Force transmission through the inner kinetochore is enhanced by centromeric DNA sequences

  1. Elise Miedlar
  2. Grace E Hamilton
  3. Samuel R Witus
  4. Sara J Gonske
  5. Michael Riffle
  6. Alex Zelter
  7. Rachel E Klevit
  8. Charles L Asbury
  9. Yoana N Dimitrova
  10. Trisha N Davis  Is a corresponding author
  1. Department of Biochemistry, University of Washington, United States
  2. Department of Neurobiology and Biophysics, University of Washington, United States
  3. Department of Structural Biology, Genentech, Inc, United States

eLife Assessment

Centromeres are specific sites on chromosomes that are essential for mitosis and genome fidelity. This valuable research advance builds upon previous studies to convincingly show that the centromere-histone core contributes to force transduction through the kinetochore. The centromere mainly strengthens one of the two paths of force transduction, influenced by the centromeric DNA sequence. The mechanism underlying this phenomenon will be an exciting future avenue of research, given that centromeric DNAs are not conserved. This work will be of interest to those studying cell division and chromosome segregation.

https://doi.org/10.7554/eLife.105150.3.sa0

Abstract

Previously, we reconstituted a minimal functional kinetochore from recombinant Saccharomyces cerevisiae proteins that was capable of transmitting force from dynamic microtubules to nucleosomes containing the centromere-specific histone variant Cse4 (Hamilton et al., 2020). This work revealed two paths of force transmission through the inner kinetochore: through Mif2 and through the Okp1/Ame1 complex (OA). Here, using a chimeric DNA sequence that contains crucial centromere-determining elements of the budding yeast point centromere, we demonstrate that the presence of centromeric DNA sequences in Cse4-containing nucleosomes significantly strengthens OA-mediated linkages. Our findings indicate that centromeric sequences are important for the transmission of microtubule-based forces to the chromosome.

Introduction

The kinetochore is an assembly of protein subcomplexes that links dynamic microtubule plus ends to chromosomes via centromeric nucleosomes (Ariyoshi and Fukagawa, 2023). Through this linkage, kinetochores transmit force from microtubules to chromosomes to align them on the metaphase plate during mitosis, putting both kinetochores and centromeres under tension. This tension signals that kinetochores are correctly bioriented and is a key aspect of the kinetochore’s ability to regulate entry into anaphase and prevent aneuploidy (Akiyoshi et al., 2010; Nicklas and Ward, 1994).

Centromeres in most eukaryotes are defined by the presence of a centromere-specific histone variant, called Cse4 in budding yeast (also known as CENP-A). The yeast ‘point’ centromere is also defined by DNA sequence – approximately 125 bp in three centromere-determining elements, CDEI, CDEII, and CDEIII (Clarke and Carbon, 1980; Clarke and Carbon, 1985). Both the Cse4-containing histone octamer and the centromere-specific DNA elements provide a scaffold for kinetochore assembly. Previously, we showed that kinetochore assemblies built from recombinant Saccharomyces cerevisiae proteins can transmit force through either Mif2 or OA as the inner kinetochore subcomplex binding the centromeric nucleosome (Hamilton et al., 2020). In that study, we used recombinant nucleosome core particles (NCPs) wrapped with the Widom 601 DNA (W601-NCPs), which has a sequence that wraps canonical histone octamers with high efficiency (Lowary and Widom, 1998). The Widom 601 sequence has also fortuitously enabled stable wrapping of centromeric histone octamers in vitro where it would not otherwise be possible. However, Widom 601 DNA does not contain any native centromeric DNA, and therefore we could not address the relationship between centromere-specific DNA and force transmission.

Here, we develop a chimeric DNA sequence (CCEN) that combines native centromeric sequence with Widom 601 sequence to reconstitute centromeric nucleosomes. The chimera includes a portion of CDEII and all of CDEIII from the native centromere to allow for DNA-dependent binding between the NCPs and the kinetochore, as well as segments of Widom 601 DNA at the ends to facilitate stable wrapping. Centromeric histone octamers wrapped with CCEN DNA are stable and thus provide an opportunity to measure the contribution of DNA sequence to the strength of kinetochore attachments.

