1. Cell Biology
  2. Developmental Biology
Download icon

Ciliary transcription factors and miRNAs precisely regulate Cp110 levels required for ciliary adhesions and ciliogenesis

  1. Peter Walentek  Is a corresponding author
  2. Ian K Quigley
  3. Dingyuan I Sun
  4. Umeet K Sajjan
  5. Christopher Kintner
  6. Richard M Harland  Is a corresponding author
  1. University of California, United States
  2. Salk Institute for Biological Studies, United States
Research Article
  • Cited 29
  • Views 2,602
  • Annotations
Cite this article as: eLife 2016;5:e17557 doi: 10.7554/eLife.17557


Upon cell cycle exit, centriole-to-basal body transition facilitates cilia formation. The centriolar protein Cp110 is a regulator of this process and cilia inhibitor, but its positive roles in ciliogenesis remain poorly understood. Using Xenopus we show that Cp110 inhibits cilia formation at high levels, while optimal levels promote ciliogenesis. Cp110 localizes to cilia-forming basal bodies and rootlets, and is required for ciliary adhesion complexes that facilitate Actin interactions. The opposing roles of Cp110 in ciliation are generated in part by coiled-coil domains that mediate preferential binding to centrioles over rootlets. Because of its dual role in ciliogenesis, Cp110 levels must be precisely controlled. In multiciliated cells, this is achieved by both transcriptional and post-transcriptional regulation through ciliary transcription factors and microRNAs, which activate and repress cp110 to produce optimal Cp110 levels during ciliogenesis. Our data provide novel insights into how Cp110 and its regulation contribute to development and cell function.



Cilia are membrane-covered cell protrusions containing an axoneme of microtubules. Modified centrioles, called basal bodies, dock to the cell membrane, serve as microtubule organizing centers (MTOCs) during cilia formation and anchor cilia to the membrane as well as to the Actin cytoskeleton (Marshall, 2008). Because centrioles also act as MTOCs during spindle formation, cell division and cilia formation are mutually exclusive events. Thus, switching from cell division to cilia formation needs precise molecular regulation at the centriole (Avidor-Reiss and Gopalakrishnan, 2013). One key event during this process is the removal of the Centriolar Coiled Coil Protein 110kDa (Cp110) from the distal end of the mother centriole, which then matures into a basal body (Tsang and Dynlacht, 2013). Failure of distal end removal or excess cellular levels of Cp110 prevent cilia formation in various cell types. Conversely, loss of Cp110 was suggested to initiate aberrant cilia formation during the cell cycle (Spektor et al., 2007). Of note, some studies indicate that Cp110 knockdown initiates elongation of cytoplasmic centrioles, rather than bona fide cilia formation (Schmidt et al., 2009).

In our previous work, we demonstrated that Cp110 also inhibits cilia formation in multi-ciliated cells (MCCs) of mucociliary epithelia (Song et al., 2014). MCCs can form >100 basal bodies, and their biogenesis occurs through an alternative, MCC-specific deuterosome pathway (Brooks and Wallingford, 2014; Zhang and Mitchell, 2015). MCC cilia are motile and account for the generation of directional extracellular fluid flow along epithelia, such as that required for mucus clearance from the conducting airways (Mall, 2008). Interestingly, while Cp110 levels are mainly regulated via the ubiquitin-dependent proteasome system during the cell cycle (D'Angiolella et al., 2010; Li et al., 2013), Cp110 levels in differentiated MCCs are also subject to post-transcriptional repression by microRNAs (miRs) from the miR-34/449 family (Song et al., 2014). Surprisingly, we also found that loss of Cp110 inhibits cilia formation in MCCs (Song et al., 2014), suggesting a more complex, and supportive role for Cp110 in ciliogenesis than previously anticipated. A recent report further supports this view, as deletion of Cp110 exon 5 impairs primary cilia formation in the mouse (Yadav et al., 2016).

Here, we use Xenopus embryos, whose epidermis provides a readily accessible model to study MCCs of mucociliary epithelia (Werner and Mitchell, 2012), as well as other mono-ciliated cells (Schweickert and Feistel, 2015). We show that Cp110 localizes to cilia-forming basal bodies and is required for the formation and function of all principal types of cilia (i.e. primary sensory cilia, motile mono-cilia and motile cilia of MCCs). In MCCs, Cp110 is specifically needed for ciliary adhesion complex (Antoniades et al., 2014) formation and basal body interactions with the Actin cytoskeleton. Furthermore, we demonstrate that Cp110's opposing roles in ciliogenesis are determined by its multi-domain protein structure. Due to its dual role, optimal Cp110 levels need to be produced to facilitate multi-ciliogenesis. We provide evidence, that optimal regulation of cellular Cp110 levels in MCCs is achieved through a transcriptional/post-transcriptional gene regulatory module, consisting of ciliary transcription factors and miRNAs (Song et al., 2014; Choksi et al., 2014; Marcet et al., 2011; Chevalier et al., 2015).


Cp110 is required for ciliogenesis at the level of basal body function

To elucidate the effects of cp110 knockdown on MCC ciliogenesis in detail, we investigated mucociliary clearance and motile cilia function in vivo. Extracellular fluid flow was analyzed by high-speed microscopy and particle tracking of fluorescent beads (Walentek et al., 2014). Control embryos generated a directional and robust flow along the epidermis, while Morpholino oligonucleotide (MO)-mediated knockdown of cp110 caused strongly reduced fluid flow velocities and loss of directionality (Figure 1A–B; Video 1). Next, we visualized cilia beating directly by injection of gfp-cfap20 (encoding an axonemal protein) and confocal resonant scanning microscopy (Turk et al., 2015). MCCs in control embryos showed directionally uniform and metachronal synchronous ciliary beating, while depletion of Cp110 caused asynchronous beating, reduced motility and randomization of directionality or a complete loss of motility (Figure 1—figure supplement 1A–B; Videos 23). Next, we analyzed basal bodies using the markers Centrin4-RFP (basal body) and Clamp-GFP (ciliary rootlet) (Park et al., 2008). In cp110 morphants, basal bodies aggregated, leading to loss of directional alignment (Figure 1C), in turn a prerequisite for directional MCC cilia beating.

Figure 1 with 2 supplements see all
Cp110 is required for basal body function in MCC ciliogenesis.

(A) cp110 knockdown causes impaired extracellular fluid flow. Control (uninjected controls and control MO injected specimens) and cp110MO-injected embryos were analyzed for extracellular fluid flow (10 s projections are shown). (B) Velocities were quantified by particle tracking (Related to Video 1). ***p<0.001; ns, p>0.05 from Wilcoxon two-sample test. (C) Alignment of basal bodies is disrupted in cp110 morphant MCCs. Centrin4-RFP (basal bodies, red), Clamp-GFP (rootlets, green). Arrows in bottom panels show basal body directionality. n embryos/MCCs: control (9/27), cp110MO (10/30). (D) Knockdown of cp110 causes severe defects in MCC ciliogenesis which can be rescued by cp110 DNA co-injection, demonstrated by immunofluorescence for Acetylated-α-tubulin (cilia, Ac.-α-tub., red). Trgeted MCCs were identified by co-injection of centrin4-cfp. Non-targeted MCCs (asterisks) produced normal cilia. (Related to Figure 1—figure supplement 2A). (E) Loss of Cp110 disrupts basal body apical transport and F-actin formation. Basal bodies (Centrin4-CFP, white) and Actin (red) are shown in apical (top row) and lateral (bottom rows) views of individual MCCs. Top views and lateral projections show representative examples (boxes indicate phenotype: white = wt; gray = mild docking defect; black = severe docking defect). (Related to Figure 1—figure supplement 2B,C). See also:

Video 1
Cp110 is required for extracellular fluid flow in the Xenopus mucociliary epidermis.

Extracellular fluid flow over the Xenopus embryonic epidermis was analyzed at stage 32 by time-lapse imaging of fluorescent beads. Knockdown of cp110 caused severely reduced fluid flow velocity (cp110MO; 14.16 µm/s) and loss of directionality, as compared to control MO-injected (CoMO; 181.37 µm/s) and uninjected (uninj. ctrl.; 228.72 µm/s) specimens. Movie plays at 1x speed. Related to Figure 1A.

Video 2
Cp110 is required for metachronal synchronous ciliary beating in MCCs.

Embryos were injected with cfap20-gfp to visualize ciliary axonemes of epidermal MCCs at stage 32 by resonant confocal microscopy. Anoptical section along the MCC apical-basal axis is shown (apical up). Control MCCs (uninj. ctrl.) showed a metachronal synchronous beating pattern of cilia. Knockdown of cp110 (cp110MO) disrupted the metachronal synchronous beating pattern and caused reduced motility in MCC cilia. Movie plays at 1x speed. Related to Figure 1—figure supplement 1A–B.

Video 3
Cp110 is required for unidirectional ciliary beating and ciliary motility in MCCs.

Embryos were injected with cfap20-gfp to visualize ciliary axonemes of epidermal MCCs at stage 32 by resonant confocal microscopy. Horizontal optical section through the MCC ciliary tuft is shown. Control MCCs (uninj. ctrl.) showed a unidirectional beating pattern of cilia. Knockdown of cp110 (cp110MO) caused loss of directionality and reduced motility in MCC cilia. Movie plays at 1x speed. Related to Figure 1—figure supplement 1A–B.


To investigate defects in ciliogenesis, we injected centrin4-cfp alone or together with cp110MO and analyzed cilia formation by immunofluorescence. About 95% of targeted MCCs were fully ciliated in controls, but less than 1% of targeted MCCs were fully ciliated in cp110 morphants (Figure 1D; Figure 1—figure supplement 2A). cp110MO's effects on MCC ciliation were cell-autonomous as non-targeted MCCs showed normal cilia, suggesting that basal body maturation or function was disrupted, rather than signaling or epithelial morphogenesis. While control MCCs showed basal bodies interspersed into a dense Actin network at the apical membrane, apical Actin formation was disrupted in Cp110-deficient MCCs and a large portion of basal bodies remained deep in the cytoplasm, indicating deficient apical transport of basal bodies (Figure 1E; Figure 1—figure supplement 2B–D). Loss of basal body transport is predicted to prevent basal body apical docking, alignment, as well as cilia formation (Marshall, 2008). In order to gain more insight into the primary versus secondary effects of Cp110 loss, we injected embryos with increasing concentrations of cp110MO. These experiments revealed a dose-dependent effect of cp110 knockdown (Figure 1—figure supplement 1C–D). At low doses cp110MO caused loss of basal body alignment and mild apical Actin defects, without interfering with basal body apical transport, docking and cilia formation. In contrast, high doses of cp110MO primarily interfered with basal body apical transport and prevented cilia formation. Rescue experiments further confirmed the specificity of the MCC phenotype in cp110 morphants (Figure 1D–E; Figure 1—figure supplement 2): co-injection of MO-insensitive cp110 DNA (cp110-fs) restored ciliation rates and partially restored apical basal body localization. As previously described for Cp110 gain-of-function experiments (Song et al., 2014), a more potent cp110 DNA from which the miR-34/449 target site was removed (cp110-fsΔmiR34/449) showed higher rescue efficiencies.

To confirm the disruptive effect of Cp110 loss-of-function on signaling through primary cilia, we analyzed Hedgehog-dependent gene expression in the developing nervous system (Dessaud et al., 2008). cp110 knockdown reduced expression of both nkx2.2 and pax6 confirming impaired Hedgehog signaling in Cp110-depleted Xenopus embryos (Figure 2A; Figure 2—figure supplement 1A–C). We also tested if motile mono-cilia of the Xenopus embryonic left-right (LR) organizer (the Gastrocoel Roof-Plate [GRP]) (Blum et al., 2014) depend on Cp110 function. GRP ciliation rates were reduced to about 26% in cp110 morphants, as compared to 85% in control embryos, and the remaining cilia were shorter and more frequently mispolarized (Figure 2B; Figure 2—figure supplement 1D–F). Ciliary function in the GRP is required for LR-asymmetric gene expression, including pitx2c, and loss of Cp110 randomized pitx2c gene expression in the lateral plate mesoderm (Figure 2C; Figure 2—figure supplement 1G).

Figure 2 with 1 supplement see all
Cp110 is required for primary and motile monocilia.

(A) Cp110 is required for Hedgehog signaling-dependent nkx2.2 expression. Whole-mount in situ hybridization (WMISH) staining for nkx2.2 expression in the neural tube. Normal expression indicated by green arrowhead, reduced expression indicated by red arrowhead. Related to Figure 2—figure supplement 1A–C (white and black boxes indicate normal and reduced expression, respectively in graph Figure 2—figure supplement 1A). (B) Cp110 is required for GRP cilia. Immunofluorescent staining for cilia (Ac.-α-tub., white) and cell borders (Actin, red). Green arrowheads, normal cilia; red arrowheads, defective cilia. Related to Figure 2—figure supplement 1D–F. (C) cp110MO interferes with left side specific pitx2c expression in the lateral plate mesoderm as shown by WMISH. Green arrowhead, normal/left expression; red arrowhead, absent expression. Related to Figure 2—figure supplement 1G. See also:


Taken together, our data revealed the requirement for Cp110 in ciliation of all principal types of cilia during Xenopus development and suggested that Cp110 is required at the level of the basal body to promote ciliogenesis.

