Disruption of the novel nested gene Aff3ir mediates disturbed flow-induced atherosclerosis in mice
eLife Assessment
The study presents valuable findings on the role of Aff3ir, a gene implicated in flow-induced atherosclerosis and regulating the inflammation-associated transcription factor, IRF5. The in vivo data are solid in providing evidence on the role of Aff3ir in shear stress and formation of atheromatous plaques. The work will be of interest to clinical researchers and biologists focusing on inflammation and atherosclerosis in cardiovascular disease with a broad eLife readership.
https://doi.org/10.7554/eLife.103413.3.sa0Valuable: Findings that have theoretical or practical implications for a subfield
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Solid: Methods, data and analyses broadly support the claims with only minor weaknesses
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
Disturbed shear stress-induced endothelial atherogenic responses are pivotal in the initiation and progression of atherosclerosis, contributing to the uneven distribution of atherosclerotic lesions. This study investigates the role of Aff3ir-ORF2, a novel nested gene variant, in disturbed flow-induced endothelial cell activation and atherosclerosis. We demonstrate that disturbed shear stress significantly reduces Aff3ir-ORF2 expression in athero-prone regions. Using three distinct mouse models with manipulated Aff3ir-ORF2 expression, we demonstrate that Aff3ir-ORF2 exerts potent anti-inflammatory and anti-atherosclerotic effects in Apoe-/- mice. RNA sequencing revealed that interferon regulatory factor 5 (Irf5), a key regulator of inflammatory processes, mediates inflammatory responses associated with Aff3ir-ORF2 deficiency. Aff3ir-ORF2 interacts with Irf5, promoting its retention in the cytoplasm, thereby inhibiting the Irf5-dependent inflammatory pathways. Notably, Irf5 knockdown in Aff3ir-ORF2 deficient mice almost completely rescues the aggravated atherosclerotic phenotype. Moreover, endothelial-specific Aff3ir-ORF2 supplementation using the CRISPR/Cas9 system significantly ameliorated endothelial activation and atherosclerosis. These findings elucidate a novel role for Aff3ir-ORF2 in mitigating endothelial inflammation and atherosclerosis by acting as an inhibitor of Irf5, highlighting its potential as a valuable therapeutic approach for treating atherosclerosis.
Introduction
Atherosclerosis, characterized by the formation of fibrofatty lesions in the arterial wall, is a leading cause of morbidity and mortality worldwide, contributing to most myocardial infarctions and many strokes (Herrington et al., 2016; Libby et al., 2019). The activation of vascular endothelial cells (ECs), induced by various chemical and mechanical stimuli, such as lipopolysaccharide and shear stress, is an initial step in the development of atherosclerosis (Davignon and Ganz, 2004). Consequently, atherosclerotic lesions preferentially develop at the branches and curvatures of the arterial tree, where blood flow is disturbed (Davis et al., 2023). For decades, researchers have been interested in exploring the mechanisms underlying mechanotransduction during endothelial activation caused by disturbed flow (Davis et al., 2023). Several mechanosensitive proteins, such as Yap/Taz (Li et al., 2019), Annexin A2 (Zhang et al., 2020), Bmp4 (Sorescu et al., 2004), and Nad(p)h oxidase (Hwang et al., 2003; Jo et al., 2006), have been identified as key regulators of disturbed shear stress in ECs and have been implicated in the progression of atherosclerosis. Emerging evidence has revealed that pharmacological or genetic inhibition of endothelial Yap activation ameliorates the progression of atherosclerotic plaques in mice (Li et al., 2019; Wang et al., 2016; Yang et al., 2021), indicating that targeting disturbed flow-induced endothelial activation could be a promising therapeutic strategy for atherosclerosis. However, the precise mechanisms by which the disturbed flow exerts detrimental effects remain unclear.
The interferon regulatory factor (IRF) family of transcription factors, comprising nine members (Irf1-Irf9) in mammals, is primarily characterized by its role in mediating antiviral responses and type I interferon production (Sato et al., 2001). Although these members share a conserved DNA-binding domain in their N-terminal region that recognizes similar DNA sequences, Irf5 plays a central role in inflammation (Almuttaqi and Udalova, 2019; Takaoka et al., 2005). Irf5 mediates the production of proinflammatory cytokines, including Il12b and Il23a, and promotes the expression of inflammatory genes (Cai et al., 2017; Saliba et al., 2014; Weiss et al., 2013). It promotes inflammatory responses in various immune cells, including macrophages (Seneviratne et al., 2017), neutrophils (Weiss et al., 2015), and B cells (Savitsky et al., 2010). Global or myeloid-specific knockouts of Irf5 have been shown to exert anti-atherosclerotic effects (Leipner et al., 2021; Seneviratne et al., 2017). Despite the established importance of Irf5 in immune cells, its restrictively regulatory mechanism and role in shear stress-induced endothelial activation remain unknown.
We recently reported that a novel protein-coding nested gene, Aff3ir, contributes to endothelial maintenance by promoting the differentiation of vascular stem/progenitor cells (SPCs) into ECs (Zhao et al., 2025). Aff3ir-ORF2, encoded by the Aff3ir transcript variant 2, is predominantly expressed in the EC layer of the mouse aorta (Zhao et al., 2025). Notably, our recent study indicated that the overexpression of Aff3ir-ORF2 could enhance laminar flow-induced mRNA levels of essential EC markers in SPCs (Zhao et al., 2025), suggesting that Aff3ir-ORF2 may be a novel mechanotransduction protein in ECs. However, the regulation of Aff3ir-ORF2 under disturbed flow and its role in atherosclerosis remain unclear.
In this study, we aimed to elucidate the mechanism by which disturbed blood flow induces endothelial activation and atherosclerosis. Our study showed that disrupted Aff3ir-ORF2 expression in athero-prone regions led to inflammatory responses and development of atherosclerosis. Aff3ir-ORF2, the expression of which is reduced by disturbed shear stress, exerts critical anti-inflammatory effects by binding to Irf5 and mitigating disturbed shear stress-induced Irf5 activation. Additionally, we demonstrated that endothelial-specific supplementation with Aff3ir-ORF2 significantly ameliorated disturbed flow-induced endothelial activation and the development of atherosclerotic plaques, highlighting its promising therapeutic potential for the treatment of atherosclerosis.
Results
Disturbed shear stress reduces the expression of Aff3ir-ORF2
Our recent study showed the active participation of Aff3ir in EC differentiation from vascular SPCs induced by laminar shear stress (Zhao et al., 2025), suggesting the potential involvement of this novel protein-encoding nested gene in mediating hemodynamic stimulation. To further elucidate the functional role of Aff3ir and its encoded proteins in disturbed shear stress-induced EC activation, we examined the expression of Aff3 and Aff3ir in the intima of mouse aorta. We found that the mRNA level of Aff3ir, but not its parent gene Aff3, was significantly lower in the intima of the aortic arch, an area exposed to disturbed shear stress, compared to the intima of the thoracic aorta, which was exposed to steady unidirectional shear stress (Li et al., 2019; Figure 1A). Aff3ir transcript variants can generate two proteins (Zhao et al., 2025), therefore, we measured the protein levels of Aff3ir-ORF1 and Aff3ir-ORF2. While Aff3ir-ORF1 and Aff3 showed comparable expression levels in the intima of aortic arch and thoracic aorta of mice, the expression of Aff3ir-ORF2 showed an 87% reduction in the intima of aortic arch compared to the intima of thoracic aorta (Figure 1B and C), suggesting that Aff3ir-ORF2 may be a novel mechanosensitive protein that responds to disturbed shear stress. Enface immunofluorescence staining confirmed a marked reduction in Aff3ir-ORF2 expression in the inner curvature of aortic arch compared to both the outer curvature of aortic arch and the thoracic aorta (Figure 1D and E). Moreover, to demonstrate the change in Aff3ir-ORF2 within the same visual field, we examined its expression in longitudinal sections of the mouse aorta (Li et al., 2019). We found that the expression of Aff3ir-ORF2, but not Aff3, was notably downregulated in athero-prone regions (the inner curvature of the aortic arch and bifurcation of the carotid artery) compared to that in the protective region in the outer curvature of the aortic arch (Figure 1F). Additionally, we found that the expression of Aff3, Aff3ir-ORF1, and Aff3ir-ORF2 in the media and adventitia was comparable between the aortic arch and the thoracic aorta (Figure 1—figure supplement 1A, B).