We found that OA-based assemblies withstood significantly higher forces when nucleosomes were wrapped in the chimeric DNA, while we did not detect significant strengthening of Mif2-based assemblies. Our findings show that centromere-specific DNA sequence elements make significant contributions, either directly or indirectly, to the attachment strength between the inner kinetochore and the centromeric nucleosome.

Results

We produced NCPs by wrapping 147 bp chimeric centromeric DNA (CCEN) or Widom 601 DNA (W601) around recombinant Cse4, H2A, H2B, and H4 histone octamers (Figure 1A). The latter three histones had a polyhistidine tag (His6) to facilitate purification and allow NCP binding to the polystyrene beads used in the optical trap rupture force assay. After the initial wrapping, NCPs were purified over a size-exclusion chromatography column (Figure 1B and C). As in our previous study (Hamilton et al., 2020), we also purified five recombinant kinetochore subcomplexes that can self-assemble onto the NCPs to create a minimal, functional kinetochore: OA, Mif2, MIND, Ndc80c, and Dam1c.

Recombinantly wrapped nucleosome core particles (NCPs) with W601 or CCEN DNA.

(A) Sequences of the W601 and CCEN DNA used to wrap histone octamers. The black text is W601 DNA, the black text highlighted in yellow is the portion of CDEII corresponding to the Mif2 footprint (Xiao et al., 2017), the cyan text is CDEIII, the sequence underlined in green is the CBF3 binding site (Guan et al., 2021), and the blue text is the pericentromeric DNA sequence just downstream of CDEIII on chromosome III. (B) Chromatogram representing elution fractions from size-exclusion chromatography column used to purify wrapped NCPs from excess free DNA. 260 nm signal is shown for both W601 and CCEN NCPs. (C) Native gel of elution fractions indicated in the chromatogram in (B). NCPs from both SEC Fraction 6 and SEC Fraction 7 were used to collect data on the optical trap. There was no statistically significant difference between rupture forces of assemblies measured with NCPs from either Fraction 6 or Fraction 7.

Before determining the quantitative rupture strength that each kinetochore assembly could withstand, we confirmed that the recombinant elements could spontaneously build a functional kinetochore as previously described (Hamilton et al., 2020). Briefly, the NCPs bearing His6-tags were bound directly to polystyrene microbeads via anti-His6 antibodies. The remaining subcomplexes, which did not have His6-tags, were added free in solution and bound to the beads only indirectly by assembling with the directly tethered, His6-tagged NCP. Using a laser trap to manipulate individual beads, we tested the kinetochore assemblies for their ability to bind microtubules. Each bead was brought to the dynamic plus end of a microtubule anchored onto the surface of the flow chamber. If the bead bound to the microtubule when released from the laser trap, then the kinetochore assembly was designated as functional, and the bead was used for the rupture force assay.

With either OA or Mif2 in solution, over 78% of beads coated in W601-NCPs or CCEN-NCPs could bind microtubules (Figure 2A, Table 1). Negative controls where OA or Mif2 was omitted from solution were also performed to confirm the specificity of the NCP for its inner kinetochore binding partner over the outer kinetochore components of the assembly. The negative controls showed 0% bead binding to microtubules, confirming that functional kinetochores are only assembled on NCPs when either OA or Mif2 is present in solution. After a bead was designated as functional, the rupture force of the assembled chain was tested as described in the ‘Materials and methods’.

Kinetochore assemblies built on CCEN-NCPs and OA form stronger attachments to microtubules.

(A) Percentages of beads that had microtubule binding capability. Error bars indicate the standard error of the proportion. Barnard’s test was used to compare contingency tables. The p-values for the significance of the difference between fraction of beads bound if either OA or Mif2 were included compared to if neither were included are given in Table 1. Data were combined from two biological replicates (see Figure 2—source data 1). (B) Boxplot of rupture forces for each of the kinetochore assemblies tested. Dots represent individual rupture events, and boxes enclose the interquartile range, with indicated medians. Whiskers extend to the inner fences. Data were combined from four biological replicates of each condition (see Figure 2—source data 1). A Kolmogorov–Smirnov test was performed to compare the probability distributions of rupture forces across conditions. *** indicates p-value of 1.87 × 10–6, n.s., not significant. (C) Survival probability curves for the data plotted in (B).

