al., 2003). However, since Ds-Fat signaling modulates Sple, but not Pk, localization, and Pk, but not Sple, is normally important for wing hair polarity, we infer that Ds-Fat PCP does not normally play a significant role in directing wing hair polarity. Instead, we propose, as also suggested by (Blair, 2014), that the hair polarity phenotypes of ds or fat mutants are better understood as a de facto gain-of-function phenotype, resulting from inappropriate accumulation of Dachs on cell membranes, which then leads to inappropriate localization of Sple, and abnormal polarity. This would also explain how Ds-Fat signaling, stripped of polarizing information, could nonetheless rescue PCP phenotypes: for example, how uniform Ds expression can rescue hair polarity in ds fj mutants (Matakatsu and Blair, 2004; Simon, 2004), and how expression of the intracellular domain of Fat can rescue hair polarity in fat mutants (Matakatsu and Blair, 2006), as these manipulations suppress the membrane accumulation of Dachs that would otherwise occur in mutant animals.

More recently, it has been proposed that Ds-Fat PCP provides directional information to orient Fz PCP in the wing by aligning and polarizing apical non-centrosomal microtubules that can traffic Fz and Dsh (Harumoto et al., 2010; Matis et al., 2014; Olofsson et al., 2014). While disorganization of these microtubules is observed in fat or ds mutants, we suggest that the inference that Ds-Fat thus orients PCP in wing via these microtubules is incorrect. There is evidence both in imaginal discs and in axons that Pk-Sple can orient microtubules (Ehaideb et al., 2014; Olofsson et al., 2014). Sple is mis-localized in fat or ds mutant wing discs. Thus, we propose that the effects of ds and fat mutants on microtubules within the wing are likely a consequence of abnormal Sple localization, which disrupts microtubule orientation, but need not be interpreted as evidence for a normal role of Ds-Fat signaling in orienting microtubules or Fz PCP in the wing.

Instruction of PCP in the abdomen

The A compartment of the abdomen can be compared to the eye (Sple-dependent), and the P compartment of the abdomen can be compared to the wing (Pk-dependent). However, we also observed striking differences in the apparent influence of Ds-Fat pathway mutations on PCP between the abdomen and other organs. One possible contribution to these differences is the metamerism of the abdomen, and the local propagation of PCP. For example, the disturbance of Pk localization in P compartments even in fat dachs, ds dachs or dachs sple mutants would not be predicted based on the lack of detected physical interaction of Ds or Dachs with Pk, and lack of influence of these mutations on Pk in the wing. However, the P compartment is adjacent to two A compartments, and disturbances of polarity in these neighboring A compartments could potentially spread into the P compartment. The relatively normal polarity within A compartments of fat dachs or ds dachs mutants would also not be predicted if Sple is normally establishing polarity in response to the polarization of Ds and Dachs, and this result is not easily explained by hypothesizing propagation of normal polarity from neighboring compartments, since polarity is partially reversed in P compartments of these genotypes. Instead, we propose that in the absence of the primary PCP signal (in this case provided by the Ds-Fat pathway), cells use information from secondary signals, which appear to provide polarizing information in the A compartment that parallels that provided by the Ds-Fat pathway.

Materials and methods

Drosophila stocks and crosses

Request a detailed protocol

For investigation of Dachs, Sple or Pk localization we used act> y+>EGFP-dachs /TM6b, act> y+>EGFP-sple /TM6b, or act> y+>EGFP-pk /TM6b (Bosveld et al., 2012; Strutt et al., 2013). Clones with posterior compartments marked were made by crossing to y w hs-FLP[122]; If/CyOGFP; hh-Gal4 UAS-mCD8-RFP /TM6b. Mutant backgrounds examined in clones were ftG-rv/ ft8, d210/ dGC13, dsUA071/ ds36D, dGC13 ftG-rv/ dGC13 ft8, dGC13 dsUA071/dGC13 ds36D, sple1/ sple1, dGC13 pk30/ dGC13 pk30, vangstbm6. Flip-out clones were induced by heat shock at 33°C either 24 hr (wing disc, eye disc) or 12 hr (abdomen) before dissection. Additional mutant backgrounds were pk30/ pk30, and pk-sple14/ pk-sple14. UAS-RNAi-fat (vdrc 9396) or UAS-RNAi-dachs (vdrc 12555) was expressed using nub-Gal4 or C765-Gal4 along with UAS-dcr2.

Immunostaining and fluorescent imaging

Request a detailed protocol

Tissues were fixed in 4% paraformaldehyde in PBS followed by permeabilization in PBS with 1% BSA and 0.1% Triton X-100. Primary antibodies used include rat anti-E-cad (1:200, DSHB), anti-Pros (1:200, DSHB), anti-Elav (1:200, DSHB) and mouse anti-Wg (1:400, DSHB). Secondary antibodies used were labeled with DyLight405, Cy3 or Alexa647 (1:100, Jackson Immuno Research, West Grove, PA); GFP and RFP were detected by autofluorescence. Alexa488-phalloidin (1:10, Life Technologies) was used to stain hairs in pleura. Protein localization in pleura was determined at ∼48 hr after pupal formation. Images were captured on a Leica TCS-SP5 confocal microscope or PerkinElmer Volocity spinning disc confocal microscope.

Plasmid constructs and primers

Request a detailed protocol

Sple was amplified by PCR from pUAST-pksple (Gubb et al., 1999) using forward primer (5’- CTCGAACCACGGCGGCCGCCAACATGAGCAGCCTGTCAACCGGTGGAG -3’) and reverse primer (5’- GTGGTTCGAGGGTACCCGAGATGATGCAGTTCTTGTCCTTG -3’) and cloned using NotI and KpnI sites into pUAST-TM-EGFP:3XFlag (Mao et al., 2009) after removal of TM-EGFP by NotI/KpnI digestion to generate pUAST-sple:3XFLAG. Sple(N) (first 349 amino acids) was amplified by PCR from pUAST-pksple using forward primer (5’- ACTCTGAATAGGGAATTGGGAATTCCAACATGAGCAGCCTGTCAACCGGTG -3’) and reverse primer (5’- GTAGTCGCCTCGAGCCGCGGCCAGCTCATTTGACTCCTGCTGGGCG -3’) and inserted using InFusion cloning kit into pUAST-app:3XFlag2XStop (gift of B. Staley) after removal of TM-EGFP by EcoRI/NotI digestion, to generate pUAST-sple:3XFLAG. Pk was amplified by PCR from pUAST-pkpk (Gubb et al., 1999) using forward primer (5’- ACTCTGAATAGGGAATTGGGAATTCCAACATGGATACCCCAAATCAAATGC -3’) and reverse primer (5’- GTAGTCGCCTCGAGCCGCGGCCAGCGAGATGATGCAGTTCTTGTCC -3’) and inserted using InFusion cloning kit into pUAST-app:3XFlag2XStop after by EcoRI / NotI digestion, to generate pUAST-pk:3XFLAG2XStop.