Disturbed shear stress reduces the expression of Aff3ir-ORF2 in vivo and in vitro.
(A) RT-PCR analysis of the mRNA levels of Aff3ir-ORF2 and AF4/FMR2 family member 3 (Aff3) in the intima of thoracic aorta (TA) and aortic arch (AA) of C57BL/6 mice. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test. (B, C) Western blot analysis of the expression of the indicated proteins in the intima of TA and AA of C57BL/6 mice. Protein levels were normalized to those of Gapdh, and the relative expression values were compared to those of the TA group. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test. (D, E) En-face immunofluorescence staining of Aff3ir-ORF2, VE-cadherin, and DAPI, and quantification of Aff3ir-ORF2 expression in inner curvature of the AA (AA inner), outer curvature of the AA (AA outer), and TA of C57BL/6 mice. Scale bar, 20 μm. The immunofluorescence intensity of Aff3ir-ORF2 was normalized to that of DAPI, and the relative expression values were compared to that of the TA group. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, one-way ANOVA with Tukey post-test. (F) Representative immunofluorescent staining for von Willebrand factor (vWF), Aff3ir-ORF2, and Aff3 in longitudinal aortic sections of C57BL/6 mice. n=6 mice per group. Scale bar, 25 μm. Inner, inner curvature of the AA; outer, outer curvature of the AA; BIF, Bifurcation. (G, H) Mouse embryonic fibroblasts (MEFs) isolated from the embryo of C57BL/6 mice were subjected to static (ST) or oscillatory shear stress (OSS, 0.5±4 dyn/cm2, 1 Hz) for indicated time. Western blot analysis of the indicated proteins. Protein levels were normalized to Gapdh and the relative expression values were compared to that of the ST group. Data are mean ± SEM (n=6 independent experiments). *p<0.05, one-way ANOVA with Tukey post-test. (I) MEFs were subjected to ST or oscillatory shear stress (OSS) treatment for 6 hr. RT-PCR analysis of the mRNA levels of Aff3ir, Aff3, intercellular adhesion molecule 1 (Icam1), and vascular cell adhesion molecule 1 (Vcam1) in MEFs. Data are mean ± SEM (n=6 independent experiments). *p<0.05, unpaired two-tailed t-test.
-
Figure 1—source data 1
The table summarizes the data in the statistical graph for Figure 1A, C, E, H and I.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig1-data1-v1.xlsx
-
Figure 1—source data 2
The original file of the full raw uncropped, unedited polyacrylamide gels for Figure 1B.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig1-data2-v1.zip
-
Figure 1—source data 3
Figures with the uncropped polyacrylamide gels with the relevant bands clearly labeled for Figure 1B.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig1-data3-v1.zip
-
Figure 1—source data 4
The original file of the full raw uncropped, unedited polyacrylamide gels for Figure 1G.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig1-data4-v1.zip
-
Figure 1—source data 5
Figures with the uncropped polyacrylamide gels with the relevant bands clearly labeled for Figure 1G.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig1-data5-v1.zip
Next, we explored the impact of disturbed shear stress on Aff3ir-ORF2 expression in vitro. Mouse embryonic fibroblasts (MEFs) exhibit responses consistent with those of ECs (Chen et al., 2010; Wen et al., 2013), therefore, we investigated Aff3ir-ORF2 expression in MEFs from WT mice exposed to static or disturbed flow (0.5±4 dyn/cm2, 1 Hz). Consistent with our in vivo findings, while disturbed shear stress increased the expression of Vcam1, a critical inflammatory marker of ECs (Nakashima et al., 1998), it significantly reduced both the protein and mRNA levels of Aff3ir-ORF2 (Figure 1G–I). The expression of Aff3 in response to the disturbed flow was minimally affected at both the mRNA and protein levels (Figure 1G–I). These results collectively demonstrate that disturbed shear stress induces a reduction in Aff3ir-ORF2 expression both in vivo and in vitro.
Aff3ir-ORF2 ameliorates disturbed shear stress-induced inflammation and atherosclerosis
Disturbed shear stress-induced atherogenic responses are initial events in atherosclerotic plaque formation (Davis et al., 2023). To elucidate the regulatory role of Aff3ir-ORF2 in disturbed shear stress-induced inflammation, we overexpressed Aff3ir-ORF2 in MEFs. Aff3ir-ORF2 overexpression attenuated Icam1 expression induced by disturbed shear stress at both the protein and mRNA levels (Figure 2A, B, Figure 2—figure supplement 1A). To further validate our findings in ECs, we overexpressed Aff3ir-ORF2 in human umbilical vein endothelial cells (HUVECs). Consistent with our previous results, Aff3ir-ORF2 overexpression reduced the protein level of Icam1 induced by disturbed shear stress in HUVECs (Figure 2C–D). Moreover, Aff3ir-ORF2 overexpression attenuated disturbed shear stress-induced expression of several inflammatory genes, including Vcam1, Il6, and Il1b, in both MEFs and ECs. (Figure 2—figure supplement 1A–B). Interestingly, we found that Aff3ir-ORF2 overexpression did not affect the basal expression of these inflammatory genes under ST conditions (Figure 2—figure supplement 1A–B), likely due to the relatively low levels of inflammatory gene expression under ST compared to OSS conditions. Notably, despite the significant anti-inflammatory effects of Aff3ir-ORF2, the sequence of this gene is not conserved in Homo sapiens. Furthermore, we measured the concentrations of inflammatory factors, including Il6 and Il1b, in the culture medium of MEFs. As expected, while Aff3ir-ORF2 overexpression had little effect on the concentrations of Il6 and Il1b under ST condition, it significantly reduced their release induced by disturbed shear stress (Figure 2E).
Aff3ir-ORF2 overexpression alleviates disturbed flow-induced inflammation and atherosclerosis.
(A–B) Mouse embryonic fibroblasts (MEFs) isolated from C57BL/6 mice were infected with indicated adenoviruses (Ad-Scramble or Ad-Aff3ir-ORF2) for 48 h and then exposed to static (ST) or oscillatory shear stress (OSS, 0.5±4 dyn/cm2, 1 Hz) for another 6 hr. Western blot analysis of the indicated proteins and quantification of their relative expression levels are shown. The protein levels were normalized to Gapdh and the relative expression values were compared to MEFs infected with Ad-Scramble and treated with ST. Data are presented as mean ± SEM (n=6 independent experiments). *p<0.05, two-way ANOVA with Tukey post-test. (C–D) Human umbilical vein endothelial cells (HUVECs) were infected with Ad-Scramble or Ad-Aff3ir-ORF2 for 48 h and then exposed to ST or OSS for an additional 6 hr. Western blot analysis of the indicated proteins and quantification of their relative expression levels are shown. The protein levels were normalized to Gapdh and the relative expression values were compared to HUVECs infected with Ad-Scramble and treated with ST. Data are presented as mean ± SEM (n=6 independent experiments). *p<0.05, two-way ANOVA with Tukey post-test. (E) MEFs were infected with Ad-Scramble or Ad-Aff3ir-ORF2 for 48 h and then exposed to ST or OSS for another 6 hr. The concentration of Il6 and Il1b in cell culture medium were detected with ELISA. The relative cytokine levels are relative to MEFs infected with Ad-Scramble and treated with ST. Data are presented as mean ± SEM (n=6 independent experiments). *p<0.05, two-way ANOVA with Tukey post-test. (F–J) Eight-wk-old male Apoe−/− mice were subjected to partial ligation of the carotid artery along with 10 μL of adenovirus suspension at 1×108 transducing units (TU)/mL was instilled into the left carotid artery (LCA). The mice were then fed high-fat diet for 4 wk. (F) Arterial tissues were isolated to examine the atherosclerotic lesions. Scale bar, 2 mm. (G, H) LCAs were sectioned for hematoxylin and eosin staining. Quantification of the lesion area in LCAs was shown. Scale bar, 25 μm. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test. (I, J) Immunofluorescence staining for vWF, Vcam1, and DAPI in the LCAs, and quantification of the relative fluorescent intensity of Vcam1. The immunofluorescence intensity of Vcam1 was normalized to DAPI, and the relative expression values were compared to that of the Ad-Scramble group. Scale bar, 50 μm. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test.