Figure 2—source data 1

Excel file of data for Figure 2A and B and a list of the number of technical and biological replicates for Figure 2A and B.

https://cdn.elifesciences.org/articles/105150/elife-105150-fig2-data1-v1.xlsx
Table 1
Statistical analyses for microtubule binding assay*.
ConditionCCEN NCP neither OA nor Mif2W601 NCP neither OA nor Mif2
W601 NCP, OAN/A2.61 × 10–12
CCEN NCP, OA3.55 × 10–13N/A
W601 NCP, Mif2N/A2.31 × 10–12
CCEN NCP, Mif24.27 × 10–7N/A
  1. N/A, not applicable.

  2. *

    p-Values for comparison of data in Figure 2A determined by a Barnard’s test.

W601 OA vs. CCEN OA

Although OA has not previously been reported to specifically bind centromeric DNA sequence elements (Hornung et al., 2014), kinetochore assemblies that relied on OA were significantly stronger when assembled on CCEN-NCPs relative to those assembled on W601-NCPs (p=1.87 × 10–6). The median rupture force for OA-based assemblies on CCEN-NCPs was 6.0 pN compared to the W601-NCP median of 4.2 pN (Figure 2B and C).

W601 Mif2 vs. CCEN Mif2

CCEN-NCP assemblies with Mif2 were not significantly stronger than assemblies with W601-NCPs (p=0.302), which was surprising given that the CDEII region of the centromere that contains a Mif2-binding footprint (Xiao et al., 2017) was present in our chimera. The median rupture force for Mif2-based assemblies on CCEN-NCPs was 2.9 pN, which was slightly higher but not significantly different than the W601-NCP median of 2.5 pN (Figure 2B and C).

Discussion

Previous work showed that OA nonspecifically binds to free CEN3 and non-CEN3 DNA fragments, suggesting a sequence-independent OA-DNA binding interaction (Hornung et al., 2014). OA is also known to bind the unstructured N-terminus of Cse4 (Anedchenko et al., 2019; Fischböck-Halwachs et al., 2019; Shukla et al., 2024). Here, we find that the strength of OA-based assemblies, when tested in the context of wrapped nucleosomes, is higher when the nucleosomes are wrapped with a CEN3-containing DNA sequence versus when the nucleosomes are wrapped with W601 DNA. This result, together with that of Hornung et al., 2014, implies a difference in the importance of centromeric DNA sequences when OA binds to free DNAs as opposed to DNA wrapped around a nucleosome. We propose two possibilities to rationalize this difference. First, the effect could be indirect; an NCP wrapped with the chimeric CCEN DNA might present the N-terminal tail of Cse4 more favorably to OA, thereby increasing the rupture strength of OA-mediated kinetochore assemblies. Alternatively, OA could demonstrate sequence preferences but only when the DNA is bent around a nucleosome and not when presented as free DNA. In support of this possibility, the recent structure of the inner kinetochore wrapped around a nucleosome shows that a small segment of OA is near the wrapped DNA (Dendooven et al., 2023).

Xiao et al., 2017 showed that both Cse4 and CEN DNA contribute to Mif2 binding to centromeric nucleosomes. Our prior work found that Mif2-based kinetochore assemblies could form on Cse4 containing nucleosomes wrapped with W601 DNA but not on H3-containing nucleosomes wrapped with W601 DNA (Hamilton et al., 2020) as expected given the 100-fold lower affinity Mif2 has for H3-based nucleosomes (Xiao et al., 2017). Xiao and coworkers also found that Mif2 has a 30-fold higher affinity for CEN3 DNA-wrapped nucleosomes than for nucleosomes wrapped with pericentromeric DNA and 100-fold higher affinity compared to nucleosomes wrapped with W601 DNA. They showed that Mif2 footprints a 35 base pair section at the end of CDEII in CEN3. Here, we wrapped Cse4 nucleosomes with CCEN DNA, which includes all 35 base pairs of the Mif2 footprint in CDEII and compared their properties to those wrapped with W601 DNA. In our experiments, Mif2 did not exhibit significant DNA sequence specificity for CCEN over W601. A key difference between CCEN and CEN3 DNA is that CCEN is missing 47 bp of CDEII. Our results suggest that the increased affinity of Mif2 for CEN3 DNA observed by Xiao and coworkers might require more than just the portion of CDEII that is footprinted by Mif2. Current structures of the yeast inner kinetochore assembled on NCPs either do not include Mif2 or reveal only a peptide of it (Dendooven et al., 2023; Yan et al., 2019). Our results suggest that a substantial portion of CEN3 might be required to stably assemble Mif2 on the NCP.

