Complex chromosomal neighborhood effects determine the adaptive potential of a gene under selection
Abstract
How the organization of genes on a chromosome shapes adaptation is essential for understanding evolutionary paths. Here, we investigate how adaptation to rapidly increasing levels of antibiotic depends on the chromosomal neighborhood of a drug-resistance gene inserted at different positions of the Escherichia coli chromosome. Using a dual-fluorescence reporter that allows us to distinguish gene amplifications from other up-mutations, we track in real-time adaptive changes in expression of the drug-resistance gene. We find that the relative contribution of several mutation types differs systematically between loci due to properties of neighboring genes: essentiality, expression, orientation, termination, and presence of duplicates. These properties determine rate and fitness effects of gene amplification, deletions, and mutations compromising transcriptional termination. Thus, the adaptive potential of a gene under selection is a system-property with a complex genetic basis that is specific for each chromosomal locus, and it can be inferred from detailed functional and genomic data.
https://doi.org/10.7554/eLife.25100.001Introduction
In the process of regulatory evolution, a finite set of genes are continuously combined to form new gene expression patterns and create a myriad of phenotypes (Carroll, 2000; Wittkopp et al., 2004; Wray, 2007). Acquiring mutations that increase the expression of a single gene can be sufficient to make an individual substantially fitter than its competitors. For example, increased expression of drug target or efflux genes is a common mechanism for the evolution of resistance to antibiotics (Li et al., 2015; Palmer and Kishony, 2014), chemotherapeutics (Cole et al., 1992), and insecticides (Devonshire and Field, 1991; Coderre et al., 1983). Increased expression of individual genes also provides access to new nutrient resources (Notebaart et al., 2014) and tolerance to diverse toxins (Soo et al., 2011). The fitness effect of increased expression of individual genes has mostly been determined in plasmid-based overexpression libraries (Notebaart et al., 2014; Soo et al., 2011). However, the large majority of genes reside on chromosomes, neighboring other genes, and thus mutations affecting gene expression occur in a specific chromosomal context. Unequal mutation rates along the genome (Foster et al., 2013; Anderson and Roth, 1981) imply that the chromosomal location can affect the adaptive potential of a gene, that is, the probability that adaptive mutations increasing expression of the gene will spread in a population under given selective conditions.
Adaptation by increased gene expression can result from mutations of different types (Blank et al., 2014; Lind et al., 2015): point mutations, promoter insertion by mobile elements (Mahillon and Chandler, 1998; Ellison and Bachtrog, 2013; Stoebel et al., 2009), promoter capture by chromosomal rearrangements (ar-Rushdi et al., 1983; Blount et al., 2012; Xiao et al., 2008), and gene duplication or amplification, which increases expression by way of gene dosage (Andersson and Hughes, 2009; Elliott et al., 2013). How the rate of mutation of these individual mutation types depends on chromosomal position has in part been determined experimentally (Foster et al., 2013; Hudson et al., 2002; Mahillon and Chandler, 1998; Craig, 1997; Touchon et al., 2009; Anderson and Roth, 1981; Seaton et al., 2012; Wahl et al., 1984). Despite considerable experimental data, we currently lack an understanding of how position biases of the different mutation types together combine across different chromosomal loci, and therefore, how the chromosomal context of a gene under selection affects overall adaptation.
Here, we investigate how the complex interplay of different mutation types and mutation rate biases gives rise to an effect of chromosome position on adaptation in Escherichia coli. To this end, we use a single chromosomal drug resistance gene as the target of selection and a two-color fluorescence reporter readout for adaptive mutations in evolution experiments. We quantify the effect of the chromosomal position of the selected gene on adaptation and identify the mutation types underlying this effect. We find that a strong effect of chromosome position on adaptation is largely explained by rate differences of gene duplications and fitness effect differences of two types of promoter co-opting mutations (promoter capture deletions and mutations that cause read-through across upstream transcriptional terminators). Both the observed rate differences and fitness effect differences depend on simple features of the chromosomal neighborhood of the gene under selection. This suggests that the adaptive potential of a gene can be estimated by looking for respective features of chromosomal neighborhoods in genomics data. Based on these results, we propose that the chromosomal context of a gene under selection is an important factor in adaptation.
Results
A dual-fluorescence reporter cassette for tracking the dynamics of adaptive mutations of different types
We devised an evolution experiment with E. coli, in which we use a single target of selection embedded in a genetic cassette that serves as a reporter of adaptive potential and mutation types. The reporter cassette can be inserted at any chromosomal position (Figure 1A and Figure 1B), and it allows us to distinguish amplifications from other adaptive mutations in real-time using two-color fluorescence measurements. The reporter cassette contains a promoterless, translational tetA-yfp gene fusion followed by a transcriptional terminator and a constitutively expressed cfp gene. Mutations that increase expression of the tetracycline efflux pump TetA-YFP can be selected with antibiotic and monitored through YFP fluorescence (Figure 1C, left). Due to the immediate proximity of the tetA-yfp and cfp genes, the large majority of tetA-yfp amplifications are expected to contain the cfp gene as well. Thus, adaptation by reporter cassette amplification is expected to be distinguishable from other up-mutations by a fluorescence increase of both YFP and CFP (Figure 1C, right). We integrated the reporter cassette at four different intergenic loci (A, B, C, and D) along the chromosome of an E. coli ΔtolC strain (Figure 1A), giving rise to four strains (strain A, B, C, and D). The four loci were chosen to lie in intergenic regions between divergently transcribed genes in order to exclude transcription from upstream genes into the tetA-yfp gene (Figure 1B). Loci A and C are located approximately in the middle of the right and left replichore, respectively. Since we wanted to also include a locus close to the origin of replication, where no pair of divergently oriented genes is present, we chose a locus in the relatively large intergenic region between the co-oriented rsmG and atpI genes (locus D, Figure 1B), a locus previously used for large insertions (Kuhlman and Cox, 2010). Locus B was chosen based on its vicinity to several insertion sequences (IS).

A dual-fluorescence reporter cassette for real-time tracking of adaptive mutations of different types.
(A) Reporter cassette construct for chromosomal insertion. p0 = 188 bp random DNA sequence, RBS = ribosomal binding site, hairpins = transcriptional terminators, tetA-yfp = selected gene, cfp = constitutively expressed amplification reporter. A, B, C, D = intergenic chromosomal insertion loci, oriC = origin of replication. (B) Immediate chromosomal neighborhoods of loci A-D. Black arrows = essential genes. White arrows = non-essential genes. Grey arrows = no essentiality data available. Patterned arrow (yoeD) = pseudogene. Orange = cryptic prophage CP4-44. Green = origin of replication (oriC). Chromosomal neighborhoods of loci B, C, and D are shown reversed with respect to conventional chromosome coordinates, so that the orientation relative to the reporter cassette is shown in the same way for all four loci. Reporter cassette genes are not drawn to scale. (C) Example fluorescence trajectories of rescued populations with YFP or YFP+CFP (amplification) fluorescence phenotype. RFU = relative fluorescence units (see Methods), yellow and blue lines = YFP and CFP fluorescence, dotted lines = threshold for phenotype classification. (D) Increase of tetracycline concentration in ten-day experiment, normalized to strain-specific minimal inhibitory concentration (MIC, dotted line). (E) qPCR validation of CFP fluorescence as an indicator of extent of amplifications. x-axis: tetA-yfp copy number as determined by qPCR on genomic DNA of rescued population with a YFP+CFP fluorescence phenotype. Error bars = SD of technical qPCR triplicates. r is the Pearson correlation coefficient and P its p-value. RFU = relative fluorescence units, line = linear fit.
-
Figure 1—source data 1
Chromosomal coordinates of reporter cassette insertion loci.
- https://doi.org/10.7554/eLife.25100.003
-
Figure 1—source data 2
Source data for Figure 1E.
Mean and standard deviation of chromosomal tetA-yfp copy number (qPCR) and final CFP fluorescence (plate reader data).
- https://doi.org/10.7554/eLife.25100.004
We used a ΔtolC genetic background in order to constrain the spectrum of possible adaptive mutations to the reporter cassette locus. TolC is an outer membrane porin and an essential part of several E. coli multi-drug efflux pumps, which are a frequent target of selection during drug exposure (Li et al., 2015) and which cause low-level intrinsic resistance of E. coli to tetracyclines (Sulavik et al., 2001). By employing daily increasing levels of tetracycline (Figure 1D) and constant daily dilution, we created an experimental evolutionary rescue scenario (Carlson et al., 2014), in which populations of ancestral cells rapidly undergo extinction. Rescue from extinction requires the spread of adaptive mutations activating tetA-yfp expression in a race against population decline.
The probability of evolutionary rescue depends on the size and decline rate of an unadapted population, and on a combination of rate and fitness effect of adaptive mutations (Martin et al., 2013). We chose selective conditions such that the initial population size and decline rate are approximately equal for all strains. In this way, the probability of rescue (estimated by performing a large number of replicate rescue experiments) is expected to be informative about the strain-specific rate and fitness effect of adaptive mutations of all types. Specifically, we adjusted the tetracycline concentrations used in evolution experiments to strain-specific minimum inhibitory concentrations (MICs), which we measured precisely (Figure 1—figure supplement 1). Given the otherwise isogenic background of the strains, we interpret MICs as a proxy for initial expression of tetA-yfp. MIC measurements revealed locus-dependent differences in the initial sensitivity to tetracycline, and all strains showed an increased MIC compared to the cassette-free ancestor, which indicates low baseline expression of tetA-yfp. For evolution experiments, we used tetracycline concentrations starting at 50% of the strain-specific MICs (Figure 1D).
We evolved 95 populations of each strain and measured optical density (OD600) and fluorescence daily. Populations yielding OD600 above a fixed threshold after ten days were regarded as rescued. Rescued populations were assigned to fluorescence phenotypes (YFP or YFP+CFP) based on the increase in fluorescence at the end of the experiment compared to the ancestor (Figure 1C). We performed qPCR on genomic DNA of populations displaying increased CFP fluorescence and found a good correlation between CFP fluorescence and the chromosomal copy number of the tetA-yfp gene (Figure 1E). Thus, CFP fluorescence is a valid proxy for the extent of high level amplification of the reporter cassette.
The chromosomal location of a selected gene has large effects on adaptation
The number of rescued populations differed significantly between strains (Figure 2A), showing that the chromosomal location of the tetA-yfp gene is critical for its adaptive potential. No rescue was observed without the reporter cassette (Figure 2—figure supplement 1), and all rescued populations displayed increased YFP fluorescence, suggesting that rescue depended on the presence and overexpression of tetA-yfp. To test if increased expression of tetA-yfp was indeed causative for rescue, we deleted the reporter cassette genes in single clones isolated from three different rescued populations. Deletions eliminated growth on tetracycline in all three cases (Figure 2B). A minority of populations went extinct despite transiently increased YFP fluorescence (37/290 extinct populations), illustrating how our experimental selection filters for mutations that increase tetA-yfp expression above a minimum level. Two sets of replicate experiments yielded qualitatively similar results (Figure 2C), although the number of rescued populations fluctuated considerably between replicates, which likely reflects both technical variability (for example, in the precise amount of transferred inoculum from day to day) as well as the inherent stochasticity of evolutionary rescue processes. Time-trajectories of OD600 and OD-normalized YFP and CFP fluorescence of all evolved populations are available in Supplementary file 1 and fluorescence phenotype classifications in Supplementary file 2.

Large differences in adaptation by amplification depend on flanking homology in the chromosomal neighborhood.
(A) Numbers of rescued populations by fluorescence phenotype. The numbers of rescued vs. extinct populations and the distribution of fluorescence phenotypes (YFP or YFP+CFP) differ among strains A, B, C, and D (p<10−16 and p<10−7, Fisher’s exact test). (B) The ability of evolved clones to grow on tetracycline depends on the reporter cassette. Pictures show YFP-fluorescence of cultures spotted at different dilutions on solid medium with and without tetracycline (2.25 µg/mL). Top rows: evolved clones sampled from rescued populations of three different strains. Bottom rows: respective deletion mutants lacking reporter cassette genes. In parentheses: position of the sampled populations on 96-well plates in evolution experiments. (C) Numbers of rescued populations by fluorescence phenotype in two additional replicate sets of evolution experiments. (D) IS5 copies flanking locus B promote duplication. Left: Cartoon showing the position of the reporter cassette between two copies of IS5 (distances not drawn to scale, genes in between omitted) and the putative unequal crossing over-event causing initial duplications. Right: The expected amplicon junction is present in amplifications in strain B, but not in the ancestor or in amplifications in strain BΔIS5I. Arrow: junction PCR product obtained with outward facing primers shown as pointers in the cartoon on the left.
Amplification mediated by flanking homology is a main determinant of neighborhood-dependent adaptation
We next set out to identify which mutation types were responsible for locus-dependent differences in the number of rescued populations. Strain B gave the highest number of rescued populations, and 76/77 rescued populations of this strain had reporter cassette amplifications (Figure 2A). Rescue by amplification in the other three strains was rare (Figure 2AC), implying that large differences between strains were related to locus-specific amplification. According to the ‘canonical’ model, formation of amplifications is limited by the rate at which initial duplications are generated (Romero and Palacios, 1997). Rates of spontaneous duplication are elevated between homologous sequences such as rRNA operons or duplicate copies of insertion sequences (IS) due to frequent unequal crossing-over (Anderson and Roth, 1981; Andersson and Hughes, 2009). We found homologous copies of IS5 at either side of locus B (IS5H and IS5I), but no flanking homology in the chromosomal neighborhood of the other three loci. We verified the presence of IS5 at the boundary of the amplicon in rescued B populations by obtaining a PCR product of the expected junction in 16/16 tested clones of evolved populations (PCR products of three populations shown in Figure 2D). The junction was undetectable in the ancestor. Deleting one of the two flanking IS (strain BΔIS5I) gave highly reduced numbers of rescued populations (Figure 2A) and only a minority (3/9) had increased CFP fluorescence, which was not connected to amplification between the IS5H and IS5I (Figure 2D). These results confirm flanking homology and its effect on gene amplification as a main factor of chromosomal neighborhood on adaptation by increased gene expression.
