1. Cancer Biology
Download icon

Prosurvival long noncoding RNA PINCR regulates a subset of p53 targets in human colorectal cancer cells by binding to Matrin 3

  1. Ritu Chaudhary
  2. Berkley Gryder
  3. Wendy S Woods
  4. Murugan Subramanian
  5. Matthew F Jones
  6. Xiao Ling Li
  7. Lisa M Jenkins
  8. Svetlana A Shabalina
  9. Min Mo
  10. Mary Dasso
  11. Yuan Yang
  12. Lalage M Wakefield
  13. Yuelin Zhu
  14. Susan M Frier
  15. Branden S Moriarity
  16. Kannanganattu V Prasanth
  17. Pablo Perez-Pinera
  18. Ashish Lal  Is a corresponding author
  1. National Cancer Institute, National Institutes of Health, United States
  2. University of Illinois at Urbana-Champaign, United States
  3. National Library of Medicine, National Institutes of Health, United States
  4. National Institute of Child Health and Human Development, National Institutes of Health, United States
  5. Ionis Pharmaceuticals, United States
  6. University of Minnesota, United States
Research Article
  • Cited 7
  • Views 1,539
  • Annotations
Cite as: eLife 2017;6:e23244 doi: 10.7554/eLife.23244

Abstract

Thousands of long noncoding RNAs (lncRNAs) have been discovered, yet the function of the vast majority remains unclear. Here, we show that a p53-regulated lncRNA which we named PINCR (p53-induced noncoding RNA), is induced ~100-fold after DNA damage and exerts a prosurvival function in human colorectal cancer cells (CRC) in vitro and tumor growth in vivo. Targeted deletion of PINCR in CRC cells significantly impaired G1 arrest and induced hypersensitivity to chemotherapeutic drugs. PINCR regulates the induction of a subset of p53 targets involved in G1 arrest and apoptosis, including BTG2, RRM2B and GPX1. Using a novel RNA pulldown approach that utilized endogenous S1-tagged PINCR, we show that PINCR associates with the enhancer region of these genes by binding to RNA-binding protein Matrin 3 that, in turn, associates with p53. Our findings uncover a critical prosurvival function of a p53/PINCR/Matrin 3 axis in response to DNA damage in CRC cells.

https://doi.org/10.7554/eLife.23244.001

eLife digest

Though DNA contains the information needed to build the proteins that keep cells alive, only 2% of the DNA in a human cell codes for proteins. The remaining 98% is referred to as non-coding DNA. The information in some of these non-coding regions can still be copied into molecules of RNA, including long molecules called lncRNAs. Little is known about what lncRNAs actually do, but growing evidence suggests that these molecules are important for a number of vital processes including cell growth and survival.

When the DNA in an animal cell gets damaged, the cell needs to decide whether to pause growth and repair the damage, or to kill itself if the harm is too great. One of the best-studied proteins guiding this decision is the p53 protein, which increases the number of protein-coding genes needed to carry out either option in this decision. That is to say that, p53 regulates the genes needed to kill the cell and the genes needed to temporarily pause its growth and repair the damage, which instead keeps the cell alive. So, how does the p53 protein guide the decision, and are lncRNA molecules involved?

Using human colon cancer cells, Chaudhary et al. now report that when DNA is damaged, the levels of a specific lncRNA increase 100-fold. Further experiments showed that this lncRNA – named PINCR, which refers to p53-induced noncoding RNA – promotes the survival of cells. Chaudhary et al. showed that PINCR molecules do this by recruiting a protein called Matrin 3 to a certain region in the DNA called an enhancer and then links it to promoter region in the DNA of specific genes that temporarily pause cell growth but keep the cell alive. This in turn activates these ‘pro-survival genes’. In further experiments, when the PINCR molecules were essentially deleted, p53 was not able to fully activate these genes and as a result more of the cells died.

Together these findings increase our knowledge of how lncRNAs can work, especially in the context of DNA damage in cancer cells. A next important step will be to uncover other roles for the PINCR molecule in both cancer and healthy cells.

https://doi.org/10.7554/eLife.23244.002

Introduction

The tumor suppressor p53 functions as a sequence-specific master regulatory transcription factor that controls the expression of hundreds of genes (Riley et al., 2008; Vogelstein et al., 2000) and is mutated at a high frequency in human cancer types (Oren, 1992; Vogelstein et al., 2000; Vousden and Lane, 2007). Although p53 exerts its tumor suppressor effects by regulating a wide variety of cellular processes, it has context-dependent functions (Aylon and Oren, 2016; Vousden, 2000; Zilfou and Lowe, 2009) that are determined by various factors including cell-type, genetic background of the cell, extracellular environment, and the nature and duration of stress. Depending on the cellular context, p53 can have opposite effects on cell survival, cell migration, differentiation and metabolism (Aylon and Oren, 2016; Kruiswijk et al., 2015; Zilfou and Lowe, 2009).

Consistent with these pleiotropic effects of p53, the expression of genes that have opposing effects on the above-mentioned processes are regulated by p53 (Aylon and Oren, 2016; Riley et al., 2008). For example, in the context of DNA damage, p53 induces the expression of prosurvival genes such as CDKN1A (p21), 14-3-3σ and BTG2 (Chan et al., 1999; Polyak et al., 1996; Rouault et al., 1996) that cause cell cycle arrest, as well as proapoptotic genes such as PUMA, BAX and NOXA (Riley et al., 2008) that cause cell death. Interestingly, these prosurvival and proapoptotic genes are all upregulated by p53 in a cell regardless of the effect of p53 on cellular outcome. Therefore, it is important to investigate the function of a p53 target gene in the appropriate cellular context.

While the protein-coding genes regulated by p53 have been extensively studied and we and others have identified critical roles of microRNAs (miRNAs) in the p53 pathway (Chang et al., 2007; Hermeking, 2012; Lal et al., 2011; Raver-Shapira et al., 2007), the function of the newly discovered long noncoding RNAs (lncRNAs) in p53 signaling remains largely unknown. LncRNAs are transcripts > 200 nucleotides (nt) long that lack a functional open reading frame. Growing evidence suggests critical roles of lncRNAs in multiple cellular processes including differentiation, dosage compensation, genomic stability, metabolism, metastasis and DNA repair (Arun et al., 2016; Dey et al., 2014; Fatica and Bozzoni, 2014; Lee, 2012; Lee et al., 2016; Ling et al., 2013; Mueller et al., 2015; Redis et al., 2016; Sharma et al., 2015; Tripathi et al., 2013). Some p53-regulated lncRNAs including lincRNA-p21, PANDA, PINT, LED, NEAT1 and DINO have been shown to function as downstream effectors of p53 (Adriaens et al., 2016; Blume et al., 2015; Dimitrova et al., 2014; Huarte et al., 2010; Hung et al., 2011; Léveillé et al., 2015; Marín-Béjar et al., 2013; Schmitt et al., 2016). However, the function and mode of action of most p53-regulated lncRNAs has yet to be elucidated.

In this study, we focused on a previously uncharacterized lncRNA that we named PINCR (p53-induced noncoding RNA). We show that during DNA damage, PINCR has a context-dependent function. RNA pulldowns from cells expressing endogenous PINCR fused to an S1-RNA aptamer show that PINCR binds to the RNA-binding protein Matrin 3 to regulate the induction of a subset of prosurvival p53 targets by associating with the enhancers of these genes via a Matrin 3-p53 complex. Our results identify PINCR as a lncRNA that functions as a context-dependent prosurvival gene in the p53 pathway.

Results

Identification of PINCR, a p53-regulated lncRNA

To identify lncRNAs regulated by p53 in multiple cell lines, we performed microarray analysis (Affymetrix HT2.0) from three colorectal cancer (CRC) cell lines (HCT116, RKO and SW48) following activation of p53 with Nutlin-3 (Figure 1—figure supplement 1A and Figure 1—figure supplement 1—source data 1), a pharmacological inhibitor of MDM2. Using a cut-off of 1.50-fold change, 66 transcripts were upregulated in all three lines (Figure 1—figure supplement 1B,C and Supplementary file 1). Forty-eight of the 66 transcripts were also identified in a recent p53 GRO-seq study in HCT116 cells (Allen et al., 2014) indicating that they may be direct p53 targets. The 66 transcripts included several known p53 targets including BTG2, BAX, CDKN1A (p21), GADD45A, MDM2 and RRM2B. Four out of 66 transcripts were annotated lncRNAs (Supplementary file 2).

Among the four lncRNAs, RP3-326I13.1, a ~2.2 kb long spliced intergenic lncRNA with unknown function, transcribed from the X-chromosome, was strongly induced upon p53 activation (Supplementary file 2). We validated this result by quantitative reverse transcription PCR (qRT–PCR) after Nutlin-3 treatment (Figure 1A). Due to this strong induction upon p53 activation, we named this lncRNA PINCR. Notably, although this lncRNA was also strongly and directly upregulated by p53 upon ectopic overexpression of p53 in a mutant p53-expressing CRC line (Hünten et al., 2015), its function has not been elucidated. Therefore, we decided to investigate the role of PINCR in the p53 network.

Figure 1 with 6 supplements see all
PINCR is a nuclear lncRNA directly induced by p53 after DNA damage.

(A) qRT-PCR analysis from HCT116, SW48 and RKO cells untreated or treated with Nutlin-3 for 8 hr. Error bars represent SD from two independent experiments. (B) qRT-PCR analysis for PINCR and the known p53 target PUMA from isogenic p53-WT and p53-KO HCT116 cells untreated or treated with DOXO for the indicated times. (C) Snapshot of p53 ChIP-seq data of the PINCR promoter from MCF7 and U2OS cells untreated or treated with Nutlin or 5-FU or RITA. (D) HCT116 cells were untreated or treated with DOXO for 16 hr and qPCR using primers spanning the p53RE of p21 and PINCR was performed from Input and p53-ChIP. (E) HCT116 cells were co-transfected for 48 hr with pGL3 or pGL3 containing the PINCR promoter, and pCB6 or pCB6-p53. Luciferase assays were performed using pRL-TK as internal control. (F) Luciferase assays were performed from untreated (CTL) or DOXO-treated HCT116 cells co-transfected for 48 hr with the internal control pRL-TK and pGL3 containing the PINCR wild-type (WT) promoter or pGL3 containing the PINCR promoter in which the p53RE was deleted (△p53RE). (G) Maximum CSF scores of PINCR as well as other coding and noncoding RNAs determined by analysis with PhyloCSF. (H) qRT-PCR analysis from nuclear and cytoplasmic fractions of DOXO-treated HCT116 cells; the cytoplasmic GAPDH mRNA and the nuclear lncRNA MALAT1 were used as controls. Error bars in B, D-F represent SD from three independent experiments. #p<0.01; **p<0.005; ##p<0.001.

https://doi.org/10.7554/eLife.23244.003

PINCR is a nuclear lncRNA directly regulated by p53

Given the well-established role of p53 after DNA damage, we next assessed changes in PINCR expression during DNA damage induced by Doxorubicin (DOXO) in isogenic p53 wild-type (p53-WT) and p53 knockout (p53-KO) HCT116 and SW48 cells. The final concentration of DOXO in this and all subsequent experiments was 300 nM, unless stated otherwise. The known p53 target PUMA (Nakano and Vousden, 2001) was used as a positive control. Although PINCR was almost undetectable at the basal level, after DNA damage it was significantly induced as early as 8 hr after DOXO treatment and was induced >100 fold after 24 hr, in a p53-dependent manner in both lines (Figure 1B and Figure 1—figure supplement 2A).

To determine if PINCR is a direct target of endogenous p53, we first utilized publicly available p53 ChIP-seq (Chromatin immunoprecipitation sequencing) data (Menendez et al., 2013; Nikulenkov et al., 2012). Upon p53 activation, we observed a single p53 ChIP-seq peak in a region ~118 bp upstream of the first exon of PINCR in MCF7 (breast cancer) and U2OS (osteosarcoma) cells (Figure 1C and Figure 1—figure supplement 2B). We validated this result in HCT116 cells by ChIP-qPCR (Figure 1D). We next inserted a ~2 kb region of the PINCR promoter into a promoterless luciferase reporter vector (pGL3) and co-transfected this construct in HCT116 cells along with a mammalian expression vector (pCB6) or pCB6 overexpressing p53 (pCB6-p53). We found that the PINCR promoter drives luciferase expression upon p53 overexpression (Figure 1E). Deletion of the p53-response element (p53RE) in the PINCR promoter resulted in significant decrease in luciferase activity (Figure 1F). These results suggest that PINCR is a direct target of p53.

A detailed subsequent analysis of PINCR revealed many features of this lncRNA: (1) PINCR is a noncoding RNA because its coding potential was comparable to the noncoding RNA NEAT1 (Figure 1G); (2) PINCR is highly enriched in the nucleus (Figure 1H), similar to the nuclear-retained lncRNA MALAT1 (Hutchinson et al., 2007); (3) the 5’and 3’ends of PINCR matched the annotated transcript based on analysis of our RNA-seq data from HCT116 cells (Li et al., unpublished) (Figure 1—figure supplement 3); (4) analysis of the length of the PINCR transcript by RT-PCR revealed two closely migrating bands (Figure 1—figure supplement 4) that matched the expected size of the amplicon (~1.8 kb); (5) PINCR is expressed at ~13–26 molecules per HCT116 cell after DNA damage and less than one molecule per cell without DNA damage (Figure 1—figure supplement 5A–C) based on comparison of the FPKM of PINCR with the lncRNA NORAD, known to be expressed at 500–1000 molecules per HCT116 cell (Lee et al., 2016). As an alternative approach, qRT-PCR using in vitro transcribed PINCR RNA showed that PINCR is expressed at ~27 molecules per HCT116 cell after DNA damage (Figure 1—figure supplement 5D); (6) PINCR promoter including the p53RE, mature PINCR transcript and the transcription start site are quite conserved among primates but poorly conserved between human and mouse (Figure 1—figure supplement 6, Figure 1—figure supplement 6—source data 1 and Figure 1—figure supplement 6—source data 2).

Targeted deletion of PINCR impairs G1 arrest and results in increased cell death after DNA damage

The strong p53-dependent induction of PINCR after DNA damage led us to hypothesize that PINCR mediates the effect of p53 by regulating G1 and/or G2/M arrest after DNA damage. To begin to test this hypothesis, we used the CRISPR/Cas9 technology to delete the PINCR genomic locus in HCT116 cells (Figure 2—figure supplement 1A and B). Targeted deletion of PINCR in 2 PINCR-KO clones (KO#1 and KO#2) was confirmed by Sanger sequencing (Figure 2—figure supplement 1C and D) and loss of PINCR expression was validated by qRT-PCR (Figure 2A). As negative controls, we selected two clones that were WT for PINCR (WT#1 and WT#2). The p53RE in the PINCR promoter was partially deleted in PINCR-KO#1 but fully intact in PINCR-KO#2 (Figure 2—figure supplement 1C and D) and as expected, we observed significantly impaired p53 binding in PINCR-KO#1 but not in PINCR-KO#2 (Figure 2—figure supplement 2).

Figure 2 with 5 supplements see all
Loss of PINCR impairs G1 arrest and results in increased cell death after DNA damage.

(A) qRT-PCR analysis from PINCR-WT (WT#1 and WT#2) and PINCR-KO clones (KO#1 and KO#2) untreated or treated with DOXO for 16 hr. (B, C) PINCR-WT and PINCR-KO clones were untreated or treated with DOXO for the indicated time points and cell cycle analysis was performed using Propidium iodide (PI) staining followed by flow cytometry analysis (FACS). (D) PINCR-KO cells were stably transfected with pCB6 or pCB6-PINCR and qRT-PCR was performed. (E) PINCR-KO cells stably expressing PINCR were untreated or treated with DOXO in biological duplicates at the indicated times and cell death (sub-G1 cells) was assessed by PI staining followed by FACS. (F) Immunostaining for Nucleoporin and cleaved caspase-3 from PINCR-WT and PINCR-KO clones with or without DOXO treatment for 72 hr. DNA was counterstained with DAPI. (G) PINCR-WT and PINCR-KO clones were untreated or treated with the indicated DOXO concentrations for 4 hr and colony formation assays were performed after 10 days. Error bars in A and D represent SD from three independent experiments. #p<0.01; ##p<0.001.

https://doi.org/10.7554/eLife.23244.013

We next treated the PINCR-WT and PINCR-KO cells with DOXO for 24, 48 and 72 hr and examined the effect on cell cycle arrest. In PINCR-KO cells, G1 arrest was substantially impaired as early as 24 hr after DNA damage (Figure 2B) and these cells displayed increased apoptosis as measured by the elevated sub-G1 population after 48 and 72 hr of DOXO treatment but not at 24 hr (Figure 2C and Figure 2—figure supplement 3A). Notably, loss of PINCR did not alter the cell cycle profile in the absence of DNA damage (Figure 2—figure supplement 3A).

To make sure that the observed phenotypes were not DNA-dependent but due to loss of PINCR RNA, we performed a rescue experiment. We inserted the full-length PINCR RNA into pCB6 and reintroduced PINCR in the PINCR-KO cells by stable transfection. The extent of PINCR overexpression was not supraphysiological; we observed ~40 fold increase in PINCR expression (Figure 2D) which is less than the ~100 fold induction that we had observed for endogenous PINCR. Although, reintroduction of PINCR in the PINCR-KO cells significantly rescued apoptosis at both 48 and 72 hr after DNA damage (Figure 2E), we did not observe a rescue of G1 arrest (Figure 2—figure supplement 3B). The incomplete rescue may be because unlike endogenous PINCR that is induced ~100 fold after DOXO-treatment, the extent of exogenous PINCR overexpression was ~40 fold. Another possibility is that in the rescue experiments, we overexpressed the annotated isoform, whereas we had found that HCT116 cells express at least two isoforms of PINCR.

In response to DOXO treatment, HCT116 cells arrest in G1 but the majority arrest in G2. p53 has been shown to play a critical role in the G1 arrest and in keeping the cells in G2 (Bunz et al., 1998; Kuerbitz et al., 1992; Levine, 1997). To determine if in addition to its role in G1 arrest, PINCR also regulates G2 arrest, we examined the integrity of the nuclear envelope by performing immunostaining for Nucleoporin after treating PINCR-WT and PINCR-KO cells with DOXO for 72 hr. We found that the nuclear membrane was intact in both PINCR-WT and PINCR-KO cells suggesting that loss of PINCR does not result in aberrant entry into mitosis (Figure 2F). Immunostaining for cleaved caspase-3, a marker of apoptosis, further confirmed increased apoptosis after DNA damage upon loss of PINCR (Figure 2F and Figure 2—figure supplement 4A). This hypersensitivity to DNA damage was persistent and also observed in colony formation assays (Figure 2G and Figure 2—figure supplement 4B). In this experiment, we did not observe a difference in clonogenicity upon loss of PINCR in untreated cells, which is consistent with the unaltered cell cycle profile upon loss of PINCR in untreated cells.

To confirm that PINCR is involved in p53-dependent G1 arrest, we performed cell cycle analysis from PINCR-WT and PINCR-KO cells after Nutlin-3 treatment. As expected, in both PINCR-WT and PINCR-KO cells, Nutlin-3 treatment resulted in dramatic reduction in the population of cells in S-phase (Figure 2—figure supplement 5). As compared to PINCR-WT cells, we observed reduced G1 population and increased G2/M population in both PINCR-KO clones after Nutlin-3 treatment. These data indicate that PINCR plays a role in p53-dependent G1 arrest and it has a prosurvival function in response to DNA damage.