-
Figure 2—source data 1
The table summarizes the data in the statistical graph for Figure 2B, D, E, H and J.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig2-data1-v1.xlsx
-
Figure 2—source data 2
The original file of the full raw uncropped, unedited polyacrylamide gels for Figure 2A.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig2-data2-v1.zip
-
Figure 2—source data 3
Figures with the uncropped polyacrylamide gels with the relevant bands clearly labeled for Figure 2A.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig2-data3-v1.zip
-
Figure 2—source data 4
The original file of the full raw uncropped, unedited polyacrylamide gels for Figure 2C.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig2-data4-v1.zip
-
Figure 2—source data 5
Figures with the uncropped polyacrylamide gels with the relevant bands clearly labeled for Figure 2C.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig2-data5-v1.zip
Given the anti-inflammatory effects of Aff3ir-ORF2, we speculated that it may ameliorate disturbed shear stress-induced inflammation and atherosclerosis in vivo. Apoe knockout (Apoe-/-) mice were subjected to partial ligation surgery to induce disturbed flow in the left carotid arteries (LCAs). The endothelium of the LCAs was intravascularly infected with adenovirus (Ad-Scramble or Ad-Aff3ir-ORF2) prior to surgery (Nam et al., 2009; Zhang et al., 2020). Enface immunofluorescence staining confirmed the successful Aff3ir-ORF2 overexpression in the left carotid artery (Figure 2—figure supplement 1C–D). Mice infected with Ad-Aff3ir-ORF2 exhibited a significant decrease in lesion area in the LCAs compared to those infected with Ad-Scramble (23 ± 17% vs 63 ± 14%) (Figure 2F–H), with no obvious plaque formation observed in the right carotid arteries (Figure 2—figure supplement 1E). Overexpression of Aff3ir-ORF2 also attenuated disturbed flow-induced inflammatory responses, as evidenced by decreased Vcam1 expression in the endothelium of LCAs (Figure 2I–J). These findings suggested that Aff3ir-ORF2 ameliorates shear stress-induced inflammation and atherosclerosis.
Aff3ir-ORF2 deficiency aggravates inflammation and atherosclerotic lesions in Apoe-/- mice
To explore the effects of Aff3ir-ORF2 on inflammation and atherosclerosis, we generated Aff3ir-ORF2 global knockout (Aff3ir-ORF2-/-) mice. Genotyping PCR (Figure 3—figure supplement 1A) and western blot analysis of Aff3ir-ORF2 expression in mouse aortas (Figure 3—figure supplement 1B–C) confirmed the successful knockout. No obvious phenotypic abnormalities were observed in Aff3ir-ORF2-/- mice up to 20 wk of age and monitoring was discontinued thereafter. Additionally, Aff3ir-ORF2 deficiency did not alter systolic blood pressure, diastolic blood pressure, or mean arterial pressure (Figure 3—figure supplement 1D), suggesting that Aff3ir-ORF2 is dispensable for physiological blood pressure maintenance. We then isolated MEFs from WT and Aff3ir-ORF2-/- mice. RT-PCR analysis confirmed the deficiency of Aff3ir-ORF2 in Aff3ir-ORF2-/- MEFs (Figure 3—figure supplement 1E). Interestingly, the Aff3ir-ORF2 knockdown efficiency showed discrepancies between the western blot (Figure 3—figure supplement 1B) and RT-PCR results (Figure 3—figure supplement 1E). In addition to the technical differences between PCR and western blot, the characteristics of Aff3ir-ORF2 may also contribute to this inconsistency. The parent gene, Aff3, is located in a genetically variable region, and it can be excised via intron 5 to form a replicable transposon that translocates to other chromosomes, potentially contributing to leukemia (Chinen et al., 2008; Hiwatari et al., 2003; Miller et al., 2022; Bergh et al., 2002). Aff3ir, located in intron 6, exists within this transposon, which may complicate the measurement of its expression. Furthermore, we found that Aff3ir-ORF2 deficient MEFs displayed higher expression of inflammatory genes, including Icam1, Vcam1, and Il1b, compared to those in WT MEFs, under disturbed flow stimulation (Figure 3—figure supplement 1F).
Next, we crossed Aff3ir-ORF2-/- mice with Apoe-/- mice to generate double-knockout (Apoe-/-Aff3ir-ORF2-/-) mice. Eight-wk-old Apoe-/- and Apoe-/-Aff3ir-ORF2-/- mice were fed a high-fat diet for 12 wk to induce atherosclerosis (Figure 3A). En face Oil-Red O staining indicated that Aff3ir-ORF2 deficiency accelerated the development of atherosclerosis in the entire aorta, AA, and TA. (Figure 3B and C). Furthermore, Aff3ir-ORF2 deletion increased the lesion area and lipid deposition in the aortic roots of Apoe-/- mice without altering the collagen fiber content (Figure 3D and E). Similar results were observed in distributing arteries (LCAs) (Figure 3F and G). Given that the expression of adhesion proteins, such as Vcam1 in ECs is crucial for monocyte infiltration into plaques (Kobiyama and Ley, 2018), we assessed Vcam1 expression in the aortic roots of these mice. We found that Aff3ir-ORF2 deletion increased Vcam1 expression in the aortic roots of Apoe-/- mice (Figure 3H, I), indicating that the atherogenic effects of Aff3ir-ORF2 deletion may result from endothelial inflammation. Additionally, there were no significant differences between the two groups in body weight or triglyceride, total cholesterol, LDL cholesterol, and HDL cholesterol levels (Figure 3—figure supplement 2A, B), indicating that the atherogenic effect of Aff3ir-ORF2 silencing is unlikely to be related to lipid metabolism. Taken together, these results indicate that Aff3ir-ORF2 deficiency aggravates inflammation and atherosclerotic lesions in mice.
Aff3ir-ORF2 deletion aggravates inflammation and atherosclerotic lesions in Apoe-/- mice.
Eight-wk-old male Apoe-/- and Apoe-/-Aff3ir-ORF2-/- mice were fed a high-fat diet for 12 wk. Arterial tissues and aortic roots were isolated to examine atherosclerotic lesions. (A) Schematic of experimental strategy. (B) Representative images of en face Oil-Red O staining of the aortas. Scale bar, 4 mm. (C) Quantification of the plaque area in the whole aorta, aortic arch (AA), and thoracic aorta (TA). Data are presented as mean ± SEM (n=12 mice per group). *p<0.05, unpaired two-tailed t-test. (D) Oil-Red O, hematoxylin and eosin (HE), and Masson staining of the aortic roots. Scale bars, 500 μm. (E) Quantification of plaque size, Oil-Red O-positive area, and collagen fiber content in aortic root sections. Data are presented as mean ± SEM (n=6 mice per group). *p0.05, unpaired two-tailed t-test. (F), left carotid arteries (LCAs) were sectioned and stained with Oil-Red O, HE, and Masson’s trichrome. Scale bars, 500 μm. (G) Quantification of plaque size, Oil-Red O-positive area, and collagen fiber content in the LCA sections. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test. (H) Representative immunofluorescence images of vWF, Vcam1, and DAPI in the aortic roots. Scale bar, 500 μm. (I), Quantification of the relative fluorescence intensity of Vcam1. The immunofluorescence intensity of Vcam1 was normalized to that of DAPI, and the relative expression values were compared to that of the Apoe-/- group. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test.
-
Figure 3—source data 1
The table summarizes the data in the statistical graph for Figure 3A, E, G and I.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig3-data1-v1.xlsx
Aff3ir-ORF2 mitigates disturbed shear stress-induced inflammation by interacting with Irf5 and retaining it within the cytosol
To explore the mechanism by which Aff3ir-ORF2 mitigates atherogenesis, we performed RNA sequencing (RNA-seq) on MEFs from WT and Aff3ir-ORF2-/- mice. Expression of all differentially expressed genes in the Supplementary file 3. The Principal component analysis plot depicted a clear clustering of WT versus Aff3ir-ORF2-/- samples (Figure 4A). We identified 1167 upregulated and 310 downregulated genes in the Aff3ir-ORF2-/- group, with a criterion of 1.5-fold change and p<0.05 (Figure 4B, Figure 4—figure supplement 1A). All the differentially expressed genes were subjected to bioinformatics enrichment analysis using Gene Ontology (GO) databases. GO analysis showed that these genes were mainly enriched in processes, including leukocyte cell-cell adhesion, regulation of cell−cell adhesion, and leukocyte activation involved in immune response (Figure 4C), which is highly consistent with the phenotypes observed in Aff3ir-ORF2-/- mice. To further investigate the functional features of these differentially expressed genes in the context of the atherosclerotic microenvironment, we mapped the differential gene list onto the atherosclerosis-related gene dataset (Rouillard et al., 2016), resulting in 363 overlapping genes. GO analysis of these genes revealed enrichment in processes related to cell−cell adhesion and leukocyte activation involved in immune response (Figure 4—figure supplement 1B), which is highly consistent with the observed effects of Aff3ir-ORF2 on Vcam1 expression.