Adaptation involves a broad diversity of mutation types
Given the above result, we expected differences to disappear in the absence of IS and we repeated the evolution experiments with four strains that had the reporter cassette integrated at the same four loci as before, but that are derived from a multiple deletion strain (MDS42) free of all IS elements (Pósfai et al., 2006). MDS42 lacks around 15% of the MG1655 chromosome, including all prophages and many nonessential genes. Apart from the absence of IS-related mutations, the rates of other mutation types in MDS42 are similar to those in MG1655 (Pósfai et al., 2006). Loci A-D are not immediately next to genes absent in MDS42, the chromosomal neighborhood at a larger scale, however, is different between IS-wt and IS-free versions of the strains (Figure 3—figure supplement 1).
Despite the expected absence of frequent amplification of locus B in the IS-free genetic background, the fraction of rescued populations was still different among strains (p=3 × 10−5, Fisher’s exact test), and rescue was observed only in strains B and D (10 and 8 rescued populations, respectively). To explain these remaining differences, we identified candidate rescue mutations in strains with and without IS. Sequencing ~1 kb of DNA upstream of tetA-yfp revealed mutations of different types: point mutations (including small insertions and deletions), larger deletions, and insertions of mobile elements (Figure 3AB and Figure 3—figure supplement 2). The relative contribution of the different mutation types to adaptation differed between different chromosomal loci in both IS-containing and IS-free strains (p=10−9 and p=0.003, Fisher’s exact test). In several cases, mutations co-occurred with other mutations or amplifications (colored dots in Figure 3A), suggesting interactions between mutations, some of which we explored in more depth later (section ‘Chromosomal neighborhood influences adaptation by affecting the fitness cost of amplifications’).

Adaptation involves a broad diversity of mutation types.
Mutation types in rescued populations of IS-wt (A) and IS-free (B) strains. Colored dots = later mutations occurring on top of other mutations (see Methods). Mutation types differ between loci (p=10−9 (A) and p=0.003 (B), Fisher’s exact test). (C–E) Effect of reconstructed point mutations and IS insertions on reporter expression on plasmids. Plasmids contain mutations reconstructed upstream of a ribosomal binding site (not shown) and a yfp reporter gene as shown in cartoons. Empty = auto-fluorescence control (plasmid backbone); p0 = ancestral 188 bp random sequence. Error bars = 95% confidence intervals of six technical replicates. Grey shading: 95% confidence interval of OD600-normalized p0 fluorescence. Asterisks = p<0.05, two-tailed t-test on mean fluorescence difference in comparison with p0. (C) Reporter fluorescence driven by small mutations within p0 (single bp substitutions and small insertions or deletions). Mutation coordinates = distance of mutation to start codon of yfp. Blue bars = mutations that co-occur with amplifications and show overlapping peaks in the sequence chromatogram of evolved clones, indicating presence of mutations only in a subset of copies in an amplification. (D) Reporter fluorescence driven by IS insertions. Plasmids contain the termini of IS which were truncated to 600 bp. 5’ and 3’ refers to the direction of the IS-contained transposase gene. IS2 and IS3 drive strong fluorescence of yfp in the plasmid context; IS1 and IS5 do not. (E) Reporter fluorescence driven by IS in the precise sequence context of p0. IS1, but not IS5, contains a partial promoter whose activity depends on the adjacent sequence in p0. Numbers in parentheses = distance between insertion point and the yfp start codon. ‘rnd’ = random shuffling of 20 bp of p0 downstream of the IS1 insertion point.
-
Figure 3—source data 1
Source data for Figure 3C–E.
OD600-normalized fluorescence values measured in exponential phase (six replicates).
- https://doi.org/10.7554/eLife.25100.012
We then continued to identify the mutation types responsible for the remaining differences in adaptation among strains, independent of neighborhood-dependent amplifications as described above. In order to test the effect of mutations on downstream expression independent of chromosomal locus, we constructed yfp reporter plasmids with all mutations found within the p0 region of clones from rescued populations of the first replicate set of evolution experiments (IS-wt strains, IS-free strains and strain BΔIS5I, Figure 3CDE). Five of six small mutations altering the sequence of p0 increased yfp fluorescence in plasmid reconstructions (Figure 3C), presumably by increasing the affinity of RNA polymerase to p0. One mutation (T-145C) did not affect fluorescence and likely did not contribute to adaptation. Instead, rescue of the respective population, which also displayed a YFP+CFP fluorescence phenotype, likely depended on amplification alone. In contrast, two other point mutations identified in conjunction with amplifications (C-31T and G-92T), did increase reporter fluorescence on plasmids, providing examples of a combined beneficial effect of amplifications and additional mutations. Two of four insertions sequences that we had found inserted into p0 increased reporter fluorescence on plasmids greatly (IS2 and IS3, Figure 3D), which is consistent with the delivery of outward-facing promoters within the termini of IS (Mahillon and Chandler, 1998). The two other IS (IS1 and IS5) had no or no strong effect on plasmid reporter fluorescence. Since some IS have been reported to contain partial outward-facing promoters that can drive downstream expression after insertion next to a resident complementary partial promoter site (Mahillon and Chandler, 1998), we tested IS1 and IS5 in the precise sequence context of p0 in which these IS were found in evolution experiments (Figure 3E). In this sequence context, IS1 indeed increased reporter fluorescence, which depended on the 20 bp downstream of the insertion point within p0 (Figure 3E), consistent with the delivery of a half-promoter within the terminus of this IS. Insertion of IS5, which we repeatedly observed in evolution experiments, had very weak, but significant effects on downstream fluorescence on plasmids (Figure 1DE). To confirm the adaptive role of upstream IS5 insertions in the evolution experiments, we transduced one of the observed upstream IS5 insertions into the ancestral background, which restored growth on tetracycline as well as a marked increase in YFP fluoresence (Figure 3—figure supplement 3). Thus, in the chromosomal context, IS5 does increase expression of downstream genes, possibly due to effects on DNA bending (Zhang and Saier, 2009), which may not be recapitulated on the plasmid reconstruction. These results illustrate the diverse ways in which IS can adaptively affect gene expression, both dependent (IS1, IS5) and independent (IS2, IS3) of the insertion context. Given the reporter plasmid results and the fact that the same p0 sequence is part of the reporter cassette at all four chromosomal loci, point mutations and IS insertions likely were not responsible for the observed differences in the frequency of rescue between strains that are not explained by amplifications.
Properties of upstream genes determine the availability of two different types of adaptive promoter co-option mutations
Whole genome sequencing of clones from three rescued populations with neither upstream genetic changes nor amplifications (Figure 3—figure supplement 4), as well as subsequent screening of other rescued populations, revealed another candidate type of adaptive mutations, which altered the protein sequence of rho (Figure 4—video 1). Unlike mutations of the other types, rho mutations occurred in trans with respect to the reporter cassette. The rho gene of E. coli is an essential gene that encodes a transcriptional termination factor estimated to be required for termination at around half of all termination sites in E. coli (Ciampi, 2006). Contrary to point mutations and IS insertions, which we found upstream of all four loci (Figure 3A and Figure 3—figure supplement 5), Rho mutations and also upstream deletions were only found in evolved clones of strains with the reporter cassette at locus B or D, with one exception of a Rho mutation co-occurring with an upstream IS insertion in strain A. Thus, upstream deletions and Rho mutations provide candidates for locus-dependent adaptive mutations. Comparing the upstream neighborhood of the four different loci revealed the basis of this locus-dependency (Figure 4A and Figure 4—figure supplement 1). The orientation and expression of upstream transcripts as determined in a different study (Conway et al., 2014) suggests that in strains B and D, active upstream promoters were co-opted to tetA-yfp, either by deletion of intervening genes, or by compromising Rho-dependent termination by partial-loss-of-function mutations in Rho that cause transcriptional read-through into tetA-yfp. At loci A and C, such adaptive mutations were not available because of two kinds of constraints from neighboring genes: either intervening genes were essential (constraining adaptive deletions, Figure 4A), or no upstream Rho-terminated transcripts were present (constraining adaptive Rho mutations, Figure 4A).

The fitness effect of promoter co-opting deletions and Rho-mutations depends on properties of upstream neighboring genes.
(A) Genes and transcripts upstream of loci A, B, C, and D. Promoters of intrinsically terminated transcripts (purple) can be co-opted by deletions (purple brackets) if no essential gene (black arrows) is deleted. Promoters of Rho-terminated transcripts (green) can be co-opted by deletions or by partial loss-of-function mutations in Rho. Only putatively expressed transcripts oriented toward the reporter cassette are shown (all transcripts in Figure 4—figure supplement 1). Pointers and numbers on the right = position and size of PCR products shown in (C). (B) Tetracycline dose-response curves of strains with wt (black squares) or transduced mutant Rho (green circles = S153F, green crosses = M416I). Final OD600 after 24 hr (platereader units) was measured in three biological replicates. Rho mutants are more tolerant to tetracycline only with the reporter cassette at loci B and D. (C) Read-through transcripts spanning upstream terminators in a Rho-mutant background are detectable at loci B and D, but not at loci A and C. Bands show PCR products obtained from genomic DNA (+ control) or cDNA from a Rho-wt or Rho mutant (M416I) strain grown with sub-inhibitory levels of tetracycline. Positions of used primers as indicated in (A). NRT = negative control (no reverse transcriptase).
-
Figure 4—source data 1
Source data for Figure 4B.
Triplicate OD600 values (plate reader units) across tetracycline concentrations.
- https://doi.org/10.7554/eLife.25100.019
Since active transcripts shown in Figure 4A were experimentally determined under conditions different from our evolution experiments (Conway et al., 2014), and classification of termination sites as intrinsic or Rho-dependent was done only computationally (Kingsford et al., 2007; Conway et al., 2014), we experimentally assessed the effect of Rho mutations on transcriptional read-through across candidate upstream terminators at all four loci under experimental conditions approximating those in evolution experiments. We first confirmed the neighborhood-dependent effect of two different Rho mutations (S153F and M416I) on the phenotype of interest, that is, tetracycline resistance, by transduction into the ancestral IS-wt strains, which are isogenic except for the position of the reporter cassette (Figure 4B). Consistent with the presence of upstream Rho-terminated transcripts as shown in Figure 4A, an increased tolerance of Rho-mutants to tetracycline was observed only in strains with the reporter cassette at loci B and D, matching our observation that Rho-mutants were only found in rescued populations of these strains. We then performed PCR on cDNA prepared from a Rho-wt strain and a Rho mutant (M416I) strain grown in sub-inhibitory tetracycline (Figure 4C). We obtained PCR products consistent with read-through across candidate terminators upstream of locus B (downstream of yeeD) and locus D (mnmG), but not upstream of locus A (cysS) and locus C (xapR). A read-through transcript at locus D was detectable even in the Rho-wt background, which offers an explanation for the higher initial TetA-YFP expression observed in strain D (Figure 1—figure supplement 1). Mutations found in rescued populations of additional replicate experiments (fluorescence phenotypes in Figure 2B) are consistent with the above constraints on promoter co-opting mutations (Figure 3—figure supplement 5). Thus, upstream deletions and trans mutations that compromise transcriptional termination are mutation types that depend on the chromosomal neighborhood of the gene under selection. Specifically, the orientation, expression, essentiality, and termination mode of neighboring genes shape the fitness effect of these promoter co-option mutations.
Chromosomal neighborhood influences adaptation by affecting the fitness cost of amplifications
As seen from promoter co-opting mutations, chromosomal neighborhood may affect the adaptive potential of a gene by influencing not only mutation rates (as flanking homology does for duplications that can expand into amplifications), but also mutation fitness effects. We next asked if this applies to amplifications as well. Due to the instability of amplifications and related difficulties in detecting them, quantifying the fitness effect of amplifications is laborious (Adler et al., 2014) and has so far not been done on a genome-wide scale. The benefit of amplifying a selected gene is counteracted by a cost that arises in part due to dosage imbalances in the co-amplified neighboring genes. This cost limits the ability of amplifications to effectively expand at the population level as selection increases, an ability that comes from high rates of expansion of amplifications at the level of the individual chromosome by homologous recombination. The probability of an amplification to contain a costly gene is expected to increase with the length of the amplicon.
We used two-color fluorescence data to extract information on amplification cost and its effect on adaptation. For validating this approach, we used two strains (strain BΔIS5I, and the newly created strain E, Figure 5A) that we predicted to form amplifications of higher and lower cost, respectively, when compared to the IS-containing strain B, which serves as reference. The IS5 deletion in strain BΔIS5I, which reduces the rate of duplications that kick-start amplifications (see above), is also expected to increase the fitness cost of amplifications, since amplicons may be larger than the 35 kb between IS5I and IS5H. In strain E, we placed the reporter cassette between two copies of IS1, where duplications are expected to form frequently, and where amplifications, due to small amplicon size (11 kb), are expected to expand at low cost. In our experiment, if cost is negligible, amplifications are expected to expand continuously as tetracycline selection increases, resulting in rescue. In this case, YFP+CFP fluorescence increases in correlation with the level of tetracycline selection (Figure 5B, left). If amplifications are cost-limited, two outcomes are possible: (i) amplifications fail to expand beyond a certain level below that required for rescue, resulting in extinction – if the level of expansion before extinction is high enough, it will appear as a transient increase of CFP fluorescence in the fluorescence trajectories of extinct populations (Figure 5B, middle), (ii) amplifications allow rescue through interaction with other adaptive mutations that increase tetA-yfp expression – resulting in increased YFP/CFP fluorescence ratios in rescued populations (Figure 5B, right). We compared the numbers of extinct vs. rescued populations with (transiently) increased CFP fluorescence and found, as expected, that amplifications in strain BΔIS5I had a significantly higher extinction risk than amplifications in the reference strain B (Table 1, upper part), and rescued amplifications had significantly higher final YFP/CFP ratios (Figure 5C), confirming that low numbers of rescue in strain BΔIS5I were in part due to amplification costs. Contrariwise, populations with increased CFP fluorescence in strain E never went extinct (Table 1, upper part) and had consistently low final YFP/CFP ratios (Figure 5C), indicating the absence of a cost limitation.

