The β-alanine transporter BalaT is required for visual neurotransmission in Drosophila

  1. Yongchao Han
  2. Liangyao Xiong
  3. Ying Xu
  4. Tian Tian
  5. Tao Wang  Is a corresponding author
  1. Graduate School of Peking Union Medical College, Chinese Academy of Medical Sciences, China
  2. National Institute of Biological Sciences, China
  3. Peking University, China
  4. Beijing Normal University, China


The recycling of neurotransmitters is essential for sustained synaptic transmission. In Drosophila, histamine recycling is required for visual synaptic transmission. Synaptic histamine is rapidly taken up by laminar glia, and is converted to carcinine. After delivered back to photoreceptors, carcinine is hydrolyzed to release histamine and β-alanine. This histamine is repackaged into synaptic vesicles, but it is unclear how the β-alanine is returned to the laminar glial cells. Here, we identified a new β-alanine transporter, which we named BalaT (Beta-alanine Transporter). Null balat mutants exhibited lower levels of β-alanine, as well as less β-alanine accumulation in the retina. Moreover, BalaT is expressed and required in retinal pigment cells for maintaining visual synaptic transmission and phototaxis behavior. These results provide the first genetic evidence that retinal pigment cells play a critical role in visual neurotransmission, and suggest that a BalaT-dependent β-alanine trafficking pathway is required for histamine homeostasis and visual neurotransmission.

eLife digest

Neurons transmit information around the body in the form of electrical signals, but these signals cannot cross the gaps between neurons. To send a message to its neighbor, a neuron releases a molecule known as a neurotransmitter into the gap between the cells. The neurotransmitter binds to proteins on the recipient neuron and triggers new electrical signals inside that cell. When the message has been received, the neurotransmitter molecules are returned to the first neuron so that they can be reused.

This recycling is particularly important in the visual system, where neurons communicate via rapid-fire signaling. In fruit flies, for example, light-sensitive neurons in the eye known as photoreceptors release a neurotransmitter called histamine when they detect light. Supporting cells called laminar glia take up any leftover histamine and combine it with another molecule known as β-alanine to form a larger molecule. The photoreceptors absorb this larger molecule and break it back down into histamine and β-alanine. However, it is not clear how the β-alanine returns to the glia to allow this cycle to continue.

Many molecules rely on so-called “transporter” proteins to help them move into or out of cells. To identify transporters that might help to move β-alanine, Han, Xiong et al. prepared a list of fruit fly genes that encode transporter proteins found inside the insect’s head. Testing the resulting proteins in a cultured cell system revealed that one of them was able to transport β-alanine. This protein, named BalaT, is found in another type of support cell called retinal pigment cells. Mutant flies that cannot produce BalaT are blind because their photoreceptors have problems in transmitting information to other neurons.

Han, Xiong et al. propose that BalaT transports β-alanine from photoreceptors to retinal pigment cells, which then pass β-alanine on to the laminar glia. Follow-up studies are required to find out exactly how the laminar glia take up histamine.


Efficient clearance of neurotransmitters from the synaptic cleft is crucial for terminating a synaptic signal. These cleared neurotransmitters must then be recycled for sustained synaptic transmission (i.e., to maintain stable levels of transmitters) (Blakely and Edwards, 2012). Neurons that utilize histamine as a neurotransmitter play important roles in a variety of biological processes, including cognition, sleep, and metabolism, and dysfunction of the histaminergic system in the brain has been linked to multiple neurological diseases (Haas et al., 2008; Panula and Nuutinen, 2013). Histamine is particularly important in the Drosophila visual system (Hardie, 1989), and histamine recycling is the dominant pathway for maintaining adequate levels of histamine in adult photoreceptors (Borycz et al., 2002). In this system, and in mammalian systems as well, the histamine recycling process involves both neurons and glial cells that surround the synapse (Edwards and Meinertzhagen, 2010; Yoshikawa et al., 2013). In fact, a network of glia cells and pigment cells interconnected via gap junctions plays a key role in the long-distance recycling of histamine in the Drosophila visual system (Chaturvedi et al., 2014). However, the mechanisms by which this cellular network recycles histamine and its metabolites are unknown.

Once histamine is released by a photoreceptor into the optic lamina, it is quickly removed from the synaptic cleft by epithelia glial cells that surround the synapse. In these laminar glia, histamine is conjugated to β-alanine by an N-β-alanyl-dopamine synthase, called Ebony, to form the inactive metabolite, carcinine (Borycz et al., 2002; Richardt et al., 2003, 2002). Recently, a carcinine transporter, CarT that is responsible for the uptake of carcinine from the synaptic cleft into photoreceptors has been identified (Chaturvedi et al., 2016; Stenesen et al., 2015; Xu et al., 2015). The discovery that CarT retrieves carcinine directly from the laminar synaptic cleft indicates that carcinine is not transported from laminar glia to photoreceptor cell bodies through a long-distance trafficking mechanism involving the laminar glial and pigment cell network.

Within photoreceptors, carcinine is hydrolyzed to generate histamine and β-alanine, a reaction catalyzed by an N-β-alanyl-dopamine hydrolase called Tan (Borycz et al., 2002; True et al., 2005). This regenerated histamine is then repackaged into synaptic vesicles for subsequent light-induced release, but it is unclear how β-alanine is returned to the laminar glial cells (where it is needed to inactivate histamine). It is also unclear whether β-alanine recycling is required for visual transmission. The finding that high levels of β-alanine are detected in retinal pigment cells suggested that pigment cells may be critical for the transport and storage of β-alanine in this system (Borycz et al., 2012; Chaturvedi et al., 2014). To address these questions, we sought to determine whether there was a β-alanine transporter that was required for Drosophila vision transmission.

Here, we identified BalaT, which is a plasma membrane transporter capable to transporting β-alanine into cells. Mutations in the balat gene disrupted photoreceptor synaptic transmission, phototaxis behaviors, and contents and retinal distribution of β-alanine. BalaT expression in retinal pigment cells completely rescued the defective visual transmission of balat mutants. Furthermore, the gap junction proteins Inx1 and Inx3 were required in retinal pigment cells for visual neurotransmission. We therefore provide evidence for a novel β-alanine recycling pathway, in which β-alanine that is released from photoreceptor cells is taken up and stored by retinal pigment cells, and then delivered to laminar glia via gap junctions, where histamine is inactivated by conjugation with β-alanine.


CG3790 transports β-alanine in vitro

In Drosophila photoreceptors, carcinine is hydrolyzed to form histamine and β-alanine (True et al., 2005; Wagner et al., 2007). Histamine is then released as a neurotransmitter, taken up by laminar glial cells, and then conjugated with β-alanine to form carcinine. Although it is known that CarT transports carcinine into photoreceptors, it is unclear how β-alanine is delivered to laminar glia. To begin to understand this process, we sought to identify a β-alanine transporter in the fly visual system. We speculated that a transporter responsible for β-alanine uptake would likely be enriched in fly heads, so we examined previous RNA-seq data comparing mRNAs isolated from the head with mRNAs isolated from the body (Xu and Wang, 2016). Among ~600 putative transmembrane transporters encoded by the Drosophila genome, we identified 20 head-enriched genes (Table 1) that represented potential β-alanine transporters (Figure 1A).

Figure 1 with 3 supplements see all
CG3790 is a retina-enriched β-alanine transporter.

(A) Screening for a β-alanine transporter. HEK293T cells transiently expressing one of ~20 head-enriched potential transporters were exposed to [3H]-β-alanine, which was added to the ECF buffer (final concentration 3.7 × 104 Bq). RFP (red fluorescent protein) was expressed as a negative control. (B) CG3790 transported β-alanine into S2 cells. Mouse GAT3 and RFP were used as positive and negative control, respectively. The results given are the mean values ± S.D. of four experiments. (C–D) CG3790 was expressed at high levels in the compound eye. (C) Relative RNA transcript levels (RT-PCR experiments) show that CG3790 expression is enriched in wild-type (w1118) heads compared with wild-type bodies or GMR-hid heads. (D) Relative CG3790 transcript levels from wild-type (wt) bodies, wt heads, and GMR-hid heads (gpdh served as an internal control). RNA levels were normalized to levels in wt bodies, which were set to 1. Error bars indicate standard deviations (SDs) from three replicate experiments. Significant differences between candidates and control were determined using unpaired t-tests (**p<0.01; ns, not significant). (E) S2 cells were transiently transfected with 3xFlag-tagged CG3790, and then labeled with Flag antibody (green) and DAPI (blue). Scale bar, 2 μm.
Figure 1—source data 1

Relates to Figure 1A and B.