Aff3ir-ORF2 mitigates disturbed shear stress-induced inflammation by interacting with Irf5 and retaining it within the cytosol.
(A–D) Mouse embryonic fibroblasts (MEFs) were isolated from wild-type (WT) and Aff3ir-ORF2-/- mice. (A) Principal component analysis (PCA) analysis of RNA-seq data to visualize sample-to-sample variation. (B) Volcano map showing mRNA profiles of WT and Aff3ir-ORF2-/- MEFs (n=3). (C) Gene Ontology enrichment pathway analysis of the differentially expressed genes. (D) Venn diagrams of the top 20 transcription factors from the ChEA3 and DisGENET analysis related to atherosclerosis. (E) Immunoprecipitation performed using antibodies against Aff3ir-ORF2, Irf5, and Irf8. n=3 independent experiments. (F–H), WT and Aff3ir-ORF2-/- MEFs were subjected to silence of Control (siNC), Irf5 (siIrf5), or Irf8 (siIrf8) with siRNAs for 24 hr, followed by exposure to static (ST) or oscillatory shear stress (OSS, 0.5±4 dyn/cm2, 1 Hz) for another 6 hr. (F) RT-PCR analysis of the mRNA levels of Vcam1, Icam1, Il6, and Il1b. The relative expression values were compared to WT MEFs transfected with siNC and treated with ST. Data are mean ± SEM (n=6 independent experiments). *p<0.05, two-way ANOVA with Tukey post-test. (G–H), Representative western blots of Irf5 and Icam1 expression. Data are mean ± SEM (n=5 independent experiments). *p<0.05, two-way ANOVA with Tukey post-test. (I–J), WT, and Aff3ir-ORF2-/- MEFs were exposed to ST or OSS for 6 hr. Nuclear and cytoplasmic proteins were extracted from the cells. Representative western blots of the indicated proteins and quantification of Irf5 expression in nucleus are shown. The expression of these proteins was relative to the level of nuclear Irf5 in ST-treated WT MEFs. Data are mean ± SEM (n=6 independent experiments). *p<0.05, one-way ANOVA with Tukey post-test. (K) HEK293 cells were transfected with the firefly luciferase reporter plasmid containing the Irf5-responsive ZNF217 promoter along with a β-galactosidase reporter plasmid for 24 hr. Cells were infected with the indicated adenoviruses (Ad-Scramble or Ad-Aff3ir-ORF2) for 24 h. Promoter activity was measured using luciferase, which was normalized to β-gal. Data are mean ± SEM (n=6 independent experiments). *p<0.05, two-way ANOVA with Tukey post-test.
-
Figure 4—source data 1
The table summarizes the data in the statistical graph for Figure 4F, H, J and K.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig4-data1-v1.xlsx
-
Figure 4—source data 2
The original file of the full raw uncropped, unedited polyacrylamide gels for Figure 4E.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig4-data2-v1.zip
-
Figure 4—source data 3
Figures with the uncropped polyacrylamide gels with the relevant bands clearly labeled for Figure 4E.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig4-data3-v1.zip
-
Figure 4—source data 4
The original file of the full raw uncropped, unedited polyacrylamide gels for Figure 4G.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig4-data4-v1.zip
-
Figure 4—source data 5
Figures with the uncropped polyacrylamide gels with the relevant bands clearly labeled for Figure 4G.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig4-data5-v1.zip
-
Figure 4—source data 6
The original file of the full raw uncropped, unedited polyacrylamide gels for Figure 4I.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig4-data6-v1.zip
-
Figure 4—source data 7
Figures with the uncropped polyacrylamide gels with the relevant bands clearly labeled for Figure 4I.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig4-data7-v1.zip
To further identify the upstream transcriptional regulators of these genes, we used the list of differentially expressed genes from the RNA-seq data to predict upstream transcription factors using the ChEA3 database (Keenan et al., 2019). Then, the top 20 transcription factors obtained from the ChEA3 database were mapped to the atherosclerotic disease-related gene list in the Disgenet database (Piñero et al., 2017). Interferon regulatory factor 5 (Irf5) and Irf8 were identified as key upstream regulators (Figure 4D). Irf5 and Irf8, which are members of the same family of transcription factors originally implicated in interferon production, have been identified as critical regulators of the inflammatory response and contribute to the pathogenesis of various inflammatory diseases (Almuttaqi and Udalova, 2019; Salem et al., 2020). However, their potential roles in disturbed shear stress-induced inflammation remain unclear. We speculated that Aff3ir-ORF2 interacts with Irf5 and/or Irf8. Coimmunoprecipitation assays indicated that endogenous Aff3ir-ORF2 could bind to both Irf5 and Irf8 (Figure 4E). To determine which transcription factor mediates the inflammatory effects of Aff3ir-ORF2 deficiency, we silenced Irf5 and Irf8 in WT and Aff3ir-ORF2-/- MEFs exposed to disturbed flow. Notably, silencing Irf5, but not Irf8, blunted the upregulation of inflammatory genes, including Icam1, Vcam1, Il6, and Il1b (Figure 4F), suggesting that Irf5 was the predominant factor mediating the anti-inflammatory effects of Aff3ir-ORF2 in the context of disturbed shear stress. Consistently, we found that Irf5 silencing significantly inhibited the upregulation of Icam1 protein levels induced by Aff3ir-ORF2 deficiency under disturbed shear stress (Figure 4G and H). In addition, neither Irf5 nor Irf8 expression levels were affected by Aff3ir-ORF2 deficiency (Figure 4—figure supplement 1C). However, we found that Aff3ir-ORF2 deficiency significantly increased the expression of Irf5-targeted genes (predicted by the ChEA3 database), including Icam1, Ccl5, and Cxcl10 (Figure 4—figure supplement 1D). Notably, the protein level of Irf5 was not significantly affected by disturbed shear stress (Figure 4G and H). Consistently, the mRNA levels of Irf5 were previously reported to be barely changed in the context of disturbed shear stress (Deng et al., 2025) (GSE276195, Figure 4—figure supplement 1E) or the atherosclerotic environment (Li et al., 2025) (GSE222583, Figure 4—figure supplement 1F). Given that the transcriptional activity of Irf5 depends on its nuclear translocation (Lv et al., 2024), we next explored whether Aff3ir-ORF2 affects the subcellular localization of Irf5. Subcellular fractionation assays indicated that Irf5 was predominantly localized in the cytoplasm under static conditions, but exhibited obvious nuclear localization when exposed to disturbed shear stress (Figure 4I and J). While the total expression of Irf5 was barely affected by Aff3ir-ORF2 deficiency or overexpression, nuclear localization of Irf5 increased with Aff3ir-ORF2 deficiency (Figure 4I and J). To further ascertain the role of Aff3ir-ORF2 in regulating the transcriptional activity of Irf5, we performed a luciferase reporter assay (Qiao et al., 2022). Aff3ir-ORF2 overexpression significantly decreased the transcriptional activity of Irf5 (Figure 4K). In summary, these results suggested that Aff3ir-ORF2 acts as an endogenous inhibitor of Irf5 and exerts anti-inflammatory effects by retaining Irf5 in the cytosol.