Chromosomal neighborhood influences the fitness cost of amplifications.
(A) Chromosomal location of reporter cassette in strains BΔIS5I and E (IS distances not drawn to scale). (B) Example fluorescence trajectories. Left: low-cost amplifications expand in correlation with the increase in tetracycline concentration over 10 days. Middle: Cost-limited amplifications fail to expand at higher tetracycline concentrations resulting in extinction. Right: Amplifications can escape extinction in combination with other mutations increasing tetA-yfp expression, resulting in higher final YFP/CFP. RFU = relative fluorescence units (see Materials and methods), r.c. = relative concentration as multiples of MIC. (C) Final YFP/CFP ratios of rescued amplifications in strains expected to have a higher (strain BΔIS5I) or lower (strain E) cost of amplifications compared to strain B. n = initial number of replicate populations used for analysis. Crosses = populations rescued by amplifications without additional mutations. Other symbols = secondary mutations (see legend). p-values: permutation tests in comparison with strain B. (D) Final YFP/CFP ratios of rescued amplifications in strains A-D. n = 285 includes replicate evolution experiments to increase statistical power. Symbols and p-values as in (C).
-
Figure 5—source data 1
Source data for Figure 5C and D.
Mutations identified in combination with amplifications and respective final YFP/CFP ratios (points indicated by symbols other than crosses in Figure 5CD).
- https://doi.org/10.7554/eLife.25100.024
Differences in amplification cost indicated by the extinction risk of populations with amplifications. Populations with amplifications of higher (strain BΔIS5I) or lower (strain E) expected cost of amplifications have a higher or lower risk of becoming extinct, respectively. n = initial number of replicate populations used for analysis (n = 285 includes replicate evolution experiments to increase statistical power), ‘Extinct’ and ‘Rescued’ = numbers of extinct and rescued populations with amplifications as indicated by (transiently) increased CFP fluorescence (see Materials and methods), sample odds ratio compared to strain B, p-values: 2 × 2 Fisher’s exact test.
n | Strain | Populations with (transiently) increased CFP fluorescence | Sample Odds Ratio | P-value | |
---|---|---|---|---|---|
Extinct | Rescued | ||||
95 | BΔIS5I | 12 | 5 | 10.1 | 10−4 |
95 | B | 18 | 76 | 1 (ref) | – |
95 | E | 0 | 95 | 0 | 10−6 |
285 | A | 8 | 4 | 5.8 | 10−3 |
285 | B | 58 | 168 | 1 (ref) | – |
285 | C | 0 | 1 | 0 | n.s. |
285 | D | 0 | 7 | 0 | n.s. |
Having validated extinction risk (Table 1) and final YFP/CFP ratios (Figure 5C) as indicators of amplification cost, we tested if neighborhood-dependent amplification costs had affected adaptation in strains A, C, and D. A significantly elevated extinction risk of populations with amplifications in strain A (Table 1, lower part), and significantly elevated final YFP/CFP ratios in connection with diverse additional mutations in strains A, C, and D (Figure 5D), support that the costs of amplifications in these strains were higher compared to strain B. Thus, amplification costs represent another neighborhood-dependent constraint on adaptation. In this perspective, the availability of neighborhood-dependent promoter co-option mutations, the most prevalent non-amplification mutation types at loci B and D, is an important determinant of adaptive potential not only in itself, but also in the interaction with amplifications.
Chromosome neighborhood effects on adaptation in a single-step plating experiment
We next investigated whether our observations of chromosomal neighborhood effects on adaptation transfer to different selective conditions. In particular, we tested the possibility that differences in rescue between strains were due to different population sizes and thus different chances for beneficial mutations to occur, rather than due to different mutation rates or fitness effects as we propose. Our experimental design corrects for population size differences between strains at the first day of selection (Figure 1—figure supplement 1, and first section of the results part), but not necessarily for population size differences at later days of the experiments. Therefore, we performed single-step plating experiments, in which approximately the same numbers of cells are plated for every strain. In these Luria-Delbrück-type experiments, we plated replicate cultures grown under non-selective conditions on solid medium with tetracycline at two-fold MIC levels. We scored the number of colonies on each plate after 2 days, when clearly visible colonies first appeared. These early colonies are expected to result mostly from pre-plating single-step mutations that increase tetA-yfp expression (point mutations, IS insertions, and promoter co-option mutations). As in evolution experiments, colony numbers in strains B and D were higher than in strains A and C (Figure 6, left), for both IS-wt and IS-free genetic backgrounds. This result is consistent with neighborhood-dependent availability of promoter co-option mutations as observed also in evolution experiments. High CFP fluorescence, indicative of amplifications, was observed only in a small fraction of early colonies (34 of 1661 across all strains and plates). During longer incubation, the number of colonies on plates of IS-wt strain B increased steadily (Figure 6—figure supplement 1) and almost all of these later colonies (1229/1304 on ten plates) showed high CFP fluorescence. Since tetracycline is bacteriostatic rather than bactericidal, the appearance of these late colonies can be explained by a continuous process of reporter cassette amplification expansion and increasing growth rates after plating on selective medium, starting from frequent duplications that have a slight growth advantage over single-copy cells (Andersson et al., 1998). After 5 days, colony counts on plates were qualitatively similar to rescue frequencies in evolution experiments, with IS-wt strain B giving the highest number of colonies (Figure 6, right). In all other tested strains, late colonies appeared at much lower rates (Figure 6—figure supplement 1) and did not show high CFP fluorescence in most cases (Figure 6, right, and Figure 6—figure supplement 2), reflecting the minor role of amplification in strains that lack flanking homology in the chromosomal neighborhood of the selected gene. The consistency between liquid-culture evolutionary rescue experiments and plating experiments supports that strong effects of chromosomal neighborhood on the rate and fitness effect of adaptive mutations extend to different selective regimes.

Tetracycline-resistant mutants arising in a single-step plating experiment.
For each strain (top panels = IS-wt, bottom panels = IS-free), 10 replicate cultures grown in the absence of tetracycline were plated on agar with tetracycline concentration two times the strain-specific MIC. Left: Colony counts after 2 days of incubation. Right: Colony counts after 5 days of incubation. Horizontal lines show the median colony number from 10 replicate plates. Pie charts = fraction of plates in which a single tested colony appearing at day 2 (left) or at days 4–5 (right) showed high CFP fluorescence indicative of amplification (Figure 6—figure supplement 2).
-
Figure 6—source data 1
Numbers of colonies on replicate plates at days 2 and 5.
- https://doi.org/10.7554/eLife.25100.028
Discussion
Our results reveal a complex genetic basis of strong effects of chromosomal position on the adaptive potential of a specific gene (Figure 7A). By combining time-resolved fluorescence data from the reporter cassette and end-point genetic analysis, we demonstrate how the relative contribution of previously known mutation types to adaptation (Figure 7A, bottom row) differs between chromosomal loci, how these differences arise, and how a layer of complexity is added by the interaction of mutation types. Thus, the concept of a one-dimensional mutation rate and a focus on point mutations can be misleading (Martinez and Baquero, 2000), even for the simple case of adaptation by increased expression of a single gene. Instead, the adaptive potential of a given gene is a system-level property shaped by the local chromosomal genetic neighborhood. Consequently, the organization of genes on a chromosome is both cause and consequence of evolutionary change.

The adaptive potential of a gene under selection for increased gene expression as a complex function of properties of neighboring genes that affect and are affected by mutations of diverse types.
(A) Top row: Properties of neighboring genes that we identify as main determinants of the adaptive potential of a gene given its chromosomal neighborhood. Round corners indicate ‘dynamic’ properties that may be environment-dependent or subject to change over short evolutionary timescales. Bottom row: Different mutation types causing increased expression of a gene. Solid arrows: Effects and interactions shown or suggested by data in this study. Dashed arrows: Other effects and interactions that are likely to exist. Pointed arrowheads indicate a positive effect, T-bar ends indicate a negative effect. A sentence equivalent of each arrow is given in Figure 7—source data 1. As a sum of the above interactions, the adaptive potential of a gene emerges as a system-property. (B) Classification of chromosomal neighborhoods of E. coli genes according to adaptive potential. The chromosomal neighborhood of 4317 genes of E. coli MG1655 was assessed using published information on the position of promoters and terminators (Conway et al., 2014) and gene essentiality (see Methods for details). Numbers in parentheses = genes belonging to respective sets or intersections of sets. Genes in the intersection of all three circles (boldface) are expected to have the highest adaptive potential based on their chromosomal neighborhood. Loci A-E of this study are placed in the respective areas of the diagram.
-
Figure 7—source data 1
Extended legend of Figure 7A explaining each arrow and what loci are affected by respective interactions.
- https://doi.org/10.7554/eLife.25100.034
-
Figure 7—source data 2
List of E. coli genes included in the analysis shown in Figure 7B and their assignment to the three sets shown by colored circles.
- https://doi.org/10.7554/eLife.25100.035
Importantly, the effects that we describe arise from several properties (Figure 7A, top row) of different genetic elements that are present in the vicinity of the selected gene, rather than from more global factors such as distance to the origin of replication or chromosome macro-domain organization (Bryant et al., 2014). Therefore, we propose to refer to them as ‘chromosome neighborhood effects’ that determine the evolution of gene expression, as opposed to ‘chromosome position effects’ that modulate gene expression per se (Bryant et al., 2014; Levis et al., 1985; Akhtar et al., 2013).
Different mutation types interact to cause neighborhood-dependent differences in adaptive potential
In our experiments, chromosomal neighborhoods facilitate or constrain adaptation mainly via amplification and promoter co-option mutations, by affecting the rate of mutations (duplication-amplification) or the fitness effects of mutations (promoter co-option mutations and amplifications). For gene amplification, a strong effect of flanking homology as provided by IS, which are often present in multiple copies, has been known for a long time (Peterson and Rownd, 1985; Andersson and Hughes, 2009). Our data confirm that if flanking homology is present at a given locus, amplification is the main response to selection for increased gene expression. For loci lacking nearby flanking homology, which depending on the distribution of IS elements on a chromosome may be the majority of loci (Boyd and Hartl, 1997; Green et al., 1984), our data show that adaptation by amplification is limited on the level of duplication rate and fitness cost. For these loci, differences in the adaptive potential are largely due to the different availability of deletions and mutations compromising transcriptional termination, both of which co-opt upstream promoters to the selected gene. Such mutations also act in concert with amplifications and can alleviate amplification cost limitations by lowering the required fold-amplification to reach a certain level of expression of the selected gene (Figure 7A).
The multitude of mutations discovered in the termination factor Rho suggests that the function of this protein may be more ‘tunable’ than expected from it being an essential gene in E. coli. Our results may suggest that adaptation via trans mutations in Rho with potentially large pleiotropic effects is more likely than via local mutations that compromise upstream terminators in cis. Given that the sequence-dependence of Rho-dependent termination is poorly understood (Ciampi, 2006), there is no clear expectation of the nature and target size of mutations that would compromise Rho-dependent termination in cis. This makes it difficult to compare adaptation via mutations affecting Rho-dependent termination in cis versus trans. The adaptiveness of trans mutations in Rho despite their pleiotropic effects is supported by a previously characterized single amino-acid substitution in Rho, which was found to have large-scale effects on the E. coli transcriptome and to confer higher fitness in several environments (Freddolino et al., 2012). We found substitutions at 22 different amino acid residues mapping to various regions of the Rho protein structure (Skordalakes and Berger, 2003) (Figure 4—video 1 and Figure 4—video 1—source data 1), which largely expands the number of Rho residues found mutated in evolution experiments (Conrad et al., 2011). This supports the idea that operons delimitated by factor-dependent terminators may be rather fluid, providing a large source of variation for adaptation to changing environments. It remains to be seen whether different Rho alleles, by revealing ‘hidden’ transcriptional variation, serve as capacitors of adaptation (Masel, 2013) beyond laboratory evolution experiments.
Assessing properties of neighboring genes to infer the adaptive potential of a gene under selection
For both amplifications and promoter co-opting mutations, the influence of the chromosomal neighborhood arises mechanistically from several simple properties of neighboring genes—their expression, orientation, transcriptional termination, essentiality, the presence or absence of flanking gene duplicates—and from the cost of neighboring gene co-amplification (Figure 7A, top row). If these properties are known at a genomic scale, inferring a chromosome-wide ‘map of adaptive potential’ becomes conceivable. An understanding of adaptive potential may help assess the risk of resistance evolution via overexpression of preexisting chromosomal genes (as opposed to via acquisition by horizontal transfer). Clearly, some properties of neighboring genes can be assessed on a genome-wide scale more easily (e.g. gene orientation) than others (e.g. gene essentiality or cost of genes when amplified). Once it becomes feasible to acquire data on all the main factors shaping adaptive potential, this data may improve efforts to predict specific adaptations.
As a first step toward this goal, we used published information on gene essentiality, and promoter and terminator locations (Conway et al., 2014) to assess how many of E. coli genes (strain MG1655) are expected to reside in a chromosomal neighborhood associated with high adaptive potential (Figure 7B). Based on the most simply assessable properties (colored circles in Figure 7B), the chromosomal neighborhood of most genes (2295/4317) is expected to have a medium adaptive potential, comparable to that of locus D from this study.