[3H]-β-alanine uptake data for screening for β-alanine transporter in HEK 293 T cells and S2 cells (.xlsx file).
Figure 1—source data 2

Relates to Figure 1D.

Relative CG3790 transcript levels from wild-type (wt) bodies, wt heads, and GMR-hid heads. RNA levels were normalized to levels in wt bodies, which were set to 1 (.xlsx file).
Table 1

Description of 20 head-enriched genes.
CG numberNameDescription
Organic anion transmembrane transporter activity
 CG18660Nckx30CSodium/potassium/calcium exchanger
 CG2893zydecoPotassium-dependent sodium/calcium exchanger
Organic anion transmembrane transporter activity
 CG13610Orct2Organic cation transporter
 CG6331OrctOrganic anion transmembrane transporter activity
Organic anion transmembrane transporter activity
Nucleic acid binding
 CG3159Eaat2L-aspartate transmembrane transporter activity
Sodium/solute symporter
 CG11010Ent3Nucleoside transmembrane transporter activity
Amino acid transporter
Neurotransmitter transporter activity
 CG4545SerTMonoamine transmembrane transporter activity
EamA domain
Neurotransmitter transporter activity
 CG7442SLC22ACholine transmembrane transporter activity
Sodium/solute symporter
Amino acid/polyamine transporter I
Solute carrier family 35 member F3/F4

To determine if any of these candidate transporters could transport β-alanine, we used HEK293T cells to perform uptake assays. Each candidate was transiently expressed in HEK293T cell, and their ability to uptake [3H]-β-alanine was assessed. Only one candidate transporters, CG3790, exhibited β-alanine uptake activity (Figure 1A). The β-alanine content of CG3790-transfected cells was approximately 119 Bq/mg, which was 2.7-fold greater than measured for mock- or RFP-transfected controls (55 and 53 Bq/mg, respectively). CG3790 shares significant amino acid identity with the mammalian solute carrier family 22 (SLC22), which includes both mouse and human OCT3 (Figure 1—figure supplement 1). The β-alanine transporting activity of CG3790 was further confirmed in S2 cells (Figure 1B). Mouse GAT3 (GABA transporter type 3), which is known to efficiently take up β-alanine, exhibited levels of β-alanine transporting activity that were similar to CG3790, suggesting that CG3790 is a bona fide β-alanine transporter (Christiansen et al., 2007) (Figure 1B). We next sought to determine whether CG3790 is a specific β-alanine transporter in Drosophila. Because a histamine transporter has not yet been identified, we first asked whether CG3790 is able to transport histamine. Histamine uptake assays revealed that CG3790 does not exhibit histamine uptake activity. As a control, the human Organic Cation Transporter (OCT2), which is known to take up histamine, exhibited high levels of histamine transport activity when expressed in S2 cells (Figure 1—figure supplement 2A). Since mGAT3 is also a GABA transporter, we asked whether CG3790 is able to transport GABA. While mGAT3 efficiently transported GABA, CG3790 did not exhibit GABA transporting activity when expressed in S2 cells (Figure 1—figure supplement 2B). Moreover, when we expressed Flag-tagged CG3790 in S2 cells the Flag signal localized exclusively to the plasma membrane (Figure 1E). These data suggest that CG3790 encodes a plasma membrane β-alanine transporter.

To further confirm that the CG3790 transporter functions in the fly head, we performed quantitative PCR comparing mRNAs isolated from wild-type heads, wild-type bodies, or heads from GMR-hid flies, which are devoid of eyes. As is seen with other eye-specific genes including ninaE (neither inactivation nor afterpotential E), which is expressed exclusively in photoreceptor cells (O'Tousa et al., 1985), and pdh (pigment-cell-enriched dehydrogenase), which is expressed exclusively in retinal pigment cells) (Wang et al., 2010), CG3790 mRNA transcripts were absent from fly bodies (Figure 1C–D and Figure 1—figure supplement 3A–B). Ectopic expression of the pre-apoptotic gene hid via the glass multiple reporter (GMR) promoter results in eye ablation (Grether et al., 1995; Hay et al., 1994). As such, ninaE and pdh expression is greatly reduced in the heads of GMR-hid flies. Similarly, CG3790 transcript levels were also greatly reduced in the heads of GMR-hid flies, suggesting that CG3790 is primarily expressed in the fly compound eye (Figure 1C–D and Figure 1—figure supplement 2A–B). These findings indicate that CG3790 encodes a retina-enriched plasma membrane β-alanine transporter. We therefore named this gene balat (beta-alanine transporter).

BalaT is required for visual synaptic transmission

To study the function of BalaT in visual perception, we generated two null mutations in the balat gene by deleting ~900 bp and ~660 bp genomic fragments using the CRISPR-associated single-guide RNA system (Cas9) (Figure 2A). PCR amplification of the balat locus from genomic DNA isolated from wild-type, balat1, and balat2 flies revealed a truncated balat locus in the mutant samples. Thus, the balat locus is disrupted in balat1 and balat2 flies (Figure 2B).

Figure 2 with 1 supplement see all
Mutations in balat disrupt photoreceptor cell synaptic transmission and visual behavior.

(A) Schematic for balat knock-out by sgRNA targeting. The organization of the balat locus and the expected structures of balta1 and balat2 alleles are shown. Boxes represent exons with the coding region between ATG and TAG. The sgRNA1 and sgRNA2 primer pair was used to generate the balat1 allele; the sgRNA2 and sgRNA3 primer pair was used to generate the balat2 allele. Arrows indicate the primers used for genomic PCR. (B) PCR products obtained from balat1 and balat2 mutants show successful gene deletions. (C) ERG recordings from: wild-type (w1118), balat1, balat2, balat1;GMR-balaT, balat1;pdh-balaT, balat2;ninaE-balaT and w+; balat1 flies. Young flies (<3 days after eclosion) were dark adapted for 1 min and subsequently exposed to a 5 s pulse of orange light. ON and OFF transients are indicated by arrows. All flies contained the w1118 mutation except for the w+; balat1 flies. (D) Quantitative analysis of the amplitudes of ERG OFF transients shown in C. (E) Phototaxis behaviors of wt, balat1 balat1;GMR-balaT, balat1;pdh-balaT and balat2;ninaE-balaT flies. Significant differences between mutant and wild-type flies were determined using unpaired t-tests (***p<0.001; ns, not significant).
Figure 2—source data 1

Relates to Figure 2D and E.

Quantitative analysis of the amplitudes of ERG OFF transients about wild-type (w1118), balat1, balat2, balat1;GMR-balaT, balat1;pdh-balaT, balat2;ninaE-balaT and w+; balat1 flies. Quantitative of phototaxis behaviors of wt, balat1 balat1;GMR-balaT, balat1;pdh-balaT and balat2;ninaE-balaT flies (.xlsx file).

These balat mutations did not cause lethality or other visible phenotypes, so we performed electroretinogram (ERG) recordings to determine whether BalaT functions in phototransduction. Exposing wild-type flies to light results in two primary components in the ERG recording, including a sustained corneal negative response resulting from photoreceptor depolarization, and ‘on’ and ‘off’ transients resulting from postsynaptic neuronal activity in the optic lamina (downstream of the photoreceptors) (Wang and Montell, 2007) (Figure 2C). Mutations in genes that disrupt histamine recycling exhibit reduced ‘on’ and ‘off’ transients, reflecting defective synaptic transmission of photoreceptors (Xu et al., 2015). Similarly, both balat1 and balat2 mutant flies lacked ERG ‘on’ and ‘off’ transients, indicating that BalaT is required for visual synaptic transmission (Figure 2C and D, and Figure 2—figure supplement 1). To confirm that the loss of ERG transients resulted from mutation of the balat locus, we generated a GMR-balat transgenic fly, which expresses BalaT in the compound eyes under control of the GMR promoter. The GMR-balat transgene completely rescued the ‘on’ and ‘off’ transients when crossed into the balat1 mutant flies (Figure 2C). Mutations in the white gene, which encodes an ATP-binding cassette (ABC) transporter, has been reported to affect histamine levels (Borycz et al., 2008). To make sure that the white mutation was not affecting ERG phenotypes exhibited by balat mutants, we crossed the balat mutation into a wild-type white (w+) background and found that ‘on’ and ‘off’ transients were still absent in this w+; balat1 fly (Figure 2C and D).