It has not yet been possible to obtain structures of yeast NCPs wrapped in authentic CEN3 DNA without using some method to stabilize the NCPs. Guan and coworkers solved a structure of yeast centromeric CEN3 DNA-wrapped NCPs bound to a stabilizing antibody. This structure did not include inner kinetochore proteins (Guan et al., 2021). Three structures of yeast NCPs bound to inner kinetochore components have also been solved (Dendooven et al., 2023; Guan et al., 2021; Yan et al., 2019), all of which relied either on W601 DNA or hybrid DNAs that contained 6 bp of CDEII, all of CDEIII, and sequences downstream of CDEIII (Table 3). Here, we describe a new chimera of CEN3 and W601 DNA (CCEN) that includes 35 bp of CDEII as well as all of CDEIII and the region downstream of CDEIII. CCEN stably wrapped yeast centromeric histone octamers and revealed new DNA sequence preferences not previously appreciated.

Conclusion

We have developed a chimeric DNA sequence (CCEN) that represents an advance toward working with a more native-like recombinant kinetochore. Using centromeric nucleosomes wrapped with CCEN DNA, we have confirmed previous findings that OA and Mif2 can independently support recombinant kinetochore assembly. We showed previously that they can distinguish centromeric versus non-centromeric nucleosomes based on histone identity (Hamilton et al., 2020). Here, we provide the first evidence that OA also distinguishes between centromeric and non-centromeric nucleosomes on the basis of DNA sequence. We also show that Mif2 requires more than the DNA binding site identified by footprinting to display sequence preferences.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Escherichia coli)Rosetta (DE3) pLys competent cellsNovagenCat# 71403
AntibodyMonoRab anti-DYKDDDDK Affinity ResinGenScriptCat# L00766
Biological sample (Bos taurus)TubulinLab purificationIsolated from Bos taurus brains
Protocol adopted from Castoldi and Popov, 2003
AntibodyBiotinylated Anti-His tag antibodyR&D SystemsCat# BAM050
RRID:AB_356845
Chemical compound, drugGlucose oxidaseMilliporeSigmaCat# 345386
Chemical compound, drugCatalaseMilliporeSigmaCat# E3289
Chemical compound, drugBiotinylated bovine serum albumin (BSA)Vector laboratoriesCat# B-2007
Chemical compound, drugAvidin DNVector LaboratoriesCat# A-3100
Chemical compound, drugTCEPThermo FisherCat# 20490
OtherStreptavidin-coated polystyrene beadsSpherotechSVP-05-10
SoftwareLabviewNational InstrumentsRRID:SCR_014325
SoftwareIgor ProWavemetricsRRID:SCR_000325

Plasmids

Plasmids are listed in Table 2. Plasmid pAZ144 was derived from pSc_Mf_7, which expressed Mif2-linker-(27-392)MBP-His6 (Hamilton et al., 2020). Agilent’s QuikChange Lightning Site-Directed Mutagenesis Kit (product number: 210518) was used according to the manufacturer’s instructions to loop out the His6 tag from pSc_Mf_7 and modify the C terminal end of the MBP tag to make it identical to the Escherichia coli MBP protein. To this end, amino acids GSSHHHHHH were removed and replaced with the native C terminal sequence of the E. coli MBP protein (QTRITK), resulting in a new coding sequence encoding Mif2-linker-(27-392)MBP. The forward and reverse primers used for this were GAAAGACGCGCAGACTCGTATTACCAAATAATAAACCAACTCCATAAGG and CCTTATGGAGTTGGTTTATTATTTGGTAATACGAGTCTGCGCGTCTTTC, respectively. In all other respects, pAZ144 was identical to pSc_Mf_7. Plasmids are available from the corresponding author.