PINCR loss results in hypersensitivity to 5-FU and decreased tumor growth

If the major function of PINCR after DNA damage is to arrest cells in G1, the effect of PINCR loss should be more pronounced if the DNA damaging agent mainly causes G1 arrest. We therefore examined the effect on G1 arrest and apoptosis 48 hr after treatment of PINCR-WT and PINCR-KO cells with three chemotherapeutic drugs: DOXO (300 nM), the radiomimetic NCS (Neocarzinostatin, 400 ng/ml) and 5-Fluorouracil (5-FU, 100 µM). After confirming the induction of PINCR in response to NCS and 5-FU treatment (Figure 3—figure supplement 1A and B), we performed cell cycle analysis. In PINCR-WT cells, the percentage of cells arrested in G1 was smallest (11%) for NCS and largest (63%) for 5-FU (Figure 3A). Loss of PINCR resulted in decreased G1 arrest for NCS, DOXO and 5-FU. However, in PINCR-KO cells, the sub-G1 population was highest (36%) after 5-FU treatment indicating that hypersensitivity of PINCR-KO cells to chemotherapeutic drugs is dependent on G1 arrest. Importantly, this impaired G1 arrest and increased apoptosis after 5-FU treatment upon loss of PINCR was observed in both PINCR-KO clones (Figure 3B and C) and was further confirmed by immunoblotting for the apoptosis marker cleaved-PARP (Figure 3D and Figure 3—source data 1). Furthermore, loss of PINCR significantly impaired clonogenicity after 5-FU treatment (Figure 3E and F).

Figure 3 with 7 supplements see all
PINCR knockout cells are hypersensitive to 5-FU in vitro and poorly tumorigenic in vivo.

(A) PINCR-WT and PINCR-KO clones were untreated or treated with NCS, DOXO, 5-FU for 48 hr and PI staining followed by FACS analysis was performed. (B, C) PINCR-WT#1 and PINCR-KO (KO#1 and KO#2) clones were untreated or treated with 5-FU in biological duplicates for 48 hr and the effect on G1 arrest and cell death (sub-G1) was assessed by PI staining followed by FACS. (D) PINCR-WT and PINCR-KO cells were untreated or treated with 5-FU for 48 hr and immunoblotting for cleaved PARP and loading control GAPDH was performed. (E, F) PINCR-WT and PINCR-KO cells were untreated or treated with indicated 5-FU concentrations for 4 hr, and colony formation assays were performed after 10 days. (G, H) Untreated PINCR-WT#1 and PINCR-KO (KO#1 and KO#2) cells were injected subcutaneously into the flanks of athymic nude mice (five mice for each group, two tumors per mice). Average tumor volume (G) and tumor mass (H) are shown. Error bars in F represent SD from three experiments. Tumor mass data in H is shown as median +/- interquartile range and p-values were calculated using the Krusal-Wallis test. *p<0.05; #p<0.01; **p<0.005; ##p<0.001.

https://doi.org/10.7554/eLife.23244.019

Next, to determine if the observed phenotypes are not restricted to HCT116, we knocked out PINCR in SW48 cells (Figure 3—figure supplement 2A and B). In response to DNA damage induced by 5-FU, we observed reduced G1 arrest and increased apoptosis in the PINCR-KO clone as compared to PINCR-WT clones (Figure 3—figure supplement 3A–C). Moreover, following extended treatment with 5-FU, the PINCR-KO clone was markedly more sensitive than PINCR-WT clones (Figure 3—figure supplement 4). These data confirm that the phenotypic effects observed upon loss of PINCR are not unique to HCT116.

We next employed several different concentrations of 5-FU (0 to 375 µM) and measured the extent of induction of PINCR and PUMA, and examined the sub-G1 population. Although we found an increase in sub-G1 population with increasing dose of 5-FU, the extent of induction of PINCR or PUMA did not change significantly (Figure 3—figure supplement 5A). At all doses of 5-FU, PINCR-KO cells were more sensitive than PINCR-WT cells (Figure 3—figure supplement 5B). These data indicate that the extent of PINCR induction may not be determinant of the likelihood of the cells to die rather than undergo G1 arrest. In addition, we found that over-expression of PINCR did not significantly affect the cell cycle in untreated cells or in response to DNA damage induced by 5-FU (Figure 3—figure supplement 6).

To determine the function of PINCR in an in vivo setting, we subcutaneously injected NOD-SCID mice with HCT116-PINCR-WT or PINCR-KO cells, untreated or treated with 5-FU for 4 hr followed by a 4-hr recovery. Although mice injected with 5-FU-treated PINCR-WT or PINCR-KO cells did not form tumors, in untreated condition the rate of tumor growth was substantially reduced (7–10-fold) upon loss of PINCR (Figure 3G and H). All mice injected with untreated PINCR-WT cells developed detectable tumors, whereas the untreated PINCR-KO cells displayed significantly reduced tumor growth as early as day 12 post-injection (p<0.05) (Figure 3G). Immunohistochemical staining of the tumors for the proliferation marker Ki67 and the apoptosis marker cleaved caspase-3 revealed that PINCR-WT and PINCR-KO tumors had a high proportion of Ki67-positive cells (>50%) and a very low proportion of cleaved caspase-3-positive cells (<1%) (Figure 3—figure supplement 7). As compared to PINCR-WT tumors, the PINCR-KO tumors had significantly decreased Ki67-positive cells (Figure 3—figure supplement 7A and Figure 3—figure supplement 7—source data 1), suggesting that the observed reduced tumor volume is due to inhibition of cell proliferation.

PINCR regulates the induction of a subset of p53 targets after DNA damage

To determine if PINCR mediates its effect by regulating gene expression, we performed mRNA microarrays from three biological replicates of PINCR-WT and PINCR-KO cells, untreated or treated with 5-FU for 24 hr (Supplementary file 3). Gene set enrichment analysis (GSEA) for the upregulated genes identified the p53 pathway as the top upregulated pathway after DNA damage in both PINCR-WT and PINCR-KO cells (Figure 4—figure supplement 1A and Figure 4—figure supplement 1—source data 1) suggesting that loss of PINCR does not alter global p53 signaling. Consistent with this, we observed comparable p53 induction in both PINCR-WT and PINCR-KO cells after 5-FU treatment (Figure 4—figure supplement 1B) and the majority of known p53 targets including the G1 regulator p21 were induced to similar levels. Interestingly, the normalized enrichment score (NES) for the p53 pathway in PINCR-KO cells was significantly lower (NES = 2.673) than that in PINCR-WT cells (NES = 3.045) indicating that the induction of a subset of p53 targets may be abrogated in PINCR-KO cells (Figure 4—figure supplement 1A). Thus, the induction of a subset of p53 targets appeared to be PINCR-dependent (Figure 4A). Further analysis indicated that the induction of 11 direct p53 targets that were also identified in the p53 GRO-seq study (Allen et al., 2014) including BTG2, GPX1, RRM2B was less pronounced in PINCR-KO cells (Supplementary file 3).

Figure 4 with 6 supplements see all
PINCR regulates the induction of select p53 target genes important for G1 arrest after DNA damage.

(A) Schematic representation of a subset of p53 target genes upregulated after 5-FU treatment in a PINCR-dependent or PINCR-independent manner. (B) qRT-PCR analysis from PINCR-WT and PINCR-KO cells untreated or treated with 5-FU for 24 hr. (C) PINCR-WT and PINCR-KO cells were treated with 5-FU for 24 hr and qPCR for the p53RE of BTG2, RRM2B and GPX1 was performed from IgG-ChIP and p53-ChIP. (D–F) HCT116 cells were reverse transfected with CTL-ASO or PINCR-ASO for 48 hr. The cells were then left untreated or treated with 5-FU for 24 hr (D) or 48 hr (E, F) following which qRT-PCR analysis (D), PI staining and FACS analysis was performed (E, F). Error bars in B-F represent SD from three independent experiments. *p<0.05; #p<0.01; **p<0.005; ##p<0.001.

https://doi.org/10.7554/eLife.23244.029

Among the 11 PINCR-dependent p53 targets, we selected BTG2, RRM2B and GPX1 for further analysis due to evidence in the literature supporting their roles in induction of G1 arrest and inhibition of apoptosis after DNA damage. BTG2 encodes an antiproliferative protein critical in regulation of the G1/S transition (Guardavaccaro et al., 2000; Rouault et al., 1996; Tirone, 2001). Silencing RRM2B in p53-proficient cells reduces ribonucleotide reductase activity, DNA repair, and cell survival after exposure to various genotoxins (Tanaka et al., 2000; Xue et al., 2007; Yanamoto et al., 2005). GPX1 attenuates DOXO-induced cell cycle arrest and apoptosis (Gao et al., 2008).

In subsequent experiments, we sought to use p21 as a negative control because p21 mRNA was induced to similar levels in both PINCR-WT and PINCR-KO cells (Figure 4B). However, given the well-established role of p21 in controlling G1 arrest after DNA damage, it was important to make sure that loss of PINCR did not alter p21 protein levels, p21 subcellular localization and/or Rb-phosphorylation. Indeed, we found similar levels of total, nuclear or cytoplasmic p21 in PINCR-WT and PINCR-KO cells under untreated condition and after 5-FU treatment (Figure 4—figure supplement 2A and B and Figure 4—figure supplement 2—source data 1). The decrease in Rb phosphorylation in response to 5-FU treatment was comparable in PINCR-WT and PINCR-KO cells (Figure 4—figure supplement 2C and Figure 4—figure supplement 2—source data 1). These results indicate that p21 expression is not altered upon loss of PINCR and it can therefore be used as a negative control.

We next asked the question if depletion of the PINCR targets BTG2, GPX1 and RRM2B recapitulated the effects of PINCR depletion. We validated significant knockdown of these genes by qRT-PCR (Figure 4—figure supplement 3A) and found significantly increased apoptosis (sub-G1 cells) upon knockdown of each of these genes followed by 5-FU treatment (Figure 4—figure supplement 3B–3D and Figure 4—figure supplement 4). Significant reduction in G1 arrest after 5-FU treatment was observed after knockdown of GPX1 but not BTG2 or RRM2B. These data indicate that depletion of BTG2, GPX1 or RRM2B recapitulates the effects of PINCR depletion in response to 5-FU treatment.

Consistent with our microarray data, we observed impaired induction of BTG2, GPX1 and RRM2B mRNAs upon loss of PINCR (Figure 4B). Moreover, by p53 ChIP-qPCR, we observed substantial decrease in the binding of p53 to the p53RE of BTG2, GPX1 and RRM2B upon loss of PINCR (Figure 4C). There is evidence in the literature that p53 can directly bind to RNA including a recent report showing direct binding of p53 to the p53-regulated lncRNA DINO (Riley and Maher, 2007; Schmitt et al., 2016). However, we found that PINCR does not directly bind to p53 (data not shown).

To make sure that the altered induction of BTG2, GPX1 and RRM2B reflect a function of the PINCR transcript itself, we measured the induction of these genes after PINCR knockdown using antisense oligonucleotides (ASOs). We tested 5 ASOs that potentially target PINCR RNA (data not shown). Robust knockdown of PINCR in HCT116 cells was observed with one ASO that we designated as PINCR-ASO (Figure 4D). Importantly, as observed with PINCR-KO cells, knockdown of PINCR followed by 5-FU treatment resulted in decreased induction of BTG2, GPX1 and RRM2B but not p21 (Figure 4D) and caused decreased G1 arrest (Figure 4E) and increased apoptosis (Figure 4F) after 5-FU or DOXO treatment (Figure 4—figure supplement 5). In clonogenic survival assays, knockdown of PINCR resulted in reduced colony formation after 5-FU treatment (Figure 4—figure supplement 6A). Surprisingly, unlike PINCR-KO cells that did not show significant difference in proliferation from PINCR-WT cells in untreated condition, decreased colony formation in untreated condition was observed after PINCR knockdown (Figure 4—figure supplement 6B). Although this result indicates that basal PINCR levels can regulate proliferation despite low expression, this growth defect may be restored long-term during genetic deletion of PINCR using CRISPR/Cas9. Taken together, the results from PINCR knockdown experiments corroborates our findings from the PINCR-KO clones.

RNA pulldowns and mass spectrometry identifies Matrin 3 as a PINCR-interacting protein that mediates the effect of PINCR

Because we found that PINCR does not bind to p53, we hypothesized that PINCR binds to an RNA-binding protein that serves as an adaptor protein and mediates this effect of PINCR. To identify this adaptor protein, we incubated in vitro-transcribed biotinylated (Bi)-PINCR (Bi-PINCR) or Bi-Luciferase (Bi-LUC) RNA with untreated or DOXO-treated nuclear extracts and performed streptavidin pulldowns followed by mass spectrometry. Eleven proteins were enriched at least twofold in the Bi-PINCR pulldowns (Supplementary file 4) as compared to Bi-LUC pulldowns in untreated condition as well as after DOXO treatment. Of these 11 proteins, the RNA- and DNA-binding nuclear matrix protein Matrin 3 showed the strongest enrichment (eightfold in untreated condition; 16-fold after DOXO treatment) (Figure 5A and Supplementary file 4). In a recent iCLIP (Individual-nucleotide resolution UV crosslinking and immunoprecipitation) study (Coelho et al., 2015), the consensus RNA motif recognized by Matrin 3 was identified. We found that PINCR has six Matrin 3 binding motifs, and this motif was significantly enriched in the PINCR RNA as compared to the transcriptome (Figure 5—figure supplement 1A and B). We next validated the specific PINCR-Matrin 3 interaction by performing streptavidin pulldowns followed by immunoblotting after incubating Bi-PINCR or Bi-LUC with HCT116 nuclear extracts (Figure 5B and Figure 5—source data 1) or recombinant Matrin 3 (rMatrin 3) (Figure 5C and Figure 5—source data 1). Moreover, we observed ~300-fold enrichment of PINCR in the Matrin 3 IPs from formaldehyde crosslinked HCT116 cells treated with DOXO (Figure 5D); p21 mRNA was not enriched (Figure 5D and Figure 5—source data 1), demonstrating the specificity of the PINCR-Matrin 3 interaction.

Figure 5 with 5 supplements see all
Matrin 3 binds to PINCR and functions as a downstream effector of PINCR.

(A) Peptide spectrum matches (PSMs) corresponding to Matrin 3 in the Bi-LUC and Bi-PINCR pulldowns from mass spectrometry analysis. (B, C) Streptavidin pulldowns followed by immunoblotting was performed following incubation of Bi-LUC and Bi-PINCR RNA with DOXO-treated HCT116 nuclear extracts (B) or recombinant Matrin 3 (rMatrin 3) (C). (D) Specific enrichment of PINCR in the Matrin 3 IPs was assessed by qRT-PCR from 24 hr 5-FU-treated formaldehyde cross-linked HCT116 cells. p21 mRNA was used as negative control. (E) PINCR-WT cells were transfected with CTL or two independent Matrin 3 siRNAs (I and II) for 48 hr and Matrin 3 knockdown was measured by immunoblotting. (F) PINCR-WT and PINCR-KO cells were transfected with CTL or Matrin 3 siRNAs and after 48 hr the cells were untreated or treated with 5-FU for 48 hr. The effect on the sub-G1 population was assessed by PI staining followed by FACS. (G) PINCR-WT and PINCR-KO cells were transfected with CTL or Matrin 3 siRNAs for 48 hr; transfected cells were left untreated or treated with 5-FU for 24 hr and qRT-PCR was performed. Error bars in D, F and G represent SD from three independent experiments. *p<0.05; #p<0.01; **p<0.005.

https://doi.org/10.7554/eLife.23244.038

Next, we knocked down Matrin 3 with two independent siRNAs (Figure 5E and Figure 5—figure supplement 1C) and determined the effect on G1 arrest and apoptosis of PINCR-WT and PINCR-KO. After 5-FU or DOXO treatment, there was more apoptosis upon Matrin 3 knockdown in PINCR-WT but this increase was not observed in the PINCR-KO (Figure 5F and Figure 5—figure supplements 2 and 3) indicating that Matrin 3 is a downstream effector of PINCR. We did not observe a significant difference in G1 arrest, suggesting that Matrin 3 does not mediate the G1 arrest regulated by PINCR. These data indicate that there is an epistatic interaction between PINCR and Matrin 3 as virtually all the apoptotic effects of Matrin 3 after DNA damage are dependent on PINCR. Furthermore, in PINCR-WT cells silencing Matrin 3 resulted in less or no induction of the PINCR targets BTG2, GPX1 and RRM2B but not p21 mRNA after 5-FU treatment (Figure 5G). A role of Matrin 3 in regulating the induction of these p53 targets was also observed in response to Nutlin-3 treatment (Figure 5—figure supplement 4). Immunoblotting from untreated or 5-FU-treated HCT116 whole cell lysates and nuclear and cytoplasmic lysates indicated no change in Matrin 3 levels or subcellular localization (Figure 5—figure supplement 5 and Figure 5—figure supplement 5—source data 1). Collectively, these data suggest that the induction of the PINCR targets BTG2, GPX1 and RRM2B is largely mediated by Matrin 3 and reveal an epistatic interaction between PINCR and Matrin 3.

Matrin 3 interacts with p53 and associates with the p53RE of select PINCR targets

To determine if Matrin 3 mediates the effect of PINCR by functioning as an adaptor protein, we performed co-IP experiments to determine if p53 and Matrin 3 form a complex. We found that p53 interacts with Matrin 3 in both untreated and 5-FU treated cells (Figure 6A and B, Figure 6—figure supplement 1A, Figure 6—source data 1 and Figure 6—figure supplement 1—source data 1). This interaction was not altered in the presence of RNase A or DNase, suggesting that p53 and Matrin 3 form a protein-protein complex (Figure 6B). This result prompted us to examine the association of Matrin 3 on the p53RE of BTG2, GPX1 and RRM2B. Matrin 3 ChIP-qPCR revealed that in untreated PINCR-WT cells, Matrin 3 binds to the p53RE of BTG2 and RRM2B but not GPX1 (Figure 6C). For all three genes, in PINCR-WT cells, there was increased Matrin 3 binding to their p53RE after 5-FU treatment. Loss of PINCR impaired this binding of Matrin 3 to the p53RE of these genes (Figure 6C) but not the p53RE of p21 (Figure 6—figure supplement 1B). Interestingly, after knockdown of Matrin 3 and 5-FU treatment in PINCR-WT cells, we did not observe a significant difference in the binding of p53 to the p53RE of these genes (Figure 6D and Figure 6—figure supplement 2) suggesting that Matrin 3 does not control p53 occupancy at the p53RE in the promoters of these genes.

Figure 6 with 2 supplements see all
Matrin 3 forms a complex with p53 complex and associates with the p53RE of select PINCR targets.