Irf5 knockdown prevents the aggravation of atherosclerosis induced by ORF2 deficiency
Next, we investigated the role of Irf5 in disturbed flow-induced atherosclerosis in vivo and whether it mediates the atherogenic phenotype associated with Aff3ir-ORF2 deficiency. Apoe-/- and Apoe-/-Aff3ir-ORF2-/- mice were subjected to partial ligation surgery in the LCAs and intravascularly infected with lentiviruses expressing either Irf5-specific shRNA (lenti-shIrf5) or Scramble shRNA (lenti-shScramble). En-face immunofluorescence staining confirmed successful Irf5 deletion in the left carotid artery (Figure 5—figure supplement 1A). After a 4 wk high-fat diet challenge, Irf5 deletion resulted in an approximately 60% reduction in plaque area in the LCAs of Apoe-/- mice (Figure 5A and B). In addition, Irf5 deletion attenuated endothelial activation, as evidenced by reduced Vcam1 expression in the endothelium of LCAs (Figure 5C and D). Notably, although Apoe-/-Aff3ir-ORF2-/- mice exhibited an increased plaque area in the LCAs compared to Apoe-/- mice, Irf5 deletion almost completely abolished these differences, reducing both the plaque area and Vcam1 expression in the endothelium of the LCAs (Figure 5A–D). These findings provide in vivo evidence that Aff3ir-ORF2 deficiency-induced atherosclerosis is mediated by endothelial Irf5.
Irf5 knockdown prevents the aggravation of atherosclerosis in Aff3ir-ORF2 deficient mice.
Eight-wk-old male Apoe-/- mice were subjected to partial ligation of the left carotid artery (LCA) along with 10 μL of lentivirus suspension at 1×108 transducing units (TU)/mL was instilled into the LCA. The mice were then fed a high-fat diet for 4 wk. (A–B) Arterial tissues were isolated to examine the atherosclerotic lesions. LCAs were sectioned for hematoxylin and eosin staining. Quantification of the lesion area in LCAs was shown. Data are mean ± SEM (n=6 mice per group). *p<0.05, two-way ANOVA with Tukey post-test. Scale bar: 2 mm for gross images, 25 μm for staining images. (C–D) Immunofluorescence staining for vWF, Vcam1, and DAPI in the LCAs and quantification of the relative fluorescent intensity of Vcam1. Scale bar, 50 μm. The immunofluorescence intensity of Vcam1 was normalized to DAPI, and the relative expression values were compared to that of the group of Apoe-/- mice infected with Ad-scramble. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, two-way ANOVA with Tukey post-test.
-
Figure 5—source data 1
The table summarizes the data in the statistical graph for Figure 5B and D.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig5-data1-v1.xlsx
Endothelial-specific Aff3ir-ORF2 supplementation ameliorates EC activation and atherosclerosis in mice
Given the significant anti-inflammatory effects of Aff3ir-ORF2 on endothelial activation and atherosclerosis, we explored the potential use of gene therapy targeting Aff3ir-ORF2 to treat atherosclerosis. Endothelial-specific Aff3ir-ORF2 overexpression was achieved using an EC-enhanced AAV-mediated CRISPR/Cas9 genome-editing system controlled by an EC-specific ICAM2 promoter as we previously reported (Li et al., 2024; Swiech et al., 2015). Apoe-/- mice infected with AAV-ICAM2-Control or AAV-ICAM2- Aff3ir-ORF2 were fed a high-fat diet for 12 wk (Figure 6A). En-face immunofluorescence staining confirmed successful Aff3ir-ORF2 overexpression in ECs (Figure 6—figure supplement 1A–B). Endothelial-specific Aff3ir-ORF2 overexpression had a minimal effect on triglycerides, total cholesterol, LDL cholesterol, and HDL cholesterol levels in the plasma of mice (Figure 6—figure supplement 1C). However, compared to the negative control, endothelial-specific Aff3ir-ORF2 overexpression significantly reduced the Oil-red O-positive lesion area in the whole aortas of Apoe-/- mice (19 ± 5% vs 54 ± 8%) (Figure 6B and C). Moreover, endothelial-specific Aff3ir-ORF2 overexpression reduced the lesion area and lipid deposition in the aortic roots of Apoe-/- mice without altering the collagen fiber content (Figure 6D and E). In addition, Aff3ir-ORF2 overexpression effectively suppressed Vcam1 expression in the endothelium of the aortic roots of Apoe-/- mice (Figure 6F and G). Collectively, these results suggest that supplementation with Aff3ir-ORF2 was effective in preventing atherosclerosis development.
Endothelial-specific Aff3ir-ORF2 supplementation alleviates EC activation and atherosclerosis in Apoe-/- mice.
Eight-wk old Apoe-/- male mice were infused with the indicated adeno-associated virus (AAV) and then fed a high-fat diet for 12 wk. (A) Schematic of the experimental strategy. (B) Representative images of enface Oil-Red O staining of the aortas. Scale bar, 4 mm. (C) Quantification of the plaque area in the entire aortas. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test. (D) Hematoxylin and eosin (HE), Oil-Red O, and Masson staining of the aortic roots. Scale bars, 500 μm. (E) Quantification of plaque size, Oil-Red O-positive area, and collagen fiber content in aortic root sections. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test. (F) Representative immunofluorescence image of vWF, Vcam1, and DAPI in the aortic roots. Scale bar, 500 μm. (G) Quantification of the relative fluorescent intensity of Vcam1. The immunofluorescence intensity of Vcam1 was normalized to that of DAPI, and the relative expression values were compared to that of the AAV-Scramble group. Data are presented as mean ± SEM (n=6 mice per group). *p<0.05, unpaired two-tailed t-test.
-
Figure 6—source data 1
The table summarizes the data in the statistical graph for Figure 6C, E and G.
- https://cdn.elifesciences.org/articles/103413/elife-103413-fig6-data1-v1.xlsx
Discussion
Endothelial activation is a critical initial event in the development of atherosclerosis, and emerging evidence suggests that targeting disturbed shear stress-induced endothelial activation is a promising therapeutic strategy. In the present study, we elucidated the role of the novel nested gene-encoded protein, Aff3ir-ORF2, in sensing disturbed shear stress. Moreover, we demonstrated that Aff3ir-ORF2 acts as an endogenous inhibitor of Irf5, a key regulator of the inflammatory response, thereby exerting potent anti-inflammatory and anti-atherogenic effects (Figure 7).
Schematic illustration of the Aff3ir-ORF2/Irf5 cascade in disturbed flow-induced endothelial activation and atherosclerosis.
Disturbed flow induced a down-regulation of Aff3ir-ORF2, which could interact with Irf5 and promote the latter’s retention in the cytoplasm, thereby boosting Irf5-dependent inflammatory pathways in endothelial cells and leading to atherogenesis.
Using three mouse models (global Aff3ir-ORF2 knockout, locally Aff3ir-ORF2 endothelial expression, and endothelial-specific Aff3ir-ORF2 overexpression), we demonstrated that Aff3ir-ORF2 exerted potent anti-inflammatory and anti-atherosclerosis effects in Apoe-/- mice. Notably, while Aff3ir-ORF2 knockout increased Vcam1 expression in the endothelium and enlarged the plaque area in the aortic roots, it had a minimal effect on collagen deposition within the plaques. This discrepancy may be attributed to the differential expression patterns of Irf5 across various cell types (Roberts et al., 2024). Phenotypically modulated vascular smooth muscle cells (VSMCs) within the fibrous cap produce extracellular matrix molecules critical for plaque composition and stabilization (Bennett et al., 2016). A previous study has shown minimal colocalization between Irf5 and the VSMC marker, α-smooth muscle actin, in aortic root lesions of Apoe-/- mice (Seneviratne et al., 2017), indicating a relatively low Irf5 expression level in VSMCs. Consequently, Aff3ir-ORF2 likely exerts its anti-inflammatory effects primarily through endothelial Irf5. Consistently, endothelial-specific Aff3ir-ORF2 overexpression reduced the aortic plaque area, but had minimal effects on collagen deposition. Our findings establish the potent anti-atherosclerotic role of Aff3ir-ORF2 in early and advanced atherosclerosis mouse models. However, given the multiple critical roles of ECs throughout the initiation and progression of atherosclerosis, further investigations are needed to explore the potential role of Aff3ir-ORF2 in other atherosclerotic processes, including endothelial-to-mesenchymal transition, plaque rupture, and atherothrombotic occlusion. Additionally, we found that disturbed shear stress transcriptional downregulated the expression of Aff3ir. However, the protein levels of Aff3ir-ORF2, but not those of Aff3ir-ORF1, were reduced by disturbed shear stress. Since both Aff3ir-ORF1 and Aff3ir-ORF2 are derived from Aff3ir, different translation mechanisms may be involved in the production of Aff3ir-ORF1/2.