Table 2
Plasmids used for expression of kinetochore proteins*.
ProteinPlasmidComponentsReferences
NucleosomepScKl2K. lactis His6-H2A,
K. lactis His6-H2B,
Cse4,
K. lactis His6-H4
Migl et al., 2020
OApGH3Okp1, Ame1-FLAGHamilton et al., 2020
Mif2pAZ144Mif2-MBPThis study
2D-MINDpGH62FLAG-Nsl1, S240D & S250D Dsn1, Mtw1, Nnf1Hamilton et al., 2020
(230-576) 2D-MINDpEHM4FLAG-Nsl1, (230-576) S240D & S250D Dsn1, Mtw1, Nnf1Hamilton et al., 2020
Ndc80cpJT48
Ndc80/Nuf2
Spc24-FLAG, Spc25
Ndc80, Nuf2
Kudalkar et al., 2015; Wei et al., 2005
Dam1cpJT44Spc34-FLAG, Dad1, Dad2, Dad3, Dad4 Duo1, Dam1, Hsk3, Spc19, Ask1Umbreit et al., 2014
  1. *

    All proteins are from Saccharomyces cerevisiae except as noted.

Design of chimeric centromeric DNA sequence

Request a detailed protocol

The chimeric centromeric DNA sequence (CCEN) is a chimera of CEN3 and Widom 601 DNA. CCEN is 147 bp long and includes four elements: (i) the first 62 bp of W601, (ii) 35 bp of CDEII that includes the Mif2 footprint (Xiao et al., 2017), (iii) the rest of the CBF 3 binding site (Guan et al., 2021), which is all of CDEIII (25 bp) and 17 bp downstream of CDEIII, and (iv) the last 8 bp of W601. (Note that the 48 bp CBF3 binding site overlaps with the last 6 bp of the Mif2 binding site; Guan et al., 2021.) Of the five CEN3-W601 chimeras tested, CCEN was chosen for further study because it included both the Mif2 footprint and the CBF3 binding site, and it stably wrapped centromeric histone octamers such that the nucleosomes could be further purified by size-exclusion chromatography. A construct containing all the CEN3 sequences and no W601 DNA did not stably wrap histone octamers in our hands (Table 3).

Table 3
DNA sequences tested for ability to wrap centromeric nucleosomes.
NameSequence*Wrapped?Stable duringSEC?
W601ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGC
TCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTA
ACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATA
TATACATCCGAT
YesYes
CEN 3 AAAGCTATTCATTGAAAAAATAGTACAAATAAGTCACATGATGATATTTGATTTTATTATATTTTTAAAAAAAGTAAAAAATAAAAAGTA
GTTTATTTTTAAAAAATAAAATTTAAAATATTAGTGTATTTGATT
TCCGAAAGTTAAAA
AAGAAATAGTAAGAAATATATATTT
SomeNo
CEN 5.1AAAGCTATTCATTGAAAAAATAGTACAAATAAGTCACATGATCGA
GAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAG
CACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGC
CAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATAC
ATCCGATTATTTGATTTCCGAAAGTTAAAAAAGAAATAGTAAGAA
ATATATATTT
YesYes
CEN3-601 (Xiao et al., 2017)ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGC
TCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTA
ATATTAGTGTATTTGATTTCCGAAAGTTAAAAAAGAAATAGTAAG
AAATCATCCGAT
YesYes
CCENATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGC
TCTAGCACCGCTTAAACAGTTTATTTTTAAAAAATAAAATTTAAA
ATATTAGTGTATTTGATTTCCGAAAGTTAAAA
AAGAAATAGTAAG
AAATCATCCGAT
YesYes
CEN 6.3ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGC
TCTAGCACCGCTTAAACAGTTTATTTTTAAAAAATAAAATTTAAA
ATATTAGAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATA
TATACATCCGAT
YesND §
CEN 6.4ATCGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGC
TCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTA
ACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATA
TATACATCCGATGCCGCCAGTTTATTTTTAAAAAATAAAATTTAA
AATATTAG
SomeND §
CON3 (Dendooven et al., 2023)ATAAGTCACATGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCT
CTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAA
TATTAGTGTATTTGATTTCCGAAAGTTAAAAAAGAAATAGTAAGA
AATATATATTTCATTGAA
ND §ND §
  1. ND, not determined.

  2. *

    W601 DNA in black font; Genomic DNA upstream or downstream of CEN3 in blue font; CDEI in purple font; CDEII in red font; CDEII Mif2 footprint in red font and underlined; CDEIII in purple font and underlined; linker DNA highlighted in bold.

  3. These are the DNA sequences used to wrap the nucleosomes tested in the optical trapping assay in this paper.

  4. The construct used by Xiao et al., 2017 included only the 147 bp of CEN3 and none of the upstream or downstream sequences.