Co-immunoprecipitation and Western blotting

Request a detailed protocol

Tagged isoforms of Dachs, Ds-ICD, Sple, Sple-N, Pk and GFP (control) were expressed in S2 cells by transient transfection using Effectene of plasmids pUAST-attB-d:V5,His (Mao et al., 2006), pUAST-TM-DS-ICD:FLAG,V5,His (Mao et al., 2009), pUAST-attB-sple:3xFLAG, pUAST-attB-sple(N):3xFLAG-2xStop, pUAST-attB-pk(N):3xFLAG-2xStop, pAc-3XFLAG:GFP (Oh et al., 2009), pAc-GFP:V5 (Feng and Irvine, 2009). Cells were harvested 48 hr after transfection and lysed in RIPA (50 mM Tris-HCl, pH 8.0; 150 mM NaCl; 1% NP-40; 0.5% Sodium deoxycholate; 0.1% SDS; 1 mM EDTA; 1 mM DTT and 10% glycerol, supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail (CalBiochem)). Cell lysates were precleared by incubation in 10 μl Protein-A beads for 2 hr at 4°C and later incubated with 10 μl anti-V5 beads at 4°C overnight for co-immunoprecipitation. Anti-V5 beads were washed four times with RIPA, boiled in Laemmli sample buffer at 100°C for 5 min, and run on SDS-PAGE gels. Western blotting was performed using rabbit anti-V5 (1:5000, Bethyl Labs) and mouse anti-Flag (1:3000 Sigma), and fluorescentconjugated secondary antibodies (Odyssey).

Quantification of polarity

Request a detailed protocol

Polarity vectors were determined manually by estimating the vector of Sple, Pk, or Dachs polarization within a cell, and comparing it to a reference vector. The images analyzed were projections through several confocal sections. Wing discs were examined at mid- to late third instar, eye discs were examined at late third instar, and abdomens were examined at 48 h after puparium formation. Vectors of polarization were determined within scoreable cells. Scoreable cells included single cell clones, and cells within small clones, or irregular portions of larger clones, with unlabeled cells on two or three sides, and for which any GFP observed could be clearly assigned to a single cell. Vectors of polarization were drawn from the center of the cell to the strongest visible accumulation of GFP-tagged proteins. In cases where a broad region of similar intensity was observed, vectors were drawn toward the center of membrane GFP accumulation. Counterstaining with E-cadherin was employed to ensure that all junctions of scored cells were visible in the images. In wing discs, polarity was determined separately in distal, proximal and A-P boundary regions, using Wg and Hh expression as references. The proximal region was defined as cells within 5 cells of the fold at the edge of the wing pouch. The reference vector for the proximal region was a line perpendicular to the tangent of the proximal Wg ring at the point closest to the cell being scored. The A-P boundary region was defined as cells within 5 cell diameters anterior to the edge of Hh expression. The reference vector for the A-P boundary region was a line drawn parallel to the A-P boundary. The distal region was defined as cells within the wing pouch, excluding the proximal and A-P boundary regions, and also limited to the central three quarters of the D-V Wg stripe (Figure 2I). Cells overlapping the D-V boundary were excluded from analysis. The reference vector for the distal region was a line perpendicular the D-V boundary Wg stripe. In eye discs, the reference vector was a line parallel to the tangent of the morphogenetic furrow (the poles of the eye disc, where the morphogenetic furrow is not perpendicular to the equator, were not analyzed). In the abdomen, the reference vector was a line perpendicular to the A-P compartment boundaries. Cells in different regions were scored separately as indicated in the figure legends, based on observed regional differences in polarity in certain genotypes. In all tissues, the angle between the vector of polarization and the reference vector was calculated using ImageJ, and rose plots summarizing the distribution of angles were generated using Matlab.


    1. Chae J
    2. Kim MJ
    3. Goo JH
    4. Collier S
    5. Gubb D
    6. Charlton J
    7. Adler PN
    8. Park WJ
    The drosophila tissue polarity gene starry night encodes a member of the protocadherin family
    Development 126:5421–5429.
    1. Feng Y
    2. Irvine KD
    (2007) Fat and expanded act in parallel to regulate growth through warts
    Proceedings of the National Academy of Sciences of the United States of America 104:20362–20367.
    1. Feng Y
    2. Irvine KD
    (2009) Processing and phosphorylation of the fat receptor
    Proceedings of the National Academy of Sciences of the United States of America 106:11989–11994.
    1. Struhl G
    2. Barbash DA
    3. Lawrence PA
    Hedgehog organises the pattern and polarity of epidermal cells in the drosophila abdomen
    Development 124:2143–2154.
    1. Tomlinson A
    2. Struhl G
    Decoding vectorial information from a gradient: sequential roles of the receptors frizzled and notch in establishing planar polarity in the drosophila eye
    Development 126:5725–5738.

Decision letter

  1. Jeremy Nathans
    Reviewing Editor; Howard Hughes Medical Institute, Johns Hopkins University School of Medicine, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your work entitled ‘Coordination of planar cell polarity pathways through Spiny legs’ for peer review at eLife. Your submission has been favorably evaluated by Fiona Watt (Senior Editor), Jeremy Nathans (Reviewing Editor), and three reviewers.

The reviewers have discussed the reviews with one another and the Reviewing editor has drafted this decision to help you prepare a revised submission.

All of the reviewers were impressed with the importance and novelty of your work. We are including the three reviews at the end of this letter, as there are multiple specific comments in them that will not be repeated in the summary here. These comments focus on a set of technical issues including the strains used, how the tissue was scored, and the consistency of phenotypes. As is the style at eLife, there was a discussion among the reviewers regarding the various points raised in the primary reviewers. At the risk of burdening you with excessive feedback, we have appended a somewhat truncated version of that discussion after the reviews.

While this is not the typical eLife style, we think the high quality of the feedback justifies giving it to you in largely unedited form.

Reviewer #1: The results presented here make a valuable addition to the field. Some of it repeats findings from Ayukawa et al., and I find myself wishing there was a bit more discussion of the similarities and contrasts in the Discussion section, rather than limiting these to the Results. I also thought that some of the quotations were a bit incomplete (see below). However, there is clearly enough new data here to be worth publishing, with a few revisions.

The weak co-IP that Ayukawa find to Pk is probably worth mentioning in the Discussion, even if the authors do not see it in their conditions, as it could be part of a Sple-independent mechanism.

Another result of Ayukawa's this is worth discussing is the improvement of sple overexpression PCP defects in a ds or fat knockdown. Shouldn't the plentiful and now-randomized Dachs still be misdirecting Sple? Why does this weaken the phenotype?

The hypothesis that inappropriate accumulation of Dachs, and thus inappropriate coupling to the core pathway, was part of the fat mutant PCP phenotype, was I think first proposed in Blair's 2014 Dispatch. I wonder if it quite works, however, to explain the rescuing effects of unpatterned Fat-Ds in the wing, as the current manuscript proposes, in light of Matakatsu and Blair 2012. They showed Fat constructs that rescued Hippo signaling, and thus presumably rescued heightened Dachs accumulation, but that did a rather poor job rescuing PCP. They also had constructs that did not rescue Hippo, and these did a much better job improving abdominal PCP.

Specific notes:


The statements do not make it clear that Ayukawa did see co-IP between Ds and Sple-N. Ayukawa also went a bit further, and showed that binding depended on the very N terminus, and was to a middle region of the Ds ICD.

Reduced junction accumulation of Ds in Fat mutants – the authors should also reference Strutt and Strutt 2002, and Ma et al. 2003.

The partial rescue of fat mutant abdominal PCP defects by loss of dachs has already been published in Mao et al. 2006, admittedly not in the detail presented here. Similarly, improvement of ds mutant wing PCP defects by loss of dachs was in Brittle et al. 2012.