Disrupting visual transmission results in blindness, which is reflected in the loss of phototaxis behavior (Behnia and Desplan, 2015). We next used this behavioral assay to assess the ability of balat mutant flies to see. Consistent with the loss of ‘on’ and ‘off’ transients, balat mutant flies exhibited impaired phototaxis, which was fully restored by the GMR-balat transgene (Figure 2E). These results strongly support the conclusion that BalaT is involved in visual transmission and that the loss of BalaT severely disrupts vision.

BalaT localizes to pigment cells

It is not currently known how β-alanine is transported out of the photoreceptor cells once generated (along with histamine) by the Tan hydrolase. Having established that BalaT functions as a β-alanine transporter in the retina, we next sought to determine which cells express balat, with the goal of determining the site of β-alanine transport during phototransduction. As we were unable to generate a high affinity antibody against BalaT, we used CRISPR/Cas9-based genome editing to introduce mCherry into the balat locus, downstream of the native balat promoter (balat-mcherry) (Figure 3—figure supplement 1A). We identified balat-mcherry flies though PCR and RFP immunofluorescence (Figure 3—figure supplement 1B–C). Importantly, homozygous balat-mcherry flies displayed the loss of ‘on’ and ‘off’ transients, as expected, indicating the insertion of mcherry into the balat locus (Figure 3—figure supplement 1D).

Photoreceptor cells and retinal pigment cells are the two major cell types in the compound eye. Staining with phalloidin and PDH labels the rhabdomere regions of photoreceptor cells and the retinal pigment cells, respectively. The mCherry signals in the balat-mcherry retina were predominantly detected in retinal pigment cells, as it overlapped with the PDH signal (Figure 3A and B). No mCherry signaling was detected in wild-type flies (Figure 3C and D).

Figure 3 with 1 supplement see all
BalaT localizes to pigment cells.

(A–B) Compound eyes from balat-mcherry flies that express mCherry (red) driven by the endogenous balat promoter were labeled for PDH (green), mCherry (red), and phalloidin (blue). High-magnification images are shown in (B). (C–D) mCherry signals were not detected in wild-type (wt) retinas. Scale bars represent 20 µm.

Since BalaT localized to retinal pigment cells, we next asked whether BalaT is required in pigment cells by performing tissue-specific rescue experiments. We expressed BalaT specifically in photoreceptor cells using the ninaE promoter (ninaE-balat) or in retinal pigment cells using the pdh promoter (pdh-balat). The pdh-balat transgene fully restored ‘on’ and ‘off’ transients and phototaxic behaviors when crossed into balat1 mutant flies, whereas expressing BalaT in photoreceptor cells failed to rescue these phenotypes (Figure 2C–E, and Figure 2—figure supplement 1). These results indicate that BalaT functions in pigment cells, and that pigment cells may play an important role in transporting β-alanine from photoreceptors to epithelia glial cells in the optic lamina.

Inx1 and Inx3 are required for visual synaptic transmission

If β-alanine is transported into pigment cell by BalaT, it must then be transported from the pigment cells to the laminar glial cells, where it can be conjugated with histamine to form carcinine. It has recently been reported that a multicellular network involving laminar glia and pigment cells mediates long-distance recycling of histamine metabolites (Chaturvedi et al., 2014). Since this transport relies on the gap junction protein Innexin 2 (Inx2) in glia, it is possible that gap junctions between pigment cells and laminar glial cells are important for β-alanine recycling, and thus for maintaining visual synaptic transmission. We first asked whether disruption of Inx2 in the retina affects fly visual transmission. Knocking down Inx2 in the retina (inx2RNAi: GMR-gal4/UAS-inx2RNAi) did not affect ERG transients (Figure 4A and C). However, there are seven Innexins, and Inx1, Inx2, and Inx3 are all expressed in the adult head. Knockdown of Inx1 or Inx3 in the compound eye also did not disrupt the ERG ‘on’ and ‘off’ transients (Figure 4B and D). Because these Innexins may have redundant functions, we knocked down combinations of two retinal Innexins and measured the effect on fly visual transmission. Knockdown of Inx1/Inx2 or Inx2/Inx3 did not affect ERG transients, but ‘on’ and ‘off’ transients were largely reduce by Inx1/Inx3 double knockdown (Figure 4E–4G). These results indicated that the gap junction proteins Inx1 and Inx3 are required in compound eyes for visual transmission.

Figure 4 with 1 supplement see all
Specific knockdown of Inx1 and Inx3 in compound eyes blocks visual neurotransduction.

ERG recordings of (A) control (GMR-gal4), (B) inx1RNAi (GMR-gal4/ UAS-inx1RNAi), (C) inx2RNAi (GMR-gal4/UAS-inx2RNAi), (D) inx3RNAi (GMR-gal4/ UAS-inx3RNAi), (E) inx1RNAi + inx2RNAi (GMR-gal4/UAS-inx1RNAi UAS-inx1RNAi), (F) inx2RNAi + inx3RNAi (GMR-gal4/UAS-inx2RNAi UAS-inx3RNAi), and (G) inx1RNAi + inx3RNAi (GMR-gal4/UAS-inx1RNAi UAS-inx3RNAi) are shown. Arrows indicate ON and OFF transients in (A). Flies (~1 day after eclosion) were dark adapted for 1 min and subsequently exposed to a 5 s pulse of orange light. (H–I) β-alanine was immunolabeled in horizontal sections of heads from (H) control: CG2198RNAi (GMR-gal4/UAS- CG2198RNAi) and (I) inx1RNAi + inx3RNAi (GMR-gal4/UAS-inx1RNAi UAS-inx3RNAi) flies. Re, retina; La, lamina; Me, medulla; Lo, lobula. (J) Fluorescence intensity ratios of β-alanine signals between retina and lobula. Quantifications of all genotypes are averages of six replicate experiments. Significant differences between inx1RNAi + inx3RNAi and controls (CG2198RNAi and CG9962RNAi) were determined using unpaired t-tests (***p<0.001; ns: not significant).
Figure 4—source data 1

Relates to Figure 4J.

Quantitative of fluorescence intensity ratios of β-alanine signals between retina and lobula of inx1RNAi + inx3RNAi and controls (CG2198RNAi and CG9962RNAi) (.xlsx file).

β-alanine levels and distributions are altered in balat mutant flies

We next examined the in vivo levels of β-alanine, histamine, and carcinine in the heads of balat mutant flies via liquid chromatography-mass spectrometry (LC-MS). For cart1 mutant flies, which cannot transport carcinine into photoreceptor cells, levels of histamine and β-alanine were significantly reduced (Figure 5A and B), as has been reported (Xu et al., 2015). Similarly, levels of β-alanine and histamine were significantly reduced in balat1 mutant flies (Figure 5A and B). Reduction of histamine in balat1 mutant flies indicates defective histamine recycling and explains the disruption of photoreceptor synaptic transmission in balat1 mutants. Reductions in β-alanine may result from inadequate β-alanine storage and/or transport into pigment cells (Borycz et al., 2012). These results therefore support the hypothesis that BalaT transports β-alanine into retinal pigment cells.

Figure 5 with 1 supplement see all
Loss of BalaT affects the level and distribution of β-alanine in vivo.

(A–B) Levels of (A) β-alanine and (B) histamine in heads of wild-type (wt, w1118), cart1, and balat1 flies are shown. Error bars indicate SDs, and significant differences between mutant and wt flies were determined using unpaired t-tests (*p<0.05; **p<0.01). (C–E) β-alanine was immunolabeled in horizontal sections of heads from (C) wild-type (w1118), (D) balat1, and (E) balat1;GMR-balat flies. Re, retina; La, lamina; Me, medulla; Lo, lobula. (F) Fluorescence intensity ratios of β-alanine labeling between retina and lobula. Significant differences between mutant and wild-type flies were determined using unpaired t-tests (**p<0.01; ns: not significant).
Figure 5—source data 1

Relates to Figure 5A and B.