Adaptive potential as a dynamic property
Importantly, some properties of chromosomal neighborhoods are dynamic (rounded boxes in Figure 7A)—gene essentiality (Baba et al., 2006) and expression can be environment-dependent, and transposition causes rapid turnover of mobile element positions (Sawyer et al., 1987; Wagner, 2006). Therefore, the classification of chromosomal neighborhoods of genes according to adaptive potential as in Figure 7B needs to be understood as a snapshot in time reflecting particular conditions. Also, how adaptive potential translates into the actual likelihood of adaptation depends on population parameters and the precise selection scenario.
On evolutionary timescales, the dynamics of chromosomal neighborhood properties would rapidly degrade signals that neighborhood-dependent evolution leaves in genome sequences. Nevertheless, neighborhood-dependent evolution could offer mechanistic explanations for phenomena observed in genomic data such as operon organization (Reams and Neidle, 2004; Lawrence and Roth, 1996), reductive genome evolution by promoter capture-deletions as suggested previously (Lind et al., 2015), or the chromosomal position of horizontally transferred genes (Touchon et al., 2009). Since horizontally transferred genes carrying selective functions are often silenced after initial integration (Navarre et al., 2006; Cardinale et al., 2008), they depend on activating mutations to play out their benefit to the host and become stably maintained in the host chromosome. Thus, the evolutionary fate of horizontally transferred genes will be shaped by the new chromosomal neighborhood they find themselves in. For example, a drug resistance gene entering the genome at loci B or D via horizontal transfer will be more likely to enable survival of the host under drug selection, compared to insertion at loci A and C, both because of higher initial expression and the higher adaptive potential associated with these loci as described here. The common association of horizontally acquired genes with flanking mobile elements as in complex transposons and genomic islands (Dobrindt et al., 2004) may not only reflect the high transferability of such configurations, but also their high amplifiability, which may be of particular relevance for mis-expressed foreign genes.
Chromosomal neighborhood effects beyond prokaryotes
Although our results reflect many specifics of prokaryote genome organization, the importance of promoter-capture mutations (ar-Rushdi et al., 1983), modulation of transcriptional read-through (Grosso et al., 2015) and gene amplification (Cole et al., 1992; Gajduskova et al., 2007) extends to cancer evolution and cases of rapid adaptation in higher organisms (Devonshire and Field, 1991). This implies that chromosomal neighborhood effects on evolution may be of wider significance and they could be investigated with similar reporter-based methods.
Materials and methods
Materials
Unless noted otherwise, we obtained chemicals from Sigma-Aldrich (St. Louis, Missouri) and enzymes from New England Biolabs (Ipswich, Massachusetts). Evolution experiments and phenotyping tests were done in in M9 medium supplemented with 2 mM MgSO4, 0.1 mM CaCl2, and 0.2% glucose and 0.2% casein hydrolysate as carbon sources (M9CG medium), unless noted otherwise. A list of oligonucleotides, strains, and plasmids is available in Supplementary file 3.
Construction of the reporter cassette
Request a detailed protocolThe reporter cassette (p0-RBS-tetA-yfp-pR-cfp) was assembled on a plasmid using a combination of standard cloning techniques, ligation chain reaction (Rouillard et al., 2004), and fusion PCR. For the p0 sequence upstream of tetA-yfp, we generated a random 188 bp nucleotide sequence matching the average GC content of E. coli (CCGGAAAGACGGGCTTCAAAGCAACCTGACCACGGTTGCG
CGTCCGTATCAAGATCCTCTTAATAAGCCCCCGTCACTGTTGGTTGTAGAGCCCAGGACGGGTTGGCCAGATGTGCGACTATATCGCTTAGTGGCTCTTGGGCCGCGGTGCGTTACCTTGCAGGAATTGAGGCCGTCCGTTAATTTCC). We synthesized the sequence from oligonucleotides in a ligation chain reaction. The tetA sequence was taken from strain TKC (Sharan et al., 2009), and the yfp gene from plasmid pZA21-yfp (Lutz and Bujard, 1997). At the fusion point, we placed a 3xGS linker peptide between the C-terminus of TetA and the N-terminus of YFP. Between p0 and the start codon of tetA-yfp is a sequence containing a restriction site and a ribosomal binding site (GTCGACAGGAGGAATTCACC). We placed the p0-tetA-yfp sequence on plasmid pAH81-FRT-cfp (Haldimann and Wanner, 2001), upstream of the chloramphenicol resistance gene and the terminator-flanked pR-cfp gene. pR is a strong constitutive promoter originating from phage λ. We sequenced the full length of the reporter cassette on the resulting plasmid, pMS7. Replication of the pMS7 plasmid depends on the Pir protein and the plasmid was propagated in a pir-containing version of strain DH5α.
Strain construction
Request a detailed protocolWe moved the ΔtolC::kan allele from E. coli strain JW5503-1 into strain MG1655 using P1 transduction. For the IS-free genetic background, the same ΔtolC::kan allele was introduced into strain MDS42 (Pósfai et al., 2006) by recombineering (Thomason et al., 2014) with pKD13 (Datsenko and Wanner, 2000) as PCR template. kanR cassettes were removed using plasmid pCP20 (Datsenko and Wanner, 2000). We inserted the reporter cassette from plasmid pMS7 into the two ΔtolC strains by recombineering. Precise insertion points are given in Figure 1—source data 1. All reporter cassette genes point toward the terminus of replication. Recombinants were selected on LB agar with chloramphenicol (10 µg/mL). The chloramphenicol marker was subsequently removed (Datsenko and Wanner, 2000). We confirmed the presence of the full-length single copy insertion by PCR and verified the sequence of p0-tetA-yfp by sequencing. The presence of functional pR-cfp was confirmed by observing fluorescence. To obtain strain BΔIS5I, the camR cassette from pKD3 (Datsenko and Wanner, 2000) was recombineered into the IS5I element of strain B. Recombinants were selected with choloramphenicol (10 µg/mL) and confirmed by PCR. Deletion of the reporter cassette genes in evolved clones was done by recombineering the kanR cassette of pKD13 into the reporter cassette such that the coding regions of both tetA-yfp and cfp were disrupted. Deletions were confirmed by absence of fluorescence and PCR with flanking primers (Figure 2—figure supplement 2). For P1 transduction of rho mutations, we first transduced mutations S153F and M416I from rescued clones of populations of strain D into MG1655. As selective marker, we used a kanR cassette that we had inserted upstream of rho by recombineering. After sequence verification, we transduced rho mutations into IS-wt strains A-D.
MIC measurements and dose-response curves
Request a detailed protocolStrains were pre-grown for 16 hr in M9CG medium without tetracycline and transferred to 96-well plates (200 µL/well). From there, we pin-diluted cultures with a VP408 pin replicator (V and P Scientific, San Diego, California, dilution factor ~1:820, tested with fluorescein) into fresh medium with different concentrations of tetracycline, incubated plates for 24 hr at 37°C on a Titramax plateshaker (Heidolph, Schwabach, Germany, 900 rpm), shook plates for 20 s at 1200 rpm and measured OD600 with a H1 platereader (Biotek, Vinooski, Vermont). For obtaining fine-scale MIC measurements we tested tetracycline concentrations at intervals of 0.125 µg/mL. We defined MIC as the lowest drug concentration that yielded OD600 ≤ 0.075 (plate reader units) in three replicates performed on different days.
Evolution experiments
Request a detailed protocolAll precultures and evolution experiments were performed in M9CG medium. We transferred an overnight culture of every strain into 95 wells of clear flat bottom 96-well plates (200 µL/well), from where we diluted cultures into medium with tetracycline using VP408. One well contained a growth medium control. As initial concentration of tetracycline, we used half of the strain-specific MIC. For 10 days, we pin-diluted cultures with VP408 every 24 hr into medium with geometrically increasing tetracycline concentrations such that at day 10 the concentration was 10 times the initial concentration (Figure 1D). During the experiment, the maximum number of generations was set by the daily dilution factor (~1:820) and was ~97. A fresh tetracycline stock solution was prepared from powdered tetracycline-HCl every day. All incubations were done at 900 rpm on a plate shaker at 37°C in the dark and plates were wrapped in plastic bags to mitigate evaporation. Replicate evolution experiments were performed with two additional 96-well plates for each of strains A, B, C, and D (IS-wt). Each 96-well plate was started from a culture inoculated with a different colony. At the end of experiments, we froze all rescued populations.
OD600 and fluorescence measurements
Request a detailed protocolEvery day during the evolution experiment, after using 24-hr-old cultures for inoculating fresh medium with a higher tetracycline concentrations using VP408, we shook the old plates for 20 s at 1200 rpm to resuspend cells and measured OD600 and reporter fluorescence with a H1 Platereader (Biotek, Vinooski, Vermont; excitation/emission: YFP 515/545 nm / gain 100; CFP 433/475 nm / gain 60).
Data analysis
Request a detailed protocolPopulations were classified as rescued if OD600 exceeded 0.075 (plate reader units) at the end of the experiment. Fluorescence values were normalized to OD600 and set to zero if OD600 fell below 0.075. As reference for calculating the fold-increase in fluorescence, we took the average OD-normalized fluorescence of 95 cultures of the respective ancestral strain, inoculated in the same way as described for the beginning of evolution experiments, and grown in 96-well plates for 24 hr without tetracycline. Rescued populations were classified as YFP or YFP+CFP if the observed fold increase in respective fluorescence over the ancestor was >2.77 at the end of the experiment. This threshold corresponds to the lowest observed increase in YFP fluorescence that was sufficient for rescue in the first set of replicate experiments (IS-wt strains A, B, C, and D). To identify populations that went extinct despite elevated YFP and/or CFP fluorescence we applied more stringent criteria, requiring increased fluorescence (fold increase >2.77) for at least 2 days at which OD was >0.3 (platereader units). These criteria were used to exclude extinct populations that were false positive for increased fluorescence due to low OD600 values prior to extinction. Rescued populations that met the more stringent criteria for elevated CFP fluorescence, but that did not show elevated CFP fluorescence at the end of the experiment (final fold increase <2.77), were counted as amplifications for cost analysis (Figure 5 and Table 1), but not for Figure 2. For calculating final YFP/CFP ratios of rescued amplifications, we used internal plate reader fluorescence units directly. A Matlab script used to perform the above analysis is available as a supplementary file along with the platereader raw data used as input for the script (Source code 1). Plots of fluorescence trajectories of every population can be found in Supplementary file 1 and phenotype classifications in Supplementary file 2.
Quantitative PCR for reporter cassette copy number determination
Request a detailed protocolWe inoculated samples of all rescued populations that we had chosen for sequencing from the first set of replicate experiments and that had a YFP+CFP fluorescence phenotype. We inoculated 2 mL M9CG with 10 µL of populations that were frozen at the end of the evolution experiment. The large inoculum was used to maintain amplification-related population diversity. We added the same amount of tetracycline as on the last day of evolution experiments to maintain amplifications. From all cultures that were turbid after overnight incubation, we isolated genomic DNA (gDNA). Ancestor gDNA was isolated from cultures without tetracycline. We performed qPCR using the GoTaq qPCR mastermix (Promega, Madison, Wisconsin) and a C1000 instrument (Bio-Rad, Hercules, California). Using dilution series of one of the gDNA extracts as template, we confirmed that all primer pairs had an amplification efficiency >90%. We quantified the copy number of tetA in each sample with the ΔΔCq method implemented in the instrument software (Bio-Rad), taking amplification efficiency into account. As reference, we used loci equidistant from the origin of replication and compared ratios of the measured and reference locus to the ratio of the same two loci in the ancestral DNA. qPCR was done in three technical replicates.
Identification of flanking homology
Request a detailed protocolWe searched 400 kb around loci A-D for homologous sequences on either side using REPuter (Kurtz et al., 2001) with the following search criteria: forward repeats ≥ 200 bp, Hamming distance ≤5.
DNA sequencing
Request a detailed protocolWe streaked all rescued populations of strains A, C, D (IS-wt), of strains B and D (IS-free), and of strain BΔIS5I for single colonies on LB agar. For IS-wt strain B, we analyzed one rescued population that had a YFP-only fluorescent phenotype, two YFP+CFP populations with unusual fluorescence trajectories and 11 randomly chosen populations from the remaining 74 YFP+CFP rescued populations, which had highly similar fluorescence trajectories. Colony-PCRs were performed on a single representative clone of each streak. We amplified at least 1.5 kb of the region upstream of the tetA start codon. The size of PCR products was checked for insertions or deletions on an agarose gel. Sequences were obtained using primer tetA_pseq1_f. If no PCR product was obtained, we performed arbitrary PCR with primer tetA_pseq2_f and a random primer, arb1 or arb6, for upstream binding. We then did a second PCR with a nested primer tetA_arb2 and primer arb2 using the first PCR product as template, and sequenced DNA extracted from the largest distinct band on an agarose gel. The full-length sequence of the rho gene was amplified and sequenced with primers rho_seq_f and rho_seq_r. For additional replicate evolution experiments, we sequenced clones of all rescued populations with a YFP fluorescence phenotype and with a YFP+CFP fluorescence phenotype showing high final YFP/CFP ratios. In four cases, we identified the exact same mutation in clones isolated from two populations that had been in neighboring wells during evolution experiments. In order to ensure that a potential cross-contamination between these two wells did not influence results, we excluded one of each pair of such neighboring populations from all analyses.
Junction PCR
Request a detailed protocolColony PCR for amplification junctions was performed with primers IS5I_flank_f and IS5H_flank_r on single colonies of 16/16 evolved populations of strain B. For the data shown in Figure 2D, we used gDNA previously isolated from populations for qPCR to ensure a comparable amount of PCR template in all reactions.
Whole genome sequencing
Request a detailed protocolWe isolated gDNA from overnight cultures of single clones of four rescued D populations as well as of the ancestral D strain grown in LB. A whole genome library was prepared and sequenced by GATC biotech (Konstanz, Germany) on an Illumina sequencer (125 bp reads). Fastq files were analyzed with the breseq script (Barrick et al., 2014). We used the MG1655 genome (Genbank accession number U00096.3) as a reference for assembling the ancestral D genome, which then served as a reference for analyzing the genomes of the evolved clones. Fastq files are available at: http://dx.doi.org/10.15479/AT:ISTA:65.