Since dachs loss will affect both Sple and the Hippo pathway, can the authors show that the dachs fat effect on wing PCP is different than the rescue of fat PCP achieved by increasing Hippo pathway activity in fat mutants, as claimed in Feng and Irvine, 2007?

"Thus, behind the morphogenetic furrows…" Strictly speaking, the authors have shown that protein polarization depends on Ds, Ft or Sple, but not that these direct it. To do that, they would have to change their levels or, better, repolarize them. They have also not shown that these effects depend on the Ds ICD.

Methods and figures:

The Methods say far too little about how polarity was measured in clones with tagged proteins, only that it was manual’ and used ImageJ. What was being measured, and how did that translate into the rose plots? Was there an assessment of the intensity of polarization in a clone, or just a direction for each clone? How was that determined and quantified? Did this assessment only use cell faces at clone boundaries, or internal cell faces? Did it adjust for the shapes of the cells and clones, and thus the amount of membrane in each quadrant? Since proximal and distal cell faces can be at slightly different focal planes due the folding of the pouch, was more than one confocal slice used for the image?

And two anatomical questions for the wing disc results: By ‘distal’ and ‘proximal’, do the authors mean the distal tip, or the prospective wing margin? Second, did they have any objective landmarks for separating proximal from distal portions of the wing pouch? The fate map can be a bit tricky if they are only using the fold, as the tissue close to the fold can change depending on the stage of eversion, especially near the AP boundary. One could always try using the identifiable sensory organ precursors along the third vein. It would be helpful to know where this actually maps to in an adult wing.

Reviewer #2: The manuscript by Ambeganokar and Irvine addressed how two different pathways that regulate planar cell polarity in Drosophila are coordinated. Recent work by a number of groups has implicated pk/sple as being a key in coupling these two pathways and this current manuscript adds to this emerging story. There are several valuable insights that come from this manuscript. A key finding is that Sple can interact physically with both Dachs and Ds. The authors provide a new way to view several issues. They describe a series of genetic experiments that show that Dachs mediates the localization of Sple in wing cells and that in regions where Ds is highly expressed it can independently direct the localization of Sple. They provide evidence for an alternative model for the ds/ft wing hair phenotype where this is viewed as a consequence of inappropriate dachs localization which results in altered accumulation of Sple which can in turn interfere with Pk function. The paper also provides an explanation for several puzzling results from the literature: the ‘rectification’ of the relationship between fz and ds/ft and for the ability of the uniform Ds expression to rescue the hair polarity of ds fj mutants. They also describe some interesting new observations that have been missed by others (e.g. that Pk localization is not proximal in all regions of the wing) even if the significance of the observation is unclear.

Specific comments:

In the subsection ‘Control of Sple polarity in eye discs by Ds-Fat PCP’, Figure 5. It is not clear to me how the authors conclude that the Sple in panel A (left side) is in R4 and in panel D (right side) R3.

Figure 5—figure supplement 2. I did not find this figure to be convincing (particularly B).

Figures 7, 9. The location of the spiracle allows the authors to determine the middle of the A compartment in the pleura but it is not clear to me how they determine where the AP boundary is. Are they counting cells?

In the subsection ‘Competition between polarizing cues’, the authors argue that the previous pk/sple balance model is not supported by the data and that a competition model is preferable. I agree with the conclusion that we should now think about the pk/sple interaction as a competition but I see that as providing a mechanism for the balance model.

Reviewer #3: In this manuscript, Ambegaonkar et al. address the function of the Core PCP Pk/Sple locus in regulating the coupling between the Fat and Core PCP systems.

Earlier work had suggested that Pk and Sple isoforms influence the coupling of the Core PCP and Fat PCP systems. While Sple enforces coupling such that Vang and Ds/Dachs are on the same side of the cell, Pk allows coupling in the opposite orientation or even complete uncoupling of Core and Fat polarity, allowing Core PCP to respond to other orienting cues. Biochemical experiments had suggested that Sple interacts directly with Dachs. These questions had been most thoroughly explored in the wing, but less was known about coupling of Core and Fat PCP in other tissues like the eye and anterior abdomen where Sple function is more important.

The current manuscript from Ambegaonkar et al. now extends these studies to the eye and abdomen. It also reveals a second interaction between Sple and Dachsous, and shows that Sple is influenced by Dachs and Ds in different places. The authors map the localization of Pk and Sple in the wing disc, eye disc and pupal abdomen by generating clones of fluorescently tagged Pk and Sple isoforms that are over-expressed under the control of the actin promoter. They examine how perturbations of Fat system components influence the localization of PkGFP and Sple:GFP, and correlate these with polarity phenotypes. Their data show that PkGFP and Sple:GFP clones have opposite polarity in wing discs and posterior abdomen (where Pk normally dominates), but the same polarity in eye discs posterior to the furrow and the anterior abdomen (where Sple normally dominates). This is an intriguing correlation, but the authors data do not explore or clarify why Pk and Sple localize together in some tissues and oppositely in others. Their data generally confirm the idea that the Fat system orients Sple in the eye disc and wing disc, but the data in the abdomen are very confusing and no clear model emerges for the orientation Sple or Pk here.

In general, I think some of the confusion may stem from the clones used to map Sple and Pk polarity, and from the unusual organization of the abdomen – here Sple and Pk-dependent regions are directly opposed to one another. There are several experiments the authors could do to resolve this confusion that should be possible within the time frame of a revision.

Pk and Sple polarity:

Throughout the, the authors map Pk and Sple polarity using flip out clones of GFP tagged Pk or Sple that are over-expressed under the control of the actin promoter. They use these constructs to deduce the localization of these proteins even in tissues where the particular isoform in question is expressed at much lower levels than the other – for example they use GFP-Sple clones to make conclusions about Sple localization in the wing disc even though endogenous levels are hardly detectable – in any case much lower than Pk. But given the feedback mechanisms that lead to polarized formation of Core PCP domains, and the fact that these proteins are overexpressed, this may not reflect the endogenous localization. What I mean is that the very small amount of Sple that is normally present in the wing disc might ordinarily be incorporated into proximal Core complexes that are oriented by the much larger amounts of Pk and the cues read by Pk. The distal localization of Sple in the wing disc (as visualized by actin promoter-driven over-expression of Sple:GFP) could result from Core PCP reversal caused by Sple over-expression. They conclude that wing cells normally have Pk on one side and Sple on the other, but this may not be true at endogenous levels.

To rule this out, the authors should stain for other Core PCP components to be sure that these Sple:GFP clones do not disturb the polarity field, and look at adult flies to make sure these clones don't cause polarity defects.

If Sple:GFP really localizes proximally in the wing without otherwise disturbing the polarity of Core PCP domains, it would suggest that Sple (unlike Pk) doesn't need other Core PCP proteins to localize to the membrane – not unreasonable if Sple interacts with Ds and Dachs. This would be easy to show by visualizing Sple in the background of fz or vang mutants – if it is localized by Ds and Dachs, it should still be found on the proximal side of cells in the wing.