(A) HCT116 cells were treated with 5-FU for 24 hr and immunoblotting for p53 was performed from input, no cell lysate control and IgG or Matrin 3 IP from whole cell extracts. (B) HCT116 cells were untreated or treated with 5-FU for 24 hr and the interaction between p53 and Matrin 3 was assessed by IPs from Mock (no extract), RNase-treated or DNase-treated whole cell lysates. (C) PINCR-WT and PINCR-KO cells were untreated or treated with 5-FU for 24 hr and qPCR with primers spanning the p53RE of BTG2, RRM2B and GPX1 was performed from IgG-ChIP and Matrin 3-ChIP. (D) PINCR-WT HCT116 cells were reverse transfected with CTL or Matrin 3 siRNAs for 48 hr and then treated with 5-FU for 24 hr. The enrichment of p53 at the p53RE of PINCR targets was determined by ChIP-qPCR. Errors bars in C and D represent SD from three independent experiments. *p<0.05; #p<0.01; ##p<0.001.

https://doi.org/10.7554/eLife.23244.046

Matrin 3 associates with enhancers within insulated neighborhoods of PINCR targets

We next examined how Matrin 3 regulates the induction of the PINCR targets BTG2, GPX1 and RRM2B after DNA damage, without altering p53 binding to their promoters. Given the evidence that Matrin 3 associates with enhancer regions (Skowronska-Krawczyk et al., 2005), we reasoned that Matrin 3 modulates the induction of these genes by binding to their enhancer regions. More recently, it has been shown that proper enhancer-gene pairing is enabled by insulated neighborhoods formed by CTCF anchoring at domain boundaries and cohesion looping (Hnisz et al., 2016) and are mostly conserved across cell types. To test this possibility, we identified insulated neighborhoods around PINCR targets, ChIP-seq data tracks (ENCODE Project Consortium, 2012) in HCT116 cells (Figure 7A, Figure 7—figure supplement 1 and Figure 7—figure supplement 2) for (1) CTCF, a protein known to bind to chromatin domain boundaries, (2) the chromatin loop-enabling cohesion component RAD21, (3) promoter associated histone mark H3K4me3 and (4) active promoter/enhancer associated mark H3K27ac. To determine the overlap of these peaks with p53, we utilized p53 ChIP-seq data from MCF7 and U2OS cells (Figure 7A, Figure 7—figure supplement 1 and Figure 7—figure supplement 2). In addition, to determine potential chromatin looping near these PINCR targets, we utilized Hi-C data (Figure 7A, Figure 7—figure supplement 1 and Figure 7—figure supplement 2). For each of the three PINCR targets, the Hi-C data indicated chromatin looping with appropriate CTCF and cohesion signal consistent with insulated domain structure. Within the loop, we observed the following: (1) a strong p53 ChIP-seq peak corresponding to the p53RE in the promoter of these genes that was also marked by strong signal for H3K4me3 and H3K27ac; (2) a weak p53 ChIP-seq peak that was also marked by strong signal for H3K27ac and weak signal H3K4me3. Promoters are marked by high H3K4me3 and high H3K27ac whereas enhancers typically have low H3K4me3 and high H3K27ac (Ernst et al., 2011). Thus, our Hi-C and ChIP-seq data analysis indicates potential chromatin looping between a weak p53 binding region in the enhancer and strong p53 binding region in the promoter of the PINCR targets BTG2, GPX1 and RRM2B. Notably, whereas the strong ChIP-seq peak at the promoters of these three genes had a canonical p53RE, the weak p53 binding region in their enhancers did not have a canonical p53RE indicating indirect association of p53 at these enhancers.

Figure 7 with 2 supplements see all
PINCR modulates the association of Matrin 3 with enhancers of PINCR targets within insulated neighborhoods.

(A) Topological domain and looping structure indicated by 3D contact domain profile (top) surrounding BTG2 gene and Hi-C data from (Rao et al., 2014). ChIP-seq data tracks (middle) in HCT116 showing CTCF anchors and loop-enabling cohesion (RAD21), as well as promoter associated histone mark H3K4me3 and active promoter/enhancer associated mark H3K27ac. p53 ChIP-seq in untreated or treated MCF7 is also shown. Candidate regulatory enhancers (used for ChIP-qPCR of Matrin3) are highlighted with an orange box at the tail of an arrow pointing toward the putative target gene. The p53 response element is shown, found at the promoter, where stronger ChIP-seq signal was present upon treatments. The one-dimensional genomic distance between the enhancer and the promoter is indicated between the zoomed in boxes (bottom). (B, C) PINCR-WT and PINCR-KO HCT116 cells were treated with 5-FU for 24 hr and the association of Matrin 3 (B) or p53 (C) with the enhancer of PINCR targets was assessed by ChIP-qPCR. (D) PINCR-WT HCT116 cells were reverse transfected with CTL or Matrin 3 siRNAs for 48 hr and then treated with 5-FU for 24 hr. The enrichment of p53 at the enhancer regions of PINCR targets was determined by ChIP-qPCR. (E) A cartoon showing the chromatin looping between the enhancer and promoter region of BTG2. Errors bars in B, C and D represent SD from three independent experiments. *p<0.05; #p<0.01; **p<0.005; ##p<0.001.

https://doi.org/10.7554/eLife.23244.051

Next, we sought to determine if Matrin 3 associates with the enhancer of BTG2, GPX1 and RRM2B and if this association is dependent on PINCR. To test this, we performed ChIP-qPCR for Matrin 3 from PINCR-WT and PINCR-KO cells after 5-FU treatment. In PINCR-WT cells, there was strong enrichment of Matrin 3 at the enhancers of each of these genes (Figure 7B). Loss of PINCR resulted in significant reduction in Matrin 3 occupancy on each of these enhancer regions (Figure 7B). Moreover, after 5-FU treatment, we found significantly reduced p53 binding to these enhancer regions upon loss of PINCR (Figure 7C) or upon knockdown of Matrin 3 (Figure 7D). These results indicate a role of Matrin 3 and PINCR in facilitating the association of p53 with the enhancers of specific p53 targets BTG2, GPX1 and RRM2B and provide evidence of chromatin looping between the enhancers and promoters of these genes (Figure 7E).

PINCR associates with the enhancer regions of select PINCR targets via Matrin 3

We next explored the possibility that PINCR is also a part of the p53-Matrin 3 complex on the p53RE of BTG2, GPX1 and RRM2B. To test this, we used a novel approach in which we tagged endogenous PINCR with an S1-tag and utilized the S1-tag to pulldown PINCR and then performed qPCR for the p53RE of BTG2, GPX1 and RRM2B. The S1-tag is a 44 nt RNA aptamer that binds to streptavidin with high affinity and has been used in vitro to identify proteins that bind to S1-tagged RNAs (Butter et al., 2009; Iioka et al., 2011; Srisawat and Engelke, 2001, 2002). To tag endogenous PINCR, we used CRISPR/Cas9 and knocked-in a single S1-tag at the 3’end of PINCR in HCT116 cells (Figure 8A and Figure 8—figure supplements 1 and 2). Importantly, the PINCR-S1 RNA was strongly upregulated (>20 fold) after DOXO treatment (Figure 8—figure supplement 3A). Like endogenous untagged PINCR, the PINCR-S1 RNA was predominantly nuclear (Figure 8—figure supplement 3B) and expressed at levels comparable to PINCR (Figure 8—figure supplement 3C). PINCR overexpression did not alter the expression of PINCR-S1 or BTG2, GPX1 and RRM2B, suggesting that PINCR does not regulate its own expression and that PINCR over-expression is not sufficient to alter the expression of PINCR targets (Figure 8—figure supplement 4A and B).

Figure 8 with 5 supplements see all
PINCR associates with the enhancer regions of select p53 targets in a Matrin-3-dependent manner.

Schematic showing knock-in of S1-tag at the 3’end of PINCR. (B) The enrichment of PINCR in the streptavidin pulldowns from PINCR and PINCR-S1 cells treated with 5-FU for 24 hr was assessed by qRT-PCR. (C) PINCR and PINCR-S1 cells were treated with 5-FU for 24 hr and followed by streptavidin pulldown. Interaction between PINCR and Matrin 3 was confirmed by immunoblotting for Matrin 3 or the control Tubulin. (D) PINCR and PINCR-S1 cells were treated with 5-FU for 24 hr and qPCR with primers spanning the p53RE of BTG2, RRM2B and GPX1 was performed following streptavidin pulldown. (E) PINCR-S1 cells were reverse transfected with CTL siRNA, p53 siRNAs or two independent Matrin 3 siRNAs and then treated with 5-FU for 24 hr. The enrichment of PINCR-S1 at the p53RE and enhancer regions of PINCR targets was determined by ChIP-qPCR from the streptavidin pulldown material. Error bars represent SD from three independent experiments. *p<0.05; **p<0.005, ##p<0.001.

https://doi.org/10.7554/eLife.23244.054

Streptavidin pulldowns from the PINCR-S1 expressing cells treated with 5-FU revealed >10-fold enrichment of the PINCR-S1 RNA (Figure 8B) and specific enrichment of Matrin 3 protein (Figure 8C and Figure 8—source data 1). To determine if PINCR-S1 associates with the p53RE of BTG2, GPX1 and RRM2B, we performed streptavidin pulldowns from formaldehyde-crosslinked parental HCT116 cells (negative control) and the PINCR-S1 cells after 5-FU treatment. We found that the p53RE of each of these three genes but not the p21 p53RE, was specifically enriched in the PINCR-S1 pulldowns (Figure 8D). Finally, we examined the association of PINCR-S1 with the p53RE and enhancer regions of PINCR targets in the presence and absence of p53 or Matrin 3. To do this, we knocked down p53 (Figure 8—figure supplement 5 and Figure 8—figure supplement 5—source data 1) or Matrin 3 with siRNAs and performed streptavidin pulldowns. As compared to the p53RE in the PINCR promoters, in CTL siRNA transfected cells treated with 5-FU, we found stronger association of PINCR-S1 with the enhancers of the PINCR targets (Figure 8E). Silencing Matrin 3 or p53 resulted in dramatic reduction of association of PINCR-S1 with these enhancers and p53REs (Figure 8E). Because p53 is important for PINCR expression, it is likely that the reduced association of PINCR-S1 to these regions after p53 knockdown is due to lack of expression. On the other hand, the observed loss in association of PINCR-S1 to the enhancers and promoters upon knockdown of Matrin 3 indicates that Matrin 3 recruits PINCR-S1 to these regions. Taken together, these results suggest that a p53-Matrin 3-PINCR complex associates with the p53RE and enhancers of BTG2, GPX1 and RRM2B and plays a critical role in modulating the induction of these genes after DNA damage.

Discussion

In this study, we report the first functional characterization of PINCR, an intergenic nuclear lncRNA, strongly induced by p53 after DNA damage. Several p53-regulated lncRNAs have been recently identified and shown to play important roles in the p53 network. However, PINCR is unique from these recently characterized p53-regulated lncRNAs. Firstly, following p53 activation, the p53-regulated lncRNAs LED (Léveillé et al., 2015) and Linc-475 (Melo et al., 2016) regulate G1 arrest and prevent entry of cells into mitosis. However, PINCR-KO cells show a defect in G1 arrest but the cells arrest in the G2 phase after DNA damage. Secondly, the p53-regulated lncRNAs lincRNA-p21 (Dimitrova et al., 2014), LED (Léveillé et al., 2015) and Linc-475 (Melo et al., 2016) regulate the levels of p21. In addition, in a recent study, the p53-induced lncRNA DINO, was shown to directly bind to and regulate p53 levels (Schmitt et al., 2016). However, PINCR does not alter p53 or p21 levels but instead regulates the expression of the p53 targets BTG2, GPX1 and RRM2B that also regulate G1 arrest after DNA damage.

Our study together with other recent studies shows that specific RNA-binding proteins and transcription factors play an important role in mediating the effects of a lncRNA. For example, in the context of p53 activation, lincRNA-p21 interacts with hnRNP-K and functions as a coactivator for p53-dependent p21 transcription (Dimitrova et al., 2014; Huarte et al., 2010). PANDA, another p53-regulated lncRNA upstream of p21, associates with the transcription factor NF-YA to regulate the expression of pro-apoptotic genes during genotoxic stress (Hung et al., 2011). The data presented here indicates that PINCR and Matrin 3 act as coactivators of p53 on a subset of p53 targets. It is known that Matrin 3 interacts with enhancer regions (Romig et al., 1992; Skowronska-Krawczyk et al., 2014), and our data shows that the induction of these genes may be mediated by chromatin looping between Matrin 3 bound to the enhancer regions of these genes and p53 bound to the p53RE in their promoters. PINCR recruits Matrin 3 to enhancers of PINCR-dependent p53 target genes. Future studies on the identification of genome-wide-binding sites of Matrin 3 and p53 and epigenetic marks in PINCR-WT and PINCR-KO cells in the absence or presence of DNA damage will be important. Interestingly, similar intrachromosomal interactions containing enhancer activity have been reported recently and shown to express enhancer RNAs (eRNAs) that are required for efficient transcriptional enhancement of interacting target genes and induction of a p53-dependent cell-cycle arrest (Léveillé et al., 2015; Melo et al., 2013).

The development of new approaches to identify targets of endogenous lncRNAs is an active area of investigation and remains a major challenge in the lncRNA field. We developed a new approach in which we knocked-in an S1 tag at the 3'end of PINCR using CRISPR/Cas9 and determined the association of PINCR-S1 with the p53RE of specific p53 targets by qPCR following streptavidin pulldowns from crosslinked cells. Our results show a Matrin-3-dependent association of PINCR-S1 with the enhancer region of BTG2, RRM2B and GPX1 and indicate a direct and specific role of PINCR in regulating these genes in response to DNA damage. Given the strong interaction between the S1 tag and streptavidin and studies utilizing transfected S1-tagged RNAs (Vasudevan and Steitz, 2007) or in vitro transcribed S1-tagged RNAs (Butter et al., 2009; Iioka et al., 2011; Srisawat and Engelke, 2001, 2002) for the identification of interacting RNA-binding proteins or miRNAs, this method has the potential to identify the genome-wide targets of PINCR and other lncRNAs.

In summary, our study suggests that PINCR is an important modulator of gene expression in the p53 pathway that regulates the induction of a subset of p53 targets and this effect is mediated in part via its interaction with Matrin 3. Future investigations on PINCR in normal cells and in an expanded panel of cell lines will enhance our understanding of its role in tumorigenesis and tumor progression.

Materials and methods

Cell culture, treatments and siRNA transfections

The colorectal cancer cell lines HCT116 (ATCC Number: CCL-247), SW48 (ATCC Number: CCL-231) and RKO (ATCC Number: CRL-2577) and HEK293T (ATCC Number: CRL-11268) cells were purchased from ATCC. The isogenic p53-WT and p53-KO HCT116, RKO and SW48 were previously generated by Bert Vogelstein’s lab (Johns Hopkins University). All cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM) (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) and 1% penicillin-streptomycin at 37°C, 5% CO2. All cell lines were routinely checked for mycoplasma using the Venor Gem Mycoplasma detection kit (Sigma-Aldrich, Catalog # MP0025-1KT). Cells were treated with 10 µM Nutlin-3 (Skelleckchem, Catalog # S1061), 300 nM Doxorubicin (DOXO, Catalog # D1515), 100 µM 5-Fluorouracil (5-FU; Calbiochem, Catalog # 343922) or 400 ng/ml NCS (Sigma-Aldrich, Catlog#N9162) for the indicated time.

The Allstars Negative (CTL) siRNAs were purchased from Qiagen and siRNAs for p53 (SMARTpool siRNAs, Catalog # L-003329–00), BTG2 (I-Catalog # J-012308–06 and II-Catalog # J-012308–07), GPX1 (I-Catalog # J-008982–05 and II-Catalog # J-008982–07), RRM2B (I-Catalog # J-010575–05 and II-Catalog # J-010575–06) and Matrin 3 (Catalog # J-017382–05 and J-017382–07) were purchased from Dharmacon. CTL-ASO and PINCR-ASO were designed and provided by Ionis Pharmaceuticals (Supplementary file 5). All siRNA and ASO transfections were performed by reverse transfection at a final concentration of 20 nM and 50 nM, respectively, using Lipofectamine RNAiMAX (Life technologies) as directed by the manufacturer. For gene expression analysis after PINCR or Matrin 3 knockdown, all the reverse transfections were performed for 48 hr followed by 24 hr DOXO or 5-FU or Nutlin-3 treatment.

RNA isolation and qRT-PCR

Total RNA from cell lines was isolated using RNeasy mini kit (Qiagen). For qRT-PCR analysis, 500 ng total RNA was reverse-transcribed using iScript Reverse Transcription kit (Bio-Rad), and qPCR was performed using Fast SYBR Green Master Mix (Life technologies) per the manufacturer’s instructions. Primer sequences are detailed in Supplementary file 5.

Nuclear and cytoplasmic extract preparations

Nuclear and cytoplasmic extracts were prepared from HCT116 cells expressing PINCR or PINCR-S1, PINCR-WT and PINCR-KO, untreated or treated with DOXO or 5-FU for 16 hr or as indicated in figure legend, using Digitonin as previously described (Lal et al., 2004). RNA was isolated from cytoplasmic and nuclear fractions using Trizol reagent (Invitrogen) following the manufacturer’s protocol.

Comparative genomic analysis and evaluation of coding potential with PhyloCSF

Strand-specific genomic coordinates for all exons of human PINCR and NEAT1, GAPDH, SDHA and UBC genes were downloaded from the UCSC Genome Browser (GRCh37/hg19) in BED format. A Multiz alignment of 46 vertebrates aligned to GRCh37/hg19 (http://hgdownload.soe.ucsc.edu/goldenPath/hg19/multiz46way/maf/, in MAF format) was downloaded separately for each gene based on the extracted coordinates for mature transcript accordingly to the UCSC annotation and uploaded to Galaxy (https://usegalaxy.org/). FASTA alignments were generated for each mature transcript separately using «reformat» and «concatenate» options in Galaxy for overlapping list of 29 mammals specified by the PhyloCSF phylogeny (http://mlin.github.io/PhyloCSF/29mammals.nh.png). PhyloCSF was applied to generated FASTA alignments for assessing the coding potential (the Codon Substitution Frequencies score - CSF) of mature transcripts and individual exons of analyzed genes. The CSF score assigns a metric to each codon substitution observed in the input alignment based on relative frequency of that substitution in known coding and non-coding regions. The following parameters were used for analysis: PhyloCSF 29mammals input fasta_file --orf=ATGStop --frames=6 removeRefGaps --aa –allScores. Comparative analysis of all possible reading frames and estimation of the potential to encode any recognizable protein domains was created by BLASTX. Multiple alignments for complete PINCR mature transcripts and promoter regions were built using the Muscle program with default parameters (Edgar, 2004). Genome rearrangements were analyzed using the Owen program for pair-wise alignments (Ogurtsov et al., 2002).

CRISPR/Cas9-mediated deletion of PINCR

gRNAs targeting the 5’ and 3’ ends of PINCR were designed using Zifit software (http://zifit.partners.org/ZiFiT/) and were cloned into U6-gRNA vector (Moriarity et al., 2014) having BsmB1 restriction enzyme site. gRNAs sequence information is provided in Supplementary file 6. gRNA oligos were ligated and phosphorylated using T4 ligation buffer (NEB) and T4 Polynucleotide Kinase (NEB) using a thermocycler with following parameter: 37°C for 30 min, 95°C for 5 min and then ramp down to 25°C at 5 °C/min. Annealed oligos were ligated with BsmB1 digested U6-gRNA vector (2.9 kb fragment) using quick DNA ligase (NEB). Ligation mix was transformed into E. coli DH5-alpha chemical competent cells and transformants were sequenced to confirm the presence of gRNAs. The efficiency of gRNAs was tested in HEK293T cells by transfecting Cas9 with the gRNAs.

CRISPR-mediated PINCR-KO HCT116 or SW48 cells were then generated using piggyBac co-transposition method as previously described (Moriarity et al., 2014). Cells were cotransfected with 2 μg each of hpT3.5Cagg5-FLAG-hCas9 and the 5′ and 3′ PINCR gRNAs cloned in U6-gRNA vector in addition to the 500 ng each of pcDNA-pPB7 transposase and pPBSB-CG-LUC-GFP (Puro)(+CRE) transposon vector using Lipofectamine 2000. After 48 hr, transfected cells were treated with puromycin and incubated at 37°C for 1 week. Cells were then seeded at one cell per well in 96-well plates with puromycin containing DMEM media. Wells that produced single colonies were expanded and DNA was extracted. Clones were then genotyped for deletion of PINCR using standard PCR genotyping (PINCR deletion analysis primer in Supplementary file 5). Identified wild-type (WT) clones were used as controls. PCR products were sequenced to confirm the deletion of PINCR genomic locus. Also, total RNA was extracted from individual clones, with and without treatment with DOXO or 5-FU, and expression of PINCR was analyzed using qRT-PCR.

Xenograft assays

Animal protocols were approved by the National Cancer Institute Animal Care and Use Committee following AALAAC guidelines and policies. PINCR-WT#1, PINCR-KO#1 and PINCR-KO#2 cells were untreated or treated with 100 µM 5-FU for 4 hr, following which the drug was washed-off and fresh medium was added. After a 4 hr recovery, live cells were counted with trypan blue exclusion assays and equal numbers of live cells were injected for each sample. Cells (1 × 106) were mixed with 30% matrigel in PBS on ice, and the mixture was injected into the flanks of 6- to 8 week-old female athymic nude mice (Animal Production Program, Frederick, MD) (each group N = 10). Tumor volume was measured twice a week after 1 week of injection.