Quantitative of levels of β-alanine and histamine in heads of wild-type, cart1, and balat1 flies (.xlsx file).

If flies are not able to transport β-alanine into pigment cells for storage, β-alanine should be specifically decreased in the retina. To test this idea, we sectioned fly heads and labeled them with an antibody against β-alanine. In wild-type flies, levels of β-alanine were highest in the retina, consistent with previous analyses (Borycz et al., 2012; Chaturvedi et al., 2014) (Figure 5C and F). In contrast, levels of β-alanine were lower in balat1 sections (for comparison, retinal signals were normalized to the β-alanine signal in the lobula) (Figure 5D and F). GMR-balat restored retinal β-alanine levels in balat1 mutants (Figure 5E and F), and rescued photoreceptor synaptic transmission. Reduced levels of β-alanine in retina lacking BalaT support the hypothesis that BalaT transports β-alanine into retinal pigment cells. We next checked if reductions in β-alanine change its distribution. In pyd1 and black double mutants (pyd1;b1), two independent metabolic pathways for de novo β-alanine biosynthesis are blocked and thus β-alanine levels are largely reduced (Borycz et al., 2012). However, in pyd1;b1 flies the pattern of β-alanine distribution is the same as seen in wild type, although immune intensity is reduced, as is the case with balat1 mutant flies (Figure 5—figure supplement 1). Therefore, pigment cells may serve as a reservoir of storedβ-alanine through a BalaT-dependent mechanism. Since Inx1/Inx3 double knockdown flies showed significant reductions in ‘on’ and ‘off’ transients, we asked whether Inx1/Inx3 is required for β-alanine trafficking. Of importance, β-alanine primarily accumulated in the retinal layer of Inx1/Inx3 double knock-down flies compared with control flies with either CG2198 or CG9962 RNAi (Figure 4H–J). Meanwhile in vivo levels of β-alanine in heads of Inx1/Inx3 double knockdown flies are significantly higher than in control flies (Figure 4—figure supplement 1). These results further support our hypothesis that Inx1/Inx3 functions to transport β-alanine back into glia cell. Taken together, we have identified a previously uncharacterized β-alanine transporter, which we have named BalaT, and shown that BalaT is responsible for β-alanine transportation and storage in pigment cells.


Histamine is the primary neurotransmitter released by photoreceptors in flies, and the synthesis of histamine can occur de novo by photoreceptor cell-specific histidine decarboxylase (Burg et al., 1993; Hardie, 1987). However, during light stimulation, flies depend primarily on histamine recycling to sustain tonic visual transmission. Histamine is inactivated when Ebony catalyzes its conjugation to β-alanine in laminar glial cells (Borycz et al., 2002; Richardt et al., 2002). In photoreceptors, CarT and Tan are involved in transporting carcinine and regenerating histamine, respectively (Chaturvedi et al., 2016; Stenesen et al., 2015; Wagner et al., 2007; Xu et al., 2015). Histamine is then loaded into synaptic vesicles, but fate of the β-alanine generated by Tan remains unknown. Here, we identify a new β-alanine transporter, BalaT, and provide evidence that BalaT is required for visual transmission. BalaT is a plasma membrane protein, and is sufficient to facilitate β-alanine uptake in cultured cells. BalaT is expressed predominantly by retinal pigment cells, and the specific expression of BalaT in these cells rescues photoreceptor synaptic transmission in balat1 mutant flies. The reduced levels and altered distribution of β-alanine in the heads of balat1 mutants support the hypothesis that BalaT functions to transport β-alanine. Therefore, we suggest that a novel β-alanine transporter, BalaT, functions in retinal pigment cells to help recycle β-alanine.

Disrupting the synthesis of histamine and carcinine abolishes photoreceptor synaptic transmission (Borycz et al., 2002; Burg et al., 1993). The transport of β-alanine seems less important, as it is present at higher concentrations in Drosophila. Two common metabolic pathways have been shown to synthesize β-alanine: (1) aspartate decarboxylase, encoded by the black gene (Hodgetts, 1972; Phillips et al., 2005), and (2) the uracil degradation pathway, which includes the enzymes dihydropyrimidine dehydrogenase (Pyd1), dihydropyrimidine amidohydrolase (Pyd2), and β-ureidopropionase (Pyd3) (Piskur et al., 2007; Rawls, 2006). The Black protein is enriched in lamina glia, together with the protein Ebony, and functions as the major enzyme in generating β-alanine (Ziegler et al., 2013). Although levels of β-alanine are reduced in the heads of black mutants (or pyd1 and black double mutants) compared to wild type, these flies still exhibit ERG transients (Borycz et al., 2012; Ziegler et al., 2013). Therefore, an efficient β-alanine recycling systems has been proposed to compensate for the rapid loss of β-alanine that occurs in the conversion of histamine to carcinine (Borycz et al., 2012). Here we show that mutations in balat disrupted transport and storage of β-alanine in the retina, resulting in dramatically reduced photoreceptor synaptic activity and visual behavior. Thus, we propose that Balat plays a key role in shuttling β-alanine from photoreceptor cells to glial cells.

A similar recycling system has been demonstrated for histamine. Mutations in Hdc (histidine decarboxylase) result in the loss of visual transduction. Feeding these flies histamine fully restores the visual transduction, whereas supplying histamine fails to rescue the ERG phenotypes of ebony mutants or Hdc;ebony double mutant flies (Melzig et al., 1996, 1998; Ziegler et al., 2013). In pyd1;black double mutants, β--alanine levels are still higher than histamine, which may be because of the uptake of exogenous β-alanine (Borycz et al., 2012). Meanwhile, the β-alanine recycling pathway is able to sustain visual synaptic transmission in black mutant flies, even in the absence of in situ β-alanine generation. Therefore, β-alanine recycling is essential for maintaining histamine homeostasis and photoreceptor synaptic transmission. In addition, establishing and maintaining a β-alanine pool play key roles in sustaining visual synaptic transmission.

The majority of pigment granules, which reduce the intensity of light exposure, are formed in retinal pigment cells of the Drosophila compound eye. Recently, it has been demonstrated that retinal pigment cells are functionally equivalent to cells within the mammalian retinal pigment epithelium (RPE), in terms of chromophore cycling (Travis et al., 2007; Wang et al., 2010, 2012). Just like chromophore (a subunit of rhodopsin) is sent back to pigment cells for regeneration, it has been suggested that the metabolism of β-alanine involves pigment cells (Borycz et al., 2012). Several observations indicate that BalaT functions in retina pigment cells to help regenerate histamine. Most notably, BalaT is expressed in pigment cells and visual transmission is rescued in balat mutants by the expression of wild-type BalaT in pigment cells, but not photoreceptor neurons. Our work provides strong genetic evidence for the involvement of retinal pigment cells in histamine recycling, and suggests that BalaT is the key player responsible for the transport of β-alanine into pigment cell.

It has been suggested that the transportation of histamine metabolites within the Drosophila visual system is mediated by a network of retinal pigment cells and laminar glia that are interconnected by gap junctions, and that this transport network is essential for fly vision (Chaturvedi et al., 2014). However, histaminergic photoreceptor cells directly acquire carcinine from synaptic terminals within the optic lamina through a CarT-dependent trafficking pathway (Xu et al., 2015). Here we provided evidence that the intercellular gap junctions between retinal pigment cells and laminar glial cells are involved in trafficking β-alanine, another histamine metabolite. Although the Inx2 gap junction protein is required in laminar glial cells for visual transmission, Inx2 was not required in retinal pigment cells. In contrast, downregulating the gap junction proteins Inx1 and Inx3 within the compound eye greatly impaired photoreceptor synaptic transmission. These data indicate that the Inx1 and Inx3 proteins are required in retinal pigment cells for maintaining fly vision. It has also been suggested that gap junctions may play a role in the formation of synapses between the retina and lamina in the Drosophila visual system (Curtin et al., 2002). Therefore, an alternative explanation would be that Inx1 and Inx3 are required for the development of synapses between retinal and laminar neurons. Although electron microscopy studies in Drosophila have not revealed gap junctions between retinal pigment cells and laminar fenestrated glia, accumulation of β-alanine in the retinal layer of inx1/inx3 double mutant flies indicates defective β-alanine trafficking.