Cp110 localizes to cilia-forming basal bodies

We next analyzed Cp110 localization in Xenopus, human and mouse MCCs. In all cases, Cp110 localized to cilia-forming basal bodies (Figure 3A–B,D; Figure 3—figure supplement 1C–E), in addition to its previously described localization to centrosomes. Co-expression of gfp-cp110 mRNA at levels permitting normal ciliogenesis, together with centrin4-cfp (basal body) and clamp-rfp (rootlet) further confirmed co-localization of these proteins in apically docked basal bodies in vivo (Figure 3C). In addition to the predominant GFP-Cp110 localization adjacent to the basal body, smaller amounts were concentrated at the tip of the rootlet (Figure 3C'). These novel localization patterns of overexpressed GFP-Cp110 at basal bodies were confirmed by analysis of endogenous Cp110 in MCCs of in vitro cultured human airway epithelial cells (HAECs): Cp110 was found interspersed into the apical Actin network and found at the base of MCC cilia (Figure 3B,D). Endogenous Cp110 also co-localized with and extended Centrin1 in human MCCs (Figure 3E), and super-resolution structured illumination microscopy (3D-SIM) verified Cp110 localization adjacent to the basal body (Figure 3F). In conclusion, we present new localization sites of Cp110 at basal bodies, which are distinct from its previously described location at the distal end of centrioles, where Cp110 inhibits axoneme elongation.

Figure 3 with 4 supplements see all
Cp110 localizes to cilia-forming basal bodies in MCCs.

(A–D) Cp110 localizes to cilia-forming basal bodies in Xenopus epidermal (A, C) and human airway epithelial cell (HAEC) (B, D) MCCs. (A) gfp-cp110 (green) was expressed at levels permitting ciliogenesis, together with centrin4-cfp (basal bodies, blue). Immunofluorescent staining (Ac.-α-tub., red) was used to visualize cilia. (B) Immunofluorescent staining for endogenous Cp110 (red), cilia (Ac.-α-tub.; blue) and Actin (green) in MCCs (n donors = 1, n MCCs = 4). Yellow arrows in A’ and B’ indicate the base of cilia. (C) Apical view (top) of individual MCC co-injected with gfp-cp110 (green), centrin4-cfp (blue) and clamp-rfp (red) to visualize Cp110, basal bodies and rootlets, respectively. Localization of basal bodies to the apical membrane is shown in lateral projection (bottom). n embryos/MCCs: (4/18). (C') High-magnification analysis of GFP-Cp110 (green, indicated by yellow arrows and green circle) binding to an individual basal body from the MCC shown in (C) (basal body and rootlet are indicated). Inset shows rootlet domain (dashed box) with increased brightness. (D) Lateral projection of MCC stained for endogenous Cp110 (green) and cilia (Ac.-α-tub.; red). n donors = 1, n MCCs = 12 (same samples as in Figure 3—figure supplement 1C) (E–F) Endogenous Cp110 (green) and Centrin 1 (red) staining shows Cp110 adjacent to MCC basal bodies by confocal microscopy (E) and 3D-SIM imaging (F). n donors = 1, n MCCs = 3 each for confocal and 3D-SIM.


Expression of gfp-cp110 together with centrin-cfp in the GRP also confirmed localization of Cp110 to cilia-forming basal bodies in motile mono-cilia (Figure 3—figure supplement 2A). GRP cells were more sensitive to gfp-cp110 overexpression, possibly because of the limited number of centrioles/basal bodies as compared to MCCs. This led to another interesting observation: GFP-Cp110 basal body levels inversely correlated with GRP cilia length, i.e. high expression levels inhibited cilia, intermediate levels caused shorter cilia, and low levels permitted normal cilia formation (Figure 3—figure supplement 2B). This implies that, in contrast to previous reports, Cp110 might play a role in ciliary length control. Our hypothesis was further supported by the observation that Cp110 can localize to ciliary tips in some GRP cells (Figure 3—figure supplement 2C). This observation might be related to the requirement to coordinately resorb cilia from GRP cells after the LR-body axis is specified.

Interestingly, overexpression of gfp-cep97, another negative regulator of ciliogenesis and Cp110-interacting partner (Spektor et al., 2007), revealed specific localization of GFP-Cep97 to centrosomes of epidermal cells, however no localization to cilia-forming basal bodies in MCCs was observed (Figure 3—figure supplement 3A–C). Furthermore, GFP-Cep97 was not able to suppress cilia formation in MCCs (Figure 3—figure supplement 3D). This data further supported a specific role for Cp110 in ciliogenesis, independent of Cep97.

In summary, our data demonstrate three novel locations of Cp110 accumulation in basal bodies and cilia, in addition to its previously described localization to distal ends of centrioles (Figure 3—figure supplement 4): (1) Adjacent to cilia-forming basal bodies, (2) at rootlets, and (3) at the tip of cilia.

Cp110 is required for ciliary adhesion complex formation

In addition to Cp110 localization to MCC basal bodies and rootlets, we also observed Cp110 localization to basal bodies during stages of apical basal body transport (preceding ciliogenesis) (Figure 3—figure supplement 1A) as well as an asymmetry in basal body Cp110 levels along the anterior-posterior axis in some MCCs (early MCC stages) (Figure 3—figure supplement 1B). The same types of localization patterns were reported for ciliary adhesion complex components, Focal Adhesion Kinase (FAK), Vinculin and Paxillin (Antoniades et al., 2014). In MCCs, these are required for basal body binding to F-actin. Furthermore, loss of Cp110 phenocopied loss of FAK in Xenopus MCCs. We therefore explored whether Cp110 might be required for ciliary adhesion complex formation or function.

First, we analyzed localization of Cp110 and FAK in Xenopus MCCs. Both Cp110 and FAK localized to posterior sites at the basal body and the rootlet, with FAK extending the Cp110 basal body domain (Figure 4 A; Figure 4—figure supplement 1A). Co-immunoprecipitation (co-IP) experiments using overexpressed FLAG-Cp110 in combination with FAK-GFP or Centrin-GFP further suggested an interaction between Cp110, FAK and Centrin4 (Figure 4 B; Figure 4—figure supplement 2E). In contrast to the overexpression tests in Xenopus, we were not able to convincingly co-IP endogenous FAK using two commercially available anti-Cp110 antibodies in ciliated HAECs (not shown). Therefore, although our data suggest that Cp110 and ciliary adhesion components localize to the same sites at basal bodies, this co-localization could rely on additional intermediate protein complexes, similar to the situation described for Cp110 interactions with Centrin at centrioles (Tsang et al., 2006).

Figure 4 with 3 supplements see all
Cp110 is required for ciliary adhesion complex formation in MCCs.

(A) Expression of gfp-cp110 (green) at concentrations permitting ciliogenesis, FAK-mKate (magenta), and centrin4-cfp (blue) revealed polarized posterior localization of GFP-Cp110 and FAK-mKate adjacent to the basal body. Note that FAK-mKate overlaps with GFP-Cp110, but extends past GFP-Cp110 in the posterior direction. n embryos/MCCs (7/28). Related to Figure 4—figure supplement 1A. (B) Western blot analysis of co-immunoprecipitation (co-IP) using Flag-Cp110. FLAG-Cp110 (~140kD) detected by anti-FLAG antibody (α-FLAG). FAK-GFP (~150kD) and Centrin4-GFP (~45kD) detected by anti-GFP antibody (α-GFP). Co-IP, IP-FLAG; input samples, input; supernatant samples, sup. (n = 2). Related to Figure 4—figure supplement 2E. (C–D) Cp110 is required for FAK binding to MCC basal bodies. (C) Mix of FAK-gfp (green) and centrin4-cfp (blue) mRNAs was injected (± cp110MO). Quantification shown in (F). n embryos/MCCs: control (16/48), cp110MO (16/48). (D) Magnification of individual basal body from C. (E) Overexpression of Cp110 caused increased localization of FAK-GFP to basal bodies (Centrin4-CFP, blue). Heatmaps of CFP and GFP intensity levels shown next to merged immunofluorescent images. Color code shown right. Quantification shown in (F). n embryos/MCCs: control (9/26), 50 ng/μl (9/27), 100 ng/μl (9/26). (F) Quantification of FAK-GFP to Centrin4-CFP ratios in controls, cp110 morphants and after overexpression of cp110 (at 50 ng/μl and 100 ng/μl concentrations). ***p<0.001 from Wilcoxon two-sample test.


To test the hypothesis that Cp110 is functionally required for ciliary adhesion complex formation or function, we depleted Cp110 in MCCs and analyzed FAK localization to basal bodies. In control MCCs, FAK-GFP normally accumulated at basal bodies and rootlets, and this localization was strongly reduced in Cp110-deficient MCCs (Figure 4C). Higher magnification revealed residual FAK-GFP levels at basal bodies in cp110 morphants (Figure 4D), which was further confirmed by analyzing the ratio of fluorescent intensity of FAK-GFP/Centrin4-CFP: on average, FAK-GFP levels were reduced to about 30% in Cp110-deficient MCCs as compared to controls (Figure 4F). We also addressed whether other ciliary adhesion components were affected by Cp110 depletion. As with FAK-GFP, both Vinculin-GFP and Paxillin-GFP levels were strongly reduced in cp110 morphant basal bodies and rootlets, and Vinculin-GFP was also reduced at the apical membrane (Figure 4—figure supplement 2A–Ds). Ciliary adhesion components appeared to be more dramatically reduced at rootlets than at basal bodies. To confirm that loss of ciliary adhesions was not primarily caused by a loss of the rootlet, we analyzed FAK-GFP localization in cp110 morphants which were triple-injected with centrin4-cfp, the rootlet marker clamp-rfp and FAK-gfp. These experiments confirmed strong reduction of FAK-GFP from basal bodies and rootlets, while Centrin4-CFP and Clamp-RFP were still present, at least in basal bodies residing close to the apical membrane (Figure 4—figure supplement 1B). These results are further supported by published mouse data, which demonstrated that Rootletin localizes to Cp110-deficient basal bodies (Yadav et al., 2016), and that Rootlet-deficient basal bodies still form cilia in mono- and multi-ciliated cells (Yang et al., 2005).

Lastly, we also tested if Cp110 was not only required for ciliary adhesion complex formation, but if cp110 overexpression could be sufficient to enhance recruitment of FAK-GFP to basal bodies and rootlets. Indeed, our results indicate that exogenous Cp110 can recruit additional FAK-GFP in a dose-dependent manner (Figure 4E–F).

We conclude from these experiments that Cp110 is required for the normal formation of ciliary adhesion complexes in MCCs, and suggest that loss of FAK from basal bodies and rootlets causes the observed defects in basal body apical transport, docking and alignment, as well as the loss of apical Actin network formation (Figure 4—figure supplement 3).

Distinct protein domains promote centriolar versus ciliary functions of Cp110

Cp110 is a multi-domain protein regulating multiple processes during the cell cycle via interaction with distinct partners (Tsang and Dynlacht, 2013). Indeed, the two opposing roles of Cp110 in cilia formation might be promoted by specific protein domains, interacting with different protein complexes. We first analyzed the Xenopus tropicalis (Xt) Cp110 sequence and found that the deposited reference sequence (matching BC167469) predicted a shorter product than in other species. Compared to the Xt7.1 genome sequences (Hellsten et al., 2010; Karpinka et al., 2014), the clone has a frameshift producing a premature stop codon and a truncated Cp110 (Cp110-FS) (Figure 5D). Restoration of the missing Adenine generated a full-length Cp110 version of 962 amino acids, which contains the domains described for human Cp110 (Chen et al., 2002) at similar positions, including two coiled-coil domains (CCDs), CDK phosphorylation sites, Cyclin binding domains (RXL) and CaM-binding domains (Figure 5D). Interestingly, the KEN box motif, which is required for proteasomal targeting of Cp110, is positioned more towards the N-terminus in Xt Cp110 than in human Cp110, which instead contains an additional destruction-box (D box) with the same function at a similar position. Judging from our functional experiments employing cp110-fs and cp110-fsΔmiR34/449 and correction of the sequence, we conclude that (a) Cp110-FS is still largely functional, (b) the miR-34/449 target site is located within the wild-type coding sequence, and (c) the domain structure of Cp110 is highly conserved among vertebrates.

Figure 5 with 3 supplements see all
Cp110 coiled-coil domains are required for cilia inhibition and centriolar functions.

(A) Cp110 coiled-coil domains are required for MCC cilia inhibition and formation of supernumerary centrioles. Controls and embryos injected with full-length gfp-cp110, gfp-cp110ΔCentral or gfp-cp110ΔCCD1+2 (all green) were analyzed for ciliation by immunofluorescent staining (Ac.-α-tub., red). Upper panels: red fluorescence channel; merge channel insets show magnifications outlined by dashed boxes. Lower panels: green/red merge; insets show magnifications of non-MCCs outlined by dashed boxes. Related to Figure 5—figure supplement 1A–B. (B) Cp110 coiled-coil domains are required for basal body aggregation. Embryos injected with centrin4-cfp (basal bodies, blue), clamp-rfp (rootlets, red), and either full-length gfp-cp110 or gfp-cp110ΔCentral or gfp-cp110ΔCCD1+2 (green). Upper panels: red/blue merge; insets show magnifications of basal bodies outlined by dashed boxes. Lower panels: green/blue merge; insets show magnifications of basal bodies outlined by dashed boxes. n embryos/MCCs: control (7/21), gfp-cp110 (7/21), gfp-cp110ΔCentral (7/21), gfp-cp110ΔCCD1+2 (7/21). Related to Figure 5—figure supplement 1D. (C) GFP-Cp110 constructs show different localization patterns at basal bodies (bb) and rootlets (r). Upper panels: Individual basal bodies from MCCs shown in (B) (solid boxes). Lower panels: heat maps of GFP-Cp110 intensity. Color code shown right. Related to Figure 5—figure supplement 1D. (D) Cp110 constructs generated in this study. Different colors indicate predicted functional domains. Green, CDK phosphorylation sites; blue, coiled-coil domains; yellow, Cyclin binding domain (RXL); pink, KEN domain (proteasomal degradation); brown, CaM-binding domains; red asterisk indicates the position of miR-34/449 target site in the cp110 mRNA. See also:


Next, we generated GFP-tagged cp110 deletion constructs and tested their ability to inhibit cilia formation in MCCs. Most deletion constructs inhibited cilia formation at similar rates to full-length GFP-Cp110, but not a construct missing both CCDs (GFP-Cp110ΔCCD1&2), which had very mild effects on cilia (Figure 5A; Figure 5—figure supplement 1A–B). CCDs can facilitate intramolecular interactions as well as intermolecular interactions during complex formation (Kuhn et al., 2014; Burkhard et al., 2001; Salisbury, 2003). We therefore deleted Cp110 CCDs separately and tested these constructs for cilia inhibition. Deletion of the first CCD alone (GFP-Cp110ΔCCD1) did not affect cilia inhibition, while deletion of the second CCD (GFP-Cp110ΔCCD2) only weakly affected cilia suppression (Figure 5—figure supplement 1B). This suggested that CCDs overlap in activity. For all constructs, effects were cell-autonomous, and non-targeted MCCs formed cilia comparable to uninjected controls. We conclude from this data, that (a) expression of all deletion constructs results in the production of functional protein, which we have confirmed by immunoblotting for GFP-Cp110 constructs at relevant stages (Figure 5—figure supplement 1C), (b) the CCDs of Cp110 inhibit ciliation in a redundant manner, and (c) Cp110 CCDs likely mediate binding to protein complexes at the basal body which support cilia inhibition.