To evaluate the effect of proliferation and/or apoptosis in the tumors, the xenograft tumors were collected from four PINCR-WT and PINCR-KO tumors and fixed in 10% neutral buffered formalin (Sigma, St. Louis, MO). Paraffin sectioning, hematoxylin and eosin staining (H and E), Ki67 staining and Cleaved Caspase-3 staining were performed by Histoserv, Inc (Gaithersburg, MD). The following antibodies were used for immunohistochemistry staining: anti-Ki67 (Abcam, Catalog # Ab16667) and anti-Cleaved Caspase-3 (Cell Signaling, Catalog # 9661). The images were acquired at 40× magnification.

RNA pulldowns and mass spectrometry

Full-length fragment of PINCR was PCR amplified from a pCB6 vector expressing full length PINCR using a forward primer containing the T7-promoter sequence at its 5’end and a gene-specific reverse primer (Supplementary file 5). The control luciferase cDNA was generated from vector pRL-TK (Addgene) linearized by BamH1 digestion. We then performed in vitro transcription to generate biotinylated PINCR (Bi-PINCR) and the control luciferase (Bi-LUC) RNAs using MEGAscript in vitro transcription kit (Ambion) and biotin RNA labeling mix (Roche). The in vitro transcribed RNA was purified with RNeasy mini kit (Qiagen). The biotinylated RNA was run on the bioanalyzer to check the quality. Nuclear extracts were prepared from HCT116 cells untreated or treated with DOXO for 24 hr as described above. The nuclear lysate was resuspended in RIP buffer (150 mM KCl, 25 mM Tris pH 7.4, 0.5 mM DTT, 0.5% NP40, 1 mM PMSF and protease Inhibitor) and sonicated three times for 5 s and centrifuged at 14,000 x g at 4°C for 30 min. The nuclear lysate was precleared by incubation with Dynabeads M-280 Streptavidin (Thermo Fisher Scientific) for 4 hr at 4°C. In parallel, 40 µl Dynabeads were blocked with 1 mg BSA (company) and 50 µg tRNA (company) for 4 hr at 4°C. Twenty-five pmole Bi-PINCR or Bi-LUC RNA was incubated with 1 mg precleared nuclear lysate prepared above for 4 hr at 4°C. The biotinylated RNA-protein complexes were pulled down by incubation with preblocked Dynabeads for overnight at 4°C. Interacting proteins were fractionated by SDS-PAGE and each lane cut into 10 slices. The protein bands were then in-gel digested with trypsin (Thermo) overnight at 37°C. The peptides were extracted following cleavage and lyophilized. The dried peptides were solubilized in 2% acetonitrile, 0.5% acetic acid, 97.5% water for mass spectrometry analysis. They were trapped on a trapping column and separated on a 75 µm x 15 cm, 2 µm Acclaim PepMap reverse phase column (Thermo Scientific) using an UltiMate 3000 RSLCnano HPLC (Thermo Scientific). Peptides were separated at a flow rate of 300 nl/min followed by online analysis by tandem mass spectrometry using a Thermo Orbitrap Fusion mass spectrometer. Peptides were eluted into the mass spectrometer using a linear gradient from 96% mobile phase A (0.1% formic acid in water) to 55% mobile phase B (0.1% formic acid in acetonitrile) over 30 min. Parent full-scan mass spectra were collected in the Orbitrap mass analyzer set to acquire data at 120,000 FWHM resolution; ions were then isolated in the quadrupole mass filter, fragmented within the HCD cell (HCD normalized energy 32%, stepped ±3%), and the product ions analyzed in the ion trap. Proteome Discoverer 2.0 (Thermo) was used to search the data against human proteins from the UniProt database using SequestHT. The search was limited to tryptic peptides, with maximally two missed cleavages allowed. Cysteine carbamidomethylation was set as a fixed modification, and methionine oxidation set as a variable modification. The precursor mass tolerance was 10 ppm, and the fragment mass tolerance was 0.6 Da. The Percolator node was used to score and rank peptide matches using a 1% false discovery rate.

Generation of S1-tagged PINCR line

For PINCR tagging, we used integration by Non-homologous end joining, which was accomplished by introducing a simultaneous double-strand break in genomic DNA and in the targeting vector at the 5’ of the S1-tag (Brown et al., 2016). Plasmids encoding spCas9 and sgRNAs were obtained from Addgene (Plasmids #41815 and #47108). Oligonucleotides for construction of sgRNAs were obtained from Integrated DNA Technologies, hybridized, phosphorylated and cloned into the sgRNA plasmid or targeting vector using BbsI sites (Brown et al., 2017). Target sequences for sgRNAs are provided in Supplementary file 6.

We prepared the targeting vector by first synthesizing two complementary oligonucleotides (IDT) with the sequence of the S1 tag followed by the sequence of RP3-326I13.1 located at the 3’ of the sgRNA-binding site, which potentially contains the native elements for termination of transcription. The oligonucleotides were dimerized, phosphorylated and cloned into the targeting vector using T4 ligase. Subsequently, we introduced at the 5’ of the S1 tag the sequence targeted by the RP3-326I13.1 sgRNA. The targeting vector also contained an independent PuroR expression cassette driven by a PGK promoter for facile isolation of clonal populations of cells that integrate the plasmid within the genome. The sequence of the targeting vector is provided in Figure 8—figure supplement 2. HCT116 cells were transfected with 300 ng Cas9, 300 ng of sgRNA and 300 ng of targeting vector using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions in 24-well plates. Three days after transfection, the cells were selected with 0.5 µg/ml Puromycin to generate clonal populations.

Genomic DNA from each clone was isolated using DNEasy Blood and Tissue Kit (Qiagen). PCRs to detect integration of the targeting vector at the target site were performed using KAPA2G Robust PCR kits (Kapa Biosystems) according to the manufacturer’s instructions. A typical reaction contained 20–100 ng of genomic DNA in Buffer A (5 µl), Enhancer (5 µl), dNTPs (0.5 µl), primers forward (PINCR Det FP, 1.25 µl) and reverse (Targeting vector Det RP, 1.25 µl) and KAPA2G Robust DNA Polymerase (0.5 U). The DNA sequences of the primers for each target are provided in Supplementary file 5. PCR products were visualized in 2% agarose gels and images were captured using a ChemiDoc-It2 (UVP). The PCR products were cloned into TOPO-TA cloning (ThermoFisher) and sequenced.

RNA pulldowns from S1-tagged PINCR cells

For immunoprecipitation experiments, HCT116 clonal cell lines expressing PINCR or PINCR-S1 RNA were treated with 5-FU for 24 hr to induce PINCR expression. 2 × 107 cells were lysed in lysis buffer (150 mM NaCl, 50 mM Tris-HCl pH 7.5, 0.5% Triton X-100, 1 mM PMSF, Protease inhibitor cocktail and RNase inhibitor). Lysates were sonicated three times for 5 s and centrifuged at 14,000 x g at 4°C for 30 min. For IP, 500 µg of cellular extract was incubated overnight at 4°C with 25 µl Dynabeads M-280 Streptavidin (Thermo Fisher Scientific). Beads were washed twice with high salt buffer (0.1% SDS, 1% Triton-X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8 and 500 mM NaCl) followed by low salt buffer (0.1% SDS, 1% Triton-X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8 and 150 mM NaCl) and TE buffer (10 mM Tris-HCl pH 8 and 2 mM EDTA). Bound proteins were eluted by boiling the samples for 5 min in SDS-PAGE sample buffer. Eluted proteins were subjected to SDS-PAGE and immunoblotting with Matrin 3 (Bethyl labs) or β-Tubulin (Cell Signaling, Catalog # 2146S). Enrichment of PINCR RNA levels in the pulldown material was evaluated by directly adding Trizol to the beads, followed by RNA extraction and qRT-PCR.

To test the binding of PINCR to the chromatin, PINCR and PINCR-S1 cells were treated with 5-FU for 24 hr to induce PINCR expression. Chromatin was cross-linked with 1% formaldehyde, and cells were lysed and sonicated in Buffer B (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8, Protease inhibitor and RNase inhibitor). RNA-DNA-protein complexes were immunoprecipitated with Dynabeads M-280 Streptavidin, overnight using IP buffer (0.01% SDS, 0.5% Triton-X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl pH 8 and 167 mM NaCl). Beads were washed twice with high-salt buffer followed by TE buffer. Bound RNA-DNA-protein complexes were eluted from the beads using elution buffer (100 mM NaCl, 50 mM Hepes pH 7.4, 0.5% NP40, 10 mM MgCl2 and 5 mM Biotin), at room temperature for 20 min. Eluted material was incubated at 65°C for 2 hr (200 mM NaCl) to reverse crosslink the bound proteins. The samples were treated with Proteinase K and eluted DNA was column purified (Qiagen) and analyzed by qPCR using primers flanking the p53-binding sites of different genes (Supplementary file 5).

To test if PINCR binding to the chromatin is p53 and/or Matrin-3-dependent, PINCR-S1 cells were reverse transfected with CTL siRNAs, p53 siRNAs or two independent Matrin 3 siRNAs. After 48 hr, the cells were treated with 5-FU for 24 hr. The enrichment of PINCR-S1 at the promoter and enhancer regions of PINCR targets was determined by ChIP-qPCR followed by streptavidin pulldown as described above.

Microarray analysis

For lncRNA profiling HCT116, SW48 and RKO cells were untreated or treated with Nutlin-3 in duplicate for 8 hr. Total RNA was isolated using the RNeasy Mini kit (Qiagen) and hybridized to Affymetrix HT2.0 arrays that contain probes for ~11,000 lncRNAs. To identify the PINCR-regulated transcriptome PINCR-WT and PINCR-KO cells were untreated or treated with 5-FU (100 uM) for 24 hr. RNA samples were prepared as described above in triplicates and labeled using the IlluminaTotalPrep RNA amplification kit (Ambion) and microarrays were performed with the HumanHT-12 v4 Expression BeadChip kit (Illumina). After hybridization, raw data were extracted with Illumina GenomeStudio software. Raw probe intensities were converted to expression values using the lumi package in Bioconductor with background correction, variance stabilization and quantile normalization. Differential expression between different conditions was computed by an empirical Bayes analysis of a linear model using the limma package in Bioconductor. Adjusted p-values were calculated with the Benjamini and Hochberg method, and differentially expressed genes were selected with adjusted p-value≤0.05 and a fold change ≥1.50.

All the microarray data for this study has been deposited in GEO. The Accession number is GSE90086 and the URL is https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE90086. The unpublished RNA-seq data (Li et al., unpublished) used in this study has been deposited in GEO. The Accession number is GSE79249 and the URL is https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE79249.

Luciferase reporter assays

A 2 kb region upstream of the first exon of PINCR was PCR amplified (primer sequences in Supplementary file 5) using 100 ng genomic DNA from HCT116 cells and inserted into upstream of Firefly luciferase of pGL3 luciferase vector (Promega). To measure PINCR promoter activity, HCT116 cells were co-transfected with 100 ng of pGL3-empty vector or pGL3 expressing the PINCR promoter, along with pCB6-empty vector or pCB6 expressing p53, and 10 ng pRL-TK expressing Renilla luciferase. After 48 hr, luciferase activity was measured using the dual-luciferase reporter system (Promega).

A 2 kb PINCR promoter region (chrX: 43,034,255–43,036,255) with (WT-p53RE) and without (Δp53RE) the 20 bp p53RE (GCCCTTGTCTGGACATGCCC) was synthesized in pGL3 luciferase vector by GenScript. HCT116 cells were co-transfected with 100 ng of pGL3 expressing the WT or Δp53RE PINCR promoter and 10 ng pRL-TK expressing Renilla luciferase. After 48 hr, cells were left untreated or treated with DOXO for 24 hr and luciferase activity was measured using the dual-luciferase reporter system (Promega).

Flow cytometry, caspase-3 immunostaining, colony formation and cell proliferation assays

For cell cycle analysis, 3.0 × 105 PINCR-WT and PINCR-KO cells were seeded per well of a 6-well plate. After 24 hr, cells were untreated or treated with 300 nM DOXO or 100 µM 5-FU or 400 ng/ml NCS or 10 µM Nutlin-3 and the samples were collected at the indicated times. Cells were fixed with ice-cold ethanol for 2 hr and stained with propidium iodide (Sigma) in the presence of RNase A (Qiagen). Cell cycle profiles were captured using FACS Calibur flow cytometer (BD Biosciences), and the data were analyzed using FlowJo software (FloJo, LLC).

To perform cell cycle analysis after Matrin 3 knockdown, PINCR-WT and PINCR-KO cells were reverse transfected with siCTL and two independent Matrin 3 siRNAs using RNAiMAX at a final siRNA concentration of 20 nM. After 48 hr, cells were untreated or treated with 300 nM DOXO or 100 µM 5-FU and cell cycle profiles were captured as described above. For cell cycle analysis after BTG2/GPX1/RRM2B knockdown, PINCR-WT HCT116 cells were reverse transfected with siCTL and two individual siBTG2, siGPX1 and siRRM2B using RNAiMAX at a final siRNA concentration of 20 nM. After 48 hr, cells were untreated or treated with 100 µM 5-FU and cell cycle profiles were captured as described above. Cell cycle analysis after PINCR knockdown using ASOs, HCT116 cells were reverse transfected with 50 nM CTL-ASO or PINCR-ASO. After 48 hr, cells were untreated or treated with 300 nM DOXO or 100 µM 5-FU and cell cycle profiles were captured as described above.

For caspase-3 immunostaining, 3.0 × 105 PINCR-WT and PINCR-KO cells were seeded per well of a six-well plate. After 24 hr, cells were untreated or treated with DOXO for 72 hr and fixed with 4% paraformaldehyde for 10 min and permeabilized by 0.5% Triton X-100 for 10 min. Fixed cells were stained for 1 hr with primary antibodies anti-Mab414 (Covance, Catalog # MMS120P) for nuclear envelope and active caspase-3 (Cell Signaling, Catalog # 9661S) for apoptotic cells, followed by further staining with DAPI (blue) and secondary antibodies, anti-mouse 586 (orange; Alexa Fluor 586 goat anti-mouse IgG, Life Technology, Catalog # A11031) and anti-rabbit 488 (green; Alexa Fluor 488 donkey anti-rabbit IgG, life Technology, Catalog # A21206) for 1 hr. Images were taken by Ziess immunofluorescence microscope with x63 lens.

For colony formation on plastic, 3 × 105 PINCR-WT and PINCR-KO HCT116 cells were seeded per well in six-well plates. After 24 hr, cells were untreated or treated with 100 nM or 300 nM DOXO or 10 µM, 50 µM or 100 µM 5-FU for 4 hr, following which the drug was washed-off and fresh medium was added. After a 4 hr recovery, cells were seeded in a 12-well plate at a density of 500 cells per well. After 2 weeks, colonies were fixed with ice-cold 100% methanol for 5 min, stained with crystal violet, and colonies were counted. For colony formation after ASO transfections, HCT116 cells were transfected with CTL-ASO and PINCR-ASO. After 48 hr, cells were untreated or treated with 100 µM 5-FU for 4 hr, following which the drug was washed-off and fresh medium was added. After a 4 hr recovery, cells were seeded in a 12-well plate at a density of 500 cells per well. After 2 weeks, colonies were fixed as described above. For long-term cell proliferation assays on plastic, 3 × 105 PINCR-WT and PINCR-KO SW48 cells were seeded in 12-well plate. After 24 hr, cells were untreated or treated with 100 µM 5-FU for 7 days. After 7 days, cells were fixed with ice-cold 100% methanol for 5 min and stained with crystal violet.

PINCR overexpression lines and cell cycle analysis

The 2.2 kb transcript corresponding to PINCR RNA (NR_110387.1) was cloned into pCB6 vector using EcoR1/Xba1 restriction enzyme cloning sites. PINCR-KO cells were transfected with pCB6 empty vector (EV) or pCB6 vector expressing PINCR. After 48 hr, the cells were treated with neomycin and incubated at 37°C for 4–5 days, for selection of stably transfected cells. Total RNA was extracted from the pool of cells and expression of PINCR was analyzed using qRT-PCR. For cell cycle analysis, 3.0 × 105 PINCR-KO cells expressing pCB6-EV or pCB6-PINCR were seeded per well in six-well plates. After 24 hr, cells were untreated or treated with 300 nM DOXO and the samples were collected at indicated times. FACS analysis was performed as described above.

To determine the effect of PINCR overexpression on cell cycle and gene regulation, HCT116 cells expressing PINCR or PINCR-S1 were transfected with pCB6 or pCB6-PINCR expressing PINCR. After 48 hr, cells were treated with DOXO or 5-FU for indicated times. Expression of PINCR and other target genes was analyzed using qRT-PCR and FACS was performed as described above.

Immunoblotting and immunoprecipitation

To measure apoptosis after 5-FU treatment PINCR-WT and PINCR-KO cells were untreated or treated with 5-FU (100 µM) for 48 hr. Similarly, to determine the levels of p53 and/or p21 or phospho-Rb in PINCR-WT and PINCR-KO cells, the cells were untreated or treated with 5-FU for 24 hr. Whole-cell lysates were prepared using radioimmunoprecipitation (RIPA) buffer containing protease inhibitor cocktail (Roche). Proteins were quantified using the bicinchoninic acid protein quantitation (BCA) kit (Thermo Scientific). For immunoblotting, 20 µg whole cell lysate per lane was loaded onto a 12% SDS-PAGE gel, transferred to nitrocellulose membrane and immunoblotted with anti-Cleaved PARP (Cell Signaling, Catalog # 2541), anti-p53 (DO-1) (Santa Cruz, Catalog # sc-126), anti-p21 (Santa Cruz, Catalog # sc-397), anti-Histone H3 (Cell Signaling, Catalog # 4620), anti-phospho-Rb (Cell Signaling, Catalog # 9307P, 9208P, 9301P) and anti-GAPDH (Cell Signaling, Catalog # 14C10).

To determine the p53 and Matrin 3 knockdown efficiency PINCR-WT cells were reverse transfected with CTL siRNAs or p53 siRNAs or Matrin 3 siRNAs (20 nM) respectively, and 48 hr after transfection cell lysates were prepared using RIPA buffer as described above, followed by immunoblotting with anti-p53, Matrin 3 (Bethyl labs Catalog # A300-591A) or GAPDH antibodies.

For co-immunoprecipitation experiments HCT116 cells were untreated or treated with 5-FU (100 µM) for 24 hr and whole cell lysates were prepared in RIPA buffer and centrifuged at 14,000 x g at 4°C for 30 min. For IP, 25 µl Pierce protein A/G magnetic beads (Thermo Scientific, Catalog # 88802) were incubated with 2 µg Matrin 3 antibody or IgG control (Santa Cruz, Catalog # sc-2027), for 4 hr at 4°C. Following this, 500 µg cellular extract was incubated for 4 hr at 4°C with A/G magnetic beads pre-coated with IgG or Matrin 3. Beads were washed 5 times at 4°C with RIPA buffer and samples were untreated or treated with RNase A and DNase for 30 min at 37°C. Bound proteins were eluted by boiling the samples for 5 min in SDS-PAGE sample buffer. Eluted proteins were subjected to SDS-PAGE and immunoblotting using anti-p53 DO-1 antibody. To perform reciprocal IP nuclear lysates were prepared from HCT116 cells as described before and Immunoprecipitation was done as discussed above. IgG control (Santa Cruz, Catalog # sc-2025) and DO-1 p53 antibodies were used for IP and anti-Matrin 3 antibody for immunoblotting.