Studies in the abdomen:

No clear conclusions emerge from the studies on the abdomen. It is puzzling that dachs mutation suppresses mislocalization of Sple caused by loss of fat or ds in the anterior abdomen. If Sple is normally oriented by ds or dachs, where does the information now come from? Furthermore, in the Discussion, the authors say that Fat-Ds signaling modulates Sple but not Pk localization. However their data in the posterior compartment of the abdomen seem to suggest that Pk can also read cues provided by the Fat PCP system (but somehow with the opposite polarity as Sple). There are no identified physical interations between Pk and Fat components and why it should be oriented in this way by Fat PCP in the posterior abdomen but not the anterior abdomen or eye is puzzling. Furthermore, this must not always be true because sometimes Pk is oriented completely orthogonally to Fat PCP (in the pupal wing and in the eye disc before the furrow passes.

The abdomen is complex because two regions with different requirements for Pk and Sple lie directly adjacent to one another. Domineering non-autonomous effects of Core PCP likely propagate over some distance through these regions and rescue (or disrupt) Core PCP domain polarity and hair polarity in other regions. This could mask where specific Fat and Core components are actually needed. This could explain why removing Dachs suppresses the polarity defects caused by Fat or Ds mutation in the anterior abdomen – once all signals from Fat PCP are gone, then correct Core polarity, propagating in to the anterior compartment from the posterior compartment, could correctly orient Sple and hair polarity. A similar mechanism might explain why Pk localization in the posterior is disturbed by loss of Fat system components – i.e. Sple-dependent alterations of Core polarity in the anterior are propagating via Core PCP interactions into the posterior.

To clarify this, the authors should target RNAi of PCP components to specific subregions of the abdomen to find out where their effects are direct and where they occur as a consequence of domineering non-autonomy.

More specific comments:

1) The authors cite both Hogan et al. and Merkel et al. as saying that there is an early phase of polarity establishment in the wing where Sple is reading a Fat/Ds-dependent signal. But the Merkel et al. paper actually says the opposite – this paper shows that loss of Sple has no consequences for Core PCP orientation in the wing until very late after hair formation when the ridge pattern is generated. The idea that Sple has an early role was based on over-expression experiments.

2) The cartoon in Figure 1 suggests a proximal distal orientation of the Fat PCP system in the pupal wing, but this is not the case. Four-jointed is expressed around the whole margin and Ds is elevated at the AP boundary as well as the hinge – the polarity pattern of the domains themselves is first radial and then AP oriented in pupal wings. Since the data they show in Figure 1C–G pertain to the wing disc not the pupal wing, maybe it would be better to show a cartoon of the Fat PCP pattern in the wing disc where it is quite different.

3) In Figure 4B, the authors should quantify the hair polarity phenotypes indicating suppression of the fat mutant by sple – a single example is not enough.

4) In Figure 6, the authors should indicate the anterior posterior axis on the images. Also, it is important to show wild type polarity rose diagrams with the same breakdown into Af, Am and Ab or A, A* and P as they show for the mutants.

5) In the Discussion, I think the authors are making what seems to be a semantic distinction between a ‘balance’ of Pk and Sple (as suggested originally by David Gubb) and ‘competition’ between Pk and Sple supported by their results. The conclusions are really the same – that Pk and Sple antagonize each other and that phenotypic disturbances when one isoform is lost are caused by inappropriate (or unbalanced) activity of the other.

Additional discussion comments:

I would have liked to see more discussion of the similarities and differences between the current manuscript and Ayukawa. Of course it is possible that they do not have any substantial insights into the differences – if so additional comments might not be valuable.

I also agree the manuscript would be substantially improved by a more detailed discussion of how they measured polarity. A supplemental figure showing an example would be good.

The Strutt et al. paper that describes the Sple:GFP and PkGFP constructs shows that they do disrupt polarity when expressed uniformly in the inappropriate tissues. The Sple:GFP construct causes a pk-like wing hair orientation pattern, and the PkGFP construct disturbs omatidial polarity in the eye. I would be surprised if the situation were different in the clones used in this paper, and I think it is essential to check the polarity around these clones. In any case, I think it will be hard to argue that Sple would localize proximally when expressed at endogenous levels in a tissue that is dominated by Pk. The reverse isn't as much of a problem – even though PkGFP is over-expressed in clones, it still generally colocalizes with Sple in the eye and anterior abdomen where Sple dominates. This makes it a very interesting question why PkGFP expression causes polarity defects in the eye as reported by Strutt et al. It would seem to suggest that some function of Pk itself, rather than reversal of Core PCP domains, is responsible for Pk over-expression defects in the eye – what do you guys think?

I do also think it is important to target knockdown of different Fat pathway components to specific abdominal regions. At the moment, the results of these experiments are confusing and inconsistent with the results from other tissues – no clear model can be drawn from them. Of course sometimes that's just the way life is, but non-autonomous effects would be a trivial explanation for these discrepancies and I think they should be ruled out so as not to confuse the field needlessly.

I agree that they need to test the effects of the flip-outs.

As for the confusing nature of the abdomen, they do provide some possible hypotheses in the Results. In the case of the anterior, Reviewer 3 was asking what supplied the information for normal Sple polarity in the ds dachs double. The manuscript opines that it could be whatever localizes Pk, presumable meaning some part of the core system, since Pk is pretty normal. Or I suppose one could invoke Pk-Sple binding. They hypothesized both to explain proximal Sple in ds dachs double mutant wings, so it is pretty much the same idea here.

The sensitivity of Pk to ds or dachs removal in the posterior is bit more confusing, as I think they admit. What they suggest is that, in absence of Ds cues, now Pk becomes sensitive to Sple and follows mislocalized Sple. It could be explained a bit better, as the molecular interactions of Dachs and Ds are with Sple; I guess this unbound Sple is now more attractive to Pk? Or we could invoke the weak Pk-Dachs binding of Ayukawa, but it would have to be binding that mediate repulsion or destruction, to get anterior Pk and posterior Dachs.

At any rate, they did not look at Pk localization in a ds sple or dachs sple double, if they are really trying to support this idea. And if we're being complete, they must know what happens to Sple in a ds dachs double in the posterior. If Sple gets strongly reversed like it does in ds dachs wing, I'm not sure it can account for the Pk mislocalization they note in a ds dachs double.

On the other hand, I would bet in a ds or fat mutant wing that, if you waited long enough, you would get misorientation of Pk polarization, just like you do of the other core polarity proteins in a 28–32 hr AP wing. What stage of abdomen were they looking at, and how long before hair formation?

I have to agree that about the need for examining the polarity around the clones. I think that rises to the level of essential. It is hard to imagine that they did not at least look at adult wings for polarity phenotypes.


Author response

Reviewer #1:

The results presented here make a valuable addition to the field. Some of it repeats findings from Ayukawa et al., and I find myself wishing there was a bit more discussion of the similarities and contrasts in the Discussion section, rather than limiting these to the Results. I also thought that some of the quotations were a bit incomplete (see below). However, there is clearly enough new data here to be worth publishing, with a few revisions. The weak co-IP that Ayukawa find to Pk is probably worth mentioning in the Discussion, even if the authors do not see it in their conditions, as it could be part of a Sple-independent mechanism. As we were unable to detect this interaction (and think it is most likely an artefact of non-specific association rather than a real interaction), we don't have anything further to say beyond noting, as we do, that this is a difference between our results and those of Ayukawa et al.

Another result of Ayukawa's this is worth discussing is the improvement of sple overexpression PCP defects in a ds or fat knockdown. Shouldn't the plentiful and now-randomized Dachs still be misdirecting Sple? Why does this weaken the phenotype?