  5. §

    Not determined.

  6. Shown for comparison only.

NCP wrapping

Request a detailed protocol

Yeast histones were purified as described (Hamilton et al., 2020). W601 DNA and CCEN DNA were purchased from Integrated DNA Technologies. Mononucleosome core particles were reconstituted by the standard salt dialysis method as described (Witus et al., 2023) with two exceptions. First, the nucleosomes contained S. cerevisiae histone Cse4, and K. lactis histones H2A, H2B, and H4, the latter three were tagged with 6X-His. Second, the W601 DNA and histones were combined in a 1:1.80 molar ratio, while CCEN DNA and histones were combined in a 1:1.55 molar ratio. Nucleosomes were further purified by size-exclusion chromatography using a 24 ml Superdex 200 increase 10/300 column equilibrated in NCP storage buffer (30 mM HEPES buffer [pH 7.5], 10 mM NaCl, 0.1 mM EDTA, 0.5 mM TCEP). NCPs purified by size-exclusion chromatography were stored on ice at 4°C and used within 5 days of purification.

Purification of kinetochore proteins

OA, Mif2, MIND, Ndc80c, and Dam1c were expressed as described with slight modifications (Hamilton et al., 2020). Briefly, each complex was expressed from a polycistronic vector (Table 2) in Rosetta 2 DE3 pLysS cells (Novagen). Cells were grown to OD600=0.6 and induced with 0.3 mM isopropyl β-d-1-thiogalactopyranoside for 16–18 hours at 18°C. After the induction period, cells were pelleted and washed with PBS containing 1 mM PMSF. Cell pellets were frozen in liquid nitrogen and stored at –80°C until purification.

MIND-FLAG

Request a detailed protocol

On the day of purification, cell pellets were resuspended in MIND-lysis buffer (Table 4), and cells were lysed using a French Press and lysates were cleared by high-speed centrifugation. The cleared lysate was incubated with 2 ml of MonoRab anti-DYKDDDDK Affinity Resin (L00766; GenScript) for 30 minutes. After the resin was washed with 10 column volumes of MIND-wash buffer (Table 4), the immobilized protein was incubated for 30 min with MIND-elution buffer (Table 4) containing 200 µg/ml 3x FLAG peptide (F4799; Sigma). Eluate from the anti-FLAG resin was collected and further purified by size-exclusion chromatography in MIND-SEC buffer on a 120 ml Superdex 200 column (28-9893-35; GE Healthcare). Eluted fractions were pooled and concentrated if necessary using an Amicon Ultra centrifugal filter (UFC805008; Millipore). Purified protein was stored in MIND-SEC buffer with 5% glycerol at –80°C. Protein concentration was measured via the bicinchoninic acid assay (Thermo Fisher and Sigma-Aldrich).