Cloning of reporter plasmids
Request a detailed protocolFor building the reference plasmid pAnc, which reports on expression from the ancestral p0 sequence, we exchanged the pLtetO-1 promoter and RBS of pZA21-yfp for the p0-RBS sequence upstream of tetA-yfp in the reporter cassette. Using a Q5 site-directed mutagenesis kit (New England Biolabs) with pAnc as template, we reconstructed small mutations (substitutions and small insertions and deletions, Figure 3C). We did the same with the terminal 50 bp of IS1 (5’ terminus) and IS5 (3’ terminus), which we put instead of the 50 bp of p0 in the exact position where insertions were found in the experiment (Figure 3E). To confirm the IS1-p0 hybrid promoter, we exchanged 20 bp of p0 downstream of the IS1 insertion point in the respective reporter plasmid. The 20 bp were replaced by a randomly shuffled sequence composed of the same nucleotides. For the other IS reporter plasmids (Figure 3D), we PCR-amplified the last 600 bp of IS and cloned them into the XhoI/EcoRI sites of pZA21-yfp. The orientation of the truncated IS corresponds to that found in sequenced clones. As autofluorescence control, we removed the YFP fragment between EcoRI and MfeI restriction sites of pZA21-yfp and obtained pZA21-empty by religation of compatible ends. All changes were sequence-verified. Cloning and reporter measurements were done in strain NEB 5 alpha (New England Biolabs).
Quantifying YFP reporter fluorescence from plasmids
Request a detailed protocolWe grew six replicate overnight cultures of the reporter plasmid strains in LB Kanamycin (50 µg/mL) in a 96-well plate and diluted them into M9CG supplemented with Kanamycin using a VP407 pin replicator (approximate dilution factor 1:100). Diluted cultures were shaken and incubated at 37°C in the platereader and OD600 and YFP fluorescence was monitored every 10 min (YFP gain 120). YFP readings were normalized to OD600 and averaged for each replicate at all timepoints at which OD600 was between 0.20 and 0.25 (platereader units, that is, mid-exponential phase).
Tetracycline resistance phenotyping on solid medium
Request a detailed protocolClones and strains to be tested were pregrown overnight in M9CG and diluted as shown in Figure 2B and Figure 3—figure supplement 3. We spotted 2.5 µL of diluted cultures on M9CG agar plates. After 24 hr incubation at 37°C, we took YFP fluorescence images of plates using a lab-made macroscope (http://openwetware.org/wiki/Macroscope). The macroscope uses a Canon EOS 600D digital camera and a Canon EF-S 60 mm f/2.8 Macro USM lense (Canon, Tokyo, Japan). For illumination, we used a Cyan (505 nm) Rebel LED (Luxeon Star LEDs, Brantford, Canada) with a HQ500/20x excitation filter (Chroma, Bellow Falls, Vermont). As emission filter we used a camera-mounted D530/20 filter (Chroma).
Reverse transcription
Request a detailed protocolStationary cultures of MG1655 ∆tolC (rho-wt) and of the isogenic strain with the rho M416I mutation in LB were diluted 1:100 in M9CG supplemented with tetracycline (0.44 µg/mL, that is, 50% of the MIC of strain MG1655 ∆tolC and grown overnight at 37°C with shaking. Total RNA was isolated using an Aurum Total RNA Mini kit (Bio-Rad) and DNA removed using an Ambion DNA-free kit (Life Technologies, Carlsbad, California). Isolated RNA was quantified using a Nanodrop spectrophotometer and integrity was checked on an agarose gel. cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad) with 1 µg of total RNA as input in a 20 µL reaction. For the non-reverse-transcriptase (NRT) control reaction we used 0.5 µg of each of the two RNA samples.
Endpoint PCR on cDNA
Request a detailed protocolAfter reverse transcription, cDNA samples and the NRT control sample were diluted by adding 150 µL of nuclease-free water. Endpoint PCR to test for the presence of transcripts resulting from possible read-through across Rho-dependent terminators were done with a OneTaq Quick-Load Mastermix (New England Biolabs), using 1 µL of diluted cDNA or NRT control as template in a 50 µL reaction. To detect rare transcripts, we used 45 amplification cycles. As a positive control template in PCR reactions, we used 1 µL of a colony of strain MG1655 ∆tolC resuspended in 25 µL water and heated to 95°C for 4’. For agarose gel visualization, we loaded 15 µL of cDNA and NRT control PCR reactions and 2 µL of the positive control PCR reactions.
Inferring the order of two adaptive mutations occurring in the same clone
Request a detailed protocolIn several cases, fluorescence analysis and sequencing revealed two potentially adaptive mutations in the same clone/population (colored dots on top of bars in Figure 3A and Figure 5—figure supplement 1). To infer which mutation came first, we proceeded as follows. For amplifications that occurred in combination with point mutations, we examined sequence chromatograms obtained from single clones. In all three cases, point mutations appeared as mixed nucleotide peaks, indicating that amplifications were initiated before the point mutations occurred. In two cases of amplifications co-occuring with upstream IS insertions, insertions occurred first. This is evident since PCR products used for sequencing appear as single bands of larger size than expected on agarose gels, whereas later insertions are expected to give two bands – a smaller one for copies without the insertion and a larger one for copies having the insertion. In one case, the insertion of IS3 upstream of locus C was a prerequisite for amplification initiation, as we could show by PCR that the IS3 insertion was at the amplicon junction. Cases of co-occurrence of amplifications with deletions or Rho-mutations were decided based on fluorescence trajectories. YFP/CFP ratios that remained high and relatively constant throughout the experiment indicate that amplifications expanded only after the other mutation had occurred. YFP/CFP ratios that increase at an intermediate timepoint during the experiment indicate that amplifications were initiated first. Last, we assume that a Rho mutation in strain A was selected only after the insertion of an upstream IS5 element, since Figure 4B indicates that Rho mutations alone would not have been adaptive in strain A. Rather, we assume that the Rho mutation enhanced transcriptional read-through from IS5 into the reporter cassette. Dots-on-bar color assignments in Figure 3—figure supplement 5 do not reflect the order of mutations, as we did not do such analysis for additional replicate experiments.
Assessment of gene essentiality
Request a detailed protocolEssentiality data for upstream protein coding genes (Figure 4A) was taken from a published dataset (Baba et al., 2006). We did not find data on the essentiality of the valU tRNA operon upstream of locus C in the literature data. Therefore we tested experimentally, if deletions of the complete valU operon are tolerated. We attempted to delete the operon using recombineering with pKD13 as template plasmid for a kanR cassette and primers valU_ko_f and valU_ko_r. The number of colonies on the valU knockout selection plate was more than tenfold lower than that of a control knockout of the neighboring xapR gene with primers xapR_ko_f and xapR_ko_r. To exclude that the low number of recombinants was due to a hairpin structure contained in the valU_ko_r primer, we repeated recombineering with a different reverse primer, valU_ko_r2, and obtained similar results. The low recombineering efficiency was not due to a smaller amount of PCR product used in transformations. Of six tested colonies obtained on the ΔvalU::kanR selection plate, only one colony gave a PCR product of the expected size in a test with flanking primers, showing that 5/6 colonies are not true valU knockouts. This suggests that valU deletion mutants require rare compensatory mutations to restore growth. Therefore the valU operon was considered as essential.
Single-step plating experiments
Request a detailed protocolWe inoculated 1 mL of LB with a single colony of strains to be tested. After overnight incubation, saturated cultures were diluted 1:1000 into experimental evolution medium without tetracycline, and then split into 10 wells of a 96-well plate (220 µL / well). The 96-well plate was incubated on a plate shaker at 37°C for 24 hr to obtain saturated cultures, of which 180 µL containing approximately 2 × 108 cells were plated on M9CG medium with tetracycline at a concentration two times the MIC of respective strains (cell numbers were determined by plating dilutions on non-selective medium). Plates were incubated at 37°C in the dark and colonies counted every 24 hr. After 2 days, we picked one colony from every plate that had at least one colony on it and inoculated 200 µL of M9CG medium in a 96-well plate with the picked colony. After 24 hr incubation at 37°C, we used the VP407 pinner to spot approximately 2 µL on M9CG agar plates. After another 24 hr incubation, we took CFP fluorescence images of plates with the macroscope (see ‘Tetracycline resistance phenotyping on solid medium’). For illumination, we used a Royal Blue (447.5 nm) Rebel LED (Luxeon Star LEDs) with a D436/20x excitation filter (Chroma). As emission filter we used a camera-mounted D480/40m filter (Chroma). The mean intensity of pixels of each spot was quantified. Spots with intensity six times greater than the mean intensity of all ancestor spots are considered to have amplifications (Figure 6—figure supplement 2).
Statistical analysis
Request a detailed protocolTo test for homogeneity in the distribution of rescued vs. extinct populations, fluorescence phenotypes and mutation types, r × c Fisher’s exact test for Count Data was used (fisher.test function in R [R Core Team, 2012]). For testing the distribution of mutation types, we used types indicated in Figure 3A by bar color, not dot color. For testing 2 × 2 contingency tables, Fisher’s exact test was used with an alternative hypothesis of odds ratio ≠ 1. Permutation tests were performed with the perm package (Fay and Shaw, 2010) for R (permTS function, method=‘exact.mc’, 104 Monte Carlo replications, two-sided).
In-silico analysis of adaptive potential of E. coli gene neighborhoods (Venn diagram)
Request a detailed protocolWe used the Profiling of E. coli Chromosome (PEC) database available at https://shigen.nig.ac.jp/ecoli/pec/genes.jsp (accession number UA00096.2) and included all 4317 genes (feature type ‘gene’) of E. coli MG1655 with essentiality information in our analysis, which excludes non-coding genes. The position and orientation of promoters was extracted from Table S2 of the same study used to identify candidate transcripts in Figure 4A (Conway et al., 2014). We only included promoters annotated as ‘primary’ promoters in our analysis. The ‘Promoter Confidence Score’ was not taken into account. The position, orientation, and termination mode (intrinsic or non-intrinsic) of all terminators was extracted from Table S3 of the same study (Conway et al., 2014). In order to identify all genes downstream of Rho-dependent terminators (green circle in Figure 7B), we identified the closest upstream co-oriented terminator of every gene and evaluated whether it was predicted to be an intrinsic terminator or not, in which case we assumed it is Rho-dependent. In order to identify all genes to which a co-oriented upstream promoter could be co-opted by deletion without disrupting an essential gene, we first identified the next essential upstream gene of every gene, and then evaluated if there is at least one co-oriented promoter and intervening co-oriented terminator between the gene of interest and the next upstream essential gene. If this was the case, the gene of interest was included in the respective set of genes (magenta circle in Figure 7B). In order to identify genes between flanking duplicates (blue circle in Figure 7B), we used the online REPuter tool (Kurtz et al., 2001) to find all forward repeats on the chromosome that satisfied the following criteria: repeat length ≥200 bp, Hamming distance ≤8, maximum distance between repeats 100 kb, minimum distance between repeats 200 bp. In this way, we identified four large regions of the MG1655 chromosome between flanking repeats: between IS1B and IS1C (containing 13 genes and locus E), between IS5H and IS5I (containing 42 genes and locus B), and between the ribosomal operons rrnA and rrnC (81 genes), and rrnB and rrnE (31 genes). We also obtained six genes between closely spaced repeats matching our criteria (ybfB, ybfL, yibA, ldrA, ldrB, and ldrC), which we did not include in the set ‘between flanking duplicates’, since the behavior of such closely spaced repeats might be different than those studied in our system. The Venn diagram was drawn in Matlab using the ‘ChowRodgers’ method for sizes of circles and intersection areas. A list of all included genes and their assignment to the three sets is available in Figure 7—source data 1.
Data deposited online
Request a detailed protocolFastq files of whole genome sequencing of IS-free strain D (ancestor) and of evolved clones from four evolved populations of this strain (A11, C08, C10, D08) have been deposited in the IST Data Repository, http://dx.doi.org/10.15479/AT:ISTA:65.
Data availability
-
Fastq files for "Complex chromosomal neighborhood effects determine the adaptive potential of a gene under selection"Publicly available at the IST Data Repository (https://datarep.app.ist.ac.at/).
References
-
High fitness costs and instability of gene duplications reduce rates of evolution of new genes by duplication-divergence mechanismsMolecular Biology and Evolution 31:1526–1535.https://doi.org/10.1093/molbev/msu111
-
Gene amplification and adaptive evolution in bacteriaAnnual Review of Genetics 43:167–195.https://doi.org/10.1146/annurev-genet-102108-134805
-
Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collectionMolecular Systems Biology 2:2006.0008.https://doi.org/10.1038/msb4100050
-
Nonrandom location of IS1 elements in the genomes of natural isolates of Escherichia coliMolecular Biology and Evolution 14:725–732.https://doi.org/10.1093/oxfordjournals.molbev.a025812
-
Chromosome position effects on gene expression in Escherichia coli K-12Nucleic Acids Research 42:11383–11392.https://doi.org/10.1093/nar/gku828
-
Evolutionary rescue in a changing worldTrends in Ecology & Evolution 29:521–530.https://doi.org/10.1016/j.tree.2014.06.005
-
Rho-dependent terminators and transcription terminationMicrobiology 152:2515–2528.https://doi.org/10.1099/mic.0.28982-0
-
Microbial laboratory evolution in the era of genome-scale scienceMolecular Systems Biology 7:509.https://doi.org/10.1038/msb.2011.42
-
Target site selection in transpositionAnnual Review of Biochemistry 66:437–474.https://doi.org/10.1146/annurev.biochem.66.1.437
-
Gene amplification and insecticide resistanceAnnual Review of Entomology 36:1–21.https://doi.org/10.1146/annurev.en.36.010191.000245
-
Genomic islands in pathogenic and environmental microorganismsNature Reviews Microbiology 2:414–424.https://doi.org/10.1038/nrmicro884
-
Copy number change: evolving views on gene amplificationFuture Microbiology 8:887–899.https://doi.org/10.2217/fmb.13.53
-
Exact and asymptotic weighted Logrank tests for Interval Censored Data: The interval R packageJournal of Statistical Software 36:.https://doi.org/10.18637/jss.v036.i02
-
Genome position and gene amplificationGenome Biology 8:R120.https://doi.org/10.1186/gb-2007-8-6-r120
-
Effect of chromosome location on bacterial mutation ratesMolecular Biology and Evolution 19:85–92.https://doi.org/10.1093/oxfordjournals.molbev.a003986
-
Site-specific chromosomal integration of large synthetic constructsNucleic Acids Research 38:e92.https://doi.org/10.1093/nar/gkp1193
-
REPuter: the manifold applications of repeat analysis on a genomic scaleNucleic Acids Research 29:4633–4642.https://doi.org/10.1093/nar/29.22.4633
-
Selfish operons: horizontal transfer may drive the evolution of gene clustersGenetics 143:1843–1860.