In addition to effects on ciliogenesis, we observed effects in non-MCC epidermal cells upon overexpression of gfp-cp110 constructs (Figure 5A; Figure 5—figure supplement 1A and 2A–D): Most constructs frequently induced multiple GFP-Cp110 foci per cell and enlargement of cells, while both effects were absent upon gfp-cp110ΔCCD1&2 overexpression. GFP-Cp110 constructs also strongly localized to centrioles, but centriolar localization of GFP-Cp110ΔCCD1&2 was relatively weak. Formation of supernumerary centrioles and resulting defects in cytokinesis and chromosome separation were previously described upon Cp110 overexpression in cycling cells (Tsang et al., 2006; Chen et al., 2002); therefore our findings suggest that Cp110 CCDs are required for centriolar functions, including suppression of ciliogenesis.

Next, we overexpressed gfp-cp110 deletion constructs with centrin-cfp and clamp-rfp to investigate MCC basal body behavior. Basal bodies in control MCCs were uniformly aligned and spaced appropriately, while overexpression of full-length gfp-cp110 caused mild alignment defects as well as aggregation of basal bodies (Figure 5B). The same defects were observed with most deletion constructs, but not in gfp-cp110ΔCCD1&2 overexpressing MCCs (Figure 5 B; Figure 5—figure supplement 1D). Interestingly, the negative effects on basal bodies and cell size were variable among cilia-inhibiting constructs (Figure 5—figure supplement 2E): Most prominently, deletion of a central domain (GFP-Cp110ΔCentral) containing most phosphorylation sites, RXL and KEN domains (proteasome targeting motifs), induced much stronger effects than full-length Cp110 and protein levels were elevated in comparison to other constructs (Figure 5A–B; Figure 5—figure supplement 1C). Collectively, the data suggested that the central domain deletion generated a hypermorphic protein, which was released from negative regulation by the proteasomal machinery (Tsang and Dynlacht, 2013). Overexpression of gfp-cp110ΔCentral also caused the formation of extremely enlarged MCCs and other epithelial cells, which were frequently polynucleated, indicating severe cytokinesis defects (Figure 5—figure supplement 2A). Abnormal nuclei were associated with multiple GFP-Cp110 foci, which also contained Centrin4-CFP, indicating presence of supernumerary centrioles (Figure 5—figure supplement 2B). In MCCs, gfp-cp110ΔCentral induced strong aggregation and an increased number of basal bodies (Figure 5—figure supplement 2C–D), likely due to the presence of supernumerary centrioles at the onset of deuterosome-mediated centriole amplification.

Finally, we investigated GFP-Cp110 localization to basal bodies and rootlets. All constructs were able to localize to basal bodies, although we detected differences in relative binding to different parts, especially when comparing full-length GFP-Cp110 to GFP-Cp110ΔCentral and GFP-Cp110ΔCCD1&2 (Figure 5C; Figure 5—figure supplement 1E). GFP-Cp110 overlapped mainly with the distal and posterior basal body and localized at much lower levels to the tip of the rootlet, while GFP-Cp110ΔCentral preferentially localized to the basal body with reduced levels at the rootlet. Conversely, GFP-Cp110ΔCCD1&2 localization was stronger at the rootlet as compared to the basal body. Interestingly, overexpression of each construct negatively affected apical Actin formation, while the apical transport of basal bodies occurred largely normally unless aggregation of basal bodies was observed (Figure 5—figure supplement 1F).

In summary, these results support the conclusion that at centrioles and basal bodies Cp110 CCDs promote binding to centriolar-type protein complexes to mediate cilia inhibition, while other domains allow Cp110 interaction with cilia-promoting or cell-cycle regulatory complexes (Figure 5—figure supplement 3).

Optimal Cp110 levels are achieved by a transcriptional/post-transcriptional regulatory module in MCCs

Since the dual function of Cp110 in promoting and limiting ciliogenesis is determined by its protein structure and concentration, Cp110 levels need to be tightly controlled to generate optimal cellular quantities for cilia formation. In MCCs, a conserved transcriptional cascade regulates ciliation (Choksi et al., 2014). Notch signaling inhibition activates multicilin (mci; or MCIDAS in humans) (Stubbs et al., 2012). Mci forms a ternary complex with E2F-4 or -5 and Dp1 to activate downstream ciliary transcription factors, including rfx2, foxj1 and myb (Chung et al., 2014; Ma et al., 2014). Together with RFX2 and Foxj1, the Mci complex regulates expression of core multi-ciliogenesis genes. Because Cp110 is indispensable for ciliogenesis, we tested whether its expression is regulated through the MCC transcriptional program. RNA-sequencing (RNA-seq) was performed on manipulated animal cap explants that develop into mucociliary organoids in culture (Werner and Mitchell, 2012), and successful manipulation was monitored by assessing expression levels of foxj1. During MCC specification stage (st. 16), inhibition of Notch signaling (su(h)-dbm) or stimulation of multi-ciliogenesis (mci) resulted in strongly increased cp110 expression as compared to overactivation of notch signaling (notch-icd) or inhibition of multi-ciliogenesis (dominant-negative- (dn-)mci) (Figure 6A; Figure 6—figure supplement 1A). Furthermore, ciliary transcription factors bind to the cp110 locus; Chromatin Immunoprecipitation and DNA-sequencing (ChIP-seq) showed binding of E2F4, RFX2 and Foxj1 to the transcriptional start site of cp110, and additional Foxj1 binding to intronic regions of cp110 (Figure 6B). Therefore, Cp110 is a core multi-ciliogenesis protein, which is regulated by ciliary transcription factors in MCCs.

Figure 6 with 2 supplements see all
Cp110 levels in MCCs are controlled by ciliary transcription factors and miR-34/449 microRNAs.

(A) cp110 expression in MCCs is regulated through the MCC signaling/transcriptional cascade. Embryos were injected with Su(H)-dbm to stimulate MCC induction (green) or with Su(H)-dbm and dominant-negative multicilin (dn-mci) to prevent MCC induction (red). RNA-sequencing (RNA-seq) was performed at MCC specification stage (st. 16). Normalized counts are shown as bar graphs. n = 2. Related to Figure 6—figure supplement 1A. (B) cp110 expression is activated by ciliary transcription factors. Chromatin immunoprecipitation and DNA-sequencing (ChIP-seq; upper five lanes) and RNA-seq (bottom two lanes) at stage 16. Embryos were injected with Notch-icd to inhibit MCC induction or together with multicilin (mci) to induce MCCs. ChIP-seq using antibodies to mark active chromatin (Histone H3 lysine tri-methylation, H3K4me3; Histone H3 lysine acetylation, H3K27ac), E2F4 binding (E2F4), RFX2 binding (RFX2), and Foxj1 binding (Foxj1) are shown. A gene model is shown in bottom lane. ChIP-seq peaks are indicated by a yellow background. (C) cp110 levels at ciliogenesis stage (st. 25) are controlled by miR-34/449 miRNAs. For quantitative RT-PCR analysis (qPCR), manipulations were performed as described in (A) (green and red bars). Additionally, miR-34/449s were knocked down (miR-34/449MO, blue bar). The uninjected control was set to 1. n = 2. (D) miR-34/449 family members are regulated through the conserved MCC signaling/transcriptional cascade. qPCR analysis for miR-34/449 expression was performed as described (C). ND, not detected. n = 2. (E–F) Expression of miRNAs miR-34b/c and miR-449a-c is activated by ciliary transcription factors. ChIP-seq and RNA-seq was performed as described in (B). miRNA location in (E) is indicated by red box. miR-449a-c are expressed from cdc20b intron 2. Related to Figure 6—figure supplement 1B. The foxj1 expression analysis confirmed successful manipulation in (AC) and (D). Error bars represent s.e.m. in (C) and (D).


While manipulation of the MCC cascade showed large changes in cp110 transcript levels at the MCC specification stage (st. 16), these did not persist. At the ciliogenesis stage (st. 25), quantitative RT-PCR (qPCR) showed that cp110 returned to normal levels, unless miR-34/449s were knocked down simultaneously (Figure 6C). This suggested that miR-34/449 expression might also be activated by ciliary transcription factors. We therefore analyzed expression of miR-34/449 after manipulation of the MCC cascade at stage 25 by qPCR (Figure 6D). Like foxj1 expression, miR-34b/c and miR-449 a/b/c expression was up- or down-regulated by inhibition of Notch signaling or dn-mci injection, respectively. In contrast, expression of miR-34a from a third genomic locus was not affected. In agreement with our qPCR results, ChIP-seq and RNA-seq at stage 16 revealed ciliary transcription factor binding and changes in expression for miR-34b/c as well as miR-449a/b/c (expressed from cdc20b intron 2), but not for miR-34a (Figure 6 E–F; Figure 6—figure supplement 1B)

Taken together, we conclude that cp110 and five of the six miR-34/449s are co-activated by ciliary transcription factors during MCC specification stages, which confers their robust expression. Expression of miR-34/449s in MCCs then represses cp110 at the post-transcriptional level preventing excess buildup of Cp110 at ciliogenesis stages. Therefore, optimal Cp110 levels in MCC ciliogenesis are generated by a gene regulatory module consisting of ciliary transcription factors and MCC-specific miRNAs from the miR-34/449 family (Figure 6—figure supplement 2).


Here we show that Cp110 localizes posteriorly to cilia-forming basal bodies as well as to rootlets in MCCs, in addition to its well-described localization to distal ends of centrioles. A similar low-level localization of endogenous Cp110 can be also observed in primary cilia of RPE-1 cells (see also Figure 4C in Tanos et al. 2013). Furthermore, we demonstrate that optimal cellular levels of Cp110 are required for cilia formation. The general conclusion that Cp110 is required for ciliogenesis is in line with our previous report (Song et al., 2014) as well as a recent study in mice, in which Cp110 was knocked out (Yadav et al., 2016).

Cp110's role in cilia suppression was proposed to be mediated by distal end capping of the basal body/centriole (Spektor et al., 2007; Kobayashi et al., 2011). In this work, we provide evidence that, additionally, loss of Cp110 prevents formation of ciliary adhesion complexes, which in turn mediate interactions of basal bodies and rootlets with F-actin in MCCs and thereby promote cilia formation. As previously described for knockdown of FAK (Antoniades et al., 2014), knockdown of cp110 exerts dose-dependent effects on basal bodies and cilia in MCCs: At low concentrations, these effects include loss of sub-apical Actin-dependent basal body alignment and mild defects in apical Actin formation, but nonetheless successful ciliogenesis. At high concentrations, basal bodies fail to migrate to the apical membrane, which prevents apical docking, apical Actin formation and ciliogenesis. Conversely, overexpression of cp110 leads to increased basal body/rootlet levels of FAK. This indicates that Cp110 is required for ciliary adhesion complex recruitment. It remains to be seen if Cp110 is able to directly interact with FAK or if it requires additional intermediate protein complexes, as seems to be the case for Cp110 interactions with Centrins.

Importantly, neither Cp110 localization to basal bodies nor interactions of basal bodies with F-actin are strict requirements for cilia formation. Disruption of F-actin in quail oviduct MCCs prevents apical transport of basal bodies, but eventually basal bodies dock to cytoplasmic membranes and form aberrant intracellular cilia (Boisvieux-Ulrich et al., 1990). Furthermore, ciliary vesicles (CVs) seem to localize apically even in the absence of basal body docking in MCCs (Park et al., 2008). Therefore, we propose that apical basal body transport promotes efficient basal body fusion with CVs by facilitating spatial proximity. This interpretation is supported by the finding that about 10% of embryonic fibroblasts were capable of CV fusion and cilia formation in Cp110 knockout mice, which should lack Cp110 altogether (Yadav et al., 2016). Alternatively, Cp110 might promote basal body fusion with CVs through independent interactions.

We further propose that Cp110 could contribute to ciliary length control and coordinated cilia resorption. On the one hand, increased Cp110 levels at the base of cilia are correlated with shorter GRP cilia. On the other hand, we observe ciliary tip localization of Cp110 in a subset of GRP cilia. GRP cilia have to be resorbed after LR-asymmetric gene expression is induced, to allow these cells to re-enter the cell cycle and to contribute to other embryonic structures like the somites or the notochord (Komatsu et al., 2011; Shook et al., 2004). At the GRP, cells ingress from lateral to medial, and cilia with Cp110 at their tips were more frequently found on lateral GRP cells. At ciliary tips, Cp110 may promote axoneme depolymerization via recruitment of Kif24, which was previously shown to interact with Cp110 and to specifically depolymerize centriolar-derived microtubules, but not cytoplasmic microtubule populations (Kobayashi et al., 2011; Kim et al., 2015).