In addition to ECs, various other cell types, particularly immune cells, play crucial roles in the progression of atherosclerotic plaques (Wolf and Ley, 2019). Although our results indicated the potent anti-inflammatory role of Aff3ir-ORF2 in ECs, the potential contributions of other cell types may also be involved, which could be further elucidated using Aff3ir-ORF2 tissue-specific knockout or overexpression mouse models. Macrophage polarization and inflammatory responses accelerate plaque development, leading to an increase in necrotic core and vulnerable plaques (Krausgruber et al., 2011). Elevated Irf5 expression and nuclear localization have been observed in macrophages within plaques of Apoe-/- mice (Seneviratne et al., 2017). Irf5 has been demonstrated to drive macrophages towards a pro-inflammatory state, thereby affecting plaque stability (Seneviratne et al., 2017). Global or myeloid cell-specific deletion of Irf5 stabilizes atherosclerotic plaques by suppressing the inflammatory phenotypes of macrophages (Leipner et al., 2021; Seneviratne et al., 2017). Despite these findings, the role of Irf5 in shear stress-induced endothelial activation remains largely unknown. Our study provides evidence that disturbed shear stress is sufficient to induce Irf5 nuclear translocation and activation in ECs. Furthermore, Irf5 knockdown in ECs significantly reduced disturbed flow-induced plaque formation in LCAs. These findings suggest that targeting endothelial Irf5 may be an effective strategy for combating the early stages of atherosclerosis.
Given the key role of Irf5 in mediating inflammatory responses, it has been considered as an attractive therapeutic target, and various strategies have been developed to study and modulate its function (Almuttaqi and Udalova, 2019). For example, nanoparticle-delivered siRNA targeting Irf5 in macrophages promotes inflammation resolution, improves infarct healing, and attenuates post-myocardial infarction remodeling (Courties et al., 2014). Additionally, manipulating Irf5 protein levels through the E3 ubiquitin ligase, Trim21, has been explored as a strategy for modulating its activity (Lazzari et al., 2014). Given the crucial physiological role of Irf5, strategies aimed at suppressing its pathophysiological activation without altering basal levels may offer additional benefits. Our study introduces a novel approach to inhibit Irf5 activation. We found that the novel nested gene-encoded protein, Aff3ir-ORF2, interacts with Irf5, leading to cytoplasmic retention and inactivation under disturbed shear stress conditions. Importantly, endothelium-specific supplementation with Aff3ir-ORF2 effectively attenuated endothelial activation and reduced the atherosclerotic plaque area in Apoe-/- mice, suggesting that targeting endothelial Irf5 activation with Aff3ir-ORF2 holds promise for the treatment of atherosclerosis. Furthermore, as emerging studies have highlighted the substantial contributions of Irf5 to autoimmune diseases (Graham et al., 2006), neuropathic pain (Masuda et al., 2014), obesity (Dalmas et al., 2015), and hepatic fibrosis (Alzaid et al., 2016), future research should investigate whether Aff3ir-ORF2 has beneficial effects in these contexts.
Conclusion
In conclusion, this study provides novel evidence that the disruption of Aff3ir-ORF2 expression under disturbed flow promotes endothelial inflammatory responses and atherosclerosis. Aff3ir-ORF2 serves as an endogenous inhibitor of Irf5 by binding to Irf5 and preventing its nuclear translocation. Supplementation with endothelial Aff3ir-ORF2 may be a promising therapeutic strategy for treating atherosclerosis.
Materials and methods
Animals
C57BL/6 and Apolipoprotein E-null (Apoe-/-) mice were purchased from the Experimental Animal Centre of the Military Medical Science Academy (Beijing, China). Aff3ir-ORF2-heterozygote (Aff3ir-ORF2+/-) mice were acquired from Dr. Lingfang Zeng’s Laboratory at King’s College London. Briefly, gRNAs targeting the mouse Aff3ir-ORF2 locus (gRNA1: GCAACCCACGGAGTTGCAGTTGG; gRNA2: GTCATTAACTCCTTTAATATAGG; gRNA3: TGCAACTCCGTGGGTTGCTGTGG; gRNA4: GACCACACATAACAGTGAATAGG) and Cas9 mRNA were co-injected into fertilized mouse eggs to generate targeted knockout offspring. F0 founder animals were identified by PCR followed by sequence analysis, and then bred to WT mice to test germline transmission and produce F1 animals. Heterozygous targeted mice were intercrossed to generate homozygous targeted mice. The genotyping primers used were: 5’-GGAAAGACCACAGAATCAATGACA-3’, 5’-AACATTGCTATACCCCACTATA-3’. To generate Apoe and Aff3ir-ORF2 double knockout mice (Apoe-/-Aff3ir-ORF2-/-), Apoe-/- mice were crossed with Aff3ir-ORF2-/- mice. The animals were maintained at 21 ± 1°C under a 12 hr light/dark cycle (lights on at 07:00, lights off at 19:00) with ad libitum access to water and standard chow unless specified otherwise. This study adhered to the Guide for the Care and Use of Laboratory Animals of the US National Institutes of Health (NIH Publication No. 85–23, revised 2011). All study protocols were approved by the Institutional Animal Care and Use Committee of Tianjin Medical University.
Carotid artery partial ligation surgery
Request a detailed protocolThe surgery was performed as we previously described (Yang et al., 2021). Briefly, mice were anesthetized with isoflurane (2–3%). A ventral midline incision (4–5 mm) was made in the neck and the left carotid artery was exposed through blunt dissection of subcutaneous fat and muscle tissue. The left external carotid, internal carotid, and occipital arteries were ligated with a 6–0 silk suture, leaving the superior thyroid artery intact. For adenovirus and lentivirus infection studies, adenovirus (Ad-ORF2 or Ad-Scramble) or lentivirus (lenti-shRNA-Irf5 or lenti-shRNA-Scramble) was introduced into the lumen of the left carotid artery and kept inside for 40 min. After infection, the adenovirus or lentivirus was released, and blood flow to the common carotid artery was restored. Mice were fed with a high-fat diet (TD88137, ENVIGO, USA) immediately after surgery and continued for 4 wk.
Endothelial Aff3ir-ORF2 overexpression in mice
Request a detailed protocolEndothelial-specific adeno-associated virus (AAV)-mediated CRISPR/Cas9 shuttle plasmid was constructed by Cell & Gene Therapy (Shanghai, China) as previously reported (Wang et al., 2016). Apoe-/- mice received a single tail vein injection of recombinant AAV containing an endothelial-specific human ICAM-2 promoter driving Aff3ir-ORF2 overexpression (AAV-Aff3ir-ORF2) or a control empty vector (AAV-Scramble), with a dose of 1×1011 viral genomes in a 200 μL vol of sterile PBS. Subsequently, the mice were fed with a high-fat diet (TD88137, ENVIGO, USA) for 3 mo.
Oil-Red O staining for atherosclerotic plaques in mouse aorta
Request a detailed protocolThe Apoe-/-, Apoe-/-Aff3ir-ORF2-/-, and EC-specific Aff3ir-ORF2 overexpression mice were anesthetized by inhalation of 2% isoflurane and euthanized by cervical dislocation. The aortas were dissected in 1x PBS and opened to expose the atherosclerotic plaques. After fixation in 4% formaldehyde for 1 hr at 4 °C, the tissues were rinsed in water for 10 min, followed by 60% isopropanol. The aortas were then stained with Oil-Red O for 30 min with gentle shaking, rinsed again in 60% isopropanol, and subsequently rinsed in water three times. The samples were mounted on wax with the endothelial surface facing upwards. Images were captured using an HP Scanjet G4050. Plaque areas were quantified using NIH ImageJ software by calculating the plaque area relative to the total vascular area.