Table 4
Kinetochore protein purification buffers.
ProteinPurification buffers
Dam1c-FLAGLysis: 50 mM sodium phosphate buffer pH 6.9, 500 mM NaCl, 1 mM PMSF, Roche protease inhibitor tablets
FLAG wash: 50 mM sodium phosphate buffer pH 6.9, 500 mM NaCl, 1 mM PMSF, Roche protease inhibitor tablets
FLAG elution: 50 mM sodium phosphate buffer pH 6.9, 500 mM NaCl, 1 mM PMSF, Roche protease inhibitor tablets, 200 ug/ml 3x FLAG peptide
SEC: 50 mM sodium phosphate buffer pH 6.9, 500 mM NaCl
Mif2-MBPLysis: 30 mM HEPES buffer pH 7.5, 2 M NaCl, 10% glycerol, 1 mM TCEP, 1 mM PMSF, Roche protease inhibitor tablets
Amylose resin elution: 30 mM HEPES buffer pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM TCEP, 1 mM PMSF, Roche protease inhibitor tablets, 10 mM maltose
QA: 30 mM HEPES buffer pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM TCEP, 1 mM PMSF, Roche protease inhibitor tablets
QB: 30 mM HEPES buffer pH 7.5, 1 M NaCl, 10% glycerol, 1 mM TCEP
MIND-FLAGLysis: 50 mM HEPES buffer pH 7.5, 200 mM NaCl, 10% glycerol, 0.5% NP40, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets
FLAG wash: 50 mM HEPES buffer pH 7.5, 200 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets
FLAG elution: 50 mM HEPES buffer pH 7.5, 200 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets, 200 ug/ml 3x FLAG peptide
SEC: 50 mM HEPES buffer pH 7.5, 200 mM NaCl, 1 mM EDTA
Ndc80c-FLAGLysis: 50 mM HEPES buffer pH 7.6, 200 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets
FLAG wash: 50 mM HEPES buffer pH 7.6, 200 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets
FLAG elution: 50 mM HEPES buffer pH 7.6, 200 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets, 200 ug/ml 3x peptide
SEC: 50 mM HEPES buffer pH 7.6, 200 mM NaCl, 1 mM EDTA
OA-FLAGLysis: 50 mM HEPES buffer pH 7.5, 200 mM NaCl, 10% glycerol, 0.5% NP40, 1 mM PMSF, Roche protease inhibitor tablets
Low salt FLAG wash: 50 mM HEPES buffer pH 7.5, 200 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets
High salt FLAG wash: 50 mM HEPES buffer pH 7.5, 2 M NaCl, 10% glycerol, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets
FLAG elution: 50 mM HEPES buffer pH 7.5, 200 mM NaCl, 10% glycerol, 1 mM EDTA, 1 mM PMSF, Roche protease inhibitor tablets, 200 ug/ml 3x FLAG peptide
SEC: 50 mM HEPES buffer pH 7.5, 200 mM NaCl, 1 mM EDTA

OA-FLAG

Request a detailed protocol

OA-FLAG was purified as described for MIND-FLAG except that the OA-lysis, OA-elution, and OA-SEC buffers listed in Table 4 were used. Additionally, the immobilized OA on the FLAG resin was washed with eight-column volumes of OA-high-salt wash and two-column volumes of OA-low-salt wash prior to elution in order to remove co-purifying bacterial DNA.

Mif2-MBP

Request a detailed protocol

Mif2-MBP was purified as described (Hamilton et al., 2020), with three exceptions. First, the Mif2-lysis, Mif2-amylose elution, Mif2-QA, and Mif2-QB buffers listed in Table 4 were used. Second, Mif2 was eluted from the anion exchange column with a 0–80% gradient of QB. Third, Mif2 was not subjected to size-exclusion chromatography.

Ndc80c-FLAG

Request a detailed protocol

Ndc80c-FLAG was purified as described for MIND-FLAG with two exceptions. First, the Ndc80c-lysis, Ndc80c-wash, Ndc80c-elution, and Ndc80c-SEC buffers listed in Table 4 were used. Second, the eluate from the FLAG affinity resin was concentrated in a 50 kDa molecular weight cutoff concentrator prior to loading on the Superdex 200 column.

Dam1c-FLAG

Request a detailed protocol

Dam1c-FLAG was purified as described for MIND-FLAG, except the Dam1c-lysis, Dam1c-wash, Dam1c-elution, and Dam1c-SEC-specific buffers listed in Table 4 were used.

Optical trap assay

Request a detailed protocol

Slide preparation for the optical trap assay was performed as previously described (Flores et al., 2022; Hamilton et al., 2020) with changes to the buffers listed below. 40 nM His6-NCPs and anti-His6 beads were incubated in bead incubation buffer (30 mM HEPES [pH 7.5], 10 mM NaCl, 1 mM EDTA, 0.5 mM TCEP, 2 mg/ml κ-casein) for 30 minutes. All kinetochore proteins were diluted in a buffer containing 1x BRB80 (80 mM PIPES pH 6.9, 1 mM MgCl2, 1 mM EGTA) and 2 mg/ml κ-casein before addition to the reaction mix. The reaction mix contained 1x BRB80, 1 mM GTP, 8 mg/ml BSA, 0.05 mg/ml biotinylated BSA, 0.8 mM DTT, 250 µg/ml glucose oxidase, 30 µg/ml catalase, 3.6 mg/ml glucose, and 16 µM tubulin in addition to the non-His6 tagged proteins free in solution. 10 nM OA or 20 nM Mif2, 10 nM 2D-MIND, 10 nM Ndc80c, and 5 nM Dam1c were used in the trapping assays. Optical trap assays were performed at room temperature using custom instrumentation to capture and manipulate beads as described (Franck et al., 2010). Rupture force assays were performed as described (Hamilton et al., 2020). Once beads were bound to microtubule tips, a test force of 1 pN was applied, and only beads that tracked with ~100 nm of tip growth were subjected to ramping force of 0.25 pN until detachment. All attachments that withstood the 1 pN preload force were included in our analysis. Each slide was used to collect data for no more than 90 minutes.