Interaction of Cp110 with distinct protein complexes was previously proposed (Tsang and Dynlacht, 2013) and our data support this idea. CCD-containing proteins are commonly found among centriolar/basal body components, and are thought to regulate pericentriolar material as well as centrioles by acting as a structural lattice and by mediating protein-protein interactions (Tsang and Dynlacht, 2013; Kuhn et al., 2014; Salisbury, 2003). Deletion of Cp110's CCDs prevents efficient cilia inhibition, and decreases binding to centrioles as well as to the distal basal body, but not to rootlets. Therefore, it will be interesting to further dissect Cp110-binding to basal body-associated protein complexes in the future. Our Cp110 deletion constructs might facilitate such dissection using a proteomics approach, as some of them display opposing functions and localization patterns.

Our study also reveals that Cp110 levels need to be precisely controlled for efficient ciliogenesis. In MCCs, cp110 expression is induced by ciliary transcription factors, and these also regulate the expression of inhibitory miRNAs from the miR-34/449 family. This co-regulation establishes a gene regulatory module that confers robust cp110 expression, while preventing excess Cp110 buildup by post-transcriptional regulation. Such regulatory modules might also exist in other ciliated cell types, which express distinct sets of cell type-specific miRNAs (Walentek et al., 2014). In the zebrafish embryonic LR-organizer, motile mono-cilia require miR-129-3p, which also controls Cp110 levels (Cao et al., 2012). Our ChIP-seq data show Foxj1 and RFX2 binding to the cp110 transcriptional start site, and these transcription factors control motile mono-cilia formation as well (Choksi et al., 2014). Therefore, RFX2 and Foxj1 could form a similar module with cp110 and miR-129-3p in the vertebrate embryonic left-right organizer.

Given the importance of Cp110 in ciliogenesis, cell division and pathogenesis, our study contributes important mechanistic insights into the roles of Cp110 during cilia formation and function, which will facilitate further understanding of complex protein networks in cilia-dependent development and disease.

Materials and methods

Manipulation of Xenopus embryos and constructs used

Request a detailed protocol

X. laevis eggs were collected and in vitro-fertilized, then cultured and microinjected by standard procedures (Sater, 2011). Embryos were injected with Morpholino oligonucleotides (MOs, Gene Tools), mRNAs and DNAs at the two- and four-cell stage using a PicoSpritzer setup in 1/3x Modified Frog Ringer’s solution (MR) with 2.5% Ficoll PM 400 (GE Healthcare, #17-0300-50), and were transferred after injection into 1/3x MR containing Gentamycin. Drop size was calibrated to about 7–8 nL per injection. Rhodamine-B dextran (0.5–1.0 mg/mL; Invitrogen, #D1841) or indicated mRNAs were co-injected and used as lineage tracers. cp110 MO (5'-ACTCTTCATATGGCTCCATGGTCCC-3'; Gene tools) (Song et al., 2014) was administered at doses ranging between 17 ng and 60 ng (or 3–7 pmol). mRNAs encoding Centrin4-RFP/CFP (Antoniades et al., 2014; Park et al., 2008), Clamp-RFP/GFP (Park et al., 2008), FAK-GFP (Antoniades et al., 2014), Vinculin-GFP (Antoniades et al., 2014), Paxillin-GFP (Antoniades et al., 2014), GFP-Cp110 in pCS107 and derivatives (this study), GFP-Cep97 in pCS107 (this study), GFP-Cfap20 (gift from BJ Mitchell) were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) and diluted to 30–150 ng/µL (240 pg–1.2 ng per injection) for injection into embryos. Xenopus tropicalis gfp-cep97 cDNA was derived from IMAGE clone #780092 and subcloned using BamH1 and Sal1 enzymes (New England Biolabs) after amplification using following primers:



Xenopus tropicalis cp110 cDNA was derived from a clone matching BC167469 obtained from Thermo Scientific (#MXT1765-202715711). The Xt cp110 reference sequence (Gene ID: 100170501) was corrected by linking to the Xenopus tropicalis genome by NCBI on 23. June 2015. Gfp-cp110-fs and gfp-cp110-fsΔmiR-34/449 were generated from the same clone and subcloned into the pCS107 expression vector, which was digested with Sph1 (New England Biolabs, #R0182S) and re-ligated to remove the miR binding site, as previously described (Song et al., 2014). DNAs were purified using the PureYield Midiprep kit (Promega, Madison, WI, USA; #A2495), and were injected at 1–2 ng/µl, as previously described (Song et al., 2014; Walentek et al., 2012; Walentek et al., 2015; Walentek et al., 2013). Subcloning was performed using BamH1 and EcoR1 (New England Biolabs, #R0101T; #R0136T) restriction enzymes and the following primers (shown 5' to 3'):







Cp110 deletion constructs were cloned using the NEB Q5 Site-Directed Mutagenesis Kit (#E0554S). All constructs were verified by sequencing. For in silico translation, Transeq (http://www.ebi.ac.uk/Tools/st/emboss_transeq) was used. For prediction of coiled-coil domain clusters COILS (http://www.ch.embnet.org/software/COILS_form.html) was used. miRNA target sites were predicted using TargetScan (http://www.targetscan.org/vert_71/) and RNA22 (https://cm.jefferson.edu/rna22/).

Statistical evaluation

Request a detailed protocol

Statistical evaluation of experimental data was performed using chi-squared tests (http://www.physics.csbsju.edu/stats/contingency.html) for all data depicted by stacked bar-graphs, or Wilcoxon sum of ranks (Mann-Whitney) tests (http://www.fon.hum.uva.nl/Service/Statistics/Wilcoxon_Test.html) for all data depicted by box-plots (the whiskers (95%) of the box (50%) plots extend to maximal 1.5x IQR, and outliers are displayed as circles).

Immunofluorescent staining and sample preparation

Request a detailed protocol

For Xenopus antibody staining, immunofluorescence was performed on whole-mount embryos fixed at embryonic stages 30–33 (mucociliary MCCs), stage 20 (apical basal body transport in MCCs) or stages 16/17 (left-right cilia) in 4% paraformaldehyde at 4°C over night. Embryos were washed 3x 15 min with PBS, then 2x 30 min in PBST (0.1% Triton X-100 in PBS), and were blocked in PBST-CAS (90% PBS containing 0.1% Triton X-100, 10% CAS Blocking; ThermoFischer #00–8120) for 1 hr at RT. Primary and secondary antibodies were applied in 100% CAS Blocking over night at 4°C. Actin staining was performed by incubation (30–60 min at room temperature) with AlexaFluor 488- or 647-labeled Phalloidin (1:40; Molecular Probes #A12379 and #A22287).

For immunofluorescence staining of human airway epithelial cells (HAECs), primary human cells were grown using standard air-liquid interface (ALI) culture by the Walter E. Finkbeiner laboratory at University of San Francisco for 28 days (Fulcher et al., 2005). Cells were fixed in 4% PFA or Dent’s 80% methanol (EMD, #MX0485P-4) with 20% DMSO (Fisher Scientific, #BP231-100) for 24 hr at −20°C and processed for staining as described for Xenopus samples.

For immunofluorescence staining on cryosections, whole tracheas of adult wildtype Black 6 (C57BL/6J) mice were fixed overnight at −20°C in Dent's. Tracheas were embedded in (1:1) 20% Sucrose and O.C.T. compound (Tissue-Tek, #4583) and sectioned with MICROM HM 550 at −18°C at a thickness of 12 µm. Slides were washed in PBS (3 × 15 min), blocked (1 hr at room temperature) in PBST-CAS, and incubated (overnight at 4°C) with primary antibodies. Slides then were washed three times in PBST, and incubated (2 hr at room temperature or over night at 4°C) with secondary antibody. Slides were counterstained using DAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride; Molecular Probes, #D1306). Slides were mounted with VECTASHIELD mounting medium (Vector Laboratories, #H-1000-10).

Primary antibodies: mouse monoclonal anti-Acetylated-α−tubulin (in Xl, Mm, Hs; 1:700; Sigma #T6793), rabbit polyclonal anti-Cp110 (in Mm, Hs; 1:200; Proteintech #12780-1-AP), mouse anti-Centrin1 (in Hs; 1:200; clone 20H5 EMD Milipore #04–1624). Secondary antibodies (1:250): AlexaFluor 555-labeled goat anti-mouse antibody (Molecular Probes #A21422), AlexaFluor 555-labeled goat anti-rabbit antibody (Molecular Probes #A21428), AlexaFlour 488-labeled goat anti-rabbit antibody (Molecular Probes #R37116) and AlexaFluor 405-labeled goat anti-mouse antibody (Molecular Probes #A31553). Z-stack analysis and processing were performed using ImageJ (Schindelin et al., 2012). Lateral projections were computed using Zeiss ZEN software. All confocal imaging was performed using a Zeiss LSM700.

3D-SIM imaging was performed on a Zeiss Elyra SR.1 (3 angels) on samples embedded in ProLong Gold (Thermo Fisher #P36930) for 48 hr and high-precision cover slips (Zeiss #474030-9010-000) were used. 3D-SIM reconstruction was performed using Zeiss Zen software and calibration using multicolor fluorescent beads was performed prior to channel alignment.

Co-immunoprecipitation and western blotting

Request a detailed protocol

Embryos were injected 4x at the four-cell stage and animal caps were prepared at stage 9. At stage 28, 15 caps per condition were pooled in 100 µl TNMEN-150 lysis buffer (150 mM NaCl, 1 mM EDTA, 2 mM MgCl2, 0.1% Nonidet-P40, 50 mM This pH8.0, 1x Roche cOmplete (#04693116001)). Co-Immunoprecipitation was performed following standard protocol, using 10 µl magnetic beads (Dynabeads M-280 Sheep Anti-Mouse IgG; #11202D) and 0.4 µl monoclonal mouse anti-FLAG antibody (Sigma; #F3165) per sample for 2 hr at 4°C. 10% of sample was removed prior to treatment with antibody/magnetic beads (input), and 30 µl of sample was removed after the treatment (supernatant). SDS-Page and Western blotting were performed using standard procedures using a 10% separating gel, Milipore Immobilon-FL PVDF membrane (#IPFL00010), TBS containing 0.1% Tween-20 (TBSw) for washing, TBSw plus 5% non-fat dry milk for blocking. FLAG-/GFP-tagged proteins were detected using monoclonal mouse anti-FLAG antibody (1:2000, Sigma; #F3165), polyclonal rabbit anti-GFP antibody (1:2000, Abcam; #ab290), anti-rabbit/-mouse HRP conjugated secondary antibodies (1:5000, Bio-Rad; Goat anti-Rabbit IgG #1706515 and Goat anti-Mouse IgG #1706516), Western Lightning Plus-ECL (Perkin Elmer; #NEL103E001EA), and Amersham Hyperfilm ECL (GE Healthcare Life Sciences; #28906836).

Imaging of extracellular fluid flow

Request a detailed protocol

For imaging of extracellular fluid flow, control and manipulated stage 32 embryos were anesthetized (Benzocaine, Sigma #E1501) and exposed to latex beads (FluoSpheres carboxylate-modified microspheres, 0.5 μm, red fluorescence [580/605], 2% solids, Invitrogen #F-8812; diluted to 0.04% in 1/3 x MR) in a sealed flow chamber. Time-lapse movies (10 s / 60 frames per s) were recorded using epifluorescent illumination at 20x magnification on a Zeiss Axioskop 2 in combination with a high-speed GX-1Memrecam (NACImage Technology) and processed in ImageJ for brightness/contrast. Particle linking, tracking and quantification of extracellular fluid flow velocities was performed as previously described using the Particle Tracker plugin for ImageJ and a customized R-script (Hagenlocher et al., 2013). Frames were reduced to 1/3 to create a 10 s movie and play rate was adjusted to 20 frames per second. Supplemental Video 1 plays at 1x speed.

Imaging of MCC cilia motility

Request a detailed protocol

For imaging of MCC cilia motility, control and manipulated stage 30 embryos were anesthetized (Benzocaine, Sigma #E1501) and imaged at a rate of 30 frames per second using a Nikon Eclipse Ti inverted confocal microscope equipped with a resonance scanner and NIS Elements Confocal software, as described (Turk et al., 2015). Maximum intensity projections were generated in ImageJ to visualize ciliary beating directionality in stills. The movies (Videos 2,3) were cropped and adjusted for brightness/contrast in ImageJ, frames were reduced to 1/3 and the play rate was adjusted to 10 frames per second. Movies play at 1x speed. Video 2 depicts single optical plane sections through the apical-basal axis of MCCs (lateral view of the MCC). Video 3 depicts single optical plane sections through the ciliary tuft of MCCs (top view on the MCC).

Quantification of basal body numbers in deep cytoplasm

Request a detailed protocol

Confocal z-stacks from controls, cp110 morphants, and rescued cp110 morphants were analyzed for the presence of apically localized basal bodies and basal bodies that remained deep in the cell. Apically localized basal bodies were defined as present in the first (apical) 4 z-sections containing Centrin4-CFP signal (=1.82 μm); deep localized basal bodies were defined as Centrin4-CFP signals located below 1.82 mm. Next, we used the 3D Objects Counter plugin in ImageJ to quantify basal bodies that remained deep in the cytoplasm. These automatic quantifications were then inspected and corrected in cases where objects other than basal bodies were detected (assigned object count = 0), and where two or more basal bodies were counted as one (assigned object count = 2 or more).