To determine the association of PINCR to Matrin 3 in intact cells, 2 × 107 HCT116 cells were treated with 5-FU (100 µM) for 24 hr and then cross-linked with 1% formaldehyde. Crosslinked cells were resuspended in Buffer B (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8, Protease inhibitor cocktail and RNAse inhibitor), followed by sonication. An aliquot of the sonicated cell lysates was subjected to IP using 2 µg IgG or Matrin 3 antibodies for 4 hr at 4°C on protein A/G magnetic beads, using IP buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl pH 8, 167 mM NaCl). The IP material was washed twice with high salt buffer (0.1% SDS, 1% Triton-X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8 and 500 mM NaCl) followed by TE buffer (10 mM Tris-HCl pH 8 and 2 mM EDTA). Bound RNA-protein complexes were eluted from the beads using elution buffer (0.1% SDS, 0.1M NaHCO3, RNase inhibitor), at 37°C for 15 min followed by reverse cross-linking at 65°C for 2 hr by with 200 mM NaCl. Matrin 3 bound RNAs were isolated by phenol-chloroform extraction (Ambion) followed by ethanol precipitation and qRT-PCR was used to determine the enrichment of p21 (negative control) and PINCR in the Matrin 3 IPs.

To determine the direct binding of PINCR to recombinant Matrin 3 (rMatrin 3), 200 ng of in vitro transcribed Bi-PINCR or Bi-LUC RNA was incubated with 500 ng recombinant Matrin 3 protein (Creative BioMart, Catalog # MATR3-15H) in 1X EMSA buffer (25 mM Tris-HCl pH 7.5, 150 mM KCl, 0.1% Triton-X-100, 100 µg/ml BSA, 2 mM DTT and 5% glycerol) at room temperature for 2 hr. RNA–protein complex was immunoprecipitated at room temperature for 2 hr, by using Dynabeads M-280 Streptavidin. Beads were washed five to six times with 1X EMSA buffer without glycerol and bound material was subjected to SDS-PAGE and immunoblotting for Matrin3. The following antibodies were used: anti-p53 (DO-1) 1: 1000 dilution from Santa Cruz Biotechnology; anti-Matrin 3 1:1000 dilution from Bethyl Laboratories; anti-Cleaved PARP and anti-GAPDH at 1:1000 dilution from Cell Signaling.

Chromatin IP assays

Chromatin IP was performed with the Active Motif ChIP kit (Active Motif, Carlsbad, CA, USA) as directed by the manufacturer. Briefly, 5 × 107 HCT116 cells grown in 15-cm plates were untreated or treated with DOXO (300 nM) for 16 hr. Similarly, PINCR-WT and PINCR-KO cells were untreated or treated with 5-FU (100 µM) for 24 hr. Chromatin was cross-linked with 1% formaldehyde, and cells were lysed and sonicated. Protein–DNA complexes were immunoprecipitated with control IgG or anti-p53 (DO1) (Santa Cruz) or anti-Matrin 3 (Bethyl labs) antibody. The IP material was washed and heated at 65°C overnight to reverse crosslinks. ChIP DNA was column purified (Qiagen) and analyzed by qPCR. Primers flanking the p53 binding sites or the enhancer regions of different genes are listed in Supplementary file 5. To test if association of p53 to the promoter and enhancer regions is Matrin-3-dependent 5 × 107 PINCR-WT cells were reverse transfected with CTL siRNAs and two independent Matrin 3 siRNAs. After 48 hr, cells were treated with 5-FU for 24 hr and enrichment of p53 at the promoter and enhancer regions of PINCR targets was determined by ChIP-qPCR as described above.

Bioinformatic analysis of ChIP-seq and Hi-C data

Integrative Genome Browser (IGV, software.broadinstitute.org/software/igv/) was used to download and visualize relevant ChIP-seq datasets from the ENCODE consortium data repository. Motif identification at CTCF peaks surrounding putative enhancer-gene pairs within insulated neighborhoods was gathered from the HOMER software package (http://homer.ucsd.edu/homer/ngs/). Genomic locations of p53 response elements were determined similarly from HOMER p53 motif datasets. Chromatin folding was inferred from 3D contact matrices calculated from in situ HiC data (Rao et al., 2014) and visualized using the Juicebox desktop application (Durand et al., 2016).

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
    p53: the ultimate tumor suppressor gene?
    1. M Oren
    (1992)
    FASEB Journal 6:3169–3176.
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
    Characterization of SAF-A, a novel nuclear DNA binding protein from HeLa cells with high affinity for nuclear matrix/scaffold attachment DNA elements
    1. H Romig
    2. FO Fackelmayer
    3. A Renz
    4. U Ramsperger
    5. A Richter
    (1992)
    The EMBO Journal 11:3431–3440.
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
    p53 in health and disease
    1. KH Vousden
    2. DP Lane
    (2007)
    Nature Reviews Molecular Cell Biology 8:275–283.
    https://doi.org/10.1038/nrm2147
  69. 69
  70. 70
  71. 71

Decision letter

  1. Joaquín M Espinosa
    Reviewing Editor; University of Colorado School of Medicine, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

[Editors’ note: the authors were asked to provide a plan for revisions before the editors issued a final decision. What follows is the editors’ letter requesting such plan.]

Thank you for sending your article entitled "Prosurvival long noncoding RNA PINCR regulates a subset of p53 targets in colorectal cancer cells by binding to Matrin 3" for peer review at eLife. Your work is being evaluated by a Senior Editor and three reviewers, one of whom is a member of our Board of Reviewing Editors.

We are in the process of discussing the reviews. Before advising further and reaching a decision, we would like to hear your response to the following concerns, along with an estimated time frame for completing any additional work (please see the reviews below).

Reviewer #1:

This is a tantalizing paper reporting the existence of p53-inducible lncRNA, dubbed PINCR, that is supposed to act as a gene-specific cofactor for induction of select p53 target genes, such as BTG2, GPX1 and RRM2B, but not the potent CDK inhibitor p21. In the absence of PINCR, the authors observe and impairment in G1 arrest upon p53 activation with genotoxic agents, concurrently with increased apoptosis. Mechanistically, PINCR is required for binding of p53 to the enhancers of some of the genes it regulates (e.g. BTG2, RRM2B, GPX1). However, PINCR does not bind to p53 directly, but binds instead to the RNA-binding protein Matrin-3. In turn, Matrin-3 is required for p53 transactivation of the genes that require PINCR. In sum, the authors conclude that the PINCR-Matrin complex is a gene-specific cofactor of p53, required for p53 binding to select enhancers.

Overall, the paper is tantalizing and interesting, but there are many unresolved aspects that prevent its publication in its current form. There are several areas where more clarity is needed about the observations made, as some of them contradict well known facts in the p53 field.

The major concerns are:

1) A p21-independent role of PINCR in p53-dependent cell cycle arrest. The authors show that PINCR is required for p53-dependent G1 arrest in response to doxorubicin, neocarcinostatin and 5FU. The authors also show that PINCR does not affect p21 expression or binding of p53 to the p21 enhancer. This is highly paradoxical, because p21 is required for G1 arrest in response to the three p53-activating agents mentioned above. The results counter this well-established and reproducible observation, and suggest that p21 cannot enforce G1 arrest without transactivation of other p53 targets, such as BTG2, RRM2B and GPX1. If this is the case, it should be demonstrated thoroughly. Can depletion of BTG2 and/or RRM2B and/or GPX1 recapitulate the effects of PINCR depletion? Is it true that these genes are required for p21-dependent cell cycle arrest? This could be answered with siRNA knockdowns. Is it true that p21 is unable to block CDKs, prevent RB phosphorylation and stall the cell cycle in the absence of PINCR? This should be explored in detail by looking a p21 localization, Rb phosphorylation and other markers of p21 action and G1-S progression.

2) A gene-specific role for PINCR and Matrin. A key observation in this paper is that PINCR and Matrin are required for p53 transactivation at selective loci, and this is explained by a requirement of PINCR for p53 binding to the respective enhancers at those genes. The notion of a RNA (or a RNA binding protein) being required for p53 binding to some DNA elements but not others is very provocative and requires further investigation. Biochemically speaking, p53 is a potent DNA-binding protein that works as a tetramer to bind a 4-repeat DNA sequence (a 20 mer consensus made of two half sites with two palindromic repeats per half site). How is this activity modified by RNA and/or a RNA-binding protein at some DNA elements but not others? This is very tantalizing and hard to comprehend. In vitro protein-DNA binding experiments should be performed to investigate this. The genome-wide requirement for PINCR and Matrin should be defined. Is it true that only 11 p53 targets require PINCR? If so, is it true that PINCR regulates p53 binding at only those 11 loci? Is it true that PINCR binds only to those p53 target loci? What about Matrin? What is Matrin's binding pattern relative to p53 target genes, those sensitive and insensitive to PINCR?

These questions should be answered with careful ChIP-seq experiments for p53, PINCR-S1 and Matrin, and a detailed investigation of this 'gene-specific effects'. This is important, because the latest and most comprehensive investigations of p53 functionality at enhancers indicate that p53 does not employ cofactors to recognize and activate transcription from ~1000 enhancers in a wide variety of contexts (see for example Verfaillie et al., Genome Research 2016). This notion is further supported by earlier work demonstrating that p53 can recognize its p53REs in nucleosomal context, often leading to nucleosome displacement.

3) DNA- versus RNA-dependent effects of PINCR. The authors conclude that PINCR acts by a RNA-dependent mechanism. However, this is based mostly on an unsatisfactory rescue overexpression experiment in PINCR knockout cells. This is important, because the field has been profoundly misled by earlier reports of another p53-inducible lncRNA, lincRNA-p21, which was first described to be acting by an RNA-dependent mechanism, yet now is ample clear that the lincRNA-p21 locus acts by a DNA-dependent, enhancer-like mechanism (see latest work from John Rinn's team in Cell Reports, backtracking on his original Cell paper by Huarte et al). To clarify this for PINCR, the authors should elaborate more on their knockout. What exact region of the genome did they delete when they deleted the 'entire PINCR region'? Did they delete the proximal p53 binding site as well? If they preserved the p53 enhancer, they should demonstrate that p53 binding to that region is intact by ChIP.

Other concerns:

1) Repeats and error bars in 2B.

2) Is PINCR upregulated in published GRO-seq data in HCT116 cells? It is unclear which ncRNA in Allen et al. the authors refer too. Is it refereed by a different name in Allen et al? A genome viewer screenshot will go a long way to show that PINCR is truly a direct p53 target is truly direct.

3) Raw cell cycle profiles for 3B-C.

4) To confirm that PINCR is involved in p53-dependent G1 arrest, they should repeat the experiments they did with genotoxic agents using Nutlin instead.

Reviewer #2:

This manuscript by Chaudhary et al. describes the characterization and functional analysis of a new p53-induced lncRNA, designated PINCR. The authors demonstrated that PINCR is a direct p53 target gene that is necessary for the induction of a subset of p53 targets involved in cell cycle regulation and apoptosis. Evidence is presented supporting a model in which a PINCR-Matrin 3 complex facilitates p53 association with select promoters. The identification of a lncRNA that is essential for transactivation of specific p53 targets and, as a result, whose loss impairs the p53 pathway is a significant finding and, in principle, appropriate for publication in eLife. However, there are several aspects of the work that are incomplete and require further experimentation to convincingly support the conclusions put forward.

1) Since this is the first functional analysis of PINCR, additional basic characterization of the lncRNA is important. The authors should confirm the 5'/3' ends and splicing of the transcript by RACE and RT-PCR. The copy number of the expressed transcript should be determined (e.g. +/- Nutlin, DOXO, and/or 5-FU). A northern blot would be helpful if possible to confirm the existence of a discrete transcript at the expected size. The conservation pattern of the transcript and p53 response element should be commented upon.

2) The use of genome editing to stably delete PINCR is a good approach to establish a robust system for functional studies. However, the authors chose to delete a ~50 kb segment to remove the lncRNA which raises concerns regarding whether other important sequences were removed in addition to the 2.2 kb spliced PINCR sequence. I appreciate the authors' attempts to mitigate these concerns by performing a rescue experiment but the analysis of rescued cells does not go nearly far enough. Cell cycle analysis of rescued cells should be shown in addition to the provided analysis of cell survival after DOXO treatment (Figure 3E). The clonogenic survival assays (Figure 3G) should also be performed on rescued cells. Likewise, cell cycle, cell survival, and clonogenic survival of rescued cells after 5-FU treatment should be added to Figure 4A-F.

Any concerns about the genome editing approach could be fully mitigated if the authors employed an orthogonal method to inhibit PINCR such as siRNA knockdown or CRISPRi, followed by analysis of cell cycle, survival, clonogenic growth, and target gene induction (e.g. BTG2, GPX1, RRM2B).

3) While p53-mediated PINCR induction was demonstrated in multiple cell lines, all functional analyses are limited to HCT116. PINCR should be knocked out or inhibited in a second cell line to confirm that the phenotypic effects observed are not unique to HCT116.

4) Knockdown of Matrin 3 partially phenocopies PINCR knockout with respect to cell survival after 5-FU treatment (Figure 6F). As this is a very important prediction of their model, the analysis of Matrin 3 knockdown should be extended. First, at least 2 independent siRNAs should be tested to avoid off-target effects (this is especially important when monitoring general cellular phenotypes such as survival). Furthermore, the cell cycle should be examined after knockdown of Matrin 3 and 5-FU treatment and both cell cycle and apoptosis should be examined after DOXO treatment.

5) What happens to the Matrin-p53 interaction in PINCR KO cells? Co-IP assays (as in Figure 7A-B) should be performed in these cells. Likewise, does PINCR associate with p53 response elements in the absence of Matrin and/or p53? The experiments in Figure 7I should be repeated after Matrin and p53 knockdown.

6) While the observation that p53-mediated induction of BTG2, GPX1, and RRM2B is attenuated in PINCR KO cells and after Matrin 3 knockdown is interesting, there is no evidence that these changes in gene expression are responsible for the impaired p53-mediated cell cycle arrest and apoptosis in PINCR KO cells. Does knockdown of any of these targets phenocopy PINCR KO? Does overexpression of any of these genes rescue PINCR KO?

7) The p53-RE luciferase assays in Figure 2E would be much more convincing if a reporter with mutations in the p53-RE were tested in parallel as a negative control.

8) In Figure 7—figure supplement 1C, it appears that the polyadenylation signal was removed when the S1 tag was inserted (at the end of the red sequence). Does this affect the level of PINCR expression? Although the authors show PINCR-S1 induction after DOXO treatment, PINCR-S1 levels should be directly compared to endogenous PINCR.

Reviewer #3:

In this original study, the authors identify the lincRNA PINCR as a new direct transcriptional target of p53. They further show that PINCR is required for p53-mediated G1 arrest, owing to the contribution of PINCR to the induction of a specific subset of p53 target genes in response to DNA damage. Importantly, they identify an interaction between PINCR and the RNA binding protein matrin 3, which is required for the induction of this subset of genes, and show nicely that PINCR binds directly to the p53 response elements (p53 RE's) of those genes.

Overall, this is a very interesting and well performed study. Publication in eLife is recommended if the authors can address, in a satisfactory manner, several important issues as listed below.

1).Figure 4. In view of the suggested biology of PINCR, one might expect it to be selectively LESS induced under conditions that favor p53-dependent cell death. What happens, for example, upon treatment of HCT116 cells with high dose 5-FU? As a matter of fact, the data in Figure 4 and its supplemental already point in this direction: 5-FU, at the concentration used by the authors, induces more apoptosis (11%) than the other treatments, while causing a relatively modest increase in PINCR. Thus, the relative extent of endogenous PINCR induction might be a determinant of the likelihood of the cells to die rather than arrest. I suggest that the authors address this possibility more closely, e.g. by employing several different concentrations of 5-FU and comparing the extent of PINCR induction, induction of a typical pro-apoptotic p53 target gene (e.g. PUMA or CD95), and the accrual of sub-G1 cells.

2) Figure 4G. The in vivo result is impressive. However, it does not necessarily support a pro-survival function of PINCR as concluded in the subsection “PINCR loss results in hypersensitivity to 5-FU and decreased tumor growth”: the authors did not address survival/death at all in this experiment. It will be important to perform histopathological examination of the tumors, and show (by cleaved caspase 3 or TUNEL) that the PINCR KO tumors indeed manifest a greater extent of apoptosis.

3) I could not find any ChIP experiment showing that matrin 3 is required for optimal binding of p53 to the p53RE's of BTG2 etc. Did I miss it? This is an important experiment, as the authors attribute the reduced expression of those genes to reduced recruitment of p53 to their p53RE's.

4) Why does PINCR bind only to a subset of p53RE's? Is there significant homology between the sequence of PINCR and that of the DNA in the vicinity of those p53RE's, but not the p21 p53RE for example?

5) Figure 3D-E: How does PINCR overexpression affect the cell cycle profile and the expression of the specific subset of G1-related genes without and with DNA damage? Is PINCR overexpression alone sufficient to upregulate those genes?

6) Figure 7A: What happens to matrin 3 after DNA damage? Do its levels increase? Does it become more localized to the nucleus?

7) Does PINCR regulate its own expression after DNA damage? Does PINCR knockout affect the binding of p53 to the PINCR promoter?

8) Figure 7C. Does matrin 3 bind those promoters also without DNA damage, or is it recruited only after DNA damage?

9) Does matrin 3 affect the induction of BTG2 etc. in response to Nutlin, or is this DNA damage-specific?

[Editors’ note: formal revisions were requested, following approval of the authors’ plan of action.]

Thank you for submitting your article "Prosurvival long noncoding RNA PINCR regulates a subset of p53 targets in colorectal cancer cells by binding to Matrin 3" for consideration by eLife and for sending us your plan for revisions. The plan was favourably assessed by the Reviewing Editor and the reviewers and we are prepared to request a submission of a revised manuscript along the lines of what is outlined in your plan. The evaluation of your submission has been overseen by a Reviewing Editor and Kevin Struhl as the Senior Editor. The following individual involved in review of your submission has agreed to reveal his identity: Moshe Oren (Reviewer #3).

In your revisions, please also address the following concerns:

1) Response #1 to Reviewer 2: Since the RNA-seq data matches the annotated transcript ends, 5'/3' RACE is not necessary. But the data should be shown in the revised manuscript.

2) Response #6 to Reviewer 2: Use of the ASO approach is encouraged to bolster the genome editing findings. ASOs would actually be preferable to CRISPRi in this case because if ASO transfection phenocopies genomic deletion of PINCR, this would provide strong evidence for an RNA-mediated function of the transcript. CRISPRi would not rule out the possibility that the observed phenotypes are somehow the result of transcription of this locus, rather than a function of the RNA itself.

3) Response #8 to Reviewer 2: Two independent siRNAs are needed. A pool of siRNAs can still result in off-target effects.

4) ChIP-seq experiments for Matrin 3 and PINCR-S1 are no longer necessary.

5) The p53 ChIP-seq experiments are still requested, even if this extends the resubmission timeline between 2-3 months.

https://doi.org/10.7554/eLife.23244.075

Author response

[Editors’ note: what follows is the authors’ plan to address the revisions.]

We thank the reviewers for their constructive comments and suggestions to improve our paper. All 3 reviewers found our paper interesting. We believe that we can address all of the major concerns of reviewers 2 and 3. Reviewer 1 has made some excellent suggestions and we can carefully address most of his/her concerns. However, to be realistic and to carefully conduct the ChIP-seq experiments (suggested by Reviewer 1) on Matrin 3 and PINCR-S1, it may take several months; thus, these experiments are beyond the scope of this study. As an alternative approach, we have proposed a series of experiments that will prove our model according to which PINCR regulates a subset of p53 targets by binding to Matrin 3.

Reviewer #1:

This is a tantalizing paper reporting the existence of p53-inducible lncRNA, dubbed PINCR, that is supposed to act as a gene-specific cofactor for induction of select p53 target genes, such as BTG2, GPX1 and RRM2B, but not the potent CDK inhibitor p21. In the absence of PINCR, the authors observe and impairment in G1 arrest upon p53 activation with genotoxic agents, concurrently with increased apoptosis. Mechanistically, PINCR is required for binding of p53 to the enhancers of some of the genes it regulates (e.g. BTG2, RRM2B, GPX1).