BalaT belongs to the SLC22 family of transporters, which mediate sodium-independent transport of neurotransmitters, amino acids, and energy metabolites (Koepsell, 2013). We provide evidence that BalaT functions specifically in pigment cells as a β-alanine transporter, as BalaT mediated β-alanine transport in vitro, and is expressed predominately in retinal pigment cells. The reduced levels and altered distribution of β-alanine in the heads of balat null mutant flies supports this hypothesis. β-alanine is one of the two constituents of the naturally occurring dipeptides, carnosine and carcinine, and is considered rate-limiting for their synthesis. Both carnosine and carcinine are found in the retina where they exert protective effects. This is because they function as antioxidants, scavenging toxic activated oxygen species (Marchette et al., 2012; Pfister et al., 2011). There is evidence that several members of the SLC family of proteins that can transportβ-alanine are present in the retina, including taurine transporter (Slc6a6/TauT) (Liu et al., 1993). This suggests a conserved function for β-alanine trafficking in mammals and Drosophila.

Our current work, together with previous reports, provides evidence for the formulation of a more complete histamine recycling pathway, which is critical for sustaining photoreceptor synaptic transmission (Figure 6). In this pathway, carcinine is synthesized in epithelial glial cells within the optic lamina, and is transported back to photoreceptor cells via the synaptic cleft. Once in the photoreceptor cells it is hydrolyzed into histamine and β-alanine by Tan, and histamine is used as neurotransmitter. Meanwhile, β-alanine is released via an unknown mechanism, and is subsequently delivered to and stored within pigment cells by BalaT. Finally, β-alanine is transported back to epithelial glia through the network of retinal pigment cells and laminar glia for histamine inactivation and carcinine synthesis.

A model of the histamine recycling pathway.

Histamine is initially synthesized by histidine decarboxylase (Hdc) in photoreceptor cells (PR). Upon light stimulation, PRs release histamine into the synaptic cleft. Released histamine is quickly taken up by an unknown histamine transporter into epithelial glial cells that express Ebony. In these glia, histamine is conjugated to β-alanine, which inactivates histamine and generates carcinine. Carcinine is released into the synaptic cleft and subsequently internalized, via CarT, by the PRs. After carcinine is hydrolyzed to histamine and β-alanine by Tan hydrolase in the PR, histamine is re-packaged into synaptic vesicles, whereas β-alanine is delivered to and subsequently internalized, via the BalaT transporter, by retinal pigment cells (PCs). PCs can store β-alanine or deliver β-alanine to the laminar glia cells through a gap junction network involving Inx1 and Inx3, which are expressed in PCs. In glial cells, β-alanine is conjugated to histamine, and the cycle repeats. Moreover, β-alanine can be synthesized by Black, which is an aspartate decarboxylase that is expressed together with Ebony in optic lobe glia.

Materials and methods

Fly stocks

Request a detailed protocol

The pyd1; b1 (su(r) rC; b1), UAS-inx1RNAi, UAS-inx2RNAi, and UAS-inx3RNAi flies were provided by the Bloomington Drosophila Stock Center. The nos-Cas9 flies were obtained from Dr. J. Ni at Tsinghua University, Beijing, China. The cart1 mutant flies were maintained in the lab of Dr. T. Wang (Xu et al., 2015).

Generation of balat mutant and knock-in flies

Request a detailed protocol

The balat1 and balat2 mutations were generated using the Cas9/sgRNA system (Xu et al., 2015). Briefly, two pairs of guide RNAs targeting the balat locus were designed (sgRNA1: ATATAGTGCGCTATCTTGAG, sgRNA2: GTGTCTACGTGGGACTGAGT, sgRNA3: GAGGCCGGAACACCGGTTTT) and cloned into the U6b-sgRNA-short vector. The sgRNA1 and sgRNA2 plasmids were used to generate the balat1 mutant flies, whereas sgRNA2 and sgRNA3 were used to generate the balat2 mutant flies. The plasmids were injected into the embryos of nos-Cas9 flies, and deletions were identified by PCR using the following primers: forward primer 5’-CGCCACCAGTTCCTGGAC-3’ and reverse primer 5’-CCAGATGTAAGAGACGCAGTG-3’. The balat-mcherry knock-in flies were generated as shown in Figure S3. Briefly, sgDNA sequence was designed and cloned into the U6b-sgRNA-short vector. Two fragments from the balat locus (−1327 to −38 and +380 to+1660, where + 1 represents the transcription start site) were subcloned into a pDM19-mcherry vector such that they were separated by the 3XP3-mcherry marker. The two plasmids were co-injected into the embryos of nos-Cas9 flies, and mCherry-positive progeny were identified. By crossing these flies with hs-Cre flies, the 3XP3 promoter region was deleted. The balat-mcherry flies were finally confirmed by PCR using the following primers: forward primer 5’-AATTAATTAATGCGCACGAGAGGCC-3’ and reverse primer 5’-TTCCACGATGGTGTAGTCCTCGTTG-3’.

Generation of plasmid constructs and transgenic flies

Request a detailed protocol

20 head-enriched potential transporters and the balat cDNA sequences were amplified from cDNA clones obtained from DGRC (Drosophila Genomics Resource Center, Bloomington, IN, USA). The mouse GAT3 cDNA sequences were amplified from mouse liver cDNA obtained from mRNA. Their entire CDS sequences were subcloned into the pCDNA3 vector (Invitrogen, Carlsbad, USA) for expression in HEK293T cells and PIB vector (Invitrogen, Carlsbad, USA) for expression in S2 cells. To construct PninaE-balat, Ppdh-balat, and PGMR-balat, the entire coding region of balat was amplified from cDNA clones and subcloned into the pninaE-attB, ppdh-attB and pGMR-attB vectors (Xu et al., 2015). These constructs were injected into M(vas-int.Dm) ZH-2A;M(3xP3-RFP.attP) ZH-86Fb embryos, and transformants were identified on the basis of eye color. The 3xP3-RFP.attP locus was removed by crossing with P(Crey) flies. HEK 293 T cells was obtained from ATCC (RRID:CVCL_0063) and S2 cells was obtained from Drosophila Genomics Resource Center (RRID:CVCL_Z232), which have been tested for contamination of bacteria, yeast, mycoplasma and virus and has been characterized by isozyme and karyotype analysis.

Electroretinogram recordings

Request a detailed protocol

ERGs were recorded as described (Xu et al., 2015). Briefly, two glass microelectrodes were filled with Ringer’s solution and placed on the surfaces of the compound eye and thorax (one each surface). The source light intensity was ~2000 lux, and the light color was orange (source light was filtered using a FSR-OG550 filter). ERG signals were amplified with a Warner electrometer IE-210, and recorded with a MacLab/4 s A/D converter and the clampelx 10.2 program (Warner Instruments, Hamden, USA).

β-alanine, histamine, and GABA uptake assay

Request a detailed protocol

Alanine, β-[3-3H (N)] (30–60 Ci/mM, American radiolabeled chemicals, Saint Louis, USA) uptake was measured as described (Tomi et al., 2008). Briefly, pcDNA3/RFP/BalaT or mock-transfected HEK293T cells were cultured in 12-well plates (BD-Falcon) and washed with 1 mL extracellular fluid (ECF) buffer consisting of 120 mM NaCl, 25 mM NaHCO3, 3 mM KCl,1.4 mM CaCl2,1.2 mM MgSO4, 0.4 mM K2HPO4,10 mM D-glucose, and 10 mM Hepes (pH 7.4) at 37°C. Uptake was initiated by applying 200 μL ECF buffer containing 7400 Bq [3H] β-alanine at 37°C. After 10 min, uptake was terminated by removing the solution, and cells were washed with 1 mL ice-cold ECF buffer. The cells were then solubilized in 1 N NaOH and subsequently neutralized. An aliquot was taken to measure radioactivity and protein content using a liquid scintillation counter and a DC protein assay kit (Bio-rad, USA), respectively, with bovine serum albumin as a standard. Histamine, histamine [ring, Methylenes-3H(N)] dihydrochloride, (10–40 Ci/mM, American radiolabeled chemicals, Saint Louis, USA), and GABA, 4-amino-n-[2, 3-3H]butyric acid ([3H]GABA, 30–60 Ci/mmol, PerkinElmer, Waltham, Massachusetts, USA) uptake assays were initiated by applying 200 μL ECF buffer containing 7400 Bq radiolabeled histamine or radiolabeled GABA. The mixture was incubated for 30 min. The continuous procedures are similar to the β-alanine transport assay.