-
The challenge of efflux-mediated antibiotic resistance in Gram-negative BacteriaClinical Microbiology Reviews 28:337–418.https://doi.org/10.1128/CMR.00117-14
-
The probability of evolutionary rescue: towards a quantitative comparison between theory and evolution experimentsPhilosophical Transactions of the Royal Society of London. Series B, Biological Sciences 368:20120088.https://doi.org/10.1098/rstb.2012.0088
-
Mutation frequencies and antibiotic resistanceAntimicrobial Agents and Chemotherapy 44:1771–1777.https://doi.org/10.1128/AAC.44.7.1771-1777.2000
-
Opposing effects of target overexpression reveal drug mechanismsNature Communications 5:1–8.https://doi.org/10.1038/ncomms5296
-
Drug resistance gene amplification of plasmid NR1 derivatives with various amounts of resistance determinant DNAJournal of Bacteriology 161:1042–1048.
-
SoftwareR: A Language and Environment for Statistical ComputingR: A Language and Environment for Statistical Computing, Vienna, Austria.
-
Selection for gene clustering by tandem duplicationAnnual Review of Microbiology 58:119–142.https://doi.org/10.1146/annurev.micro.58.030603.123806
-
Gene amplification and genomic plasticity in prokaryotesAnnual Review of Genetics 31:91–111.https://doi.org/10.1146/annurev.genet.31.1.91
-
Gene2Oligo: oligonucleotide design for in vitro gene synthesisNucleic Acids Research 32:W176–180.https://doi.org/10.1093/nar/gkh401
-
Distribution and abundance of insertion sequences among natural isolates of Escherichia coliGenetics 115:51–63.
-
Antibiotic susceptibility profiles of Escherichia coli strains lacking multidrug efflux pump genesAntimicrobial Agents and Chemotherapy 45:1126–1136.https://doi.org/10.1128/AAC.45.4.1126-1136.2001
-
Recombineering: genetic engineering in bacteria using homologous recombinationCurrent Protocols in Molecular Biology 106:1.16.1–1.1639.https://doi.org/10.1002/0471142727.mb0116s106
-
A mu gin complementing function and an invertible DNA region in Escherichia coli K-12 are situated on the genetic element e14Journal of Bacteriology 158:517–522.
-
Cooperation is fleeting in the world of transposable elementsPLoS Computational Biology 2:e162.https://doi.org/10.1371/journal.pcbi.0020162
-
The evolutionary significance of cis-regulatory mutationsNature Reviews. Genetics 8:206–216.https://doi.org/10.1038/nrg2063
Decision letter
-
Michael T LaubReviewing Editor; Massachusetts Institute of Technology, United States
In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.
Thank you for submitting your article "Complex chromosomal neighborhood effects determine the adaptive potential of a gene under selection" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Diethard Tautz as the Senior Editor. The reviewers have opted to remain anonymous.
The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.
Summary:
This paper uses a specially designed reporter to examine the nature of adaptation and the mutations that can drive tetracycline resistance under continual selection. The reviewers were generally enthusiastic about the work as such systematic analyses of mutational spectra during selection have the potential to inform us about evolution at a very detailed molecular level. In particular, this paper presents reasonably strong data to suggest that the local chromosomal context of a tet-resistance gene can influence its adaptation via differences in amplification potential (driven by IS elements) and read-through from other nearby genes. Despite some enthusiasm, the reviewers noted a few important weaknesses that would have to be remedied in a revised manuscript. These issues are detailed below and generally fall into three categories.
Essential revisions:
1) Some of the suggestions about how adaptation has occurred are incompletely substantiated. Additional experiments are needed to address these concerns; in most, if not all, cases, the necessary experiments are relatively straightforward.
– Results section; "All rescued populations displayed increased YFP fluorescence. Thus, rescue depended on the presence and overexpression of tetA-yfp." The second sentence doesn't logically follow from the first. The authors should test, at least in 1-2 cases, that selective deletion of TetA-YFP in the evolved clone eliminates rescue.
– "…or no upstream Rho-terminated transcripts were present (constraining adaptive Rho mutations, Figure 4A)." The notion that the Rho mutations allow read-through into tetA-YFP is interesting, but the claim that no upstream Rho-terminated transcripts exist in strains A and C needs to be substantiated. Is this information being pulled from some prior study of Rho and if so, how reliable are these data? Or are they simply predictions based on Rho site bioinformatics? If it's the latter, then qRT-PCR data supporting the claims should be generated and shown.
– Figure 3C: It wasn't clear how the evolved clones examined in a plasmid-based assay in Figure 3C were chosen. Additionally, it was unclear why 7 of the 14 mutations "reconstructed" on plasmids didn't recapitulate the evolved behavior. This point raises the important concern that the paper is ultimately about how genomic context can influence evolution, but the "reconstruction" experiments involve placing a limited genomic region onto a plasmid to drive YFP, not TetA-YFP, production. Could it be that 7 of the cases in Figure 3C failed because the genomic context has changed? This should be better discussed. In addition, the authors should, for at least a handful of the 'failed' cases in Figure 3C, do proper reconstructions by engineering the putatively causal mutation into the ancestral strain background.
2) The presentation of results could be substantially improved. There is a general lack of primary data provided and many figures lack highly relevant details on the exact nature of the genomic context of each locus, both in the original strains and the evolved isolates.
– The authors should say something in the main text, not just the Materials and methods section, about (i) the rationale for choosing the four sites of insertion that they chose and (ii) the nature/genomic context of the four insertion sites. Genomic diagrams of the four insertion sites with flanking genes, etc should also be provided in the main Figure 1. One half of these regions is shown in Figure 4, but the other half is omitted and these diagrams should come earlier in the paper.
– "We verified the presence of IS5 at the boundary of the amplicon in rescued B populations (Figure 2C)." Figure 2C appears to contain only a schematic of locus B, with no data supporting the claim that IS5 is at the boundary of the amplified region, nor is there really any primary data demonstrating or validating the notion that the cassette was amplified.
Subsection “Properties of upstream genes determine the availability of two different types of adaptive promoter co-option mutations”: The use of a strain that is apparently free of all IS elements needs more explanation. The strain generated in Posfai et al., 2006, has actually been reduced by 15% and so lacks a wide range of genomic features. This could complicate the interpretation that the difference in mutational spectra in the two strains (Figure 3A) results from a lack of IS elements. The authors should more clearly discuss this issue and its impact on the interpretation of their results.
– In the same section: Without more details, it's difficult to assess or interpret the data in this section of the manuscript. It's not clear whether individual strains only have single mutations or multiple mutations and if it's the latter, were the individual mutations made? And while the nature of 'point mutations' is clear, it's not clear what the authors mean by mutations 'delivering full or partial promoters'. And in the cases where the reconstructed mutation does not increase the reporter, what's the explanation? Is it because there are other mutations?
3) There was a concern about whether the results depend on the precise way in which the selection was performed. The evolution is done with relatively small populations in microtiter plates that are diluted each day into fresh media whose tetracycline concentration increases by about 25% each day. Consequently, the populations are effectively in a race for increasing the expression of the tetA sufficiently fast to 'keep ahead' of the increasing tetracycline concentration. This suggests that even small differences in the initial expression levels of tetA at the different loci could have a large effect on the probability of survival. Thus, it seems plausible that the increased survival of clones with tetA at the B and D loci might be a result of higher initial expression at these loci. This might also explain puzzling observations like the fact that, in the IS-free case, rescue through point mutations in the promoter are observed 4 times at D but never at A or C, and the fact that rescue rates at the B locus vary across replicates even though CFP increase is observed almost without fail (table 1). The authors should quantify initial expression levels at each locus and investigate the effect of this on the probability of rescue.
Related to this, the authors should include a panel of 96 figures (one for each well of the plate) showing the time courses of OD, YFP/OD, and CFP/OD across the 10 days. Right now the authors only report numbers of rescued and numbers with YFP or YFP+CFP increase, but it is hard to judge if such a simple classification does justice to the potentially complex dynamics that is observed across populations.
Apart from the effect of initial expression, to what extent does the selection for 'fast increase in expression' bias the mutations that are observed to one type or another? To argue for the generality of the observations that the authors make, it would be useful to assess the rate of rescue in another setting where the type of selection is different, e.g. using a Luria-Delbrueck type experiment in which many cultures (with tetA at the different loci) are grown in media without tetracycline, with colonies counted on agar plates with tetracycline concentrations beyond the MIC. Does one again find mostly rescue of clones at B and D, even in the IS free case?
[Editors' note: further revisions were requested prior to acceptance, as described below.]
Thank you for submitting your article "Complex chromosomal neighborhood effects determine the adaptive potential of a gene under selection" for consideration by eLife. Your article has been reviewed by two peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Diethard Tautz as the Senior Editor. The reviewers have opted to remain anonymous.
The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.
Summary:
The reviewers are still generally positive and there was a consensus that no additional experiments or analyses are critical at this stage. However, there was a continued concern, also raised in the first round of review, that the Introduction is somewhat disorienting and excessively abstract. While the reviewers appreciate the effort to place the work in a broad and general context, they also felt strongly that the paper would benefit from a more direct, concrete exposition of what specific questions were addressed, what was done, and what was learned. The use of simple, straightforward language is encouraged. It's not a matter of "dumbing" down the Introduction, but making it clear and accessible. The comments of one reviewer are provided in full below as they will be helpful as you further revise the manuscript.
Essential revisions:
As I suspected the initial MIC's of the different constructs (cassette at locus A, B, C or D) are not the same, but even the initial B and D populations already have elevated MIC. The authors explain that they attempt to normalize for this difference by treating each construct with a concentration profile that is the same relative to the original MIC of that construct. That is, the constructs at locus D will be subjected to time-dependent anti-biotic concentrations that are about twice that of what the construct at locus A are subjected to (based on data presented in Figure 1—figure supplement 1).
I understand that this is the most reasonable way to correct for the differences in MIC of the initial populations, but I am not really convinced that it will now make the selective environments directly comparable. That is, it seems likely that, even if no beneficial mutations were to occur at all, substantial differences in the population sizes would remain and these might substantially affect the probability of generating beneficial mutants (i.e. just because of an elevated population size).
I think it would be good for the authors to add some discussion of this issue. I personally feel this issue is the main motivation for doing the Luria-Delbrueck like experiments (i.e. to check that the results are not specific to the precise way of performing the selection) and it might be worthwhile to mention this also.
Finally, regarding this point, although I feel that it still cannot be definitively said that the increased rescue of B and D constructs is solely due to the increased RATE of generating beneficial mutations rather than an increase in the size of the target population for such mutations, what one could definitely conclude is that, if this cassette were to be inserted in the genome through horizontal transfer, than rescue under selection with antibiotic is clearly highest when it is inserted into loci B or D, rather than at A or C.
The other comment I have is about presentation. I still find the introductory sections rather disorienting regarding what this paper is going to actually show. My impression is that this is due to a choice of presentation style which seems to aim to present the questions that the work addresses in as general and abstract terms as possible, leaving it typically up to the reader to connect the general abstract description to the actual concrete things that are being done. I find this rather tiresome to read. I believe the paper would become much more pleasant to read if the authors simply removed all attempts at phrasing large general abstract questions about evolution, and instead just say what exactly they do and what they find. The readers will then themselves immediately appreciate the generality of these findings.
(As an aside, I found the start of paragraph two in subsection “Different mutation types and their rate biases” a particularly striking example of general abstract phrasing that is almost impossible to parse, e.g. I have no idea what it means for mutation types to sustain adaptations.)
In the end it seems to me that the authors have a rather straight-forward and simple message: The rate at which genetic mutations occur that increase the expression level of a gene depends strongly on features of the genomic context of the gene, i.e. the rate at which the region is duplicated, the rate at which deletions or insertions cause promoter sequences to be placed upstream of the gene, and the rate of mutations causing read-through from neighboring genes. In contrast, apart from the read-through mutations, the EFFECT of the observed mutations, once introduced, is largely independent of this chromosomal context (as the experiments with the plasmids show).
Why not stress rather than obscure that these are the concrete results?
https://doi.org/10.7554/eLife.25100.042Author response
Essential revisions:
1) Some of the suggestions about how adaptation has occurred are incompletely substantiated. Additional experiments are needed to address these concerns; in most, if not all, cases, the necessary experiments are relatively straightforward.
– Results section; "All rescued populations displayed increased YFP fluorescence. Thus, rescue depended on the presence and overexpression of tetA-yfp." The second sentence doesn't logically follow from the first. The authors should test, at least in 1-2 cases, that selective deletion of TetA-YFP in the evolved clone eliminates rescue.