Analysis of basal body FAK-GFP, Vinculin-GFP, and Paxillin-GFP localization

Request a detailed protocol

Imaging was performed using the same settings within individual experiments on embryos which were injected with equal amounts of mRNAs. Four apical optical sections (most apical section determined by appearance of Centrin4-CFP) were chosen and processed using ImageJ to adjust brightness/contrast and to generate maximum intensity projections. Brightness for depicted images was further adjusted to match maximum intensity levels at lateral membrane foci to account for variation in expression levels. For quantification of FAK-GFP/Centrin4-CFP ratio all z-planes were used, and the same adjustment of brightness/contrast was performed in ImageJ for samples from the same experiment. Maximum intensity projections were generated and the basal body-containing central region (without lateral membranes) was chosen as the region of interest (ROI) to analyze gray values for each channel separately using ImageJ. Intensity ratios were calculated and normalized using the average intensities in controls (set to 1) for each experiment.

Analysis of left-right axis development and neural gene expression

Request a detailed protocol

For analysis of left-right axis development and ciliation of the GRP, embryos were injected two times into the dorsal marginal zone at the four-cell stage (Walentek et al., 2012). For analysis of neural gene expression embryos were injected dorsal-animally at the four-cell stage. For GRP analysis, embryos were stained as described above. For quantification of ciliation rates, cilia length and polarization, central GRP areas were analyzed using ImageJ and R as previously described (Walentek et al., 2012). In situ hybridization was performed using standard procedures (Harland, 1991) after fixation in MEMFA (100 mM MOPS pH 7.4, 2 mM EGTA, 1 mM MgSO4, 3.7% (v/v) formaldehyde) for 2 hr at room temperature. A Digoxigenin-labeled (Roche, #11209256910) anti-sense probe was generated using Sp6 or T7 RNA polymerase (Promega, #P1085; #P2075) from plasmids encoding pitx2c (Schweickert et al., 2001), nkx2.2 (Dessaud et al., 2008), and pax6 (plasmid matching NP_001079413.1). Embryos were bleached after staining by standard procedures to remove pigment, and for neural gene expression embryos were imaged in 1: 2 (vol: vol) benzylbenzoate: benzyl alcohol (BB:BA).

Quantitative RT-PCR

Request a detailed protocol

Xenopus mucociliary organoids were generated from animal caps, dissected in 1x Modified Barth's Saline from stage 9 embryos, which were either uninjected or injected four times with the indicated constructs (mRNAs or MOs). Explants were cultured in 0.5xModified Barth's Saline until unmanipulated control embryos reached indicated stages. Total RNA was isolated by Trizol (Invitrogen, #15596) from 15 explants per condition and experiment. For RT-qPCR, cDNA was generated from total RNA extracts using iScript Reverse Transcription Supermix (BioRad; #170–8840); and the following qPCR primers were used: Foxj1-F: CCAGTGATAGCAAAAGAGGT, and Foxj1-R: GCCATGTTCTCCTAATGGAT; Cp110-F: AGCCAGAATCCAAGTAAAGG, and Cp110-R: CTTGCTTCTTTTCAGCAGTC; EF1a-F: CCCTGCTGGAAGCTCTTGAC, and EF1a-R: GGACACCAGTCTCCACACGA; ODC-F: GGGCTGGATCGTATCGTAGA, and ODC-R: TGCCAGTGTGGTCTTGACAT. Reactions were performed on a BioRad CFX96 Real-Time System C1000 Touch.

For miRNA quantitation, Trizol prepared total RNA was poly (A)-tailed by Poly (A) Polymerase (Epicentre, #PAP5104H). Poly (A)-tailed small RNA was reverse transcribed into small RNA cDNA with SuperScript III reverse transcriptase (Invitrogen, #18080) using miRNA RT primer (CGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCTTTTTTTTTTTTTTTTTTTTTTTTTVN). (V is A, G or C; N is A, G, C or T). TaqMan-based qPCR was subsequently performed on a 7900HT fast real-time PCR system (Applied Biosystems). The U6 snRNA was used as the endogenous control for miRNA real time qPCR analyses. Universal TaqMan probe, CTCGGATCCACTAGTC; Universal reverse primer, CGAATTCTAGAGCTCGAGGCAG. The following forward primers, specific for each small RNA, were used: ATGTGAAGCGTTCCATATGA; miR-34a: TGGCAGTGTCTTAGCTGGTTGTT; miR-34b: CAGGCAGTGTAGTTAGCTGATTG; miR449c: TGCACTTGCTAGCTGGCTGT.

RNA-sequencing and chromatin immunoprecipitation and DNA-sequencing

Request a detailed protocol

RNA-seq libraries: RNAs were isolated by the proteinase K method followed by phenol-chloroform extractions, lithium precipitation, and treatment with RNase-free DNase and a second series of phenol-chloroform extractions and ethanol precipitation. RNAseq libraries were then constructed (Illumina TruSeq v2; #RS-122-2001) and sequenced on an Illumina platform. RNAseq reads are deposited at NCBI (GSE76342).

RNAseq informatics: Sequenced reads from this study or (Chung et al., 2014; Ma et al., 2014) were aligned to the X. laevis transcriptome, MayBall version with RNA-STAR (Dobin et al., 2013) and then counted with eXpress. DESeq (Roberts et al., 2013) was used to estimate dispersion and test differential expression using rounded effective counts from eXpress. Changes in expression were visualized in R with beanplot (https://cran.r-project.org/web/packages/beanplot/beanplot.pdf), and to visualize RNAseq reads in a genomic context they were mapped to genome version 9.1 with bwa mem (Li and Durbin, 2009) and loaded as bigWig tracks into the Integrative Genomics Viewer browser (Thorvaldsdottir et al., 2013).

ChIPseq libraries: Samples were prepared for ChIP using methods described (Ma et al., 2014) with the following modifications: About 250 animal caps for transcription factors or 100 caps for histone modifications were fixed for 30 min in 1% formaldehyde, and chromatin was sheared on a BioRuptor (30 min; 30 s on and 2 min off at the highest power setting). Tagged proteins with associated chromatin were immunoprecipitated with antibodies directed against GFP (Invitrogen; #A11122 lot #1296649), FLAG (Sigma; #F1804), H3K4me3 (Active Motif; #39159 lot #01609004), or H3K27ac (Abcam; #ab4729, lot #GR71158-2). DNA fragments were then polished (New England Biolabs, end repair module; #E6050S), adenylated (New England Biolabs, Klenow fragment 3′–5′ exo- and da-tailing buffer), ligated to standard Illumina indexed adapters (Illumina TruSeq v2; #RS-122-2001), PCR-amplified (New England Biolabs, Phusion #M0530S or Q5 #M0491S, 16 cycles), and sequenced on an Illumina platform. ChIPseq reads are deposited at NCBI (pending).

ChIPseq informatics: ChIP-seq reads from this study or from (Chung et al., 2014; Ma et al., 2014) were mapped to X. laevis v9.1 with bwa mem, peaks called with HOMER (Heinz et al., 2010) using input as background and loaded as bigWig tracks into the Integrative Genomics Viewer browser. Peak positions were annotated relative to known exons (Mayball gene models).

Sample size and analysis

Request a detailed protocol

Sample sizes for all experiments were chosen based on previous experiences and performed in embryos derived from at least two different females. No randomization or blinding was applied.


Decision letter

  1. Janet Rossant
    Reviewing Editor; University of Toronto, Canada

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Ciliary transcription factors and miRNAs precisely regulate Cp110 levels at basal bodies required for ciliogenesis" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by Janet Rossant as the Senior and Reviewing Editor. The reviewers have opted to remain anonymous.


Using Xenopus embryos, the authors show that optimal Cp110 levels are required for cilia formation and that Cp110 is needed for ciliary adhesion complex formation. The ciliation defects in cp110 morphants were initially reported by the authors in (Song et al., 2014), and this study extends these observations to examine the mechanism of Cp110 in promoting ciliogenesis, as compared to its well-studied role in limiting cilium assembly. These studies also confirm certain recent findings in knock-out mice. The most novel data pertain to a role for Cp110 in regulating actin pathways and the ciliary adhesion complex. However, the latter data need substantial corroboration as described below.

Essential revisions:

The reviewers have discussed the reviews with one another extensively and have concluded that the paper as it stands lacks some important data, particularly with regard to the localization of the endogenous components of the complexes in which Cp110 is proposed to be engaged. A significant amount of additional data is required for us to reconsider the paper, including controls for the main experiments presented in terms of localisation and CP110 interaction with the ciliary adhesion complex, FAK and the actin cytoskeleton. The reviewers felt that you might be able to address these issues within the eLife two month window for revisions, but only if you have immediate access to appropriate antibodies to carry out the analysis requested. After reading the reviews, please let us know if you feel you can address the comments with new data in a timely manner – direct email discussion with Dr Rossant is simplest.

The full reviews are provided below to help you consider whether the revisions requested can be achieved.

Reviewer #1:

Using Xenopus embryos, the authors show that optimal Cp110 levels are required for cilia formation and that Cp110 is needed for ciliary adhesion complex formation. In addition, analysis of Cp110 mutants revealed distinct functions for different Cp110 domains. The ciliation defects in cp110 morphants were initially reported by the authors in (Song et al., 2014), and this study extends these observations to examine the mechanism of Cp110 in promoting ciliogenesis, as compared to its well-studied role in limiting cilium assembly. These studies also confirm certain recent findings in knock-out mice. The most novel data pertain to a role for Cp110 in regulating actin pathways and the ciliary adhesion complex. However, the latter data need substantial corroboration as described below.

1) The authors conclude that Cp110 could promote cilia assembly by facilitating formation of the ciliary adhesion (CA) complex, which was previously shown to link basal bodies and ciliary rootlets to the apical actin network. Because Cp110 localizes to both the basal body and tip of rootlets, does Cp110 MO also affect rootlet structure (e.g., length)? In Figure 4C and Figure 4—figure supplement 1D, E, the localization of ciliary adhesion complex around the basal bodies (possibly the rootlet region) seems to be more dramatically affected than at the basal bodies. Does Cp110 loss lead to overall reduction of CA proteins or preferential disappearance of CA proteins at the tip of rootlet? Triple staining of CA proteins, basal bodies and rootlets may help.

2) Related to the above point: A major conclusion is that Cp110 needs to be kept at optimal levels. In normal embryos, Cp110 and ciliary adhesion complex levels differ among basal bodies at anterior and posterior aspects. How does this asymmetric distribution correlate with the role of Cp110 in ciliogenesis? Basal bodies with lower Cp110 levels are also likely to have lower levels of ciliary adhesion proteins that contribute to basal body docking to actin, so does docking of these basal bodies with lower Cp110 differ as compared to those with higher Cp110 levels? Also, do cilia that emanate from basal bodies with higher and lower Cp110 levels differ? Does overexpression of Cp110 recruit excess CA proteins to the basal bodies/rootlets?

3) Most importantly, data are currently not sufficiently convincing to support a major conclusion, namely, the existence of the Cp110-FAK interaction. In particular, biochemical support for the observation regarding Cp110 interactions with FAK and the actin cytoskeleton is lacking. For example, data in Figure 4A are not of sufficient quality, as only data from over-expression are shown, and adequate negative controls are lacking. Immunoprecipitation of endogenous proteins, ideally using both antibodies, and/or validation of the interaction between Cp110 and another component of the ciliary adhesion complex (vinculin, paxillin) is essential.

4) The authors state (subsection “Cp110 localizes to cilia-forming basal bodies”) that Cp110 plays a role in cilia length control because intermediate levels result in short cilia. Without additional ciliary markers (besides ac-tubulin) and/or ultra-structural studies, this conclusion is not well-supported.

Reviewer #2:

The Walentek manuscript details the function of CP110 in regulating cilia formation in MCCs in Xenopus. They find that CP110 levels are elaborately regulated by the MCC regulatory network. Depletion of CP110 causes a range of phenotypes including loss of cilia, loss of cilia organization, loss of basal body docking and loss of adhesion complex localization. Overexpression of CP110 has previously been reported to cause ciliogenesis defects, but they further these studies by perform domain mapping to determine the functional domains of CP110 responsible for localization and function at the basal body. Additionally, they perform detailed localization studies and find GFP-CP110 localized adjacent to basal bodies towards the rootlet and weakly at the tip of the rootlet. These results are consistent with a potential role in adhesion complex formation which is disrupted in morphants. CP110 is a very interesting protein and this paper suggests novel previously unappreciated functions for it during ciliogenesis. The manuscript contains a large amount of high quality imaging data and is well written. Clearly the loss of CP110 is detrimental to the function of MCCs. The challenge is determining the primary vs. secondary defects associated with CP110 which I think requires a bit more effort. My main concern is that many of the phenotypes might not be directly attributable to CP110 but to any basal body that has failed to dock.


With the rate of videos presented I am not sure one can make too strong a claim about directionality (I don't doubt the overall claim but the data in Figure 1—figure supplement 1B seems a bit subjective to me). While this claim is consistent with the rootlet polarity (1C) it is a bit concerning as one does not know which rootlets actually contain a cilium, as most probably do not give the observed ciliogenesis phenotype. Since rootlets without cilia or with immotile cilia will likely not be polarized, I suspect that any polarity defect is secondary to ciliogenesis and should be presented as such.

Figure 1—figure supplement 1E. I could not find a description of what constitutes a mild vs. severe defect in docking and I worry that this data is also a bit subjective. As this phenotype is likely contributing to many (or all) of the other phenotypes it seems critically important.