We would like to clarify that in our paper, we showed that PINCR is required for binding of p53 to the p53RE in the promoters of these genes (Line 256). Regulation of binding of p53 to the enhancers of these genes via Matrin 3 and PINCR may be one mechanism by which PINCR acts, a point that we had mentioned in the Discussion but if we are given an opportunity to revise this paper, we will test this as mentioned (please see: response # 5 to reviewer #1).

However, PINCR does not bind to p53 directly, but binds instead to the RNA-binding protein Matrin-3. In turn, Matrin-3 is required for p53 transactivation of the genes that require PINCR. In sum, the authors conclude that the PINCR-Matrin complex is a gene-specific cofactor of p53, required for p53 binding to select enhancers.

Overall, the paper is tantalizing and interesting, but there are many unresolved aspects that prevent its publication in its current form. There are several areas where more clarity is needed about the observations made, as some of them contradict well know facts in the p53 field.

We thank this reviewer for appreciating our findings and the constructive comments. Below is our response and plans to address the unresolved issues.

The major concerns are:

1) A p21-independent role of PINCR in p53-dependent cell cycle arrest. The authors show that PINCR is required for p53-dependent G1 arrest in response to doxorubicin, neocarcinostatin and 5FU. The authors also show that PINCR does not affect p21 expression or binding of p53 to the p21 enhancer. This is highly paradoxical, because p21 is required for G1 arrest in response to the three p53-activating agents mentioned above. The results counter this well-established and reproducible observation, and suggest that p21 can not enforce G1 arrest without transactivation of other p53 targets, such as BTG2, RRM2B and GPX1. If this is the case, it should be demonstrated thoroughly. Can depletion of BTG2 and/or RRM2B and/or GPX1 recapitulate the effects of PINCR depletion? Is it true that these genes are required for p21-dependent cell cycle arrest? This could be answered with siRNA knockdowns. Is it true that p21 is unable to block CDKs, prevent RB phosphorylation and stall the cell cycle in the absence of PINCR? This should be explored in detail by looking a p21 localization, Rb phosphorylation and other markers of p21 action and G1-S progression.

This is an excellent point. As the reviewer pointed out, p21 plays an important role in mediating the effects of p53 when it comes to G1 arrest after DNA damage. According to some papers, in the absence of p21, there is no G1 arrest after DNA damage (Waldman et al., Cancer Res, 1995). However, according to other papers (also cited in the Waldman et al. paper), p21 is not the only player (Deng et al., Cell, 1995). In addition, there are other papers in support of both models. Our data shows that the% of cells arrested in G1 after 24 hr (Figure 3B) is 28-35% in PINCR-WT clones and 10-15% in PINCR-KO clones. However, we found no difference in p21 mRNA induction upon loss of PINCR.

This was an unexpected result and indicates, as pointed out by the reviewer, that p21 cannot enforce G1 arrest if BTG2, RRM2B and GPX1 are not induced. Although this may seem paradoxical, it may be a truly novel finding – p21 may need these 3 genes to enforce G1 arrest. As suggested by the reviewer, we will test the roles of these genes in p21-dependent G1 arrest by siRNA knockdown of p21, and these 3 genes. This experiment will give us a sense of the contribution of each of these genes to the G1 arrest and their significance to p21 biology. In addition, as suggested, we will look at p21 localization because as mentioned by the reviewer, it may be the case that loss of PINCR alters p21 localization leading to altered Rb phosphorylation. In addition, we will look at other markers of p21 action and G1/S progression, as suggested by this reviewer.

These are straightforward experiments that can be addressed in a timely manner and the results will be instrumental in determining the role of these 3 PINCR targets in G1 arrest after DNA damage and their role in in p53 and p21 biology.

2) A gene-specific role for PINCR and Matrin. A key observation in this paper is that PINCR and Matrin are required for p53 transactivation at selective loci, and this is explained by a requirement of PINCR for p53 binding to the respective enhancers at those genes. The notion of a RNA (or a RNA binding protein) being required for p53 binding to some DNA elements but not others is very provocative and requires further investigation. Biochemically speaking, p53 is a potent DNA-binding protein that works as a tetramer to bind a 4-repeat DNA sequence (a 20 mer consensus made of two half sites with two palindromic repeats per half site). How is this activity modified by RNA and/or a RNA-binding protein at some DNA elements but not others? This is very tantalizing and hard to comprehend. In vitro protein-DNA binding experiments should be performed to investigate this. The genome-wide requirement for PINCR and Matrin should be defined. Is it true that only 11 p53 targets require PINCR?

Our data indicates that PINCR regulates only 11 p53 targets. This result is consistent with our additional data (to be added to the revised paper) that PINCR is expressed at 19-38 copies per HCT116 cell after DNA damage. A lncRNA expressed at 19-38 copies per cell is likely not to regulate all p53 targets, until it regulates p53 itself, which is not the case.

If so, is it true that PINCR regulates p53 binding at only those 11 loci? Is it true that PINCR binds only to those p53 target loci? What about Matrin? What is Matrin's binding pattern relative to p53 target genes, those sensitive and insensitive to PINCR?

Our data (Figure 7C, Figure 7—figure supplement 1B and Figure 7I)) shows that Matrin 3 and PINCR associate specifically with the p53RE of BTG2, RRM2B and GPX1 but not the p53RE of p21. We can extend this analysis to the remaining 8 out of 11 p53 targets. The results will further establish the role of PINCR and Matrin 3 in regulation of this subset of p53 targets. In addition, the proposed PINCR-S1 pulldown experiments after knockdown of p53 or Matrin 3 (please see: response # 10 to reviewer # 2) will support these conclusions.

These question should be answered with careful ChIP-seq experiments for p53, PINCR-S1 and Matrin, and a detailed investigation of this 'gene-specific effects'. This is important, because the latest and most comprehensive investigations of p53 functionality at enhancers indicate that p53 does not employ cofactors to recognize and activate transcription from ~1000 enhancers in a wide variety of contexts (see for example Verfaillie et al., Genome Research 2016). This notion is further supported by earlier work demonstrating that p53 can recognize its p53REs in nucleosomal context, often leading to nucleosome displacement.

The reviewer’s suggestion of conducting ChIP-seq experiments for p53, PINCR- S1 and Matrin 3 will allow detailed gene-specific effects of PINCR and Matrin 3. We can do the p53 ChIP-seq from PINCR-WT and PINCR-KO cells ± 5-FU. The results will further support our model of gene-specific regulation by PINCR.

The suggestion to do ChIP-seq for Matrin 3 and PINCR-S1 is great. However, unlike p53 ChIP-seq, the conditions for Matrin 3 ChIP-seq will need to be optimized. Moreover, to make sure that the ChIP-seq peaks are bona fide Matrin 3 associated sites, the experiments will also have to be done from Matrin 3 knockdown and/or Matrin 3 knockout cells. Likewise, the PINCR-S1 ChIP-seq will require optimization and scaling up because even for the very abundant lncRNAs such as MALAT1, NEAT1 and HOTAIR, endogenous lncRNA pulldown methods such as ChIRP, RAP and CHART require 50-100 million cells. Thus, it will take several months to get high confidence Matrin 3 and PINCR-S1 ChIP-seq data, if done carefully. These experiments are therefore beyond the scope of this study but we plan to follow-up on this.

How is this activity modified by RNA and/or a RNA-binding protein at some DNA elements but not others?

This is an intriguing question. A likely scenario is that Matrin 3 binds to enhancer regions of these genes and regulates p53 occupancy of their promoter (see Discussion,). To address this question, we hypothesize that Matrin 3 and PINCR associate with the enhancer regions upstream of BTG2, RRM2B and GPX1. We have looked at potential p53 binding sites in the enhancer regions for these genes (and negative controls such as p21) and will examine the association of p53, Matrin 3, PINCR-S1 and epigenetic marks in these regions in PINCR-WT and PINCR-KO cells by ChIP-qPCR.

3) DNA- versus RNA-dependent effects of PINCR. The authors conclude that PINCR acts by a RNA-dependent mechanism. However, this is based mostly on an unsatisfactory rescue overexpression experiment in PINCR knockout cells. This is important, because the field has been profoundly misled by earlier reports of another p53-inducible lncRNA, lincRNA-p21, which was first described to be acting by an RNA-dependent mechanism, yet now is ample clear that the lincRNA-p21 locus acts by a DNA-dependent, enhancer-like mechanism (see latest work from John Rinn's team in Cell Reports, backtracking on his original Cell paper by Huarte et al). To clarify this for PINCR, the authors should elaborate more on their knockout. What exact region of the genome did they delete when they deleted the 'entire PINCR region'? Did they delete the proximal p53 binding site as well? If they preserved the p53 enhancer, they should demonstrate that p53 binding to that region is intact by ChIP.

We used 2 gRNAs that were designed upstream of the first and downstream of the last exon on PINCR, respectively. Based on Sanger sequencing data, we found that out of the 2 PINCR-KO clones used in our study, one clone has intact p53RE whereas the other clone has partially intact p53RE. We can provide the DNA sequence showing the exact region of the genome that was deleted. As suggested, we can check the binding of p53 to the p53RE of PINCR in both PINCR-KO clones. We would like to mention that unlike lincRNA-p21 that is encoded upstream of p21, PINCR is expressed from an intergenic region from the X-chromosome and none of the 11 p53 PINCR-regulated genes are on the X-chromosome. Therefore, unlike lincRNA-p21, PINCR is a trans-acting lncRNA.

Other concerns:

1) Repeats and error bars in 2B.

We will repeat this experiment to generate error bars.

2) Is PINCR upregulated in published GRO-seq data in HCT116 cells? It is unclear which ncRNA in Allen et al. the authors refer too. Is it refereed by a different name in Allen et al? A genome viewer screenshot will go a long way to show that PINCR is truly a direct p53 targetis truly direct.

The reference Allen et al. was cited to determine how many of the protein-coding genes in our lncRNA array data (Figure 1C) were also identified in the p53 GRO-seq paper. Genome viewer screenshot of p53 ChIP-seq data (Figure 2C), the sequence of the p53RE (Figure 2—figure supplement 1) and the data in Figure 2D-E indicate that PINCR is a direct target of p53. In addition, as suggested by reviewer # 3 (please see: response # 3 to reviewer # 3), we will mutate the p53RE in the PINCR promoter that was inserted upstream of luciferase (Figure 2E) and perform luciferase assays.

3) Raw cell cycle profiles for 3B-C.

We will add these profiles to supplemental material.

4) To confirm that PINCR is involved in p53-dependent G1 arrest, they should repeat the experiments they did with genotoxic agents using Nutlin instead.

As suggested, we will do this experiment to further support the role of PINCR in p53-dependent G1 arrest.

Reviewer #2:

This manuscript by Chaudhary et al. describes the characterization and functional analysis of a new p53- induced lncRNA, designated PINCR. The authors demonstrated that PINCR is a direct p53 target gene that is necessary for the induction of a subset of p53 targets involved in cell cycle regulation and apoptosis. Evidence is presented supporting a model in which a PINCR-Matrin 3 complex facilitates p53 association with select promoters. The identification of a lncRNA that is essential for transactivation of specific p53 targets and, as a result, whose loss impairs the p53 pathway is a significant finding and, in principle, appropriate for publication in eLife. However, there are several aspects of the work that are incomplete and require further experimentation to convincingly support the conclusions put forward.

We thank this reviewer for appreciating our findings and the constructive comments. Below is our response and plans to address his/her comments.

1) Since this is the first functional analysis of PINCR, additional basic characterization of the lncRNA is important. The authors should confirm the 5'/3' ends and splicing of the transcript by RACE and RT-PCR.

This is a very important point. We have done RNA-seq data from HCT116, RKO and SW48 p53+/+ and p53-/- cells (Li et al., unpublished). This data can be used to show the 5’ and 3’ends of this transcript. The RNA-seq data matches the annotated 5’ and 3’ends of PINCR. This can be further supported by RT-PCR. If the reviewer wants, we can also do 5’ and 3’ RACE.

The copy number of the expressed transcript should be determined (e.g. +/- Nutlin, DOXO, and/or 5-FU).

We have found that after DNA damage with DOXO, PINCR is expressed at 19- 38 copies per cell. This data will be added to the revised paper.

A northern blot would be helpful if possible to confirm the existence of a discrete transcript at the expected size.

We tried the Northern blot but it did not work. This is not surprising given our finding that PINCR is expressed at 19-38 copies per cell.

The conservation pattern of the transcript and p53 response element should be commented upon.

We will add this information in the revised paper.

2) The use of genome editing to stably delete PINCR is a good approach to establish a robust system for functional studies. However, the authors chose to delete a ~50 kb segment to remove the lncRNA which raises concerns regarding whether other important sequences were removed in addition to the 2.2 kb spliced PINCR sequence. I appreciate the authors' attempts to mitigate these concerns by performing a rescue experiment but the analysis of rescued cells does not go nearly far enough. Cell cycle analysis of rescued cells should be shown in addition to the provided analysis of cell survival after DOXO treatment (Figure 3E). The clonogenic survival assays (Figure 3G) should also be performed on rescued cells. Likewise, cell cycle, cell survival, and clonogenic survival of rescued cells after 5-FU treatment should be added to Figure 4A-F.

We have the cell cycle data from the rescue experiments and will add it to the revised paper. Alternatively, these issues can be addressed by PINCR knockdown with antisense oligos (ASOs) and/or CRISPRi as suggested below.

Any concerns about the genome editing approach could be fully mitigated if the authors employed an orthogonal method to inhibit PINCR such as siRNA knockdown or CRISPRi, followed by analysis of cell cycle, survival, clonogenic growth, and target gene induction (e.g. BTG2, GPX1, RRM2B).

Excellent point. When we initiated this study, we tried to knockdown PINCR with siRNAs but we did not get robust knockdown. However, we now have antisense oligos (ASOs) and CRISPR-KRAB expressing HCT116 cells that can be used to knockdown PINCR and examine the phenotype and target gene induction, as suggested by the reviewer. We are confident that this approach will successfully knockdown PINCR and the results will further solidify our findings from the PINCR-KO clones.

3) While p53-mediated PINCR induction was demonstrated in multiple cell lines, all functional analyses are limited to HCT116. PINCR should be knocked out or inhibited in a second cell line to confirm that the phenotypic effects observed are not unique to HCT116.

This is an important point. We will knockdown PINCR in another cell line with ASOs or CRISPRi and determine if the observed phenotypic effects are not restricted to HCT116.

4) Knockdown of Matrin 3 partially phenocopies PINCR knockout with respect to cell survival after 5-FU treatment (Figure 6F). As this is a very important prediction of their model, the analysis of Matrin 3 knockdown should be extended. First, at least 2 independent siRNAs should be tested to avoid off-target effects (this is especially important when monitoring general cellular phenotypes such as survival). Furthermore, the cell cycle should be examined after knockdown of Matrin 3 and 5-FU treatment and both cell cycle and apoptosis should be examined after DOXO treatment.

In our paper, we have used smart pool siRNAs that contain 4 siRNAs. If the reviewer insists, we will do the experiments with 2 independent siRNAs. In addition, we will perform the cell cycle and apoptosis after Matrin 3 knockdown as suggested by the reviewer.

5) What happens to the Matrin-p53 interaction in PINCR KO cells? Co-IP assays (as in Figure 7A-B) should be performed in these cells.

Our data (Figure 7B) indicates that p53-Matrin 3 interaction is RNA-independent. So, we expect p53 to interact with Matrin 3 even in PINCR-KO cells. However, it would be good to do this co- IP experiment in PINCR-KO cells, as suggested by the reviewer.

Likewise, does PINCR associate with p53 response elements in the absence of Matrin and/or p53? The experiments in Figure 7I should be repeated after Matrin and p53 knockdown.

Great suggestion. The suggested experiments can be done easily and will further establish the model and also answer reviewer #1 and # 3 concern.

6) While the observation that p53-mediated induction of BTG2, GPX1, and RRM2B is attenuated in PINCR KO cells and after Matrin 3 knockdown is interesting, there is no evidence that these changes in gene expression are responsible for the impaired p53-mediated cell cycle arrest and apoptosis in PINCR KO cells. Does knockdown of any of these targets phenocopy PINCR KO?

A similar point was raised by reviewer # 1 (please see: response # 1 to reviewer # 1). We will address this by knocking down BTG2, GPX1 and RRM2B alone or in combination and determine the effect on cell cycle arrest and apoptosis, as suggested.

Does overexpression of any of these genes rescue PINCR KO?

We can attempt this experiment but if overexpression of these genes in the absence of DNA damage causes cell cycle arrest, it may be complicate the analysis.

7) The p53-RE luciferase assays in Figure 2E would be much more convincing if a reporter with mutations in the p53-RE were tested in parallel as a negative control.

We agree with the reviewer and will be do this experiment.

8) In Figure 7—figure supplement 1C, it appears that the polyadenylation signal was removed when the S1 tag was inserted (at the end of the red sequence). Does this affect the level of PINCR expression? Although the authors show PINCR-S1 induction after DOXO treatment, PINCR-S1 levels should be directly compared to endogenous PINCR.

We can address this question by RT-qPCR from cells expressing PINCR or PINCR-S1.

Reviewer #3:

In this original study, the authors identify the lincRNA PINCR as a new direct transcriptional target of p53. They further show that PINCR is required for p53-mediated G1 arrest, owing to the contribution of PINCR to the induction of a specific subset of p53 target genes in response to DNA damage. Importantly, they identify an interaction between PINCR and the RNA binding protein matrin 3, which is required for the induction of this subset of genes, and show nicely that PINCR binds directly to the p53 response elements (p53 RE's) of those genes.

Overall, this is a very interesting and well performed study. Publication in eLife is recommended if the authors can address, in a satisfactory manner, several important issues as listed below.

We thank this reviewer for his/her kind words and constructive comments. Below is our response and plans to address the reviewer’s comments.

1) Figure 4. In view of the suggested biology of PINCR, one might expect it to be selectively LESS induced under conditions that favor p53-dependent cell death. What happens, for example, upon treatment of HCT116 cells with high dose 5-FU? As a matter of fact, the data in Figure 4 and its supplemental already point in this direction: 5-FU, at the concentration used by the authors, induces more apoptosis (11%) than the other treatments, while causing a relatively modest increase in PINCR. Thus, the relative extent of endogenous PINCR induction might be a determinant of the likelihood of the cells to die rather than arrest. I suggest that the authors address this possibility more closely, e.g. by employing several different concentrations of 5-FU and comparing the extent of PINCR induction, induction of a typical pro-apoptotic p53 target gene (e.g. PUMA or CD95), and the accrual of sub-G1 cells.

This is a very interesting point. As suggested, at several different concentrations of 5-FU, we will measure the induction of PINCR, PUMA and CD95 and also determine the effect on G1 arrest and the sub-G1 population.

2) Figure 4G. The in vivo result is impressive. However, it does not necessarily support a pro-survival function of PINCR as concluded in the subsection “PINCR loss results in hypersensitivity to 5-FU and decreased tumor growth”: the authors did not address survival/death at all in this experiment. It will be important to perform histopathological examination of the tumors, and show (by cleaved caspase 3 or TUNEL) that the PINCR KO tumors indeed manifest a greater extent of apoptosis.

This is an important point. We have the frozen tissues and will compare apoptosis between the injected PINCR-WT and PINCR-KO cells as suggested.

3) I could not find any ChIP experiment showing that matrin 3 is required for optimal binding of p53 to the p53RE's of BTG2 etc. Did I miss it? This is an important experiment, as the authors attribute the reduced expression of those genes to reduced recruitment of p53 to their p53RE's.

We agree with the reviewer. This experiment was also suggested by reviewer # 2 (please see: response #10 to reviewer # 2) and will test the binding of p53 to the p53RE of the PINCR targets after Matrin 3 knockdown.