We agree that the logic of this sentence in isolation is incomplete. We now modified this sentence and combined it with the previous one to clarify that in the absence of the reporter cassette, rescue was never observed. We also performed the requested experiments: Figure 2B shows how resistance to tetracycline is lost in 3/3 cases in which we selectively deleted tetA-yfp from evolved clones derived from three different ancestral strains.
– "…or no upstream Rho-terminated transcripts were present (constraining adaptive Rho mutations, Figure 4A)." The notion that the Rho mutations allow read-through into tetA-YFP is interesting, but the claim that no upstream Rho-terminated transcripts exist in strains A and C needs to be substantiated. Is this information being pulled from some prior study of Rho and if so, how reliable are these data? Or are they simply predictions based on Rho site bioinformatics? If it's the latter, then qRT-PCR data supporting the claims should be generated and shown.
To our knowledge, there is no reliable way of inferring Rho termination sites using bioinformatics, because they show almost no conservation at the sequence level ((Ciampi, 2006), cited also in the revised main text) and only a handful of Rho-termination sites have been studied in detail. Rather, candidate Rho termination sites on a genomic level are found by the absence of signatures of intrinsic termination sites (stem-loop structures), which are more readily identifiable. The RNAseq study from which we drew the information on termination sites as shown in Figure 4A (Conway et al., 2014) used this approach, and combined experimental evidence for the end of a transcript (single-bp RNAseq) with the commonly used bioinformatic algorithm TransTermHP (Kingsford, Ayanbule, and Salzberg, 2007) to detect intrinsic termination sites. Importantly, the level and termination of transcripts can be condition-dependent, and our experimental conditions are not exactly the same as in the RNAseq study. As explained in the revised text and shown in Figure 4C, we therefore also generated direct RNA-level data to verify that there are transcripts spanning putative Rho-termination sites upstream of loci B and D in a way that is dependent on the Rho status (i.e. elevated transcript levels across the candidate terminator transcripts in the Rho mutant compared to the Rho wt). While we cannot completely rule out the presence of Rho-terminated active transcripts upstream of loci A and C, we did not find evidence for them at the level of RNA (Figure 4C) or at the phenotypic level (Figure 4B). As suggested by the reviewers, we also attempted to obtain RT-qPCR data to quantify RNA levels directly at candidate terminator sites upstream of all four loci, however we found this data difficult to interpret because of three reasons: (1) Despite optimization attempts, several of the qPCR primer pairs had very poor amplification efficiencies, likely because they spanned stem-loop structures that are typical of intrinsic termination sites. (2) Given the potentially global effect of Rho mutations on the transcriptome (Freddolino, Goodarzi, and Tavazoie, 2012), it is not obvious which genes could be used as valid reference genes to compare transcript levels in Rho-wt vs. mutant backgrounds. (3) Standard RT-qPCR data using small amplicons does not allow to draw conclusions about the directionality of read-through at two head-to-head facing terminators (see Figure 4—figure supplement 1 for such configurations), and it does not give information on whether read-through propagates all the way downstream to the reporter cassette insertion loci. Importantly, even in the absence of quantitative data on Rho-dependent read-through at terminators upstream of loci A-D, our interpretation is now supported by four lines of evidence: (1) Position and termination mode of transcripts and terminators as found in the RNA-seq study (Figure 4A). (2) The integration-locus-dependent effect of Rho mutations on tetracycline resistance, which is the phenotype under selection in our evolution experiments (Figure 4B). (3) RNA-level evidence (Figure 4C). (Andersson et al., 1998) Restriction of Rho mutations to strains with the reporter cassette at loci B and D (Figure 3, disregarding one Rho mutation in strain A which co-occurred with an upstream IS5 insertion that changes the upstream neighborhood at locus A).
– Figure 3C: It wasn't clear how the evolved clones examined in a plasmid-based assay in Figure 3C were chosen.
We agree that the section on mutation reconstructions on plasmids was originally written in a somewhat confusing way. We now placed this information in a separate section ‘Adaptation involves a broad variety of different mutation types’, which we expanded in order to clarify how and why we chose the mutations that we reconstructed, and how to interpret the results from reporter plasmids. Since in this part, we were interested in context-independent effects of mutations (hence the reconstruction on plasmids), we only reconstructed mutations that affected the sequence of p0, which is common to all strains. This included point mutations and a small deletion with p0 (Figure 3C), as well as IS insertions into p0 (Figure 3D). We only reconstructed mutations found in the first set of evolution experiments (i.e. those shown in Figure 3A). In Supplementary file 2, which contains information on every replicate population of every evolution experiment, we included a column ‘Reconstructed on reporter plasmid’ for easy identification of these mutations.
Additionally, it was unclear why 7 of the 14 mutations "reconstructed" on plasmids didn't recapitulate the evolved behavior. This point raises the important concern that the paper is ultimately about how genomic context can influence evolution, but the "reconstruction" experiments involve placing a limited genomic region onto a plasmid to drive YFP, not TetA-YFP, production. Could it be that 7 of the cases in Figure 3C failed because the genomic context has changed? This should be better discussed.
The issue of context-dependent mutation effects is indeed very central, and we tried to clarify it better throughout the text. We think that the particular concern of the reviewers here stems from a confusion rooted in the rather misleading way in which Figure 3 and its discussion in the text was originally presented. We split up Figure 3C of the original submission into three panels (Figure 3C-E) to aid the understanding of this figure. Figure 3C shows plasmid reconstructions of 6 unique mutations within p0 (one of them a small deletion). Figure 3D shows reconstructions of four different IS sequences that we had found inserted into p0 (IS5 at two different insertion points). For Figure 3D, we cloned 600 bp of the four IS directly upstream of the yfp-reporter to quantify effects on expression independent of the p0 insertion context. Figure 3C and 3D therefore show 10 primary mutations (not 14) analyzed in these experiments. 8 out of 10 of these reconstructed mutations did increase reporter fluorescence significantly. In the revised text, we discuss why the lack of reporter fluorescence from one point mutation (T-145C) does not represent a ‘failed’ reconstruction. The ‘failure’ of 1-2 IS insertion reconstruction is addressed in Figure 3E, which is a follow-up of Figure 3D. In Figure 3E, we investigate those IS insertions that did not increase yfp expression on plasmids when cloned directly upstream of the reporter (IS1 and IS5). For Figure 3E, we engineered the terminal 50 bp of these two IS within the p0 sequence at the precise point where we had found them inserted in evolved clones (hence, two reconstructions for IS5). For IS1, we observe reporter fluorescence that depends on the precise insertion point, which indicates a hybrid promoter at the insertion point. For IS5, we did not find evidence of a hybrid promoter. The ‘failure’ of the IS5 reconstruction is discussed in the main text and addressed in the newly included Figure 3—figure supplement 3 (see our reply to the next point).
In addition, the authors should, for at least a handful of the 'failed' cases in Figure 3C, do proper reconstructions by engineering the putatively causal mutation into the ancestral strain background.
As explained above, only one of the 10 tested mutations, the insertion of IS5 upstream of the reporter cassette can be considered as ‘failed’ in the sense of lacking reporter fluorescence on the plasmid reconstruction. We engineered one of the IS5 insertions from an evolved clone of strain A into the ancestral background and showed that it restores growth on tetracycline and tetA-yfp fluorescence. Thus, the activating effect of IS5 on downstream gene expression appears to depend indeed on the chromosomal context. The respective data is shown in Figure 3—figure supplement 3 and explained in the Results section.
2) The presentation of results could be substantially improved. There is a general lack of primary data provided and many figures lack highly relevant details on the exact nature of the genomic context of each locus, both in the original strains and the evolved isolates.
– The authors should say something in the main text, not just the Materials and methods section, about (i) the rationale for choosing the four sites of insertion that they chose and (ii) the nature/genomic context of the four insertion sites. Genomic diagrams of the four insertion sites with flanking genes, etc should also be provided in the main Figure 1. One half of these regions is shown in Figure 4, but the other half is omitted and these diagrams should come earlier in the paper.
We moved the section on the choice of the loci to the beginning of the Results, in which we explain our experimental system. We also corrected an error on the rational for choosing locus C. Genomic diagrams showing flanking genes both up- and downstream of the insertion loci are now shown in main Figure 1B. The chromosomal neighborhood at a larger scale with the position of insertion sequences that could provide flanking homology is shown in Figure 3—figure supplement 1, which also shows the regions in which the IS-free strains based on strain MDS42 differs from the MG1655-based ‘IS-wt’ strains.
– "We verified the presence of IS5 at the boundary of the amplicon in rescued B populations (Figure 2C)." Figure 2C appears to contain only a schematic of locus B, with no data supporting the claim that IS5 is at the boundary of the amplified region, nor is there really any primary data demonstrating or validating the notion that the cassette was amplified.
We included an agarose gel as part of Figure 2D, which shows the presence of the PCR product corresponding to the expected IS5I/H junction in evolved populations with increased CFP fluorescence, and the absence of the junction in the ancestral genotype and amplified populations from strain B∆IS5I, in which one of the flanking IS is missing.
We validated the amplification of the reporter cassette in populations with increased CFP fluorescence by qPCR on genomic DNA extracted from several populations evolved from different ancestor strains. We agree that using CFP as a marker of amplification is a central pillar of this study and that we needed to make more clear how it was validated. Therefore, for the revised version, we moved the respective figure that shows a correlation between CFP fluorescence and genomic DNA copy number from the supplement to main Figure 1E. The respectively extended part of the revised text is now at the end of the first section in the Results.
Subsection “Properties of upstream genes determine the availability of two different types of adaptive promoter co-option mutations”: The use of a strain that is apparently free of all IS elements needs more explanation. The strain generated in Posfai et al., 2006, has actually been reduced by 15% and so lacks a wide range of genomic features. This could complicate the interpretation that the difference in mutational spectra in the two strains (Figure 3A) results from a lack of IS elements. The authors should more clearly discuss this issue and its impact on the interpretation of their results.
Posfai et al. performed several different tests on mutation rates and spectra of strain MDS41, a close relative of MDS42, the parent strain of our IS-free strains, and compared mutation rates to MG1655, the parent strain of our IS-wt strains. They concluded that the difference in the total mutation rate between the two strains is fully explained by the lack of IS-mediated mutations in MDS41; mutations of all other tested types were found to occur at similar rates in both strains. We now explain this at the beginning of the new Results section “Adaptation involves a broad diversity of mutation types”. We also added Figure 3—figure supplement 1 to show which regions in the larger neighborhood of our insertion loci have been deleted in the MDS42 background. We cannot exclude that the deletions in the MDS42 background have effects on adaptation in our experiments that we are not aware of. For example, deletions may affect regulation of genes in the neighborhood of our loci. Therefore, we have avoided quantitative comparisons of adaptation between IS-wt and IS-free strains. Rather, given that the only difference within the sets of IS-wt and IS-free strains is the integration locus of the reporter cassette, we interpret differences in adaptation within these sets of strains as indicators of neighborhood effects. We then compare the differences found in the set of IS-wt strains and in the set of IS-free strains to rationalize whether these differences are dependent on the local neighborhood (as is the case for promoter co-opting mutations which are locus-specific in both sets) or on the more global neighborhood (as is the case for amplifications mediated by flanking homologous IS elements).
– In the same section: Without more details, it's difficult to assess or interpret the data in this section of the manuscript. It's not clear whether individual strains only have single mutations or multiple mutations and if it's the latter, were the individual mutations made? And while the nature of 'point mutations' is clear, it's not clear what the authors mean by mutations 'delivering full or partial promoters'. And in the cases where the reconstructed mutation does not increase the reporter, what's the explanation? Is it because there are other mutations?
As explained in our reply on mutation reconstructions on plasmids (see above), we have largely expanded the section in the Results to clarify these questions raised be the reviewers. Multiple mutations found in the same clone are indicated by colored dots on bars shown in Figure 3A, some of these multiple mutations are explained at respective points in the text (e.g. mutations that occur with amplifications are investigated in the section “Chromosomal neighborhood influences adaptation by affecting the fitness cost of amplifications” of the Results). By mutations ‘delivering full or partial promoters’ we mean IS elements that contain promoters, which can drive expression of genes downstream of their insertion point (IS2, IS3), or that contain the upstream part of promoters which require a corresponding sequence downstream at the point of insertion (IS1) (Figure 3D and E). Cases ‘where the reconstructed mutation does not increase the reporter’ are discussed above in our reply to the last point of part (1) of the decision letter. After our initial sequencing (of clones from rescued populations from IS-wt strains of the first replicate experiment set), which only included the upstream sequence of the tetA-yfp gene, we did have four unexplained cases of adaptations without a known candidate causative mutation. We addressed these four cases with whole-genome sequencing, and discovered Rho mutations in three of them – as explained at the beginning of the section “Properties of upstream genes determine the availability of two different types of adaptive promoter co-option mutations” and in Figure 3—figure supplement 4. For all other experiments (IS-free strains and additional replicate experiment sets), candidate adaptive mutations were then found using Sanger sequencing of the tetA-yfp upstream region and the rho gene. In this way, we found a candidate adaptive mutation for every rescued population, with a few exceptions that we did not follow up on.
3) There was a concern about whether the results depend on the precise way in which the selection was performed. The evolution is done with relatively small populations in microtiter plates that are diluted each day into fresh media whose tetracycline concentration increases by about 25% each day. Consequently, the populations are effectively in a race for increasing the expression of the tetA sufficiently fast to 'keep ahead' of the increasing tetracycline concentration. This suggests that even small differences in the initial expression levels of tetA at the different loci could have a large effect on the probability of survival. Thus, it seems plausible that the increased survival of clones with tetA at the B and D loci might be a result of higher initial expression at these loci. This might also explain puzzling observations like the fact that, in the IS-free case, rescue through point mutations in the promoter are observed 4 times at D but never at A or C, and the fact that rescue rates at the B locus vary across replicates even though CFP increase is observed almost without fail (table 1).