Sple over-expression results in a reversal of polarity. According to our results and model, this is because Sple is localized by Dachs. In otherwise wild-type wings, Dachs directs this over-expressed Sple to the distal sides of cells, reversing polarity. Upon fat or ds knockdown, Dachs is now uniform. Hence, co-localization of Sple with Dachs no longer specifies a reversal of polarity, and this phenotype is suppressed. Whether this should lead back to normal polarity (Sple gives no net directional cue, but Pk does, hence cells follow the Pk cue) or randomized polarity (Sple is on all sides of cells, and cells follow the Sple cue because its over-expressed) depends upon how cells resolve this situation – we would have predicted the latter, but it’s possible that it’s the former. The Ayukawa et al. paper only actually shows the polarity in a very small region in the center of the wing (boxed region in their Figure 3B) so it’s actually not clear what the overall result is here, and hence it’s difficult for us to discuss.

The hypothesis that inappropriate accumulation of Dachs, and thus inappropriate coupling to the core pathway, was part of the fat mutant PCP phenotype, was I think first proposed in Blair's 2014 Dispatch.

Thank you for pointing this out, we now cite this review in the Discussion of the revised manuscript.

I wonder if it quite works, however, to explain the rescuing effects of unpatterned Fat-Ds in the wing, as the current manuscript proposes, in light of Matakatsu and Blair 2012. They showed Fat constructs that rescued Hippo signaling, and thus presumably rescued heightened Dachs accumulation, but that did a rather poor job rescuing PCP. They also had constructs that did not rescue Hippo, and these did a much better job improving abdominal PCP.

We have also identified Fat constructs that preferentially rescue Hippo or PCP signaling (Pan et al. 2013). In our case, we found that this correlated with whether these regions primarily affected polarization of Dachs, or levels of Dachs, consistent with our earlier studies arguing that Hippo is sensitive to the total amount of Dachs on membranes, whereas PCP is sensitive to the direction of Dachs polarization. Matakatsu and Blair 2012 did not examine Dachs localization, without knowing this, it is not possible to make firm conclusions regarding the role of Dachs in the phenotypes of their constructs. Nonetheless, based on our understanding of how Dachs works in Hippo versus PCP signaling, there is no indication that their study is inconsistent with the results and model we present here.

Specific notes: Results:The statements do not make it clear that Ayukawa did see co-IP between Ds and Sple-N. Ayukawa also went a bit further, and showed that binding depended on the very N terminus, and was to a middle region of the Ds ICD.

We revised the text to note their detection of interaction between Sple-N and Ds-ICD.

Reduced junction accumulation of Ds in Fat mutants – the authors should also reference Strutt and Strutt 2002, and Ma et al. 2003.

Thank you for pointing this out, we revised manuscript to include these citations.

The partial rescue of fat mutant abdominal PCP defects by loss of dachs has already been published in Mao et al. 2006, admittedly not in the detail presented here.

This was already cited in the text (subsection ‘Interactions between PCP pathways in the abdomen’, fourth paragraph).

Similarly, improvement of ds mutant wing PCP defects by loss of dachs was in Brittle et al. 2012.

Thank you for pointing this out, we now cite this in the revised manuscript.

Since dachs loss will affect both Sple and the Hippo pathway, can the authors show that the dachsfat effect on wing PCP is different than the rescue of fat PCP achieved by increasing Hippo pathway activity in fat mutants, as claimed in Feng and Irvine, 2007?

Yes, the effect is different. dachs efficiently suppresses both Fat-PCP phenotypes and Fat-Hippo phenotypes. Warts over-expression (as in Feng and Irvine 2007) efficiently suppresses Hippo phenotypes, but these animals still have PCP phenotypes. We now note this in the text and added an example of the wing hair PCP phenotype to the revised manuscript (Figure 4—figure supplement 1).

"Thus, behind the morphogenetic furrows…" Strictly speaking, the authors have shown that protein polarization depends on Ds, Ft or Sple, but not that these direct it. To do that, they would have to change their levels or, better, repolarize them. They have also not shown that these effects depend on the Ds ICD.

Agreed, we showed the phenotypes of loss-of-function mutations, and we revised the text accordingly. For the revised manuscript, we attempted to examine the influence of ectopic Ds on Sple localization, however, were unable to do so with available reagents because the frequency of GFP:Sple flip-out was much greater than the frequency of Ds flip-out.

Methods and figures:The Methods say far too little about how polarity was measured in clones with tagged proteins, only that it was ‘manual’ and used ImageJ.

We extended Methods in the revised manuscript, which addresses all the questions raised below.

What was being measured, and how did that translate into the rose plots?

The intensity of membrane localization of GFP tagged proteins was examined. When membrane accumulation was restricted to one side of a cell, the center of the membrane accumulation was taken as the direction, and this direction was compared to tissue coordinates, as described in the revised Methods. We note that the original text incorrectly referred to the polarity of clones – polarity was actually assessed within individual cells.

Was there an assessment of the intensity of polarization in a clone, or just a direction for each clone?

Just direction.

How was that determined and quantified? Did this assessment only use cell faces at clone boundaries, or internal cell faces?

The intensity of membrane localization was examined. When membrane accumulation was restricted to one side of a cell, the center of the membrane accumulation was taken as the direction, and this direction was compared to a reference vector as described in the revised Methods.

Did it adjust for the shapes of the cells and clones, and thus the amount of membrane in each quadrant?

The direction of polarization was estimated without regard to the sizes or shapes of clones and cells.

Since proximal and distal cell faces can be at slightly different focal planes due the folding of the pouch, was more than one confocal slice used for the image?

Yes, multiple confocal slices were combined, and E-cadherin staining was used as a reference to make sure that all sides of a cell were contained within all cells scored.

And two anatomical questions for the wing disc results: By ‘distal’ and ‘proximal’, do the authors mean the distal tip, or the prospective wing margin?

As clarified in the revised Methods, within the distal wing, wing margin was used as a reference, because the analysis was limited to regions in which the Fj and Ds gradients are essentially perpendicular to the D-V boundary. Within the proximal wing, proximal wingless expression, which encircles the wing pouch, was used as a reference.

Second, did they have any objective landmarks for separating proximal from distal portions of the wing pouch? The fate map can be a bit tricky if they are only using the fold, as the tissue close to the fold can change depending on the stage of eversion, especially near the AP boundary. One could always try using the identifiable sensory organ precursors along the third vein. It would be helpful to know where this actually maps to in an adult wing.

As noted in the Methods, we used the fold at the edge of the wing pouch as a marker, and defined proximal as within 5 cells of the fold. Our analysis was conducted in larval wing discs, before disc eversion. The L3 SOP marker would only provide a point of reference in a tiny portion of the disc, and only at late third instar, and adding it as a marker would require repeating an enormous amount of work, without affecting the conclusions of our study, so we have not done this.