Immunofluorescence staining
Request a detailed protocolMEFs slides or frozen sections were fixed in 4% paraformaldehyde for 30 min, then permeabilized in 0.1% Triton X-100 (in PBS) and blocked with 1% bovine serum albumin for 30 min at room temperature. Sections were incubated overnight at 4 °C with primary antibodies (1:100). Aff3ir-ORF2 (Cat. No. C0302HL300-4) antibody was from GenScript (Piscataway, NJ, USA). The vWF (Cat. No. ab11713) and VE-Cadherin (Cat. No. ab33168) antibodies were obtained from Abcam (Cambridge, UK). Vcam1 (Cat. No. sc-13160) antibody was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Following primary antibody incubation, sections were treated with Alexa Fluor 488- or Alexa Fluor 594-conjugated secondary antibodies (1:200, Thermo Fisher Scientific, Grand Island, NY, USA) at room temperature for 1 hr. Slides were then mounted with DAPI-containing mounting medium. Antibody specificity and target staining authenticity were verified using negative controls. Immunofluorescence micrographs were acquired using a Leica confocal laser scanning microscope. Representative images were randomly selected from each group.
Histological analysis of atherosclerotic lesions
Request a detailed protocolHarvested carotid arteries and cross-sections of aortic roots were fixed in 4% paraformaldehyde and embedded in optimal cutting temperature compound (OCT). OCT-embedded tissues were sectioned at a thickness of 7 μm. Slides were immersed in 1x PBS for 5 min to remove OCT, and subsequently stained with Oil-Red O, hematoxylin and eosin (HE), and Masson’s trichrome stain to assess lipid accumulation, lesion area, and collagen deposition, respectively (Li et al., 2019). Images were acquired using microscopy.
Quantification of plasma lipid levels
Request a detailed protocolBlood samples were obtained via cardiac puncture, rinsed with heparin, and collected in 1.5 mL Eppendorf tubes. Total plasma cholesterol, triglycerides, LDL cholesterol, and HDL cholesterol levels were measured enzymatically using an automated clinical chemistry analyzer kit (Biosino Biotech, Beijing, China).
Cell culture, transfection, and shear stress experiments
Request a detailed protocolMouse Embryonic Fibroblasts (MEFs) were obtained and cultured as previously described (Ferreira and Hein, 2023). Cell passages 4–7 were used in all experiments. MEFs were cultured in the Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FBS, penicillin (100 U/mL), and streptomycin (100 μg/mL). Cells were incubated at 37 °C in a humidified environment containing 5% CO2 and grown to 70–80% confluence before treatment.
Small interfering RNA against Irf5 or Irf8 were synthesized from General Biosystems (Hefei, China). The sequences of siRNAs are shown in the Supplementary file 1. The MEFs were passaged to six-well plates and transfected with 20 nmol/L siRNA per well using the Lipofectamine RNA iMAX Reagent (Invitrogen, Carlsbad, CA, USA).
For flow experiments, confluent monolayers of MEFs were seeded onto glass slides, and a parallel plate flow system was used to launch oscillatory flow (0.5±4 dyn/cm2). The flow system was enclosed in a chamber (Frangos et al., 1985; Fu et al., 2011).
Cell Lines
Request a detailed protocolHEK293T (Cat NO. CRL-11268, ATCC) cells were cultured in DMEM medium with 10% FBS, penicillin (100 U/mL), and streptomycin (100 μg/mL). Cells were incubated at 37 °C in a humidified environment containing 5% CO2 and grown to 70–80% confluence prior to treatment. Their identity has been authenticated by the supplier. HEK293T cells used here were negative for mycoplasma contamination test.
Adenovirus and lentivirus production and infection
Request a detailed protocolAff3ir-ORF2 sequences were inserted into the GV138 vector (CMV-MCS-3FLAG) to generate recombinant adenovirus (Ad-Aff3ir-ORF2). The short hairpin RNA (shRNA) sequences targeting mouse Irf5 were 5’-GGGACAACACCATCTTCAAGG-3’, 5’GGTTGCTGCTGGAGATGTTCT-3’, and 5’-GCCTAGAGCAGTTTCTCAATG-3’. The control shRNA was 5’-GCGTGATCTTCACCGACAAGA-3’. These shRNAs were constructed and cloned into pLV-U6-shRNA-CMV-EGFP to generate recombinant lentivirus (lenti-shRNA- Irf5 or lenti-shCtrl). MEFs were infected with adenovirus or lentivirus at a multiplicity of infection (MOI) of 10, with no detectable cellular toxicity observed.
Western blot analysis
Request a detailed protocolWhole-cell lysates were prepared in a lysis buffer containing a complete protease inhibitor cocktail, PhosSTOP, and PMSF (Roche, Mannheim, Germany). Cytoplasmic and nuclear proteins were extracted from wild-type and Aff3ir-ORF2-/- MEFs using a protein extraction kits (Invent Biotechnologies, SC-003, Beijing, China). Protein were separated by SDS-PAGE and transferred to nitrocellulose membranes (Cat. No. 10600001; GE Healthcare; Chicago, IL, USA). The membranes were incubated with primary antibodies. Irf5 (Cat. No. 96527), Irf8 (Cat. No. 98344), and Flag (Cat. No. 14793) antibodies were from Cell Signaling Technology (Danvers, MA, USA). Icam1 (Cat. No. ab222736) antibodies were from Abcam (Cambridge, UK). Aff3ir-ORF2 (Cat. No. C0302HL300-4) and Aff3ir-ORF1 (Cat. No. C0302HL300) antibodies were from GenScript (Piscataway, NJ, USA). Gapdh (Cat. No. 60004–1-Ig) antibody was from Proteintech (Wuhan, China). Aff3 (Cat. No. PA5-68961) antibody was from Thermo Fisher Scientific (Waltham, MA, USA).
After incubation with horseradish peroxidase-conjugated secondary antibodies, the proteins were visualized using enhanced chemiluminescence reagents in a ChemiScope3600 Mini chemiluminescence imaging system (Clinx Science Instruments; Shanghai, China). Protein levels were quantified by measuring integrated density with NIH Image J software (https://imagej.nih.gov/ij/), using Gapdh as a loading control for normalization.
Co-immunoprecipitation
Request a detailed protocolWhole-cell lysates were prepared by lysing cells in a 1% NP-40 lysis buffer containing 50 mM Tris-HCl, 1% Nonidet-P40, 0.1% SDS, and 150 mM NaCl, supplemented with a complete protease inhibitor cocktail (Cat. No. 04693132001; Roche, Indianapolis, IN, USA), a phosphatase inhibitor (PhosSTOP; Cat. No. 04906845001; Roche), and PMSF (Cat. No. IP0280; Solarbio Life Sciences; Beijing, China). Samples were incubated on ice for 30 min, then centrifuged at 12,000 g for 10 min, and the supernatant was transferred to a new tube. Protein concentrations were determined using the BCA Protein Assay Kit (Thermo Fisher Scientific, Grand Island, NY, USA).
For immunoprecipitation, 1000 μg of protein was incubated with specific antibodies at 4 °C for 12 hr with constant rotation. Subsequently, 50 μL of 50% Protein A/G PLUS-Agarose beads was added, and the incubation continued for an additional 2 hr. Beads were washed five times with the lysis buffer and collected by centrifugation at 12,000 g for 2 min at 4 °C. After the final wash, the supernatant was removed and discarded. Precipitated proteins were eluted by resuspending the beads in 2x SDS PAGE loading buffer and boiling for 5 min. The eluates from immunoprecipitation were subjected to Western blot analysis.
ELISA
Request a detailed protocolThe concentrations of Il6 (EM0121) and Il1b (EM0109) in cell culture supernatant were measured using ELISA kit (FineTest, Wuhan, China). The experiments were conducted according to the protocols provided by the manufacturer.
Total RNA extraction and real-time quantitative PCR analysis
Request a detailed protocolTotal RNA was extracted from cells using RNA extraction kits (Transgen Biotech, ER501-01, Beijing, China). Reverse transcription was performed with a reverse transcription kit (Thermo Fisher Scientific, Grand Island, NY, USA). Quantitative PCR was conducted using SYBR Select (Thermo Fisher Scientific) according to the manufacturer’s protocol, with Gapdh serving as the internal control. The primers for quantitative real-time PCR are listed in Supplementary file 2.