Our understanding of the evolutionary rescue scenario (‘adapt or die out’) faced by evolving populations matches exactly what the reviewers describe as a ‘race for increasing the expression of tetA-yfp sufficiently fast to ‘keep ahead’ of the increasing tetracycline concentration. We now included a sentence at the beginning of the Results section that explicitly states this: ‘Rescue from extinction requires the spread of adaptive mutations in a race against population decline.’ We also agree with the reviewers that the initial level of tetA-yfp expression is expected to have a large effect on survival, as it sets the decline rate of the unadapted genotype (see (Martin et al., 2013) for an accessible description of the mathematical framework used to describe evolutionary rescue and the impact of peculiarities of evolution experiments such as periodic bottlenecking). Since we did not want to study the effect of chromosomal location on initial expression (for which our experiments would have been a very complicated way to do so), but the effect of chromosomal location on adaptive mutations that can change expression, we designed our experiments to account for initial expression differences as best as we can. In the revised text, we have made it more clear why and how exactly we did so. The respective section at the beginning of the Results starts with the sentence “The probability of evolutionary rescue depends on the size and decline rate…”.
Concerning the numbers of rescue by point mutations observed in different IS-free strains, numbers are too low to draw conclusions supported by statistics.
We agree that the variability in the number of rescued populations of strain B between replicate experiments is likely an effect of fluctuations in the relatively small population size at the time of daily transfer. Although we did not quantify this explicitly, we think that the largest component causing such fluctuations comes from variability in the amount of liquid (around 2 µL) transferred with the pin inoculator that we used (and of course from the inherent stochasticity of mutations). We mention this also in the revised text (at the end of the section “The chromosomal location of a selected gene has large effects on adaptation” in the Results section).
The authors should quantify initial expression levels at each locus and investigate the effect of this on the probability of rescue.
Since initial expression levels of tetA-yfp are very low (although maybe surprisingly not zero, as might be expected from a randomized upstream sequence as p0), we could not use YFP fluorescence to quantify initial expression. What is more relevant in our experiments, and apparently also much more sensitive, are differences in tolerance to tetracycline between strains. We quantified these differences by measuring dose-response curves of each strain to tetracycline at a high resolution of tetracycline concentration (Figure 1—figure supplement 1, to which we added explicit MIC values for each strain in the revised version). We consider differences in the MIC as a good proxy for initial expression levels at each locus, given that apart from the integration locus strains are isogenic. To account for initial expression levels in evolution experiments, we adjusted tetracycline concentrations to the initial MIC levels. We made this also more explicit in the main text (starting with “Given the otherwise isogenic background of strains, …”).
Related to this, the authors should include a panel of 96 figures (one for each well of the plate) showing the time courses of OD, YFP/OD, and CFP/OD across the 10 days. Right now the authors only report numbers of rescued and numbers with YFP or YFP+CFP increase, but it is hard to judge if such a simple classification does justice to the potentially complex dynamics that is observed across populations.
The requested figures are now found in Supplementary file 1, which we also refer to in the main text. Certainly, adaptation dynamics are more complex than suggested by the fluorescence phenotype classification and time-resolved fluorescence data across the 10 days can be informative about these dynamics. Since we have sequencing data however only for the endpoint of the experiment (day 10), interpreting these dynamics is hard. We therefore decided to analyze the temporal dynamics of fluorescence only in relation to the specific questions that came up during our investigation and that could be addressed with it (i.e. the section on amplification cost).
Apart from the effect of initial expression, to what extent does the selection for 'fast increase in expression' bias the mutations that are observed to one type or another? To argue for the generality of the observations that the authors make, it would be useful to assess the rate of rescue in another setting where the type of selection is different, e.g. using a Luria-Delbrueck type experiment in which many cultures (with tetA at the different loci) are grown in media without tetracycline, with colonies counted on agar plates with tetracycline concentrations beyond the MIC. Does one again find mostly rescue of clones at B and D, even in the IS free case?
Clearly, the precise way in which selection is imposed should matter for the outcome of the experiment. We mention this rather early in the Results section (“… illustrating how our experimental selection filters for mutations that increase tetA-yfp expression above a minimum level.”). It is known that the precise way in which conditions deteriorate can affect the genetic architecture of adaptations, by making particular routes to adaptation inaccessible (Lindsey et al., 2013). In our particular experiment, the gradual increase in tetracycline concentration is expected to favor amplifications, which according to the ‘canonical’ model are built up in a sequential process that starts from an initial duplication (Romero and Palacios 1997). We included a new section and Figure (‘Chromosome neighborhood effects on adaptation in a single-step plating experiment’ and Figure 6), in which we present the results of plating experiments as suggested by the reviewers. Importantly, since selection on tetracycline plates is not stringent, i.e. sensitive clones may grow at very low rates even at tetracycline concentrations above the MIC, the results of these experiments should not be interpreted in the same way as the classical Luria-Delbrueck fluctuation experiment. This is because mutations may occur also after plating, which may cause a misinterpretation of mutation rates calculated using colony counts (Foster 2006). However if colonies are counted at the earliest possible time point (Day 2 in Figure 6), we expect colony numbers to report mostly on the locus-specific rate of single-step mutations, i.e. point mutations, IS insertions, and promoter co-option mutations. At later time points (Day 5 in Figure 6), multi-step adaptations such as amplifications (and possibly other multi-step adaptations) become dominant. The dynamics of colony appearance in our plating experiment recapitulates several aspects of Cairns’ classic lacZ frameshift reversion experiment (Cairns, Overbaugh, and Miller 1988), which has been linked to transient amplification of the selected gene (Andersson 1998) in a process that heavily depends on the position of the lacZ gene in a way similar to our system (Slechta et al., 2002). Regardless of the temporal dynamics of colony appearance, rescued clones are found mostly with the reporter cassette at loci B and D, also in the IS-free case, which recapitulates the results from our evolution experiments in liquid culture.
[Editors' note: further revisions were requested prior to acceptance, as described below.]
Summary:
The reviewers are still generally positive and there was a consensus that no additional experiments or analyses are critical at this stage. However, there was a continued concern, also raised in the first round of review, that the Introduction is somewhat disorienting and excessively abstract. While the reviewers appreciate the effort to place the work in a broad and general context, they also felt strongly that the paper would benefit from a more direct, concrete exposition of what specific questions were addressed, what was done, and what was learned. The use of simple, straightforward language is encouraged. It's not a matter of "dumbing" down the Introduction, but making it clear and accessible. The comments of one reviewer are provided in full below as they will be helpful as you further revise the manuscript.
We thank the reviewers and in particular the author of the below review for their specific criticism and their concrete suggestions, which we implemented as detailed in the following.
We largely restructured the Introduction and removed most of the opening paragraph. To improve readability and focus, we also shortened the section on different mutation types and their position biases. The last paragraph of the Introduction now contains a specific exposition of our research question, the methodology, the results and the conclusions.
Essential revisions:
As I suspected the initial MIC's of the different constructs (cassette at locus A, B, C or D) are not the same, but even the initial B and D populations already have elevated MIC. The authors explain that they attempt to normalize for this difference by treating each construct with a concentration profile that is the same relative to the original MIC of that construct. That is, the constructs at locus D will be subjected to time-dependent anti-biotic concentrations that are about twice that of what the construct at locus A are subjected to (based on data presented in Figure 1—figure supplement 1).
Yes, this is correct.
I understand that this is the most reasonable way to correct for the differences in MIC of the initial populations, but I am not really convinced that it will now make the selective environments directly comparable.
Agreed. The correction for initial MIC differences is no direct correction for population size differences throughout the experiment. The correction rather addresses the otherwise large population size differences at the beginning of the experiment, making selective environments as comparable as possible in a practical way. We have added an explanatory sentence on the purpose of the MIC correction in the caption of Figure 1—figure supplement 1.
That is, it seems likely that, even if no beneficial mutations were to occur at all, substantial differences in the population sizes would remain and these might substantially affect the probability of generating beneficial mutants (i.e. just because of an elevated population size).
I think it would be good for the authors to add some discussion of this issue.
We now discuss this possibility in the section on the Luria-Delbrueck like experiments. We have also modified a sentence earlier in the Results section, which previously may have implied that results from strains are perfectly comparable.
I personally feel this issue is the main motivation for doing the Luria-Delbrueck like experiments (i.e. to check that the results are not specific to the precise way of performing the selection) and it might be worthwhile to mention this also.
We have now explicitly mentioned the above concern as a motivation for the Luria-Delbrueck like experiments and explain how these experiments address this potential problem.
Finally, regarding this point, although I feel that it still cannot be definitively said that the increased rescue of B and D constructs is solely due to the increased RATE of generating beneficial mutations rather than an increase in the size of the target population for such mutations, what one could definitely conclude is that, if this cassette were to be inserted in the genome through horizontal transfer, than rescue under selection with antibiotic is clearly highest when it is inserted into loci B or D, rather than at A or C.
Yes, this conclusion is definitely valid. We have now included it in the Discussion along with the relevance of our results for horizontal gene transfer.
The other comment I have is about presentation. I still find the introductory sections rather disorienting regarding what this paper is going to actually show. My impression is that this is due to a choice of presentation style which seems to aim to present the questions that the work addresses in as general and abstract terms as possible, leaving it typically up to the reader to connect the general abstract description to the actual concrete things that are being done. I find this rather tiresome to read. I believe the paper would become much more pleasant to read if the authors simply removed all attempts at phrasing large general abstract questions about evolution, and instead just say what exactly they do and what they find. The readers will then themselves immediately appreciate the generality of these findings.
As explained in our reply to the reviewing editor’s summary, we have removed the respective parts of the Introduction and added a specific summary of our research question and our results at the end of the Introduction.
(As an aside, I found the start of paragraph two in subsection “Different mutation types and their rate biases” a particularly striking example of general abstract phrasing that is almost impossible to parse, e.g. I have no idea what it means for mutation types to sustain adaptations.)
We removed this sentence.
In the end it seems to me that the authors have a rather straight-forward and simple message: The rate at which genetic mutations occur that increase the expression level of a gene depends strongly on features of the genomic context of the gene, i.e. the rate at which the region is duplicated, the rate at which deletions or insertions cause promoter sequences to be placed upstream of the gene, and the rate of mutations causing read-through from neighboring genes. In contrast, apart from the read-through mutations, the EFFECT of the observed mutations, once introduced, is largely independent of this chromosomal context (as the experiments with the plasmids show).
Why not stress rather than obscure that these are the concrete results?
Understood. Our main message is now summarized in the last paragraph of the Introduction of our manuscript. We thank the reviewer for these specific suggestions, which helped make our manuscript more accessible.
https://doi.org/10.7554/eLife.25100.043Article and author information
Author details
Funding
No external funding was received for this study.
Acknowledgements
We thank M Ackermann, N Barton, J Bollback, J Jäger, members of the Barton, Bollback, Bollenbach and Guet groups, and especially M Pleška for comments on earlier versions of the manuscript. We thank F Korč for assistance with the data analysis script.
Reviewing Editor
- Michael T Laub, Massachusetts Institute of Technology, United States
Publication history
- Received: January 12, 2017
- Accepted: June 15, 2017
- Version of Record published: July 25, 2017 (version 1)
Copyright
© 2017, Steinrueck et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 2,104
- Page views
-
- 349
- Downloads
-
- 9
- Citations
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Computational and Systems Biology
Cycling of co-substrates, whereby a metabolite is converted among alternate forms via different reactions, is ubiquitous in metabolism. Several cycled co-substrates are well known as energy and electron carriers (e.g. ATP and NAD(P)H), but there are also other metabolites that act as cycled co-substrates in different parts of central metabolism. Here, we develop a mathematical framework to analyse the effect of co-substrate cycling on metabolic flux. In the cases of a single reaction and linear pathways, we find that co-substrate cycling imposes an additional flux limit on a reaction, distinct to the limit imposed by the kinetics of the primary enzyme catalysing that reaction. Using analytical methods, we show that this additional limit is a function of the total pool size and turnover rate of the cycled co-substrate. Expanding from this insight and using simulations, we show that regulation of these two parameters can allow regulation of flux dynamics in branched and coupled pathways. To support these theoretical insights, we analysed existing flux measurements and enzyme levels from the central carbon metabolism and identified several reactions that could be limited by the dynamics of co-substrate cycling. We discuss how the limitations imposed by co-substrate cycling provide experimentally testable hypotheses on specific metabolic phenotypes. We conclude that measuring and controlling co-substrate dynamics is crucial for understanding and engineering metabolic fluxes in cells.
-
- Computational and Systems Biology
- Neuroscience
Seizure generation, propagation, and termination occur through spatiotemporal brain networks. In this paper, we demonstrate the significance of large-scale brain interactions in high-frequency (80-200 Hz) for identification of the epileptogenic zone (EZ) and seizure evolution. To incorporate the continuity of neural dynamics, here we have modeled brain connectivity constructed from stereoelectroencephalography (SEEG) data during seizures using multilayer networks. After introducing a new measure of brain connectivity for temporal networks, named multilayer eigenvector centrality (mlEVC), we applied a consensus hierarchical clustering on the developed model to identify the epileptogenic zone (EZ) as a cluster of nodes with distinctive brain connectivity in the ictal period. Our algorithm could successfully predict electrodes inside the resected volume as EZ for 88% of participants, who all were seizure-free for at least 12 months after surgery. Our findings illustrated significant and unique desynchronization between EZ and the rest of the brain in early to mid-seizure. We showed that aging and duration of epilepsy intensify this desynchronization, which can be the outcome of abnormal neuroplasticity. Additionally, we illustrated that seizures evolve with various network topologies, confirming the existence of different epileptogenic networks in each patient. Our findings suggest not only the importance of early intervention in epilepsy but the possible factor which correlates with disease severity. Moreover, by analyzing the propagation patterns of different seizures, we asserted the necessity of collecting sufficient data for identifying the epileptogenic networks.