Reviewer #2:

The manuscript by Ambeganokar and Irvine addressed how two different pathways that regulate planar cell polarity in Drosophila are coordinated. Recent work by a number of groups has implicated pk/sple as being a key in coupling these two pathways and this current manuscript adds to this emerging story. There are several valuable insights that come from this manuscript. A key finding is that Sple can interact physically with both Dachs and Ds. The authors provide a new way to view several issues. They describe a series of genetic experiments that show that Dachs mediates the localization of Sple in wing cells and that in regions where Ds is highly expressed it can independently direct the localization of Sple. They provide evidence for an alternative model for the ds/ft wing hair phenotype where this is viewed as a consequence of inappropriate dachs localization which results in altered accumulation of Sple which can in turn interfere with Pk function. The paper also provides an explanation for several puzzling results from the literature: the ‘rectification’ of the relationship between fz and ds/ft and for the ability of the uniform Ds expression to rescue the hair polarity of dsfj mutants. They also describe some interesting new observations that have been missed by others (e.g. that Pk localization is not proximal in all regions of the wing) even if the significance of the observation is unclear. Specific comments: In the subsection ‘Control of Sple polarity in eye discs by Ds-Fat PCP’, Figure 5. It is not clear to me how the authors conclude that the Sple in panel A (left side) is in R4 and in panel D (right side) R3.

There is a very faint cytoplasmic stain that does not show up in the images but can be detected if the intensity of the green channel is increased. We only scored cells in which GFP:Sple was expressed only in R3 or only in R4.

Figure 5—figure supplement 2. I did not find this figure to be convincing (particularly B). We replaced these panels with different examples for the revised manuscript.

Figures 7 and 9. The location of the spiracle allows the authors to determine the middle of the A compartment in the pleura but it is not clear to me how they determine where the AP boundary is. Are they counting cells?

Within the tergites, we can determine this by the location and size of hairs. Within the pleura, we can only roughly estimate the location of the A-P boundary, based on comparison to the adjacent tergites (which are present in the original pictures, but mostly cropped out of these panels). We revised the text to point this out.

In the subsection ‘Competition between polarizing cues’, the authors argue that the previous pk/sple balance model is not supported by the data and that a competition model is preferable. I agree with the conclusion that we should now think about the pk/sple interaction as a competition but I see that as providing a mechanism for the balance model.

We have tried to make this distinction because a requirement for a ‘balance’ implies that you require some of each isoform. While this is true in the fly as a whole, we argue that individual cells only ever require 1 of the isoforms, and that in many places the two isoforms provide distinct, competing, polarity cues, which is conceptually distinct from a requirement for a ‘balance’.

Reviewer #3:

In this manuscript, Ambegaonkar et al. address the function of the Core PCP Pk/Sple locus in regulating the coupling between the Fat and Core PCP systems.

Earlier work had suggested that Pk and Sple isoforms influence the coupling of the Core PCP and Fat PCP systems. While Sple enforces coupling such that Vang and Ds/Dachs are on the same side of the cell, Pk allows coupling in the opposite orientation or even complete uncoupling of Core and Fat polarity, allowing Core PCP to respond to other orienting cues. Biochemical experiments had suggested that Sple interacts directly with Dachs. These questions had been most thoroughly explored in the wing, but less was known about coupling of Core and Fat PCP in other tissues like the eye and anterior abdomen where Sple function is more important.

The current manuscript from Ambegaonkar et al. now extends these studies to the eye and abdomen. It also reveals a second interaction between Sple and Dachsous, and shows that Sple is influenced by Dachs and Ds in different places.

The authors map the localization of Pk and Sple in the wing disc, eye disc and pupal abdomen by generating clones of fluorescently tagged Pk and Sple isoforms that are over-expressed under the control of the actin promoter. They examine how perturbations of Fat system components influence the localization of PkGFP and Sple:GFP, and correlate these with polarity phenotypes. Their data show that PkGFP and Sple:GFP clones have opposite polarity in wing discs and posterior abdomen (where Pk normally dominates), but the same polarity in eye discs posterior to the furrow and the anterior abdomen (where Sple normally dominates). This is an intriguing correlation, but the authors data do not explore or clarify why Pk and Sple localize together in some tissues and oppositely in others. Their data generally confirm the idea that the Fat system orients Sple in the eye disc and wing disc, but the data in the abdomen are very confusing and no clear model emerges for the orientation Sple or Pk here. In general, I think some of the confusion may stem from the clones used to map Sple and Pk polarity, and from the unusual organization of the abdomen – here Sple and Pk-dependent regions are directly opposed to one another. There are several experiments the authors could do to resolve this confusion that should be possible within the time frame of a revision. Pk and Sple polarity:Throughout the, the authors map Pk and Sple polarity using flip out clones of GFP tagged Pk or Sple that are over-expressed under the control of the actin promoter. They use these constructs to deduce the localization of these proteins even in tissues where the particular isoform in question is expressed at much lower levels than the other – for example they use GFP-Sple clones to make conclusions about Sple localization in the wing disc even though endogenous levels are hardly detectable – in any case much lower than Pk. But given the feedback mechanisms that lead to polarized formation of Core PCP domains, and the fact that these proteins are overexpressed, this may not reflect the endogenous localization. What I mean is that the very small amount of Sple that is normally present in the wing disc might ordinarily be incorporated into proximal Core complexes that are oriented by the much larger amounts of Pk and the cues read by Pk. The distal localization of Sple in the wing disc (as visualized by actin promoter-driven over-expression of Sple:GFP) could result from Core PCP reversal caused by Sple over-expression. They conclude that wing cells normally have Pk on one side and Sple on the other, but this may not be true at endogenous levels.

We think it possible, as the reviewer suggests, that in wild-type wing discs, endogenous Sple is co-localized proximally with Pk and other Fz-PCP proteins. Our view is that PCP is regulated by competing cues, but due to the feedback processes that are intrinsic to PCP systems, normally one cue ‘wins’ and any Pk (and possibly most Sple as well) will co-localize at one side of the cell. What clones (over-)expressing GFP tagged proteins tell us then, is the cues that a particular isoform sees and responds to when it is the predominant isoform in that tissue. We revised the text to comment on this in the Discussion. We further note that antisera that specifically recognize Pk or Sple were reported by David Gubb, and we obtained some of this sera, but he told us that they are unable to recognize endogenously expressed proteins by immunostaining, they can only detect over-expressed proteins, and this was also true in our hands. Moreover, it is usually not possible to define polarization without clonal expression of tagged proteins.

To rule this out, the authors should stain for other Core PCP components to be sure that these Sple:GFP clones do not disturb the polarity field, and look at adult flies to make sure these clones don't cause polarity defects.

If Sple:GFP really localizes proximally in the wing without otherwise disturbing the polarity of Core PCP domains, it would suggest that Sple (unlike Pk) doesn't need other Core PCP proteins to localize to the membrane – not unreasonable if Sple interacts with Ds and Dachs. This would be easy to show by visualizing Sple in the background of fz or vang mutants – if it is localized by Ds and Dachs, it should still be found on the proximal side of cells in the wing.

It has already been reported by others that over-expressed Sple disturbs wing polarity, and we have confirmed for the revised manuscript that polarity defects are observed in our hands when GFP:Sple is expressed (Figure 4–figure supplement 1).

We also expect though, that Sple does not necessarily need other Fz-PCP proteins to localize to the membrane, as its distal localization could be directed by Dachs and Ds. For the revised manuscript, we preformed the requested experiment of examining GFP:Sple in a vang mutant. The results (Figure 3G) show that Sple is still preferentially distal. We also see a relative increase in the cytoplasmic staining for Sple, consistent with published studies describing the influence of Vang (Stbm) on Pk.

Studies in the abdomen:No clear conclusions emerge from the studies on the abdomen. It is puzzling that dachs mutation suppresses mislocalization of Sple caused by loss of fat or ds in the anterior abdomen. If Sple is normally oriented by ds or dachs, where does the information now come from?