The claim that Cp110 localizes to "cilia forming basal bodies" seems a bit restrictive, as S3G clearly shows CP110 at non-cilia forming centrioles. Also, the main claim of this manuscript is that CP110 levels are critical, so the overexpression (and therefore localization) of CP110 might not reflect the endogenous situation in regards to localization. This data, while reasonable should be qualified and more clearly stated.

"At the apical membrane, GFP-Cp110 localized between Centrin4-CFP and F-actin (Figure 4—figure supplement 1A), supporting the idea that Cp110 might facilitate F-actin binding." I have several concerns with this figure. First off, from my reading of the EM literature there is a complex 3D architecture of actin in MCCs. This analysis appears to be done at the level of the lower basal body / upper rootlet and I am unclear what pool of actin is being analyzed. Second the quality of the image together with the somewhat diffuse actin staining does not seem to me to reflex any consistent relationship between CP110 localization and actin.

"We conclude from these experiments that Cp110 is required for normal formation of ciliary adhesion complexes in MCCs, and suggest that loss of FAK, Vinculin and Paxillin from basal bodies and the apical membrane causes the observed defects in basal body transport, docking and alignment, as well as loss of apical actin." The claim that CP110 somehow regulates the adhesion complex seems concerning. If basal bodies have failed to dock then I am not sure what one would expect to find in regards to the adhesion complex. I am concerned that these adhesion complex phenotypes are completely secondary to docking failure and not that FAK is regulating docking.

"In MCCs, gfp-cp110DCentral induced strong aggregation and an increased number of basal bodies (Figure 5—figure supplement 2C-D), implicating Cp110 in regulation of basal body biogenesis and separation via the MCC-specific deuterosome pathway." This is most certainly an overstatement. Multinucleated cells have more "stuff" and therefore make more cilia, independent of what is causing the cytokinesis defect.

Reviewer #2 (Additional data files and statistical comments):

Most of the data is solid. A better description of some of the "subjective" quantifications should be provided. Full images of the IP would help in the interpretation of the rigor of these experiments.

Reviewer #3:

Walentek, Harland and coauthors here present a detailed analysis of the impacts of CP110 deficiency and overexpression on ciliogenesis, primarily in Xenopus. The regulation of Cp110 levels through miRNAs in ciliogenesis was shown in a recent paper from the authors (Song et al. (2014) Nature 510: 115-120) and the dual roles of Cp110 in ciliogenesis have been demonstrated in the mouse (Yadav et al. (2016) Development 143:1491-1501). To make the current submission a significant advance on this previous work, there are some important control experiments needed.

1) The localizations shown for GFP-Cp110 are inconsistent in Figure 3: Figure 3A shows GFP-CP110 away from the distal end of the basal body, in contrast to its localization in Figure 3D' at the distal end and possibly at the rootlet, and apparently at both centrioles in the mono-ciliated cells. As the main topic of the MS. is the importance of CP110 levels, the concern about promiscuous localization of over-expressed CP110 should be addressed. Where is the endogenous protein?

2) Better controls should be shown for the IP experiments in Figure 4. The co-IPs with FAK-GFP and Centrin4-GFP are effectively the negative controls for each other, so they should be included on the same membrane.

3) It is not clear whether Cp110-FS is actually expressed, or whether this was an error in the deposited sequence. The Xenopus tropicalis CP110 sequence should be verified by RT-PCR and the correct sequence deposited. The section on the Xt sequence should be rewritten accordingly.

4) The expression levels of the various Cp110 deletion constructs appear different by GFP fluorescence. An immunoblot should be included to show that the different effects are not due to different expression levels or altered protein stability.

5) Arising from point 4., are post-translational regulation of Cp110 levels important in MCCs? Given the published work on the cell cycle regulation of Cp110, some discussion/ clarification of this point for the differentiated cells would be relevant.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Ciliary transcription factors and miRNAs precisely regulate Cp110 levels required for ciliary adhesions and ciliogenesis" for further consideration at eLife. Your revised article has been favorably evaluated by Janet Rossant as the Senior editor and Reviewing editor, and three reviewers.

The manuscript has been improved and provides important new insights into the roles of Cp110 in ciliogenesis, but there is a remaining issue that needs to be addressed before acceptance, as outlined below:

The main concern remains that the conclusions on the localization of Cp110 are largely based on expression of GFP-CP110, which may be over-expressed relative to endogenous protein, and that they lack quantitation. The authors should present evidence that the unconventional localization is not background and that it is a statistically significant occurrence. It was recognized that the findings of the paper are novel and interesting and should not be held hostage to the lack of all the necessary reagents to confirm native localization and interactions. However, the reviewers felt that the claims of the paper on these issues should be modified and the caveats made clearer.


Author response

The reviewers have discussed the reviews with one another extensively and have concluded that the paper as it stands lacks some important data, particularly with regard to the localization of the endogenous components of the complexes in which Cp110 is proposed to be engaged. A significant amount of additional data is required for us to reconsider the paper, including controls for the main experiments presented in terms of localisation and CP110 interaction with the ciliary adhesion complex, FAK and the actin cytoskeleton. The reviewers felt that you might be able to address these issues within the eLife two month window for revisions, but only if you have immediate access to appropriate antibodies to carry out the analysis requested. After reading the reviews, please let us know if you feel you can address the comments with new data in a timely manner – direct email discussion with Dr Rossant is simplest.

The full reviews are provided below to help you consider whether the revisions requested can be achieved.

We thank the reviewers and editors for their thoughtful suggestions and critical assessment of our manuscript. We have addressed all of the reviewers’ concerns through clarification and experiments. Most importantly, we now provide additional evidence for the regulation of ciliary adhesion complexes by Cp110. We present new conventional and super-resolution immunofluorescence imaging data on endogenous Cp110 localization at basal bodies in human airway multiciliated cells, which confirms our findings from GFP-Cp110 overexpression.

Furthermore, we show co-localization of Cp110 and FAK at posterior basal bodies, and dosedependent recruitment of FAK to basal bodies and rootlets upon Cp110 overexpression in Xenopus, which supports the idea that different doses of Cp110 have different effects on the cilia. We now also show that defects in basal body alignment and ciliary adhesion localization are not secondary to defects in basal body docking, since we have identified conditions where basal body docking and cilia formation are normal, but alignment is affected. Finally, we show that the differential effects of Cp110 deletion constructs are not primarily caused by differences in expression levels.

Reviewer #1:

Using Xenopus embryos, the authors show that optimal Cp110 levels are required for cilia formation and that Cp110 is needed for ciliary adhesion complex formation. In addition, analysis of Cp110 mutants revealed distinct functions for different Cp110 domains. The ciliation defects in cp110 morphants were initially reported by the authors in (Song et al., 2014), and this study extends these observations to examine the mechanism of Cp110 in promoting ciliogenesis, as compared to its well-studied role in limiting cilium assembly. These studies also confirm certain recent findings in knock-out mice. The most novel data pertain to a role for Cp110 in regulating actin pathways and the ciliary adhesion complex. However, the latter data need substantial corroboration as described below.

1) The authors conclude that Cp110 could promote cilia assembly by facilitating formation of the ciliary adhesion (CA) complex, which was previously shown to link basal bodies and ciliary rootlets to the apical actin network. Because Cp110 localizes to both the basal body and tip of rootlets, does Cp110 MO also affect rootlet structure (e.g., length)? In Figure 4C and Figure 4—figure supplement 1D, E, the localization of ciliary adhesion complex around the basal bodies (possibly the rootlet region) seems to be more dramatically affected than at the basal bodies. Does Cp110 loss lead to overall reduction of CA proteins or preferential disappearance of CA proteins at the tip of rootlet? Triple staining of CA proteins, basal bodies and rootlets may help.

We agree with the reviewer that loss of ciliary adhesion complex proteins appears more dramatic at the rootlet than at the basal body, although clearly both populations are affected. So, to address this we provide additional experiments in the revised manuscript, in which we demonstrate the dose-dependent effects of cp110 knockdown on MCCs (Figure 1—figure supplement 1C-D). At low concentrations, cp110 MO caused disruption of basal body alignment and mild apical actin defects, but without major impact on ciliation or apical basal body transport/docking or rootlet formation. These data support the conclusion that the rootlet complex of ciliary adhesion proteins is most sensitive to Cp110 deficiency, possibly because Cp110 levels are relatively low at the rootlet tip (Figure 3C’).

We also provide a triple staining in controls and cp110 morphants using Centrin-CFP to mark the basal body, Clamp-RFP as rootlet marker, and FAK-GFP for ciliary adhesions, as suggested by the reviewer. We now show in Figure 4—figure supplement 1B that Clamp and Centrin4 localize to rootlets/basal bodies in both controls and cp110 morphant MCCs, while FAK is selectively and strongly reduced in cp110 morphants. These results indicate that loss of the rootlet is unlikely the primary cause for loss of ciliary adhesion complexes and failure of ciliogenesis in Cp110-deficient MCCs. Further analysis of apical versus deep basal bodies in cp110 morphant MCCs (Figure 4—figure supplement 1B’) revealed that Clamp staining in apically localized basal bodies was similar to controls, while Clamp concentrations at basal bodies that remained deep in the cytoplasm were reduced, indicating possible defects in the most significantly affected basal bodies.

Our results are in line with Yadav et al. (Development, 2016, 143, 1491-1501), who show that Rootletin still localizes to basal bodies/rootlets in Cp110-/- mice. Furthermore, Yang et al. (2005, Mol Cell Biol. 25(10):4129-37) previously reported that rootlets are not required for basal body docking and ciliogenesis in the mouse. We refer to these observations in the third paragraph of the subsection “Cp110 is required for ciliary adhesion complex formation”.

Taken together, we conclude that loss of ciliary adhesion complexes and cilia formation is not primarily caused by a loss of the rootlet, and that ciliary adhesion complexes are strongly reduced in Cp110-deficient basal bodies even when the rootlet marker Clamp is still present.

2) Related to the above point: A major conclusion is that Cp110 needs to be kept at optimal levels. In normal embryos, Cp110 and ciliary adhesion complex levels differ among basal bodies at anterior and posterior aspects. How does this asymmetric distribution correlate with the role of Cp110 in ciliogenesis?

Our data suggest that cellular Cp110 levels need to be optimal to allow for successful ciliogenesis. The finding that levels of ciliary adhesion complexes and Cp110 also vary along the axis of polarization is an interesting observation, but at this point we can only speculate about the mechanism of asymmetric distribution as well as about the functional consequences of this asymmetry. It could be related to the mechanism by which tissue-level planar cell polarity signaling (e.g. via Frizzled6 and Vangl1) is transduced to the polarity of basal bodies in MCCs. Vladar and colleagues (2015, Methods in Cell Biology, 127, 37-54) have proposed that in the trachea – where cilia beat along the proximal-distal axis – proximally localized Frizzled connects to the “first row” of basal bodies via microtubules. This is thought to polarize these basal bodies, which pass this polarity on to the remaining basal bodies within the cell via the apical and sub-apical actin networks. Therefore, the differences in levels of ciliary adhesion complex proteins and Cp110 along this axis might reflect the strength of polarization and mechanical coupling. Such a reasoning is also discussed by Antoniades et al. (2014, Dev Cell 28, 70-80).

In fact, we do observe this polarity more frequently in earlier stages, possibly during initial polarization, than in later stages. This suggests that additional ciliary adhesion proteins and Cp110 could be recruited during later steps of polarization to further stabilize basal body orientation, possibly in a similar manner as suggested for Bbof1 (Chien et al. 2013, Development Aug, 140(16):3468-77).

Basal bodies with lower Cp110 levels are also likely to have lower levels of ciliary adhesion proteins that contribute to basal body docking to actin, so does docking of these basal bodies with lower Cp110 differ as compared to those with higher Cp110 levels?

In the revised manuscript we present data on cp110 MO-dose dependent phenotypes in MCCs (Figure 1—figure supplement 1C-D). Low cp110 MO concentrations lead to largely normal docking of basal bodies and successful ciliogenesis, while interfering selectively with proper basal body alignment. With increasing concentrations, cp110 MO causes increasingly severe basal body transport and docking defects with the result that cilia are not formed and basal bodies remain deep in the cytoplasm. All these processes require ciliary adhesion complexes, and a similar dose-dependency was reported for FAK knockdown in MCCs (Antoniades et al. 2014, Dev Cell 28, 70-80). Therefore, this data supports our hypothesis that a fairly specific (low) dose of Cp110 is required for normal ciliary adhesion complex formation and function, while excess levels of Cp110 recruit more ciliary adhesions to basal bodies (Figure 4E-F), but simultaneously prevent cilia formation, likely by distal end capping(Kobayashi et al. Centriolar Kinesin Kif24 Interacts with CP110 to Remodel Microtubules and Regulate Ciliogenesis. Cell 145, 914–925 [2011]; Spektoret al. Cep97 and CP110 suppress a cilia assembly program. Cell 130, 678–90 [2007]).

Also, do cilia that emanate from basal bodies with higher and lower Cp110 levels differ?

Yes, we do observe a reduction in length of GRP cilia with more Cp110 (Figure 3—figure supplement 2B, B’). We address this in the Results subsection “Cp110 localizes to cilia-forming basal bodies” as well as in the discussion on Cp110’s possible role in cilia length control and resorption (Discussion, fourth paragraph).

Does overexpression of Cp110 recruit excess CA proteins to the basal bodies/rootlets?

We thank the reviewer for this suggestion. We performed the experiments and we do see a dose-dependent increase in FAK-GFP localization upon cp110 overexpression. The results are now shown in Figure 4E-F, and mentioned in the Results subsection “Cp110 is required for ciliary adhesion complex formation” as well as in the second paragraph of the Discussion.