Request a detailed protocol

Fly head sections (10 μm thick) were prepared from adults that were frozen in OCT medium (Tissue-Tek, Torrance, USA). Immunolabeling was performed on cryosections sections with rabbit anti-β-alanine (1:200, Abcam, USA; RRID:AB_305476), rat anti-RFP (1:200, Chromotek, Germany; RRID:AB_2336064), rabbit anti-PDH (1:200; RRID:AB_2570065) (Wang et al., 2010) as primary antibodies. Cells transfected with BalaT-3XFLAG were incubated with mouse monoclonal anti-Flag M2 antibody (1:200, Sigma-Aldrich, USA; RRID:AB_439685) and. Goat anti-rabbit lgG conjugated to Alexa 488 (1:500, Invitrogen, USA; RRID:AB_143165), goat anti-rat lgG conjugated to Alexa 568 (1:500, Invitrogen, USA; RRID:AB_2534121), and goat anti-mouse lgG conjugated to Alexa 647 (1:500, Jackson ImmunoResearch, USA; RRID:AB_2535805) were used as secondary antibodies. Phalloidin conjugated to Alexa 650 (1:500, Thermo scientific, Germany; RRID:AB_2532159) and DAPI (1:1000, Life Technologies, USA; RRID:AB_2307445) was used to indicate photoreceptor cells and nucleus respectively. The images were recorded with a Nikon A1-R confocal microscope.

The phototaxis assay

Request a detailed protocol

Flies were dark adapted for 15 min before phototaxis assay, as described (Xu et al., 2015). Phototaxis index was calculated by dividing the total number of flies by the number of flies that walked above the mark. At least three groups of flies were collected for each genotype and three repeats were made for each group. Each group contained ≥20 flies. Results were expressed as the mean of the mean values for the three groups.

RNA extraction and qPCR

Request a detailed protocol

Total RNA was prepared from the heads of 3-day-old flies using Trizol reagent (Invitrogen, Carlsbad, USA), followed by TURBO DNA-free DNase treatment (Ambion, Austin, USA). Total cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad Laboratories, USA). iQ SYBR green supermix was used for real-time PCR (Bio-Rad Laboratories, USA). Three different samples were collected from each genotype. The primers used for qPCR were as follows:









Liquid chromatography–mass spectrometry (LC-MS)

Request a detailed protocol

The Dionex Ultimate 3000 UPLC system was coupled to a TSQ Quantiva Ultra triple-quadrupole mass spectrometer (Thermo Fisher, CA), equipped with a heated electrospray ionization (HESI) probe in negative ion mode. Extracts were separated by a Fusion-RP C18 column (2 × 100 mm, 2.5 μm, phenomenex). Data acquired in selected reaction monitoring (SRM) for histamine, carcinine, and β-alanine with transitions of 112/95.2, 183/95, and 90/72, respectively. Both precursor and fragment ions were collected with resolution of 0.7 FWHM. The source parameters are as follows: spray voltage: 3000 V; ion transfer tube temperature: 350°C; vaporizer temperature: 300°C; sheath gas flow rate: 40 Arb; auxiliary gas flow rate: 20 Arb; CID gas: 2.0 mTorr. Data analysis and quantification were performed using the software Xcalibur 3.0.63 (Thermo Fisher, CA). Each sample contained 50 Drosophila heads, and the mean values from five samples were calculated.


    1. Borycz J
    2. Borycz JA
    3. Loubani M
    4. Meinertzhagen IA
    Tan and ebony genes regulate a novel pathway for transmitter metabolism at fly photoreceptor terminals
    Journal of Neuroscience 22:10549–10557.
    1. Burg MG
    2. Sarthy PV
    3. Koliantz G
    4. Pak WL
    Genetic and molecular identification of a Drosophila histidine decarboxylase gene required in photoreceptor transmitter synthesis
    The EMBO Journal 12:911.
    1. Curtin KD
    2. Zhang Z
    3. Wyman RJ
    Gap junction proteins are not interchangeable in development of neural function in the Drosophila visual system
    Journal of Cell Science 115:3379–3388.
    1. Hay BA
    2. Wolff T
    3. Rubin GM
    Expression of baculovirus P35 prevents cell death in Drosophila
    Development 120:2121–2129.
    1. Liu QR
    2. López-Corcuera B
    3. Mandiyan S
    4. Nelson H
    5. Nelson N
    Molecular characterization of four pharmacologically distinct gamma-aminobutyric acid transporters in mouse brain [corrected]
    The Journal of Biological Chemistry 268:2106–2112.
    1. Marchette LD
    2. Wang H
    3. Li F
    4. Babizhayev MA
    5. Kasus-Jacobi A
    Carcinine has 4-Hydroxynonenal scavenging property and neuroprotective effect in mouse retina carcine neuroprotection in mouse retina
    Investigative Ophthalmology & Visual Science 53:3572–3583.
    1. Melzig J
    2. Burg M
    3. Gruhn M
    4. Pak WL
    5. Buchner E
    Selective histamine uptake rescues photo- and mechanoreceptor function of histidine decarboxylase-deficient Drosophila mutant
    Journal of Neuroscience 18:7160–7166.

Decision letter

  1. Hugo J Bellen
    Reviewing Editor; Howard Hughes Medical Institute, Baylor College of Medicine, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

[Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The first decision letter after peer review is shown below.]

Thank you for submitting your work entitled "The β-alanine transporter BalaT is required for visual neurotransmission in Drosophila" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Hong-Sheng Li (Reviewer #2).

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that although the work is of interest, it will not be considered further for publication in eLife as the findings at this stage are too preliminary. However, if you can address the comments raised by the reviewers we are willing to re-review a substantially edited version that address the reviewers concern.

The following are important issues to address:

The authors proposed that β-Ala diffuses between retinal and lamina through gap junctions and provided RNAi evidence that either Inx1 or Inx3 forms the junctions. Although this hypothesis represents the most direct model of β-Ala trafficking, EM studies from both Drosophila and Musca didn't reveal any gap junction between retinal pigment cells and laminar fenestrated glia.

We know from research reported from the Hovemann lab that epithelial glia express Black, which synthesizes β-alanine from aspartate (Ziegler 2013, J Comp Neurol 521: 1207-1224). In the same paper the coexpression of Ebony in the epithelial glia was also demonstrated. This indicates that the machinery to produce β-alanine and carcinine is exactly present in the site involved in β-alanyl-histamine synthesis and probably should be sufficient to maintain the histamine recycling. It is strange that the authors choose not to report the findings of that study, since they bear critically on this submission.

The authors' interests seem to be one-sided and focus only on β-alanine transport, as shown in Figure 1A. As a standard in Figure 1B is presented the function of a transporter that is not specific for β-alanine transport e.g. GAT3. In Figure 1B the tritiated β-alanine uptake into S2 cells is similar for that for CG3790 and for the GABA transporter GAT3. Why have the authors not checked whether CG3790 is a GABA transporter in Drosophila? Maybe CG3790 also acts as a transporter for other biologically important and structurally similar molecules, such as glycine, taurine or even glutamate. Transport by the product of CG3790 of some other substances engaged in phototransmission, could explain the ERG abnormalities observed after deleting this gene. Why did the authors not test histamine as a substrate for CG3790 product?

Reviewer #1:

Wang et al. present a straightforward manuscript on the characterization of a novel β-alanine transporter with a specific defect in visual transmission in Drosophila. This is an interesting system to study neurotransmitter recycling through support cells, even though the neurotransmitter system itself (histamine) is quite special. The manuscript presents the novel and interesting finding, namely that in addition to glia cells another cell type, the interommatidial pigment cells, have a special requirement in the process: histamine is generated through 'splitting' of histamine and β-alanine from carcinine in photoreceptor terminals; β-alanine is apparently then taken up by the pigment cells through the newly described BalaT transporter for delivery into glia cells, where histamine and β-alanine get conjugated again for delivery back into photoreceptor terminals.