Data analysis and visualization

Request a detailed protocol

Igor Pro (Wavemetrics) was used to analyze data from optical trap assays and generate graphs for figures. Adobe Illustrator was used to generate figures.

Data availability

Figure 1—source data 2 contains the original image of the native gel shown in Figure 1C. Figure 2—source data 1 contains the numerical data used to generate Figure 2A and 2B.

References

Article and author information

Author details

  1. Elise Miedlar

    Department of Biochemistry, University of Washington, Seattle, United States
    Present address
    University of Pennsylvania, Philadelphia, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0009-0009-8209-5210
  2. Grace E Hamilton

    Department of Biochemistry, University of Washington, Seattle, United States
    Present address
    Department of Chemistry, High Point University, High Point, United States
    Contribution
    Conceptualization, Supervision, Investigation, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0522-0702
  3. Samuel R Witus

    Department of Biochemistry, University of Washington, Seattle, United States
    Present address
    Department of Molecular and Cell Biology, University of California, Berkeley, United States
    Contribution
    Supervision, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1907-8484
  4. Sara J Gonske

    Department of Biochemistry, University of Washington, Seattle, United States
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0009-0003-5491-9469
  5. Michael Riffle

    Department of Biochemistry, University of Washington, Seattle, United States
    Present address
    Department of Genome Sciences, University of Washington, Seattle, United States
    Contribution
    Data curation, Formal analysis, Validation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1633-8607
  6. Alex Zelter

    Department of Biochemistry, University of Washington, Seattle, United States
    Present address
    Department of Genome Sciences, University of Washington, Seattle, United States
    Contribution
    Supervision, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5331-0577
  7. Rachel E Klevit

    Department of Biochemistry, University of Washington, Seattle, United States
    Contribution
    Resources, Supervision, Funding acquisition
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3476-969X
  8. Charles L Asbury

    Department of Neurobiology and Biophysics, University of Washington, Seattle, United States
    Contribution
    Conceptualization, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Investigation, Visualization, Methodology, Project administration, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0143-5394
  9. Yoana N Dimitrova

    Department of Structural Biology, Genentech, Inc, South San Francisco, United States
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Visualization, Methodology
    Competing interests
    Affiliated with Genentech, Inc; the author has no other competing interests to declare
  10. Trisha N Davis

    Department of Biochemistry, University of Washington, Seattle, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Project administration, Writing – review and editing
    For correspondence
    tdavis@uw.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4797-3152

Funding

National Institute of General Medical Sciences (R35GM130293)

  • Trisha N Davis

National Institute of General Medical Sciences (R35GM134842)

  • Charles L Asbury

National Cancer Institute (R01CA260834)

  • Rachel E Klevit

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Mai Bayarjargal, Emmanuel Boakye-Ansah and Eric Muller for helpful discussions. This work was funded by NIH Grants R35GM130293 to TND, R35GM134842 to CLA, and R01CA260834 to REK.

Version history

  1. Sent for peer review:
  2. Preprint posted:
  3. Reviewed Preprint version 1:
  4. Reviewed Preprint version 2:
  5. Version of Record published:

Cite all versions

You can cite all versions using the DOI https://doi.org/10.7554/eLife.105150. This DOI represents all versions, and will always resolve to the latest one.

Copyright

© 2025, Miedlar et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 913
    views
  • 36
    downloads
  • 0
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Elise Miedlar
  2. Grace E Hamilton
  3. Samuel R Witus
  4. Sara J Gonske
  5. Michael Riffle
  6. Alex Zelter
  7. Rachel E Klevit
  8. Charles L Asbury
  9. Yoana N Dimitrova
  10. Trisha N Davis
(2025)
Force transmission through the inner kinetochore is enhanced by centromeric DNA sequences
eLife 14:RP105150.
https://doi.org/10.7554/eLife.105150.3

Share this article

https://doi.org/10.7554/eLife.105150