4) Why does PINCR bind only to a subset of p53RE's? Is there significant homology between the sequence of PINCR and that of the DNA in the vicinity of those p53RE's, but not the p21 p53RE for example?

This point was also raised by reviewer # 1. Please see our response to reviewer # 1 (response #2-4 to reviewer # 1).

5) Figure 3D-E: How does PINCR overexpression affect the cell cycle profile and the expression of the specific subset of G1-related genes without and with DNA damage? Is PINCR overexpression alone sufficient to upregulate those genes?

Another great suggestion. This is a straightforward experiment that will test if PINCR overexpression is sufficient to upregulate these genes and to determine the effect on G1 arrest after DNA damage.

6) Figure 7A: What happens to matrin 3 after DNA damage? Do its levels increase? Does it become more localized to the nucleus?

As suggested, we will measure Matrin 3 protein levels and nuclear localization after DNA damage. Preliminary data suggests that Matrin 3 expression is not deregulated after DNA damage.

7) Does PINCR regulate its own expression after DNA damage? Does PINCR knockout affect the binding of p53 to the PINCR promoter?

We will check the effect of overexpressing exogenous PINCR on PINCR-S1 cells using primers specific to the S1-tagged lncRNA. As mentioned before, the PINCR-KO cells have a complete or partial loss of the p53RE in the PINCR promoter. We will test the binding of p53 to the p53RE, as mentioned in the response to reviewer 1 (response # 6 to reviewer # 1).

8) Figure 7C. Does matrin 3 bind those promoters also without DNA damage, or is it recruited only after DNA damage?

We will determine by ChIP-qPCR this in the revised paper.

9) Does matrin 3 affect the induction of BTG2 etc in response to Nutlin, or is this DNA damage-specific?

We will address this in the revised paper by knocking down Matrin 3 and treating the cells with Nutlin.

[Editors’ notes: the authors’ response after being formally invited to submit a revised submission follows.]

Reviewer #1:

Overall, the paper is tantalizing and interesting, but there are many unresolved aspects that prevent its publication in its current form. There are several areas where more clarity is needed about the observations made, as some of them contradict well known facts in the p53 field.

The major concerns are:

1) A p21-independent role of PINCR in p53-dependent cell cycle arrest. The authors show that PINCR is required for p53-dependent G1 arrest in response to doxorubicin, neocarcinostatin and 5FU. The authors also show that PINCR does not affect p21 expression or binding of p53 to the p21 enhancer. This is highly paradoxical, because p21 is required for G1 arrest in response to the three p53-activating agents mentioned above. The results counter this well-established and reproducible observation, and suggest that p21 cannot enforce G1 arrest without transactivation of other p53 targets, such as BTG2, RRM2B and GPX1. If this is the case, it should be demonstrated thoroughly.

This is an excellent point. As the reviewer pointed out, p21 plays an important role in mediating the effects of p53 to induce G1 arrest after DNA damage. According to some papers, in the absence of p21, there is no G1 arrest after DNA damage (Waldman et al., Cancer Res, 1995). However, other papers (also cited in the Waldman et al. paper) show that p21 is not the only player (Deng et al., Cell, 1995).

Can depletion of BTG2 and/or RRM2B and/or GPX1 recapitulate the effects of PINCR depletion?

To address this point we have added new data (Figure 4—figure supplement 3 and Figure 4—figure supplement 4). We indeed found that depletion of BTG2, GPX1 or RRM2B using siRNAs, recapitulates the effects of PINCR depletion in response to 5-FU treatment. Accordingly, we made changes in the text as described below.

“We next asked the question if depletion of the PINCR targets BTG2, GPX1 and RRM2B recapitulated the effects of PINCR depletion. […] Significant reduction in G1 arrest after 5-FU treatment was observed after knockdown of GPX1 but not BTG2 or RRM2B. These data indicate that depletion of BTG2, GPX1 or RRM2B recapitulates the effects of PINCR depletion in response to 5-FU treatment.”

Is it true that these genes are required for p21-dependent cell cycle arrest? This could be answered with siRNA knockdowns.

To address this question, we knocked down p21 alone or p21 and each of these PINCR targets and examined the effect on G1 arrest and apoptosis after 5-FU treatment. The results from 3 biological replicates (Author response image 1) and the raw cell cycle profiles from a representative experiment (Author response image 2) show that concurrent knockdown of p21 and BTG2 results in further reduction in G1 arrest and increased apoptosis as compared to knockdown of p21 alone. On the other hand, concurrent knockdown of p21 and RRM2B results in less G1 arrest and decreased apoptosis as compared to knockdown of p21 alone. These data indicate that in the absence of p21, BTG2 may function as a G1-arrest promoting gene in response to 5-FU, whereas RRM2B may function as a G1-arrest antagonizing gene upon 5-FU treatment. However, future investigations are needed to further understand the crosstalk between p21 and these genes during cell cycle arrest.

Author response image 1

(A) PINCR-WT HCT116 cells were transfected with CTL siRNA (siCTL) or p21 siRNAs (sip21) for 48 hr and p21 knockdown was measured by immunoblotting. GAPDH was used as loading control. (B) PINCRWT HCT116 cells were transfected for 48 hr with siCTL or sip21 or co-transfected with sip21 and siCTL or siBTG2 or siGPX1 or siRRM2B. PI-staining and FACS analysis was performed after 48 hr of 5-FU treatment. Error bars represent SD from three biological replicates. *p<0.05; #p<0.01; **p<0.005; ##p<0.001.

https://doi.org/10.7554/eLife.23244.068
Author response image 2
Raw cell cycle profiles from a representative experiment for Author response image 1.
https://doi.org/10.7554/eLife.23244.069

Is it true that p21 is unable to block CDKs, prevent RB phosphorylation and stall the cell cycle in the absence of PINCR? This should be explored in detail by looking a p21 localization, Rb phosphorylation and other markers of p21 action and G1-S progression.

We have added new data (Figure 4—figure supplement 2) which shows that total p21 protein levels, p21 localization and Rb-phosphorylation are not regulated by PINCR. Accordingly, we made changes in the text, as described below.

“However, given the well-established role of p21 in controlling G1 arrest after DNA damage, it was important to make sure that loss of PINCR did not alter p21 protein levels, p21 subcellular localization and/or Rb- phosphorylation. […] These results indicate that p21 expression is not altered upon loss of PINCR and it can therefore be used as a negative control.”

2) A gene-specific role for PINCR and Matrin. A key observation in this paper is that PINCR and Matrin are required for p53 transactivation at selective loci, and this is explained by a requirement of PINCR for p53 binding to the respective enhancers at those genes. The notion of a RNA (or a RNA binding protein) being required for p53 binding to some DNA elements but not others is very provocative and requires further investigation. Biochemically speaking, p53 is a potent DNA-binding protein that works as a tetramer to bind a 4-repeat DNA sequence (a 20 mer consensus made of two half sites with two palindromic repeats per half site).

Our analysis of the overlap between the PINCR-regulated transcriptome identified by microarrays and the list of p53-regulated genes identified in the p53 GRO-seq paper (Allen et al., 2014) indicates that PINCR regulates the mRNA levels of only 11 p53 targets. This result is consistent with our additional data (Figure 1—figure supplement 5) showing that PINCR is expressed at ~25 molecules per HCT116 cell after DNA damage. A lncRNA expressed at ~25 molecules per cell is most likely not to regulate hundreds of p53 targets, unless it regulates p53 itself, which is not the case, as shown in Figure 4—figure supplement 1B.

How is this activity modified by RNA and/or a RNA-binding protein at some DNA elements but not others?

This is an important question that was also raised by Reviewer # 3.

To address this point, we have added new data (Figure 7, Figure 7—figure supplement 1 and 2 and Figure 8E). Briefly, we found that Matrin 3 associates with the enhancers of BTG2, GPX1 and RRM2B and this interaction is mediated by the binding of PINCR to Matrin 3. In addition, using published Hi-C data and ChIP- seq data for CTCF, RAD21, H3K4Me3, H3K27ac and p53, we provide evidence of chromatin looping between the enhancer region and p53RE in the promoter region of BTG2, GPX1 and RRM2B. As a control, Matrin 3 and PINCR do not associate with the p21 promoter. Accordingly, we made changes in the text as described below.

“Given the evidence that Matrin 3 associates with enhancer regions (Skowronska-Krawczyk et al., 2005), we reasoned that Matrin 3 modulates the induction of these genes by binding to their enhancer regions. […] These results indicate a role of Matrin 3 and PINCR in facilitating the association of p53 with the enhancers of specific p53 targets BTG2, GPX1 and RRM2B and provide evidence of chromatin looping between the enhancers and promoters of these genes (Figure 7E).”

Interestingly, when we looked at the sequence in the peaks of these enhancer regions, we were unable to find a canonical p53RE indicating indirect binding of p53.

“Finally, we examined the association of PINCR-S1 with the p53RE and enhancer regions of PINCR targets in the presence and absence of p53 or Matrin 3. […] On the other hand, the observed loss in association of PINCR-S1 to the enhancers and promoters upon knockdown of Matrin 3 indicates that Matrin 3 recruits PINCR-S1 to these regions.”

This is very tantalizing and hard to comprehend. In vitro protein-DNA binding experiments should be performed to investigate this. The genome-wide requirement for PINCR and Matrin should be defined. Is it true that only 11 p53 targets require PINCR?

Our analysis of the overlap between the PINCR-regulated transcriptome identified by microarrays and the list of p53-regulated genes identified in the p53 GRO-seq paper (Allen et al., 2014) indicates that PINCR regulates the mRNA levels of only 11 p53 targets. This result is consistent with our additional data (Figure 1—figure supplement 5) showing that PINCR is expressed at ~25 molecules per HCT116 cell after DNA damage. A lncRNA expressed at ~25 molecules per cell is most likely not to regulate hundreds of p53 targets, unless it regulates p53 itself, which is not the case, as shown in Figure 4—figure supplement 1B.

If so, is it true that PINCR regulates p53 binding at only those 11 loci? Is it true that PINCR binds only to those p53 target loci? What about Matrin? What is Matrin's binding pattern relative to p53 target genes, those sensitive and insensitive to PINCR?

One approach to address this question is by identifying genome-wide binding sites of p53, Matrin 3 and PINCR-S1. As suggested by the reviewers in the decision letter, we did not perform the Matrin 3 ChIP-seq or PINCR-S1 ChIP-seq experiments during the revision. However, our data (Figure 6C and Figure 8D) shows that Matrin 3 and PINCR associate specifically with the p53RE of BTG2, RRM2B and GPX1 but not the p53RE of p21.

These questions should be answered with careful ChIP-seq experiments for p53, PINCR-S1 and Matrin, and a detailed investigation of this 'gene-specific effects'. This is important, because the latest and most comprehensive investigations of p53 functionality at enhancers indicate that p53 does not employ cofactors to recognize and activate transcription from ~1000 enhancers in a wide variety of contexts (see for example Verfaillie et al., Genome Research 2016). This notion is further supported by earlier work demonstrating that p53 can recognize its p53REs in nucleosomal context, often leading to nucleosome displacement.

As mentioned above, we did not conduct the ChIP-seq for Matrin 3 and PINCR- S1 during the revision. As requested by the reviewers, we performed p53 ChIP-seq in biological duplicates from PINCR-WT and PINCR-KO cells ± 5-FU. Unfortunately, in the first replicate there was too much background binding of p53 in one sample. In the second set, we observed specific p53 ChIP-seq peaks for only 41 among the 198 p53 targets identified in the p53 GRO-seq paper (Allen et al., 2016). Given this lack of significant overlap with well-established p53 target database and the fact that this data was from a one-time experiment, we believe that the p53 ChIP-seq experiments will need further optimization and we plan to investigate this in the future.

3) DNA- versus RNA-dependent effects of PINCR. The authors conclude that PINCR acts by a RNA-dependent mechanism. However, this is based mostly on an unsatisfactory rescue overexpression experiment in PINCR knockout cells. This is important, because the field has been profoundly misled by earlier reports of another p53-inducible lncRNA, lincRNA-p21, which was first described to be acting by an RNA-dependent mechanism, yet now is ample clear that the lincRNA-p21 locus acts by a DNA-dependent, enhancer-like mechanism (see latest work from John Rinn's team in Cell Reports, backtracking on his original Cell paper by Huarte et al). To clarify this for PINCR, the authors should elaborate more on their knockout. What exact region of the genome did they delete when they deleted the 'entire PINCR region'? Did they delete the proximal p53 binding site as well? If they preserved the p53 enhancer, they should demonstrate that p53 binding to that region is intact by ChIP.

We agree with the reviewer’s concern. To address the concern on the rescue experiment, we have added new data (Figure 4D-4F, Figure 4—figure supplement 5 and 6, Figure 3—figure supplement 24) showing that PINCR knockdown using antisense oligos in HCT116 or knocking out PINCR in another CRC line SW48 cells, has phenotypes similar to PINCR-KO HCT116 cells. Accordingly, we have made changes in the text as described below:

“To make sure that the altered induction of BTG2, GPX1 and RRM2B reflect a function of the PINCR transcript itself, we measured the induction of these genes after PINCR knockdown using antisense oligonucleotides (ASOs).[…] Taken together, the results from PINCR knockdown experiments corroborates our findings from the PINCR-KO clones.”

“Next, to determine if the observed phenotypes are not restricted to HCT116, we knocked out PINCR in SW48 cells (Figure 3—figure supplement 2A and B). […] Moreover, following extended treatment with 5- FU, the PINCR-KO clone was markedly more sensitive than PINCR-WT clones (Figure 3 —figure supplement 4). These data confirm that the phenotypic effects observed upon loss of PINCR are not unique to HCT116.”

To address the reviewer’s comment on the concern on the region of the genome that we deleted, we now show this deleted region (Figure 2—figure supplement 1). As shown in this figure, based on Sanger sequencing data, out of the 2 PINCR-KO clones used in our study, one clone (PINCR-KO#2) has intact p53RE whereas the other clone (PINCR-KO#1) has partially intact p53RE.

As suggested by the reviewer, we checked the binding of p53 to the p53RE of PINCR in both PINCR- KO clones and found that p53 binding was abrogated in the KO clone that had a partially intact p53RE.

Other concerns:

1) Repeats and error bars in 2B.

As suggested, we have repeated this experiment to generate error bars (Figure 1—figure supplement 2A).

2) Is PINCR upregulated in published GRO-seq data in HCT116 cells? It is unclear which ncRNA in Allen et al. the authors refer too. Is it refereed by a different name in Allen et al?

PINCR was not identified in the published GRO-seq data in HCT116 cells. The reference Allen et al. in the original submission was cited to determine how many genes in our lncRNA arrays were also identified in the p53 GRO-seq paper.

A genome viewer screenshot will go a long way to show that PINCR is truly a direct p53 target is truly direct.

Genome viewer screenshot of p53 ChIP-seq data (Figure 1C), the sequence of the p53RE (Figure 1—figure supplement 2B) and our data (Figure 1D-F) indicate that PINCR is a direct target of p53. In addition, as suggested by reviewer # 2, we have now deleted the p53RE in the PINCR promoter and performed luciferase assays. As shown in Figure 1F, deletion of the p53RE resulted in marked reduction in luciferase activity under basal conditions and after DNA damage. Collectively, our data shows that PINCR is a direct target of p53.

3) Raw cell cycle profiles for 3B-C.

We have added these profiles (Figure 2—figure supplement 3). Please note that 3B-C in the original submission is Figure 2B-C in the revised manuscript.

4) To confirm that PINCR is involved in p53-dependent G1 arrest, they should repeat the experiments they did with genotoxic agents using Nutlin instead.

As suggested by the reviewer, we performed cell cycle analysis from PINCR-WT and PINCR-KO cells after Nutlin treatment. Results from this experiment are shown in Figure 2—figure supplement 5 and incorporated in the text, as described below.

“To confirm that PINCR is involved in p53-dependent G1 arrest, we performed cell cycle analysis from PINCR- WT and PINCR-KO cells after Nutlin-3 treatment. […] These data indicate that PINCR plays a role in p53-dependent G1 arrest and it has a prosurvival function in response to DNA damage”.

Reviewer #2:

[…] 1) Since this is the first functional analysis of PINCR, additional basic characterization of the lncRNA is important. The authors should confirm the 5'/3' ends and splicing of the transcript by RACE and RT-PCR.

This is a very important point. We have added new data (Figure 1—figure supplement 3 and Figure 1—figure supplement 4) to address this point. These results are described in the last paragraph of the subsection “PINCR is a nuclear lncRNA directly regulated by p53” and below.

As mentioned in the decision letter, we did not perform RACE. To identify the 5’ and 3’ends of the PINCR RNA, we analyzed our RNA-seq data from HCT116 cells (Li et al., unpublished). We found that the 5’and 3’end of the PINCR RNA matched the annotated transcript (Figure 1—figure supplement 3A). Interestingly, the reads from the first exon were substantially higher than the reads from the last exon which may be due to 3’ to 5’ degradation of this lncRNA, as recently reported for other lncRNAs (Schlackow et al., 2017). Finally, to determine the length of the PINCR transcript, we performed RT-PCR using a forward primer at the start of exon 1 and reverse primer complementary to the last exon (exon 6). As a positive control, we used pCB6-PINCR, a mammalian expression construct in which the full-length annotated PINCR RNA (~2.2 kb) was inserted into pCB6. Because the reverse primer at the end of the annotated last exon did not work even for pCB6-PINCR, we had to use an alternative reverse primer that started at position 1864 of the annotated ~2.2 kb long PINCR RNA. As shown in (Figure 1—figure supplement 4), we found two closely migrating bands that matched the expected size of the amplicon (~1.8 kb).

The copy number of the expressed transcript should be determined (e.g. +/- Nutlin, DOXO, and/or 5-FU).

To estimate the number of molecules of PINCR per cell, we compared the FPKM of PINCR with the lncRNA NORAD, known to be expressed at 500-1000 molecules per HCT116 cell (Lee et al., 2016). This analysis indicated that PINCR is expressed at ~13-26 molecules per HCT116 cell after DNA damage and less than 1 molecule per cell without DNA damage (Figure 1—figure supplement 5A-C). As an alternative approach, we performed qRT-PCR using in vitrotranscribed PINCR RNA and DOXO-treated HCT116 total RNA, and found that PINCR is expressed at ~27 molecules per HCT116 cell after DNA damage (Figure 1—figure supplement 5D). These results are described in the second paragraph of page 6 of the revised manuscript.

A northern blot would be helpful if possible to confirm the existence of a discrete transcript at the expected size.

We tried the Northern blot from HCT116 (DOXO-treated) total RNA but it did not work. This is not surprising given our finding that PINCR is expressed at only ~25 molecules per HCT116 cell.

The conservation pattern of the transcript and p53 response element should be commented upon.

As suggested by the reviewer, we performed conservation analysis (Figure 1—figure supplement 6). We found that the PINCR promoter including the p53RE, mature PINCR transcript and the transcription start site are well conserved among primates but poorly conserved between human and mouse.

2) The use of genome editing to stably delete PINCR is a good approach to establish a robust system for functional studies. However, the authors chose to delete a ~50 kb segment to remove the lncRNA which raises concerns regarding whether other important sequences were removed in addition to the 2.2 kb spliced PINCR sequence. I appreciate the authors' attempts to mitigate these concerns by performing a rescue experiment but the analysis of rescued cells does not go nearly far enough. Cell cycle analysis of rescued cells should be shown in addition to the provided analysis of cell survival after DOXO treatment (Figure 3E). The clonogenic survival assays (Figure 3G) should also be performed on rescued cells. Likewise, cell cycle, cell survival, and clonogenic survival of rescued cells after 5-FU treatment should be added to Figure 4A-F.