The strength of the manuscript is in the clear straight-forward discovery of the balat transporter using a β-alanine uptake assay and demonstration of its function in pigment cells using cell-specific rescue. The link to glia is a bit weaker: RNAi experiments in two innexins that are supposed to be the delivery route of β-alanine back into the glia are not controlled and not fully convincing. This and a few minor gaps in the story can be fixed in a reasonable amount of time. These fixes should include a better characterization of the balat-mcherry, quantification of ERGs and better immunohistochemistry.

The key experiment I would like to see regards the innexin link: if innexin mutants really are the link between pigments cells and glia, then β-alanine should accumulate in the pigment cells in the innexin double RNAi knock-down (which also needs some RNAi controls). With inclusion of these revisions, I am in support of the manuscript.

Reviewer #2:

The Drosophila visual system is a great model in the study of neurotransmitter homeostasis, in which the primary visual transmitter, histamine, is recycled through a glial pathway that involves two essential enzymes (Ebony and Tan) and multiple steps of transmembrane transport. Previous genetic and immunostaining data have suggested the involvement of retinal pigment cells in the storage/transport of β-Ala, a histamine-inactivating metabolite during this transmitter recycling. Here Wang et al. identified a β-Ala transporter in the pigment cells and demonstrated its importance to the visual transmission at both electrophysiological and behavioral levels. This is merely the second membrane transporter identified in the histamine recycling pathway, and the work provides direct evidence for the involvement of retinal pigment cells.

My only concern is about the step of β-Ala transport from pigment cells to laminal glia, where β-Ala is conjugated to histamine to form the inactive metabolite carcinine. The authors proposed that β-Ala diffuses between retinal and lamina through gap junctions and provided RNAi evidence that either Inx1 or Inx3 forms the junctions. Although this hypothesis represents the most direct model of β-Ala trafficking, EM studies from both Drosophila and Musca didn't reveal any gap junction between retinal pigment cells and laminar fenestrated glia. It is thus important to discuss on alternative, Inx-independent trafficking mechanisms. The ERG defects of Inx1+Inx3 knockdown flies could have different interpretations. For instances, they could be required for the development of synapses between retinal and laminar neurons (see Curtin et al., 2002, J. Cell Sci.), or for the β-Ala transport into core cells for storage.

Reviewer #3:

The authors report a new β-alanine transporter, encoded by CG3790, which they named BalaT, and which is present in the retinal pigment cells of the Drosophila visual system. The results indicate that BalaT is critical for β-alanine recycling together with the action of innexins. The authors demonstrate that lacking BalaT disrupts the normal ERG and phototaxis. The results are consistent with the authors' theory but they run contrary to current knowledge about β-alanine and its sources in the Drosophila head. We know from research reported from the Hovemann lab that epithelial glia express Black, which synthesizes β-alanine from aspartate (Ziegler 2013, J Comp Neurol 521: 1207-1224). In the same paper the coexpression of Ebony in the epithelial glia was also demonstrated. This indicates that the machinery to produce β-alanine and carcinine is exactly present in the site involved in β-alanyl-histamine synthesis and probably should be sufficient to maintain the histamine recycling. It is strange that the authors choose not to report the findings of that study, since they bear critically on this submission. What do the authors suppose is the reason that the long way to transport β-alanine into the epithelial glia, as suggested in their manuscript, would offer adaptive advantage and be critical for histamine recycling? It seems obvious that the more energetically demanding process should be outcompeted by the simpler one. The authors have forgotten to mention, or possibly have overlooked the Ziegler et al. (2013) paper in their manuscript, and in this way have avoided discussing the strongest arguments against their proposed β-alanine recycling pathway. From the work of others (Borycz et al. 2012, J Exp Biol 215: 1399-1411; Ziegler 2013, J Comp Neurol 521: 1207-1224; Rawls 2006, Genetics 172: 1665-1674) it is known that the metabolism of uracil produces β-alanine, so it is a substance present in all living cells. These biochemical processes are not the only ones and there are also reports of alternative pathways for β-alanine synthesis. Borycz et al. (2012) reported more than 10 ng β-alanine/head in the wild type, which is 5 times the histamine head content in these flies. The process of histamine conjugation with β-alanine, mediated by Ebony in the epithelial glia, requires roughly equal amounts of both compounds, which indicates that head β-alanine greatly exceeds the requirements for Ebony function. The abundance of β-alanine may in fact indicate that there is no need to recycle this substance. For these reasons the controversy with the Ziegler at al. (2012) paper should be resolved, and could only be considered in a resubmitted version.

The authors' interests seem to be one-sided and focus only on β-alanine transport, as shown in Figure 1A. As a standard in Figure 1B is presented the function of a transporter that is not specific for β-alanine transport e.g. GAT3. In Figure 1B the tritiated β-alanine uptake into S2 cells is similar for that for CG3790 and for the GABA transporter GAT3. Why have the authors not checked whether CG3790 is a GABA transporter in Drosophila? Maybe CG3790 also acts as a transporter for other biologically important and structurally similar molecules, such as glycine, taurine or even glutamate.

Transport by the product of CG3790 of some other substances engaged in phototransmission, could explain the ERG abnormalities observed after deleting this gene. Why did the authors not test histamine as a substrate for CG3790 product? The histamine transporter has yet to be discovered and histamine is the neurotransmitter of major importance in the fly's visual system.

Additionally, use of human embryonic kidney cells (HEK293T) to study the invertebrate transporter function may be methodologically a wrong decision. The concentrations of some ions and molecules may be different in insect and human cells, so that the observed effect may be irrelevant to the results that could be seen in the appropriate cells/tissues.

The metabolite β-alanine is structurally similar to L-alanine or D-alanine as well as to GABA and glycine. These substances should all also be analysed when assessing the uptake (Figure 1) and also considered as a source of noise observed in immunolabeling (Figure 5).

Finally, the legends for the figures are scarce and abbreviations are often not explained, neither in the legend nor in the text. For example, to what does RFP in Figure 1A refer?

The results connected to the role of innexins are interesting and may indicate their role in balancing the neuronal voltage gradients but again their link to β-alanine may be misleading. Altogether, before it could be reconsidered, the paper requires substantial revision and addressing all important questions related to the previous β-alanine findings. The only link to β-alanine transport provided by the authors are the data shown in Figure 1, because the ERGs and phototaxis fail to differentiate between β-alanine and other factors involved in the process.

To report a protein as a transporter requires more detailed analysis of the transporter kinetics than the data shown in the manuscript.

In addition, the flies used in the study all contained a background of w1118, which is itself an ABC-transporter-deficient mutant, and this may be a factor adding to the final results.

In the list of references for eLife, the authors should be listed in alphabetical order and not chronological one. This omission suggests a lack of care in preparation of the manuscript for submission. Overall I cannot recommend this submission for publication in its present form.

Author response

[Editors’ note: the author responses to the first round of peer review follow.]

Reviewer #1:

[…] The strength of the manuscript is in the clear straight-forward discovery of the balat transporter using a β-alanine uptake assay and demonstration of its function in pigment cells using cell-specific rescue. The link to glia is a bit weaker: RNAi experiments in two innexins that are supposed to be the delivery route of β-alanine back into the glia are not controlled and not fully convincing. This and a few minor gaps in the story can be fixed in a reasonable amount of time. These fixes should include a better characterization of the balat-mcherry, quantification of ERGs and better immunohistochemistry.

We improved the immunostaining assays in balat-mcherry flies, and now show these results in Figure 3. We also quantified the ERG OFF transients (data are shown in Figure 2D).

The key experiment I would like to see regards the innexin link: if innexin mutants really are the link between pigments cells and glia, then β-alanine should accumulate in the pigment cells in the innexin double RNAi knock-down (which also needs some RNAi controls). With inclusion of these revisions, I am in support of the manuscript.

We performed the experiments as suggested. We performed β-alanine immunostaining to examine the in vivo levels of β-alanine in heads of control (knocking down of CG9962 and CG2198, which do not express in compound eyes), and Inx1/Inx3 double knockdown flies. These results have been added to Figure 4H, 4I and 4J, and described in the Results section (subsection “β-alanine levels and distributions are altered in balat mutant flies”, last paragraph). In Inx1/Inx3 double knockdown flies, β-alanine levels were slightly increased and largely accumulated in the retinal layer compared with controls, which confirmed our hypothesis that Inx1/Inx3 functions to transport β-alanine back to glia cells.