Luciferase reporter assay
Request a detailed protocolThe Irf5-binding motif and the full-length ZNF217 promoter were ligated into pGl3-based plasmids (Genechem, Shanghai, China), as previously described (Qiao et al., 2022). HEK293T cells were seeded into 24-well plates and grown to 70–80% confluency. Cells were transfected with the firefly luciferase reporter plasmid containing the Irf5-responsive ZNF217 promoter along with a β-galactosidase reporter plasmid (Promega, Madison, WI, USA) for 24 hr. Subsequently, cells were then infected with adenovirus (Ad-ORF2 or Ad-Scramble) for an additional 24 hr. Relative luciferase activity was measured using a luciferase assay and normalized to β-galactosidase activity as determined by the β-Galactosidase Enzyme Assay System (Promega, Madison, WI, USA).
RNA-sequencing (RNA-seq)
Request a detailed protocolRNA-seq was performed as we previously described (Li et al., 2024). Wild-type (WT) and Aff3ir-ORF2-/- MEFs were harvested, and RNA was extracted using the MagicPure Total RNA Kit (TransGen, Beijing, China). Whole transcriptome RNA-seq analysis were conducted by the Beijing Genomics Institute (BGI). Paired-end sequencing in 150 bp length was performed using the DNBSEQ-G400 platform. Raw data was filtered using SOAPnuke (v1.5.6). Differential gene expression analysis, with thresholds set at p<0.05 and fold change ≥1.5, was performed via the BGI website (http://omiscribe.bgi.com). Pathway enrichment analysis was carried out using DAVID tools.
Statistical analysis
Request a detailed protocolStatistics analyses were performed using GraphPad Prism 8.0. No sample outliers were excluded. At least six independent experiments were performed for all biochemical experiments and the representative images were shown. Unpaired Student’s t-test (two-tailed), one-way ANOVA, or two-way ANOVA with Bonferroni multiple comparison post hoc test were used for analyses, as appropriate. Sample size, statistical method, and statistical significance are specified in Figures and Figure Legends. Levels of probabilities less than 0.05 were regarded as significant.
Data availability
Sequencing data have been deposited in GEO under accession codes GSE286206. All data generated or analysed during this study are included in the manuscript and supporting files; source data files have been provided for all figures.
-
NCBI Gene Expression OmnibusID GSE286206. Disruption of the Novel Nested Gene Aff3ir Mediates Disturbed Flow-Induced Atherosclerosis in Mice.
References
-
Advances and challenges in targeting IRF5, a key regulator of inflammationThe FEBS Journal 286:1624–1637.https://doi.org/10.1111/febs.14654
-
Vascular smooth muscle cells in atherosclerosisCirculation Research 118:692–702.https://doi.org/10.1161/CIRCRESAHA.115.306361
-
LAF4, an AF4-related gene, is fused to MLL in infant acute lymphoblastic leukemiaGenes, Chromosomes & Cancer 35:92–96.https://doi.org/10.1002/gcc.10091
-
IRF-5 accelerates leukocyte adhesion to endothelial cells in ischemia-reperfusion injury through regulating the transcription of VCAM-1Biochemical and Biophysical Research Communications 492:192–198.https://doi.org/10.1016/j.bbrc.2017.08.044
-
In vivo silencing of the transcription factor IRF5 reprograms the macrophage phenotype and improves infarct healingJournal of the American College of Cardiology 63:1556–1566.https://doi.org/10.1016/j.jacc.2013.11.023
-
Vascular mechanotransductionPhysiological Reviews 103:1247–1421.https://doi.org/10.1152/physrev.00053.2021
-
Purification of mouse embryonic fibroblasts (MEFs)Current Protocols 3:e921.https://doi.org/10.1002/cpz1.921
-
Oscillatory shear stress stimulates endothelial production of O2- from p47phox-dependent NAD(P)H oxidases, leading to monocyte adhesionThe Journal of Biological Chemistry 278:47291–47298.https://doi.org/10.1074/jbc.M305150200
-
Role of NADPH oxidases in disturbed flow- and BMP4- induced inflammation and atherosclerosisAntioxidants & Redox Signaling 8:1609–1619.https://doi.org/10.1089/ars.2006.8.1609
-
ChEA3: transcription factor enrichment analysis by orthogonal omics integrationNucleic Acids Research 47:W212–W224.https://doi.org/10.1093/nar/gkz446
-
IRF5 promotes inflammatory macrophage polarization and TH1-TH17 responsesNature Immunology 12:231–238.https://doi.org/10.1038/ni.1990
-
c-Abl regulates YAPY357 phosphorylation to activate endothelial atherogenic responses to disturbed flowThe Journal of Clinical Investigation 129:1167–1179.https://doi.org/10.1172/JCI122440
-
Endothelial YAP mediates hyperglycemia-induced platelet hyperactivity and arterial thrombosisArteriosclerosis, Thrombosis, & Vascular Biology 44:254–270.https://doi.org/10.1161/ATVBAHA.123.319835
-
CD147 sparks atherosclerosis by driving M1 phenotype and impairing efferocytosisCirculation Research 134:165–185.https://doi.org/10.1161/CIRCRESAHA.123.323223
-
Upregulation of VCAM-1 and ICAM-1 at atherosclerosis-prone sites on the endothelium in the ApoE-deficient mouseArteriosclerosis, Thrombosis, and Vascular Biology 18:842–851.https://doi.org/10.1161/01.atv.18.5.842
-
Partial carotid ligation is a model of acutely induced disturbed flow, leading to rapid endothelial dysfunction and atherosclerosisAmerican Journal of Physiology. Heart and Circulatory Physiology 297:H1535–H1543.https://doi.org/10.1152/ajpheart.00510.2009
-
DisGeNET: a comprehensive platform integrating information on human disease-associated genes and variantsNucleic Acids Research 45:D833–D839.https://doi.org/10.1093/nar/gkw943
-
Role of interferon regulatory factor 5 (IRF5) in tumor progression: Prognostic and therapeutic potentialBiochimica et Biophysica Acta. Reviews on Cancer 1879:189061.https://doi.org/10.1016/j.bbcan.2023.189061
-
The interferon system and interferon regulatory factor transcription factors -- studies from gene knockout miceCytokine & Growth Factor Reviews 12:133–142.https://doi.org/10.1016/s1359-6101(00)00032-0
-
In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9Nature Biotechnology 33:102–106.https://doi.org/10.1038/nbt.3055
-
IRF5 is a specific marker of inflammatory macrophages in vivoMediators of Inflammation 2013:245804.https://doi.org/10.1155/2013/245804
-
Immunity and inflammation in atherosclerosisCirculation Research 124:315–327.https://doi.org/10.1161/CIRCRESAHA.118.313591
-
Harmine alleviates atherogenesis by inhibiting disturbed flow-mediated endothelial activation via protein tyrosine phosphatase PTPN14 and YAPBritish Journal of Pharmacology 178:1524–1540.https://doi.org/10.1111/bph.15378
-
Coupling of Integrin α5 to Annexin A2 by flow drives endothelial activationCirculation Research 127:1074–1090.https://doi.org/10.1161/CIRCRESAHA.120.316857
Article and author information
Author details
Funding
National Natural Science Foundation of China (82330012 and 82127808)
- Yi Zhu
National Natural Science Foundation of China (82422006)
- Jinlong He
National Natural Science Foundation of China (32471166)
- Jinlong He
National Natural Science Foundation of China (82270516)
- Jinlong He
British Heart Foundation (FS-15/74/31669)
- Lingfang Zeng
Natural Science Foundation of Tianjin Municipality (24JCJQJC00060)
- Jinlong He
Natural Science Foundation of Tianjin Municipality (21JCYBJC01590)
- Lei Huang
Key Research Project in Traditional Chinese Medicine of Tianjin (2023013)
- Lei Huang
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
This work was supported by National Natural Science Foundation of China Grants (82330012, 82127808, 82422006, 32471166, and 82270516), British Heart Foundation (FS-15/74/31669), Natural Science Foundation of Tianjin (24JCJQJC00060 and 21JCYBJC01590), and the Key Research Project in Traditional Chinese Medicine of Tianjin (2023013).
Ethics
This study adhered to the Guide for the Care and Use of Laboratory Animals of the US National Institutes of Health (NIH Publication No. 85-23, revised 2011). All study protocols were approved by the Institutional Animal Care and Use Committee of Tianjin Medical University.
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.103413. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, He, Huang et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 603
- views
-
- 53
- downloads
-
- 2
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.
Citations by DOI
-
- 2
- citations for Version of Record https://doi.org/10.7554/eLife.103413.3