We have added the cell cycle analysis of the rescued cells. Reintroduction of PINCR in PINCR-KO cells significantly rescues the sub-G1 population but not the G1 arrest (Figure 2E and Figure 2—figure supplement 3B). The incomplete rescue (rescue of cell death but not G1 arrest) may be because unlike endogenous PINCR that is induced ~100-fold after DOXO-treatment, the extent of exogenous PINCR overexpression was ~40-fold. Another possibility is that in the rescue experiments, we overexpressed the annotated isoform whereas we found that HCT116 cells express at least 2 isoforms of PINCR (Figure 1—figure supplement 4). Overall, the results from these rescue experiments indicate that the observed cell death phenotype after DOXO treatment of PINCR-KO cells was due to loss of PINCR RNA.

We would like to mention that in the interest of time, we did not perform the clonogenic survival assays and other suggested experiments with 5-FU. Instead, as shown below and as suggested in the decision letter, we addressed these issues using an orthogonal method in which we knocked down PINCR.

Any concerns about the genome editing approach could be fully mitigated if the authors employed an orthogonal method to inhibit PINCR such as siRNA knockdown or CRISPRi, followed by analysis of cell cycle, survival, clonogenic growth, and target gene induction (e.g. BTG2, GPX1, RRM2B).

This is an excellent point. As suggested by the reviewers in the decision letter, we have now examined the cell cycle, survival, clonogenic growth and target gene induction after knockdown of PINCR RNA. In collaboration with Ionis Pharmaceuticals, we tested 5 antisense oligos (ASOs) that target PINCR RNA. We achieved robust knockdown with only one ASO designated as PINCR-ASO. We have added the data from these experiments (Figure 4D-F, Figure 4—figure supplement 5s and 6) and made changes in the text as described below:

“To make sure that the altered induction of BTG2, GPX1 and RRM2B reflect a function of the PINCR transcript itself, we measured the induction of these genes after PINCR knockdown using antisense oligonucleotides (ASOs). […] Taken together, the results from PINCR knockdown experiments corroborates our findings from the PINCR-KO clones.”

3) While p53-mediated PINCR induction was demonstrated in multiple cell lines, all functional analyses are limited to HCT116. PINCR should be knocked out or inhibited in a second cell line to confirm that the phenotypic effects observed are not unique to HCT116.

This is an important point. As suggested by the reviewer, we knocked out PINCR in another CRC line (SW48 cells) to confirm that the phenotypic effects observed are not unique to HCT116. We found that loss of PINCR in SW48 cells results in reduced G1 arrest, increased apoptosis and reduced clonogenicity in response to 5-FU. Accordingly, we made changes in the text as described below:

“Next, to determine if the observed phenotypes are not restricted to HCT116, we knocked out PINCR in SW48 cells (Figure 3—figure supplement 2A and 2B). […] These data confirm that the phenotypic effects observed upon loss of PINCR are not unique to HCT116.”

4) Knockdown of Matrin 3 partially phenocopies PINCR knockout with respect to cell survival after 5-FU treatment (Figure 6F). As this is a very important prediction of their model, the analysis of Matrin 3 knockdown should be extended. First, at least 2 independent siRNAs should be tested to avoid off-target effects (this is especially important when monitoring general cellular phenotypes such as survival). Furthermore, the cell cycle should be examined after knockdown of Matrin 3 and 5-FU treatment and both cell cycle and apoptosis should be examined after DOXO treatment.

We agree with the reviewer’s comment. As suggested, we now provide evidence with 2 independent Matrin siRNAs, that knockdown of Matrin 3 (Figure 5E and Figure 5—figure supplement 1C) results in increased cell death in PINCR-WT cells but not in PINCR-KO cells after 5-FU treatment (Figure 5F). However, the effect on G1 arrest was consistently observed (Figure 5—figure supplement 2A) with only one siRNA (siMatrin 3-I). Cell cycle analysis in response to DOXO-treatment showed that knockdown of Matrin 3 resulted in increased sub-G1 population (Figure 5—figure supplement 2C) but the effect on G1 arrest was not the same for both siRNAs (Figure 5—figure supplement 2B). Raw cell cycle profiles from a representative experiment are shown in Figure 5—figure supplement 3.

These data suggest that Matrin 3 mediates the anti-apoptotic effect of PINCR in response to DNA damage induced by 5-FU or DOXO. Furthermore, in PINCR-WT but not in PINCR-KO cells, silencing Matrin 3 resulted in less or no induction of the PINCR targets BTG2, GPX1 and RRM2B (Figure 5G) after 5-FU treatment.

5) What happens to the Matrin-p53 interaction in PINCR KO cells? Co-IP assays (as in Figure 7A-B) should be performed in these cells.

As suggested by the reviewer, we performed the p53-Matrin 3 Co-IP experiment. We found no difference in the amount of p53 pulled down in the Matrin 3 IP material between PINCR-WT and PINCR-KO cells (Author response image 3). This result is consistent with our data (Figure 6B) where we found that the p53-Matrin 3 interaction is RNA-independent.

Author response image 3
PINCR-WT and PINCR-KO HCT116 cells were treated with 5-FU for 48 hr and the interaction between p53 and Matrin 3 was assessed by immunoblotting for p53 following IgG or Matrin 3 IP.
https://doi.org/10.7554/eLife.23244.070

Likewise, does PINCR associate with p53 response elements in the absence of Matrin and/or p53? The experiments in Figure 7I should be repeated after Matrin and p53 knockdown.

Great suggestion. As suggested, we examined the association of PINCR-S1 with the p53RE and enhancer regions of PINCR targets in the presence and absence of p53 or Matrin 3. To do this, we knocked down p53 (Figure 8—figure supplement 5) or Matrin 3 with siRNAs and performed streptavidin pulldowns. As compared to the p53RE in the PINCR target gene promoters, in CTL siRNA transfected cells treated with 5-FU, we found stronger association of PINCR-S1 with the enhancers of the PINCR targets (Figure 8E). Silencing Matrin 3 or p53 resulted in dramatic reduction in the association of PINCR-S1 with these enhancers and p53REs (Figure 8E). Because p53 is important for PINCR expression, it is likely that the reduced association of PINCR-S1 to these regions after p53 knockdown is due to lack of PINCR expression. On the other hand, the observed loss in association of PINCR-S1 to the enhancers and promoters upon knockdown of Matrin 3 indicates that Matrin 3 recruits PINCR-S1 to these regions.

6) While the observation that p53-mediated induction of BTG2, GPX1, and RRM2B is attenuated in PINCR KO cells and after Matrin 3 knockdown is interesting, there is no evidence that these changes in gene expression are responsible for the impaired p53-mediated cell cycle arrest and apoptosis in PINCR KO cells. Does knockdown of any of these targets phenocopy PINCR KO?

This point was also raised by reviewer #1. To address this point we have added new data (Figure 4—figure supplement 3 and Figure 4—figure supplement 4). We indeed found that depletion of BTG2, GPX1 or RRM2B using siRNAs, recapitulates the effects of PINCR depletion in response to 5-FU treatment. Accordingly, we made changes in the text, as described below.

“We next asked the question if depletion of the PINCR targets BTG2, GPX1 and RRM2B recapitulated the effects of PINCR depletion. […] These data indicate that depletion of BTG2, GPX1 or RRM2B recapitulates the effects of PINCR depletion in response to 5-FU treatment.”

Does overexpression of any of these genes rescue PINCR KO?

As mentioned in our initial response, we could have attempted this experiment but in the interest of time and given that overexpression of some of these genes in the absence of DNA damage is known to induce cell cycle arrest, we were unable to perform this experiment during the revision of our study.

7) The p53-RE luciferase assays in Figure 2E would be much more convincing if a reporter with mutations in the p53-RE were tested in parallel as a negative control.

As suggested, in the revised manuscript, we performed luciferase assays after deleting the p53RE in the luciferase reporter carrying the PINCR promoter. As shown in Figure 1F, we found that deletion of the p53RE in the PINCR promoter resulted is profound reduction in luciferase activity, both in the absence and presence of DOXO.

8) In Figure 7—figure supplement 1C, it appears that the polyadenylation signal was removed when the S1 tag was inserted (at the end of the red sequence). Does this affect the level of PINCR expression? Although the authors show PINCR-S1 induction after DOXO treatment, PINCR-S1 levels should be directly compared to endogenous PINCR.

This is a very interesting point. The reviewer is correct. The potential polyadenylation signal was removed when the S1 tag was inserted. We call this as a potential polyadenylation signal because according the RefSeq annotation, PINCR is not a polyadenylated lncRNA but this needs to be confirmed in future experiments. As suggested by the reviewer, we compared PINCR-S1 levels to endogenous PINCR by qRT-PCR (normalized to GAPDH) in PINCR-S1 HCT116 cells and in parental HCT116 cells. We found that PINCR-S1 is expressed at levels similar to PINCR (Figure 8—figure supplement 3C). These data indicate that insertion of the S1-tag does not affect PINCR expression.

Reviewer #3:

[…] 1) Figure 4. In view of the suggested biology of PINCR, one might expect it to be

selectively LESS induced under conditions that favor p53-dependent cell death. What happens, for example, upon treatment of HCT116 cells with high dose 5-FU? As a matter of fact, the data in Figure 4 and its supplemental already point in this direction: 5-FU, at the concentration used by the authors, induces more apoptosis (11%) than the other treatments, while causing a relatively modest increase in PINCR. Thus, the relative extent of endogenous PINCR induction might be a determinant of the likelihood of the cells to die rather than arrest. I suggest that the authors address this possibility more closely, e.g. by employing several different concentrations of 5-FU and comparing the extent of PINCR induction, induction of a typical pro-apoptotic p53 target gene (e.g. PUMA or CD95), and the accrual of sub-G1 cells.

This is a very interesting point. As suggested, we treated the cells with several different concentrations of 5-FU and measured the induction of PINCR and PUMA. As shown in Figure 3—figure supplement 5A, both PINCR and PUMA are induced ~10-14-fold after treatment of PINCR-WT cells with 0, 10, 50, 100 or 375 μm of 5-FU. The sub-G1 cells for this range of 5-FU was 0, 3, 8, 14 and 43% in PINCR-WT cells and 0, 9, 17, 34 and 83% in PINCR-KO cells (Figure 3—figure supplement 5B). In addition, at each dose of 5-FU, the% of cells arrested in G1 was smaller in PINCR-KO cells as compared to PINCR-WT cells (Figure 3—figure supplement 5B). Based on these data, it appears that the relative extent of endogenous PINCR induction may not be a determinant of the likelihood of the cells to die rather than arrest.

2) Figure 4G. The in vivo result is impressive. However, it does not necessarily support a pro-survival function of PINCR as concluded in the subsection “PINCR loss results in hypersensitivity to 5-FU and decreased tumor growth”: the authors did not address survival/death at all in this experiment. It will be important to perform histopathological examination of the tumors, and show (by cleaved caspase 3 or TUNEL) that the PINCR KO tumors indeed manifest a greater extent of apoptosis.

This is an important point. As suggested, we performed immunohistochemical staining of the tumors for the proliferation marker Ki67 and the apoptosis marker cleaved caspase-3 (Figure 3—figure supplement 7). We found that both PINCR-WT and PINCR-KO tumors had a high proportion of Ki67- positive cells (>50%) and a very low proportion of cleaved caspase-3-positive cells (<1%). As compared to PINCR-WT tumors, the PINCR-KO tumors had significantly decreased Ki67-positive cells (Figure 3—figure supplement 7A), suggesting that the observed reduced tumor volume is due to inhibition of cell proliferation.

Based on these data, we have accordingly modified the text on page 11. We agree that the in vivo data does not support a pro-survival function of PINCR. However, our in vitro data from 2 CRC cell lines suggests that PINCR has a prosurvival function in response to DNA damage.

3) I could not find any ChIP experiment showing that matrin 3 is required for optimal binding of p53 to the p53RE's of BTG2 etc. Did I miss it? This is an important experiment, as the authors attribute the reduced expression of those genes to reduced recruitment of p53 to their p53RE's.

We agree with the reviewer. In the revised manuscript, we show that the binding of p53 to the p53RE element of BTG2, GPX1 and RRM2B is not affected after knockdown of Matrin 3 (Figure 6D and Figure 6—figure supplement 2). This was a surprising result. However, our analysis of the enhancer region of these genes and potential chromatin looping between their promoter and enhancer regions indicates that Matrin 3 may regulate these genes not by controlling p53 binding at their promoters but by modulating their expression after 5-FU treatment by associating with their enhancer regions (Figure 7 and Figure 7—figure supplements 1 and 2).

4) Why does PINCR bind only to a subset of p53RE's? Is there significant homology between the sequence of PINCR and that of the DNA in the vicinity of those p53RE's, but not the p21 p53RE for example?

This is a very interesting question. We did not find significant homology between the PINCR RNA and the DNA in the vicinity of the p53RE of BTG2, GPX1 and RRM2B. Our data indicates that PINCR binds to Matrin 3 and after binding to Matrin 3, PINCR is recruited to the p53RE of these genes but not the p21 p53RE as shown in Figure 6B and Figure 6—figure supplement 1B. This is further supported by our data showing PINCR does not associate to these p53REs upon Matrin 3 knockdown (Figure 8E).

5) Figure 3D-E: How does PINCR overexpression affect the cell cycle profile and the expression of the specific subset of G1-related genes without and with DNA damage? Is PINCR overexpression alone sufficient to upregulate those genes?

Another great suggestion. We found that PINCR overexpression has no effect on the expression of BTG2, GPX1 and RRM2B, without and with DNA damage induced by 5-FU (Figure 8—figure supplement 4). In addition, there was no effect on cell cycle profile after PINCR overexpression (Figure 3—figure supplement 6B and C). Thus, our data indicates that PINCR overexpression alone is not sufficient to upregulate those genes. PINCR functions under conditions that upregulate p53, such as Nutlin treatment or DNA damage induced with DOXO or 5-FU.

6) Figure 7A: What happens to matrin 3 after DNA damage? Do its levels increase? Does it become more localized to the nucleus?

As suggested, we measured total Matrin 3 protein levels and nuclear and cytoplasmic Matrin 3 protein levels in HCT116 cells, in untreated condition and after DNA damage induced by 5-FU. We found no change in total, nuclear or cytoplasmic Matrin 3 levels in response to DNA damage (Figure 5—figure supplement 5A and B).

7) Does PINCR regulate its own expression after DNA damage?

To determine if PINCR regulates its own expression after DNA damage, we introduced exogenous PINCR (using pCB6-PINCR) in PINCR-S1 cells and treated the cells with 5-FU. Using PINCR-S1-specific primers, we found that PINCR overexpression had no effect on PINCR-S1 levels (Figure 8—figure supplement 4A).

Does PINCR knockout affect the binding of p53 to the PINCR promoter?

Based on Sanger sequencing data, we found that out of the 2 PINCR-KO clones used in our study, one clone (PINCR-KO#2) has intact p53RE whereas the other clone (PINCR-KO#1) has partially intact p53RE. The DNA sequence showing the exact region of the genome that was deleted is shown in Figure 2—figure supplement 1. As suggested, we checked the binding of p53 to the p53RE of PINCR in both PINCR-KO clones and found that p53 binding was abrogated in the KO clone that had a partially intact p53RE (Figure 2—figure supplement 2).

8) Figure 7C. Does matrin 3 bind those promoters also without DNA damage, or is it recruited only after DNA damage?

It depends on the gene. As shown in Figure 6C, in untreated cells, Matrin 3 binds to the p53RE of BTG2 and RRM2B but not GPX1. The binding of Matrin 3 to all these 3 p53REs is increased after DNA damage (Figure 6C).

9) Does matrin 3 affect the induction of BTG2 etc. in response to Nutlin, or is this DNA damage-specific?

Our new data (Figure 5—figure supplement 4) shows that Matrin 3 regulates the induction of PINCR targets in response to Nutlin treatment as well.

https://doi.org/10.7554/eLife.23244.076

Article and author information

Author details

  1. Ritu Chaudhary

    Regulatory RNAs and Cancer Section, Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    RC, Conceptualization, Writing—original draft, Writing—review and editing
    Competing interests
    The authors declare that no competing interests exist.
  2. Berkley Gryder

    Oncogenomics Section, Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    BG, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  3. Wendy S Woods

    Department of Bioengineering, University of Illinois at Urbana-Champaign, Urbana, United States
    Contribution
    WSW, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  4. Murugan Subramanian

    Regulatory RNAs and Cancer Section, Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    MS, Validation
    Competing interests
    The authors declare that no competing interests exist.
  5. Matthew F Jones

    Regulatory RNAs and Cancer Section, Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    MFJ, Investigation
    Competing interests
    The authors declare that no competing interests exist.
  6. Xiao Ling Li

    Regulatory RNAs and Cancer Section, Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    XLL, Validation
    Competing interests
    The authors declare that no competing interests exist.
  7. Lisa M Jenkins

    Laboratory of Cell Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    LMJ, Validation, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  8. Svetlana A Shabalina

    National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, United States
    Contribution
    SAS, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  9. Min Mo

    Laboratory of Gene Regulation and Development, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, United States
    Contribution
    MM, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  10. Mary Dasso

    Laboratory of Gene Regulation and Development, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, United States
    Contribution
    MD, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  11. Yuan Yang

    Laboratory of Cancer Biology and Genetics, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    YY, Investigation
    Competing interests
    The authors declare that no competing interests exist.
  12. Lalage M Wakefield

    Laboratory of Cancer Biology and Genetics, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    LMW, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  13. Yuelin Zhu

    Molecular Genetics Section, Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    YZ, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  14. Susan M Frier

    Ionis Pharmaceuticals, Carlsbad, United States
    Contribution
    SMF, Resources
    Competing interests
    The authors declare that no competing interests exist.
  15. Branden S Moriarity

    Department of Pediatrics, Masonic Cancer Center, University of Minnesota, Twin Cities, United States
    Contribution
    BSM, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  16. Kannanganattu V Prasanth

    Department of Cell and Developmental Biology, University of Illinois at Urbana-Champaign, Urbana, United States
    Contribution
    KVP, Resources, Validation
    Competing interests
    The authors declare that no competing interests exist.
  17. Pablo Perez-Pinera

    Department of Bioengineering, University of Illinois at Urbana-Champaign, Urbana, United States
    Contribution
    PP-P, Methodology, Writing—review and editing
    Competing interests
    The authors declare that no competing interests exist.
  18. Ashish Lal

    Regulatory RNAs and Cancer Section, Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, United States
    Contribution
    AL, Conceptualization, Writing—original draft, Writing—review and editing
    For correspondence
    ashish.lal@nih.gov
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon 0000-0002-4299-8177

Funding

National Cancer Institute (NIH IRP)

  • Ashish Lal

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Tom Misteli, Glenn Merlino, Susan Gottesman, Shiv Grewal, Curtis Harris and Javed Khan for their critical comments on the manuscript and Bert Vogelstein for the isogenic cell lines. This research was supported by the Intramural Research Program (AL, LW, LMJ) of the National Cancer Institute (NCI), Center for Cancer Research (CCR), NIH. KVP lab is supported by grants from NIH [GM088252] and American Cancer Society [RSG-11-174-01-RMC].

Ethics

Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All animal studies were conducted under protocol LC-070 approved by the Animal Care and Use Committee of the National Cancer Institute, The Frederick National Laboratory and the Center for Cancer Research are accredited by AALAC International and follow the Public Health Service Policy for the Care and Use of Laboratory Animals.

Reviewing Editor

  1. Joaquín M Espinosa, Reviewing Editor, University of Colorado School of Medicine, United States

Publication history

  1. Received: November 12, 2016
  2. Accepted: May 20, 2017
  3. Accepted Manuscript published: June 5, 2017 (version 1)
  4. Version of Record published: June 14, 2017 (version 2)

Copyright

This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.

Metrics

  • 1,539
    Page views
  • 411
    Downloads
  • 7
    Citations

Article citation count generated by polling the highest count across the following sources: Scopus, Crossref, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

  1. Further reading

Further reading

    1. Cancer Biology
    2. Structural Biology and Molecular Biophysics
    Warintra Pitsawong et al.
    Research Article
    1. Cancer Biology
    2. Immunology and Inflammation
    Thornton W Thompson et al.
    Research Article Updated