We agree that there are aspects of the results in the abdomen that we cannot explain based on our present understanding of the components and their interactions. The most likely explanation for how Sple is localized in ds dachs mutants is that Sple responds under these circumstances to the same cues that localize Pk, which localizes anteriorly in fat or ds mutants as well as fat dachs or ds dachs double mutants. The question then becomes what localizes Pk (and/or other Fz-PCP components). One answer could be Hedgehog (whose effects have been characterized by Struhl, Lawrence, and Casal), but this could not explain polarity across the whole A compartment, as the Hedgehog gradient flips in the middle. Indeed we think that the flip in polarity in the A compartment in sple or pk sple mutants could be due to the Fz-PCP pathway becoming directed by the Hh gradient in the absence of Sple. So why doesn’t this happen in ds dachs, and what directs polarity in this genotype? We are not sure, but it’s possible as the reviewer suggests below that propagation of polarity between compartments plays a role.

Furthermore, in the Discussion, the authors say that Fat-Ds signaling modulates Sple but not Pk localization. However their data in the posterior compartment of the abdomen seem to suggest that Pk can also read cues provided by the Fat PCP system (but somehow with the opposite polarity as Sple). There are no identified physical interations between Pk and Fat components and why it should be oriented in this way by Fat PCP in the posterior abdomen but not the anterior abdomen or eye is puzzling. Furthermore, this must not always be true because sometimes Pk is oriented completely orthogonally to Fat PCP (in the pupal wing and in the eye disc before the furrow passes.

The abdomen is complex because two regions with different requirements for Pk and Sple lie directly adjacent to one another. Domineering non-autonomous effects of Core PCP likely propagate over some distance through these regions and rescue (or disrupt) Core PCP domain polarity and hair polarity in other regions. This could mask where specific Fat and Core components are actually needed. This could explain why removing Dachs suppresses the polarity defects caused by Fat or Ds mutation in the anterior abdomen – once all signals from Fat PCP are gone, then correct Core polarity, propagating in to the anterior compartment from the posterior compartment, could correctly orient Sple and hair polarity. A similar mechanism might explain why Pk localization in the posterior is disturbed by loss of Fat system components – i.e. Sple-dependent alterations of Core polarity in the anterior are propagating via Core PCP interactions into the posterior.

To clarify this, the authors should target RNAi of PCP components to specific subregions of the abdomen to find out where their effects are direct and where they occur as a consequence of domineering non-autonomy.

We agree that propagation (‘domineering non-autonomy’) of PCP between compartments could potentially influence some of the phenotypes observed (e.g. boundaries of where we see polarity phenotypes often don’t correspond to compartment boundaries). We have attempted over the past two months to perform compartment-specific RNAi as suggested, but have encountered a series of technical difficulties, and found that they are currently not feasible. What we have done instead is to add some text to the Discussion to comment on the establishment of PCP in the abdomen and mention the potential for propagation of polarity between compartments to influence the results.

More specific comments:1) The authors cite both Hogan et al. and Merkel et al. as saying that there is an early phase of polarity establishment in the wing where Sple is reading a Fat/Ds-dependent signal. But the Merkel et al. paper actually says the opposite – this paper shows that loss of Sple has no consequences for Core PCP orientation in the wing until very late after hair formation when the ridge pattern is generated. The idea that Sple has an early role was based on over-expression experiments.

Agreed, we have revised the text here.

2) The cartoon in Figure 1 suggests a proximal distal orientation of the Fat PCP system in the pupal wing, but this is not the case. Four-jointed is expressed around the whole margin and Ds is elevated at the AP boundary as well as the hinge – the polarity pattern of the domains themselves is first radial and then AP oriented in pupal wings. Since the data they show in Figure 1C–G pertain to the wing disc not the pupal wing, maybe it would be better to show a cartoon of the Fat PCP pattern in the wing disc where it is quite different.

Agreed, our cartoon here ignored the more complex and dynamic patterns in the pupal wing, so as suggested we replaced this with a cartoon of the wing disc.

3) In Figure 4B, the authors should quantify the hair polarity phenotypes indicating suppression of the fat mutant by sple – a single example is not enough.

We now include this in the Figure 4 legend.

4) In Figure 6, the authors should indicate the anterior posterior axis on the images. Also, it is important to show wild type polarity rose diagrams with the same breakdown into Af, Am and Ab or A, A* and P as they show for the mutants.

We have made these suggested changes to the revised manuscript (Figure 6 and supplements).

5) In the Discussion, I think the authors are making what seems to be a semantic distinction between a ‘balance’ of Pk and Sple (as suggested originally by David Gubb) and ‘competition’ between Pk and Sple supported by their results. The conclusions are really the same – that Pk and Sple antagonize each other and that phenotypic disturbances when one isoform is lost are caused by inappropriate (or unbalanced) activity of the other.

We agree that the conclusion that they antagonize each other holds, but we think that it is nonetheless an important distinction to make, as a requirement for a ‘balance’ implies that one needs some of each isoform, which is not, as far as we can tell, true for any cell. We revised the text here.

Additional discussion comments: I would have liked to see more discussion of the similarities and differences between the current manuscript and Ayukawa. Of course it is possible that they do not have any substantial insights into the differences – if so additional comments might not be valuable.

We don’t feel that we have much to add beyond noting, as we already do, where our observations agree or disagree with Ayukawa et al.

I also agree the manuscript would be substantially improved by a more detailed discussion of how they measured polarity. A supplemental figure showing an example would be good.

We have revised the Methods to better explain how polarity was assessed. We could add supplemental figures too, but we think it’s not necessary with the improved description.

The Strutt et al. paper that describes the Sple:GFP and PkGFP constructs shows that they do disrupt polarity when expressed uniformly in the inappropriate tissues. The Sple:GFP construct causes a pk-like wing hair orientation pattern, and the PkGFP construct disturbs omatidial polarity in the eye. I would be surprised if the situation were different in the clones used in this paper, and I think it is essential to check the polarity around these clones. In any case, I think it will be hard to argue that Sple would localize proximally when expressed at endogenous levels in a tissue that is dominated by Pk. The reverse isn't as much of a problem – even though PkGFP is over-expressed in clones, it still generally colocalizes with Sple in the eye and anterior abdomen where Sple dominates. This makes it a very interesting question why PkGFP expression causes polarity defects in the eye as reported by Strutt et al. It would seem to suggest that some function of Pk itself, rather than reversal of Core PCP domains, is responsible for Pk over-expression defects in the eye – what do you guys think?

We agree that polarity reversals are expected in clones, as previously observed by Strutt et al. and others. In the revised manuscript, we show that PCP phenotypes are induced in the wing by GFP:Sple-expressing clones. In the eye, in order to score PCP we needed ommatidia in which transgenes were expressed only in R3 or only in R4. This was achieved by examining eye discs only 24 hr after clone induction. We estimate that in these eye discs, GFP:Pk was expressed in or behind the furrow, i.e., when and where it co-localizes with Sple. We hypothesized that disturbance of PCP by Pk might require Pk expression in front of the furrow (where it localizes differently than Sple). To test this idea, we compared PCP in eye discs with clones of cells expressing GFP:Pk for one day, versus 3 days. Indeed, we observed normal PCP with 1 day clones, and abnormal PCP with 3 day clones. These results imply that the timing of Pk over-expression is important in determining whether or not a PCP phenotype is induced, and are included in the revised manuscript (Figure 5—figure supplement 2).