3) Most importantly, data are currently not sufficiently convincing to support a major conclusion, namely, the existence of the Cp110-FAK interaction. In particular, biochemical support for the observation regarding Cp110 interactions with FAK and the actin cytoskeleton is lacking. For example, data in Figure 4A are not of sufficient quality, as only data from over-expression are shown, and adequate negative controls are lacking. Immunoprecipitation of endogenous proteins, ideally using both antibodies, and/or validation of the interaction between Cp110 and another component of the ciliary adhesion complex (vinculin, paxillin) is essential.

We agree with the reviewer that Co-IP of endogenous protein would strongly support our experimental findings and the Co-IP data from overexpressed Flag-tagged Cp110. We have tried two commercially available anti-human-Cp110 antibodies and used human airway epithelial cell cultures as our target for immunoprecipitation. Unfortunately, despite obtaining effective ciliation in these cultures over the four week period required, we were limited in the amount of material and could not convincingly Co-IP associated proteins, including endogenous FAK. Nevertheless, our other observations show that the proteins are associated in a functional complex, even though we cannot make a statement that they are in direct contact. The finding that they do participate in the functional regulation of ciliary adhesions as well as basal body interactions with Actin is one of the significant insights coming from the work.

As suggested by reviewers two and three, we now show the full membranes for the Co-IP of overexpressed Cp110 in Xenopus in Figure 4—figure supplement 2E. In Figure 4B, we also show the uninjected control lane. In the revised manuscript, we clearly point out the differences between Co-IPs on endogenous and overexpressed Cp110.

Importantly, however, we provide additional conventional and super-resolution immunofluorescence data of endogenous Cp110 in human airway multiciliated cells, which confirms Cp110 localization at cilia-forming basal bodies in the same way as observed with overexpressed GFP-Cp110 in Xenopus. Furthermore, we show co-localization of GFP-Cp110 and FAK-mKate (Figure 4A), and that FAK-GFP localization to basal bodies correlates with Cp110 levels in loss- and gain-of-function experiments (Figure 4C-F).

Collectively, these data support our main conclusion that Cp110 is required for ciliary adhesion complex formation/recruitment to basal bodies. Nevertheless, it remains to be demonstrated if the influence of Cp110 on ciliary adhesion complex proteins is via direct interaction or if it involves additional protein complexes, which we will address in future unbiased proteomics studies.

4) The authors state (subsection “Cp110 localizes to cilia-forming basal bodies”) that Cp110 plays a role in cilia length control because intermediate levels result in short cilia. Without additional ciliary markers (besides ac-tubulin) and/or ultra-structural studies, this conclusion is not well-supported.

We appreciate the comment and agree with the reviewer that our rather short statement in the initial manuscript might have led to the impression we are overstating this correlative finding.

We provide additional data in the revised manuscript that support our hypothesis that Cp110 might be involved in ciliary length control/cilia resorption. In a subset of embryos, we observe frequent ciliary tip localization of Cp110 in monociliated Gastrocoel Roof Plate cells (GRP cells of the left-right organizer/node equivalent), which is now shown in Figure 3—figure supplement 2D. This observation suggests that Cp110 could be directly involved in cilia length regulation. We think that Cp110 at the ciliary tip could mediate axoneme depolymerization and cilia resorption for the following reasons:

1) Ciliated cells at the left-right organizer are a transient phenomenon during development. After the left-right axis is induced by cilia-driven leftward flow, cells retract their cilia in a coordinated manner which allows re-entry into the cell cycle (Komatsu et al. Development, 2011, Sep;138(18):3915-20) and ingression into the somites, notochord and hypochord in Xenopus (Shook et al. Developmental Biology, 2004, 270:163-185). The observation that we find more abundant ciliary tip localization of Cp110 in older embryos is consistent with the idea that Cp110 accumulates in tips of cilia that are actively shortening. Furthermore, we see Cp110 more frequently at ciliary tips at the lateral edges of the GRP, which is in line with the finding that GRP cells ingress from lateral to medial in Xenopus laevis (Shook et al. Developmental Biology, 2004, 270:163-185).

2) Cp110 was reported to be part of a cilia suppression complex, which acts via recruitment of negative regulators of tubulin polymerization, i.e. Kif24 (which was shown to specifically depolymerize centriolar microtubules, but not cytoplasmic microtubules; please see Kobayashi et al. Cell, 2011, 145(6):914-25). Therefore, Cp110 could be translocated to the ciliary tip together with Kif24 in order to promote active axoneme depolymerization necessary for cilia resorption.

In the revised manuscript, we now discuss these findings and our hypothesis in the fourth paragraph of the Discussion.

Reviewer #2:

With the rate of videos presented I am not sure one can make too strong a claim about directionality (I don't doubt the overall claim but the data in Figure 1—figure supplement 1B seems a bit subjective to me). While this claim is consistent with the rootlet polarity (1C) it is a bit concerning as one does not know which rootlets actually contain a cilium, as most probably do not give the observed ciliogenesis phenotype. Since rootlets without cilia or with immotile cilia will likely not be polarized, I suspect that any polarity defect is secondary to ciliogenesis and should be presented as such.

We agree with the reviewer and this is certainly true for cp110 morphants injected with high doses of cp110 MO. Our additional data argue that polarity defects can occur in the absence of severe ciliogenesis defects in cp110 morphants injected with low doses of cp110 MO. In revised Figure 1—figure supplement 1C and D we now show the dose-dependent effects on ciliation, basal body polarization, basal body localization and apical actin formation.

Figure 1—figure supplement 1E. I could not find a description of what constitutes a mild vs. severe defect in docking and I worry that this data is also a bit subjective. As this phenotype is likely contributing to many (or all) of the other phenotypes it seems critically important.

Representative examples as used for classification into “fully docked”, “mild docking defect” and “severe docking defect” are shown in the figures and color coded (white, grey and black boxes shown on lateral projections) in Figure 1E and Figure 1—figure supplement 2B. In the revised manuscript, we have added a description to the figure legend to clarify that. Additionally, we have taken one of the data sets and re-analyzed it in a more quantitative fashion: Confocal z-stacks from controls, cp110 morphants, and rescued cp110 morphants were analyzed for presence of apically localized basal bodies and basal bodies that remained deep in the cytoplasm. Apically localized basal bodies were defined as present in the first (apical) 4 z-sections containing Centrin4-CFP signal (=1.82µm), deep localized basal bodies were defined as Centrin4-CFP signals located below 1.82µm. Next, we used the 3D Objects Counter plugin in ImageJ to quantify basal bodies that remained deep in the cytoplasm. These automatic quantifications were then inspected and corrected in cases where objects other than basal bodies were detected (assigned object count = 0), and where two or more basal bodies were counted as one (assigned object count =2 or more). This analysis confirmed our previous conclusions and the results are depicted in revised Figure 1—figure supplement 2C-D.

The claim that Cp110 localizes to "cilia forming basal bodies" seems a bit restrictive, as S3G clearly shows CP110 at non-cilia forming centrioles.

We do not mean our wording in a restrictive sense. In this manuscript we use “Cp110 localizes to cilia forming basal bodies (and rootlets)” to emphasize our focus on Cp110’s role in cilia formation and function. In the revised manuscript we now mention Cp110’s centriolar role more prominently.

Also, the main claim of this manuscript is that CP110 levels are critical, so the overexpression (and therefore localization) of CP110 might not reflect the endogenous situation in regards to localization. This data, while reasonable should be qualified and more clearly stated.

In revised Figure 3B, D-F we now show endogenous Cp110 localization data from human airway epithelial cells generated by confocal as well as super-resolution imaging. As in the case of the overexpression data, endogenous Cp110 localizes to the base of cilia (Figure 3B, D), adjacent to the basal body (Figure 3F) and at the rootlet (Figure 3E). This adds to our previous data on endogenous Cp110 localization to cilia-forming basal bodies in human and mouse airway MCCs, which we in part moved to revised Figure 3—figure supplement 1D-E.

Additionally, although the authors made no comment, careful re-examination of previously published work by Tanos et al. (Genes Dev. 2013, 27:163-168) revealed essentially the same Cp110 localization pattern (medium levels adjacent to the distal end of the cilia-forming mother centriole – low levels at the tip of the rootlet) in primary cilia of human RPE-1 cells using antibody staining of endogenous protein in combination with super-resolution imaging (we provided a figure for the reviewers’ consideration).

"At the apical membrane, GFP-Cp110 localized between Centrin4-CFP and F-actin (Figure 4—figure supplement 1A), supporting the idea that Cp110 might facilitate F-actin binding." I have several concerns with this figure. First off, from my reading of the EM literature there is a complex 3D architecture of actin in MCCs. This analysis appears to be done at the level of the lower basal body / upper rootlet and I am unclear what pool of actin is being analyzed. Second the quality of the image together with the somewhat diffuse actin staining does not seem to me to reflex any consistent relationship between CP110 localization and actin.

We agree with the reviewer in that the figure was difficult to assess. Therefore, we have removed it from the revised manuscript, and instead provide additional triple staining of Centrin4-CFP, GFP-Cp110 and FAK-mKate (Figure 4A, Figure 4—figure supplement 1A). This triple staining revealed that Cp110 overlaps posteriorly with Centrin, while FAK mainly overlaps with and extends Cp110 at the posterior domain. These data thus further support a role for Cp110 in linking ciliary adhesions to the basal body. Ciliary adhesions, in turn, were shown to directly interact with the actin cytoskeleton in MCCs by FRET analysis (Antoniades et al. 2014, Dev Cell 28, 70-80).

"We conclude from these experiments that Cp110 is required for normal formation of ciliary adhesion complexes in MCCs, and suggest that loss of FAK, Vinculin and Paxillin from basal bodies and the apical membrane causes the observed defects in basal body transport, docking and alignment, as well as loss of apical actin." The claim that CP110 somehow regulates the adhesion complex seems concerning. If basal bodies have failed to dock then I am not sure what one would expect to find in regards to the adhesion complex. I am concerned that these adhesion complex phenotypes are completely secondary to docking failure and not that FAK is regulating docking.

Antoniades et al. (2014, Dev Cell 28, 70-80) have shown that ciliary adhesion complexes in MCCs are first required for apical basal body transport and docking. Therefore, ciliary adhesions act upstream of basal body docking to the apical membrane, in addition to their later role in basal body alignment, which takes place after docking and cilia formation. In revised Figure 3—figure supplement 1A we now show that Cp110 localizes to newly formed basal bodies already during stages when apical basal body transport and docking takes place, which supports our conclusion.

Additionally, we present new data on cp110 MO-dose dependent phenotypes in MCCs (Figure 1—figure supplement 1C-D). Low cp110 MO concentrations lead to normal apical transport and docking of basal bodies and successful ciliogenesis, while interfering selectively with proper basal body alignment, which depends on ciliary adhesions at the rootlet tip. Lower Cp110 concentrations are found at the rootlet tip (Figure 3C’) and loss of ciliary adhesion complexes is more pronounced at this site (Figure 4D, Figure 4—figure supplement 2C-D). We further provide evidence that gain of Cp110 increases FAK levels at basal bodies and rootlets – again, in a dose-dependent manner. Collectively, these data strongly support a specific and dose-dependent effect of Cp110 loss on ciliary adhesion formation, independent of basal body docking.

Our conclusions are also in line with the observations by Yadav et al. (Development, 2016, 143, 1491-1501) that in Cp110-/- mice, 5-10% of primary cilia were still formed, and basal bodies docked to ciliary vesicles were found in about the same frequency. These mice should lack Cp110 protein altogether; therefore, presence of Cp110 at the basal body does not seem to be a strict requirement for ciliary vesicle docking (which also takes place at the distal end and not adjacent to the basal body where Cp110 is found in cilia-forming basal bodies) and cilia formation, but rather promote it at the optimal concentrations and sites. For clarification, we extended our discussion on this point in the third paragraph of the Discussion.

"In MCCs, gfp-cp110DCentral induced strong aggregation and an increased number of basal bodies (Figure 5—figure supplement 2C-D), implicating Cp110 in regulation of basal body biogenesis and separation via the MCC-specific deuterosome pathway." This is most certainly an overstatement. Multinucleated cells have more "stuff" and therefore make more cilia, independent of what is causing the cytokinesis defect.

We agree with the reviewer in that the increase in basal body numbers is likely a secondary effect due to the presence of supernumerary centrioles. The sentence now reads as follows: “In MCCs, gfp-cp110△Central induced strong aggregation and an increased number of basal bodies (Figure 5—figure supplement 2C-D), likely due to the presence of supernumerary centrioles at the onset of deuterosome-mediated centriole amplification.”

Reviewer #2 (Additional data files and statistical comments):

Most of the data is solid. A better description of some of the "subjective" quantifications should be provided. Full images of the IP would help in the interpretation of the rigor of these experiments.

We now provide a quantification of basal body localization (Figure 1—figure supplement 2C). Full images of the IP presented in Figure 4F are now shown in Figure 4—figure supplement 2E.

Reviewer #3:

1) The localizations shown for GFP-Cp110 are inconsistent in Figure 3: Figure 3A shows GFP-CP110 away from the distal end of the basal body, in contrast to its localization in Figure 3D' at the distal end and possibly at the rootlet, and apparently at both centrioles in the mono-ciliated cells. As the main topic of the MS. is the importance of CP110 levels, the concern about promiscuous localization of over-expressed CP110 should be addressed. Where is the endogenous protein?

In both cases, (revised Figure 3A and C’) GFP-Cp110 localizes adjacent to the basal body in a posterior polarized fashion, with some overlap with the Centrin4-CFP. We understand that this is somewhat more difficult to appreciate in Figure 3C’ where we increased brightness of the GFP channel to visualize the harder-to-see population of GFP-Cp110 at the rootlet tip (Author response image 1). Therefore, we indicated the positions of Centrin4-CFP (yellow circle) and GFP-Cp110 (green dotted circle) in Figure 3C’.

Author response image 1
Left panel shows Centrin-CFP (blue) and GFP-Cp110 (green) in images where green channel brightness is low.

In this image Cp110 localizes adjacent to the basal body. Right panel shows Centrin-CFP (blue) and GFP-Cp110 (green) in images where green channel brightness is high. In this image we can visualize the low-level localization of GFP-Cp110 to the rootlet tip, which was not visible in the left panel. Bottom panel shows Clamp-RFP staining of the ciliary rootlet (red). Top row, middle panel shows schematic localization of Cp110 relative to the basal body and the rootlet. Green = Cp110, blue = Centrin4, red = Clamp.


In revised Figure 3B, D-F we now show endogenous Cp110 localization data from human airway epithelial cells. As in the case of the overexpression data, endogenous Cp110 localizes to the base of cilia (Figure 3B, D), adjacent to the basal body (Figure 3F) and at the rootlet (Figure 3E). We have also included a schematic overview of the observed Cp110 localization patterns at centrioles and basal bodies (Figure 3—figure supplement 3A-B).

Additionally, careful re-examination of previously published work by Tanos et al. (Genes Dev. 2013, 27:163-168) revealed essentially the same Cp110 localization pattern (medium levels adjacent to the distal end of the cilia-forming mother centriole, low levels at the tip of the rootlet) in primary cilia of human RPE-1 cells using antibody staining of endogenous protein in combination with super-resolution imaging.

2) Better controls should be shown for the IP experiments in Figure 4. The co-IPs with FAK-GFP and Centrin4-GFP are effectively the negative controls for each other, so they should be included on the same membrane.

We thank the reviewer for this comment. Indeed, the experiment was performed on the same membrane and also included Flag-IP of a Flag-Cp110FS△CCD1 construct which also interacted with FAK-GFP and Centrin4-GFP. The full membrane scans are now provided in the revised manuscript Figure 4—figure supplement 2E.

3) It is not clear whether Cp110-FS is actually expressed, or whether this was an error in the deposited sequence. The Xenopus tropicalis CP110 sequence should be verified by RT-PCR and the correct sequence deposited. The section on the Xt sequence should be rewritten accordingly.

We have no indication that the Cp110-FS clone (accession # BC167469) is representing a real transcript variant, but we rather conclude that it was a cloning artifact during the initial EST clone collection. The NCBI curators have already identified the artifact in the reference sequence clone independently from us. Therefore, the previous reference sequence for Xenopus tropicalis cp110 was suppressed with the comment: “This RefSeq was suppressed temporarily based on the calculation that the encoded protein was shorter than proteins from the putative ortholog from human: CCP110 (GeneID:9738)” (link: http://www.ncbi.nlm.nih.gov/nuccore/194332527).

The missing adenine is also present in Xenopus laevis cp110 at the same position (not shown). Author response image 2 shows an alignment of the region in question including BC167469 (cp110-fs clone), the updated Xenopus tropicalis cp110 reference sequence (XM_0129708) and genome sequence (v9.0). In all but BC167469 the Adenine at position 1766 is present.

Author response image 2
Alignment of the cp110 region, where the missing Adenine was identified in the FS-clone.

BC167469, Xenopus tropicalis genome 9.0 sequence and the current Xenopus tropicalis cp110 reference sequence (XM_0129708) are shown.


4) The expression levels of the various Cp110 deletion constructs appear different by GFP fluorescence. An immunoblot should be included to show that the different effects are not due to different expression levels or altered protein stability.

We agree with the reviewer that there are some differences in effective expression levels between the constructs. We have indicated that in Figure 5—figure supplement 2F (last column) of our manuscript. As requested, we now show an immunoblot of GFP-tagged Cp110 constructs (Figure 5—figure supplement 1C), which shows that all constructs are expressed in relevant stages (stage 20) at similar levels, with GFP-Cp110△Central (which lacks the RXL and KEN motifs) and GFP-Cp110△C (which lacks the miR-34/449 target sites in its mRNA) showing the highest expression. Most importantly, GFP-Cp110△CCD1&2 (which shows low cilia inhibition potential) is not significantly less expressed than constructs that inhibit cilia efficiently.

5) Arising from point 4., are post-translational regulation of Cp110 levels important in MCCs? Given the published work on the cell cycle regulation of Cp110, some discussion/ clarification of this point for the differentiated cells would be relevant.

We agree with the reviewer that post-translational mechanisms likely contribute to the regulation of Cp110 levels in all cells, including MCCs to some extent. We indicate that by stating: “Interestingly, the negative effects on basal bodies and cell size were variable among cilia-inhibiting constructs (Figure 5—figure supplement 1F): Most prominently, deletion of a central domain (GFP-Cp110ΔCentral) containing most phosphorylation sites, RXL and KEN domains (proteasome targeting motifs), induced much stronger effects than full-length Cp110 (Figure 5B; Figure 5—figure supplement 1F). This suggests that central domain deletion generated a hypermorphic protein which was released from negative regulation by the proteasomal machinery.”

[Editors' note: further revisions were requested prior to acceptance, as described below.]

The main concern remains that the conclusions on the localization of Cp110 are largely based on expression of GFP-CP110, which may be over-expressed relative to endogenous protein, and that they lack quantitation. The authors should present evidence that the unconventional localization is not background and that it is a statistically significant occurrence. It was recognized that the findings of the paper are novel and interesting and should not be held hostage to the lack of all the necessary reagents to confirm native localization and interactions. However, the reviewers felt that the claims of the paper on these issues should be modified and the caveats made clearer.

We thank the reviewers and editors for the constructive criticism on our manuscript, which helped to improve it. However, we are puzzled about the above comment, that “The main concern remains that the conclusions on the localization of Cp110 are largely based on expression of GFP-CP110, which may be over-expressed relative to endogenous protein, and that they lack quantitation. The authors should present evidence that the unconventional localization is not background and that it is a statistically significant occurrence.”

Indeed, we added further immunostaining (conventional and super-resolution) of endogenous proteins to the paper, which addressed this point directly. The staining is reproducible, and we provide the number of experiments/donors and cells in the figure legends to figures Figure 3B (n donors = 1, n MCCs =4), 3D (n donors =1, n MCCs = 12), 3E-F (n donors = 1, n MCCs = 3 each for confocal and 3D-SIM), Figure 3—figure supplement 1D-E (mice, n=4; and including a control staining with only secondary antibody). In all species and cases, Cp110 was found at cilia-forming basal bodies. Furthermore, with respect to the possibility that GFP might cause background, other papers have demonstrated that expression of GFP alone does not result in profound basal body localization (including Antoniades, I., Stylianou, P. & Skourides, P. A. Making the connection: ciliary adhesion complexes anchor Basal bodies to the actin cytoskeleton. Dev. Cell28,70–80 (2014).).

We have however, further addressed the reviewer’s concern in our re-revised manuscript by including additional data on the localization of an overexpressed, GFP-tagged Cep97 construct in the Xenopus epidermis and present these findings in revised Figure 3—figure supplement 3 as well as in the third paragraph of the subsection “Cp110 localizes to cilia-forming basal bodies”. Cep97 cooperates with Cp110 in cilia suppression at centrosomes (Spektor, A., Tsang, W. Y., Khoo, D. & Dynlacht, B. D. Cep97 and CP110 suppress a cilia assembly program. Cell130, 678–90 (2007)). We now show that while GFP- Cep97 localizes robustly to centrosomes, it does not localize to MCC basal bodies and does not suppress cilia formation, which further supports our conclusion that GFP-Cp110 localization adjacent to basal bodies and to rootlet tips are specific. We hope that this addresses the reviewer’s remaining concerns.

We are unsure what kind of “statistical significance” the reviewer(s) expect from us since all our staining experiments reliably detected Cp110 at basal bodies?


Article and author information

Author details

  1. Peter Walentek

    Division of Genetics, Genomics and Development, Center for Integrative Genomics, Department of Molecular and Cell Biology, University of California, Berkeley, United States
    PW, Designed and performed experiments, Interpreted the data, Wrote the manuscript
    For correspondence
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2332-6068
  2. Ian K Quigley

    Molecular Neurobiology Laboratory, Salk Institute for Biological Studies, La Jolla, United States
    IKQ, Contributed RNA-seq and ChIP-seq data and analysis
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0075-8324
  3. Dingyuan I Sun

    Division of Genetics, Genomics and Development, Center for Integrative Genomics, Department of Molecular and Cell Biology, University of California, Berkeley, United States
    DIS, Contributed to molecular cloning, in situ hybridization, sectioning and immunofluorescence staining
    Competing interests
    The authors declare that no competing interests exist.
  4. Umeet K Sajjan

    Division of Genetics, Genomics and Development, Center for Integrative Genomics, Department of Molecular and Cell Biology, University of California, Berkeley, United States
    UKS, Contributed to molecular cloning, in situ hybridization, sectioning and immunofluorescence staining
    Competing interests
    The authors declare that no competing interests exist.
  5. Christopher Kintner

    Molecular Neurobiology Laboratory, Salk Institute for Biological Studies, La Jolla, United States
    CK, Contributed RNA-seq and ChIP-seq data and analysis
    Competing interests
    The authors declare that no competing interests exist.
  6. Richard M Harland

    Division of Genetics, Genomics and Development, Center for Integrative Genomics, Department of Molecular and Cell Biology, University of California, Berkeley, United States
    RMH, Contributed to experimental design, Interpretation of data, Manuscript preparation
    For correspondence
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8247-4880


Deutsche Forschungsgemeinschaft (Wa 3365/1-1)

  • Peter Walentek

National Heart, Lung, and Blood Institute (K99HL127275)

  • Peter Walentek

National Institute of General Medical Sciences (GM42341)

  • Richard M Harland

National Institute of General Medical Sciences (GM076507)

  • Christopher Kintner

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank M Blum, BJ Mitchell, A Schweickert, PA Skourides and JB Wallingford and their labs for sharing of constructs and unpublished data, P Lishko for using GX-1 Memrecam, and the Wallingford lab for using Nikon Eclipse Ti microscope. We thank R Song, L He for discussions, help with miR qPCR and miR target analysis; and C Boecking, L Zlock, W Finkbeiner for HAECs (Cystic Fibrosis Cell Models Core funded by NIH DK072517 and Cystic Fibrosis Foundation DR613-CR11). Work in the Kintner lab was funded by NIH grant 5R01GM076507 to CK. We thank HL Aaron and J-Y Lee (Berkeley Imaging Center) for imaging support, and D Schichnes (Berkeley Biological Imaging Facility) for help with 3D-SIM (supported by NIH, Health S10 program 1S10OD018136-01). The National Xenopus Resource (RRID:SCR_013731) and Xenbase (RRID:SCR_003280) were continuously used throughout the project. We thank C Exner for careful reading of the manuscript and Edivinia and Elleanor Pangilinan for expert technical help. PW was funded by the Deutsche Forschungsgemeinschaft (DFG, Wa 3365/1-1) and NIH-NHLBI (K99HL127275). Xenopus work in the Harland laboratory was funded by NIH grant GM42341 to RMH.


Animal experimentation: This work was done with approval of University of California, Berkeley's Animal Care and Use Committee. University of California, Berkeley's assurance number is A3084-01, and is on file at the National Institutes of Health Office of Laboratory Animal Welfare.

Reviewing Editor

  1. Janet Rossant, University of Toronto, Canada

Publication history

  1. Received: May 5, 2016
  2. Accepted: September 12, 2016
  3. Accepted Manuscript published: September 13, 2016 (version 1)
  4. Version of Record published: September 30, 2016 (version 2)


© 2016, Walentek et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 2,602
    Page views
  • 654
  • 29

Article citation count generated by polling the highest count across the following sources: Crossref, Scopus, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cell Biology
    2. Developmental Biology
    Patrick Morley Willoughby et al.
    Research Article Updated

    In emerging epithelial tissues, cells undergo dramatic rearrangements to promote tissue shape changes. Dividing cells remain interconnected via transient cytokinetic bridges. Bridges are cleaved during abscission and currently, the consequences of disrupting abscission in developing epithelia are not well understood. We show that the Rab GTPase Rab25 localizes near cytokinetic midbodies and likely coordinates abscission through endomembrane trafficking in the epithelium of the zebrafish gastrula during epiboly. In maternal-zygotic Rab25a and Rab25b mutant embryos, morphogenic activity tears open persistent apical cytokinetic bridges that failed to undergo timely abscission. Cytokinesis defects result in anisotropic cell morphologies that are associated with a reduction of contractile actomyosin networks. This slows cell rearrangements and alters the viscoelastic responses of the tissue, all of which likely contribute to delayed epiboly. We present a model in which Rab25 trafficking coordinates cytokinetic bridge abscission and cortical actin density, impacting local cell shape changes and tissue-scale forces.

    1. Cell Biology
    2. Computational and Systems Biology
    Inge M N Wortel, Johannes Textor
    Tools and Resources

    The Cellular Potts Model (CPM) is a powerful in silico method for simulating biological processes at tissue scale. Their inherently graphical nature makes CPMs very accessible in theory, but in practice, they are mostly implemented in specialised frameworks users need to master before they can run simulations. We here present Artistoo (Artificial Tissue Toolbox), a JavaScript library for building 'explorable' CPM simulations where viewers can change parameters interactively, exploring their effects in real time. Simulations run directly in the web browser and do not require third-party software, plugins, or back-end servers. The JavaScript implementation imposes no major performance loss compared to frameworks written in C++; Artistoo remains sufficiently fast for interactive, real time simulations. Artistoo provides an opportunity to unlock CPM models for a broader audience: Interactive simulations can be shared via a URL in a zero-install setting. We discuss applications in CPM research, science dissemination, open science, and education.