I do also think it is important to target knockdown of different Fat pathway components to specific abdominal regions. At the moment, the results of these experiments are confusing and inconsistent with the results from other tissues – no clear model can be drawn from them. Of course sometimes that's just the way life is, but non-autonomous effects would be a trivial explanation for these discrepancies and I think they should be ruled out so as not to confuse the field needlessly.

As noted above, we attempted these experiments, but unfortunately were unsuccessful. We revised the text to note the possibility of non-autonomous effects.

I agree that they need to test the effects of the flip-outs.

This presumably refers to showing that PCP is disturbed by Flip-out clones expressing Sple and/or Pk? As noted above, we have now added these experiments to the revised manuscript.

As for the confusing nature of the abdomen, they do provide some possible hypotheses in the Results. In the case of the anterior, Reviewer 3 was asking what supplied the information for normal Sple polarity in the dsdachs double. The manuscript opines that it could be whatever localizes Pk, presumable meaning some part of the core system, since Pk is pretty normal. Or I suppose one could invoke Pk-Sple binding. They hypothesized both to explain proximal Sple in ds dachs double mutant wings, so it is pretty much the same idea here. The sensitivity of Pk to ds or dachs removal in the posterior is bit more confusing, as I think they admit. What they suggest is that, in absence of Ds cues, now Pk becomes sensitive to Sple and follows mislocalized Sple. It could be explained a bit better, as the molecular interactions of Dachs and Ds are with Sple; I guess this unbound Sple is now more attractive to Pk? Or we could invoke the weak Pk-Dachs binding of Ayukawa, but it would have to be binding that mediate repulsion or destruction, to get anterior Pk and posterior Dachs. At any rate, they did not look at Pk localization in a ds sple or dachs sple double, if they are really trying to support this idea. And if we're being complete, they must know what happens to Sple in a ds dachs double in the posterior. If Sple gets strongly reversed like it does in ds dachs wing, I'm not sure it can account for the Pk mislocalization they note in a ds dachs double.

Sple is predominantly posteriorly localized in abdominal P compartments of ds dachs mutants, as it is in wild-type (Figures 6H, 8D). For revisions we also examined Pk in dachs sple (Figure 6—figure supplement 1).

On the other hand, I would bet in a ds or fat mutant wing that, if you waited long enough, you would get misorientation of Pk polarization, just like you do of the other core polarity proteins in a 28–32 hr AP wing. What stage of abdomen were they looking at, and how long before hair formation?

Pk and Sple localization in pleura were examined around 48 hr APF, which is around the time of hair formation. We now note this in the Methods.

I have to agree that about the need for examining the polarity around the clones. I think that rises to the level of essential. It is hard to imagine that they did not at least look at adult wings for polarity phenotypes.

This is now included in the revised manuscript. The result (GFP:Sple clones disturb PCP) doesn’t change any of our conclusions.


Article and author information

Author details

  1. Abhijit A Ambegaonkar

    1. Howard Hughes Medical Institute, Rutgers University, Piscataway, United States
    2. Waksman Institute of Microbiology, Rutgers University, Piscataway, United States
    3. Department of Molecular Biology and Biochemistry, Rutgers University, Piscataway, United States
    AAA, Conception and design; Acquisition of data; Analysis and interpretation of data; Drafting or revising the article
    Competing interests
    The authors declare that no competing interests exist
  2. Kenneth D Irvine

    1. Howard Hughes Medical Institute, Rutgers University, Piscataway, United States
    2. Waksman Institute of Microbiology, Rutgers University, Piscataway, United States
    3. Department of Molecular Biology and Biochemistry, Rutgers University, Piscataway, United States
    KDI, Conception and design, Analysis and interpretation of data, Drafting or revising the article
    For correspondence
    Competing interests
    The authors declare that no competing interests exist


Howard Hughes Medical Institute

  • Kenneth D Irvine

National Institute of General Medical Sciences (R01 GM078620)

  • Kenneth D Irvine

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank the Developmental Studies Hybridoma Bank, the Bloomington stock center, and D Strutt, S Collier, D Gubb, R Holmgren, B Staley for plasmids, antibodies, and Drosophila stocks, Y Feng for fat tub-Gal4 UAS-wts wings, Idse Heemskerk and Sebastian Streichan for help with image analysis, and Gary Struhl and anonymous reviewers for comments on the manuscript. This research was supported by NIH grant R01 GM078620 and the Howard Hughes Medical Institute.

Reviewing Editor

  1. Jeremy Nathans, Howard Hughes Medical Institute, Johns Hopkins University School of Medicine, United States

Publication history

  1. Received: July 8, 2015
  2. Accepted: October 22, 2015
  3. Accepted Manuscript published: October 27, 2015 (version 1)
  4. Version of Record published: February 11, 2016 (version 2)
  5. Version of Record updated: February 8, 2017 (version 3)


© 2015, Ambegaonkar et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,548
    Page views
  • 434
  • 23

Article citation count generated by polling the highest count across the following sources: Crossref, Scopus, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cancer Biology
    2. Cell Biology
    Linda Julian et al.
    Research Article

    Apoptosis is characterized by profound morphological changes, but their physiological purpose is unknown. To characterize the role of apoptotic cell contraction, ROCK1 was rendered caspase non-cleavable (ROCK1nc) by mutating Aspartate 1113, which revealed that ROCK1 cleavage was necessary for forceful contraction and membrane blebbing. When homozygous ROCK1nc mice were treated with the liver-selective apoptotic stimulus of diethylnitrosamine, ROCK1nc mice had more profound liver damage with greater neutrophil infiltration than wild-type mice. Inhibition of the damage associated molecular pattern protein HMGB1 or signalling by its cognate receptor TLR4 lowered neutrophil infiltration and reduced liver damage. ROCK1nc mice also developed fewer diethylnitrosamine-induced hepatocellular carcinoma (HCC) tumours, while HMGB1 inhibition increased HCC tumour numbers. Thus, ROCK1 activation and consequent cell contraction are required to limit sterile inflammation and damage amplification following tissue-scale cell death. Additionally, these findings reveal a previously unappreciated role for acute sterile inflammation as an efficient tumour suppressive mechanism.

    1. Cell Biology
    2. Stem Cells and Regenerative Medicine
    Emma Carley et al.
    Research Article Updated

    While the mechanisms by which chemical signals control cell fate have been well studied, the impact of mechanical inputs on cell fate decisions is not well understood. Here, using the well-defined system of keratinocyte differentiation in the skin, we examine whether and how direct force transmission to the nucleus regulates epidermal cell fate. Using a molecular biosensor, we find that tension on the nucleus through linker of nucleoskeleton and cytoskeleton (LINC) complexes requires integrin engagement in undifferentiated epidermal stem cells and is released during differentiation concomitant with decreased tension on A-type lamins. LINC complex ablation in mice reveals that LINC complexes are required to repress epidermal differentiation in vivo and in vitro and influence accessibility of epidermal differentiation genes, suggesting that force transduction from engaged integrins to the nucleus plays a role in maintaining keratinocyte progenitors. This work reveals a direct mechanotransduction pathway capable of relaying adhesion-specific signals to regulate cell fate.