Reviewer #2:

[…] My only concern is about the step of β-Ala transport from pigment cells to laminal glia, where β-Ala is conjugated to histamine to form the inactive metabolite carcinine. The authors proposed that β-Ala diffuses between retinal and lamina through gap junctions and provided RNAi evidence that either Inx1 or Inx3 forms the junctions. Although this hypothesis represents the most direct model of β-Ala trafficking, EM studies from both Drosophila and Musca didn't reveal any gap junction between retinal pigment cells and laminar fenestrated glia. It is thus important to discuss on alternative, Inx-independent trafficking mechanisms. The ERG defects of Inx1+Inx3 knockdown flies could have different interpretations. For instances, they could be required for the development of synapses between retinal and laminar neurons (see Curtin et al., 2002, J. Cell Sci.), or for the β-Ala transport into core cells for storage.

We have analyzed β-alanine levels and performed β-alanine immunostaining of inx1/inx3 double knock-down mutants (data is shown in Figure 4H, 4I and 4J). Β-alanine largely accumulated in the retinal layer. This may represent direct evidence that Inx1/Inx3 functions to transport β-alanine back to glia cells. However, we have been unable to detect gap junctions between these cells at the EM level. Therefore, we discuss the possibilities that developmental roles of Inx may be an alternative explanation (Discussion, fifth paragraph).

Reviewer #3:

The authors report a new β-alanine transporter, encoded by CG3790, which they named BalaT, and which is present in the retinal pigment cells of the Drosophila visual system. The results indicate that BalaT is critical for β-alanine recycling together with the action of innexins. The authors demonstrate that lacking BalaT disrupts the normal ERG and phototaxis. The results are consistent with the authors' theory but they run contrary to current knowledge about β-alanine and its sources in the Drosophila head. We know from research reported from the Hovemann lab that epithelial glia express Black, which synthesizes β-alanine from aspartate (Ziegler 2013, J Comp Neurol 521: 1207-1224). In the same paper the coexpression of Ebony in the epithelial glia was also demonstrated. This indicates that the machinery to produce β-alanine and carcinine is exactly present in the site involved in β-alanyl-histamine synthesis and probably should be sufficient to maintain the histamine recycling. It is strange that the authors choose not to report the findings of that study, since they bear critically on this submission. What do the authors suppose is the reason that the long way to transport β-alanine into the epithelial glia, as suggested in their manuscript, would offer adaptive advantage and be critical for histamine recycling? It seems obvious that the more energetically demanding process should be outcompeted by the simpler one. The authors have forgotten to mention, or possibly have overlooked the Ziegler et al. (2013) paper in their manuscript, and in this way have avoided discussing the strongest arguments against their proposed β-alanine recycling pathway. From the work of others (Borycz et al. 2012, J Exp Biol 215: 1399-1411; Ziegler 2013, J Comp Neurol 521: 1207-1224; Rawls 2006, Genetics 172: 1665-1674) it is known that the metabolism of uracil produces β-alanine, so it is a substance present in all living cells. These biochemical processes are not the only ones and there are also reports of alternative pathways for β-alanine synthesis. Borycz et al. (2012) reported more than 10 ng β-alanine/head in the wild type, which is 5 times the histamine head content in these flies. The process of histamine conjugation with β-alanine, mediated by Ebony in the epithelial glia, requires roughly equal amounts of both compounds, which indicates that head β-alanine greatly exceeds the requirements for Ebony function. The abundance of β-alanine may in fact indicate that there is no need to recycle this substance. For these reasons the controversy with the Ziegler at al. (2012) paper should be resolved, and could only be considered in a resubmitted version.

It is our mistake that we did not discuss in detail the relationship between de novo synthesis and recycle of β-alanine. To remedy this, we have added two paragraphs to the Discussion (second and third paragraphs).

In wild type flies, β-alanine levels in the head are 5 times higher than histamine. Even in pyd and black double mutant flies, β-alanine levels are still higher than histamine. Black is expressed in Ebony-expressing lamina glia, and serves as the major enzyme in the local generation of β-alanine. The pyrimidine catabolism pathway is an alternative pathway for β-alanine synthesis. However, the pyd and black double mutant flies do not completely lose the ability to synthesize β-alanine, which may be due to the uptake of exogenous β-alanine. This low level of β-alanine is enough to sustain visual transduction. If β-alanine does not need to be recycled, the phenotype should be the same as seen in ebony mutants. Therefore, the normal visual response in black and pyd,black double mutants indicates that the β-alanine shuttle system indeed exists in the visual system. In balat mutant flies, levels of β-alanine in the head are reduce as well, but remain a few times higher than histamine. However, balat mutant flies display obvious ERG phenotypes, as they lack “on” and “off” transients. If the abundance of β-alanine indicates that there is no need to recycle this substance, we should not observe ERG phenotypes and β-alanine decreases in balat mutant fly heads. We could explain this by the β-alanine distribution changes which indicates that the β-alanine trafficking is blocked.

It has been demonstrated in many cases that de novo synthesis and the recycling of metabolites are both critical to maintain their threshold levels. For example, histamine is easily generated by Hdc in photoreceptor cells. However, the recycling of histamine to photoreceptor cells is also important to sustain visual transduction. Loss of either pathway disrupted visual transduction. However, loss of visual transduction caused by mutations in Hdc (which disrupts de novo synthesis) can be fully restored by feeding histamine. The same situation occurred in pyd and black double mutant flies, in which exogenous β-alanine is enough to keep β-alanine levels over histamine. In contrast, feeding histamine did not restore visual transduction in ebony mutants (which affect the recycle pathway). This situation is similar to balat-dependent β-alanine trafficking, which is required for synaptic transmission even though local de novo synthesis takes place in glia cells.

The authors' interests seem to be one-sided and focus only on β-alanine transport, as shown in Figure 1A. As a standard in Figure 1B is presented the function of a transporter that is not specific for β-alanine transport e.g. GAT3. In Figure 1B the tritiated β-alanine uptake into S2 cells is similar for that for CG3790 and for the GABA transporter GAT3. Why have the authors not checked whether CG3790 is a GABA transporter in Drosophila? Maybe CG3790 also acts as a transporter for other biologically important and structurally similar molecules, such as glycine, taurine or even glutamate.

We have assessed the transporter specificity of CG3790. CG3790 did not transport Histamine or GABA. We have added these data to figures (Figure 1—figure supplement 2) and to the Results section (subsection “CG3790 transports β-alanine in vitro”, second paragraph).

Transport by the product of CG3790 of some other substances engaged in phototransmission, could explain the ERG abnormalities observed after deleting this gene. Why did the authors not test histamine as a substrate for CG3790 product? The histamine transporter has yet to be discovered and histamine is the neurotransmitter of major importance in the fly's visual system.

We preformed histamine uptake assays, which revealed that CG3790 does not exhibit histamine uptake activity. As a control, the human Organic Cation Transporter (OCT2), which is known to take up histamine, exhibited high levels of histamine transport activity (Figure 1—figure supplement 2 and Results subsection “CG3790 transports β-alanine in vitro”, second paragraph”).

Additionally, use of human embryonic kidney cells (HEK293T) to study the invertebrate transporter function may be methodologically a wrong decision. The concentrations of some ions and molecules may be different in insect and human cells, so that the observed effect may be irrelevant to the results that could be seen in the appropriate cells/tissues.

For ease of manipulation we used HEK293T cells to screen for putative fly β-alanine transporters. We then performed all CG3790 transport experiments in S2 cells (Figure 1B and Figure 1—figure supplement 2).

The metabolite β-alanine is structurally similar to L-alanine or D-alanine as well as to GABA and glycine. These substances should all also be analysed when assessing the uptake (Figure 1) and also considered as a source of noise observed in immunolabeling (Figure 5).

We asked whether CG3790 is able to transport GABA. In contrast to mGAT3, which exhibited high levels of GABA transporting activity, CG3790 did not show any GABA transporting activity when expressed in S2 cells (subsection “CG3790 transports β-alanine in vitro”, second paragraph).

Finally, the legends for the figures are scarce and abbreviations are often not explained, neither in the legend nor in the text. For example, to what does RFP in Figure 1A refer?

We have reviewed the figure legends and fixed the abbreviations. For example, we have changed “RFP” to “red fluorescent protein (RFP)” as a negative control in Figure 1 figure legend.

The results connected to the role of innexins are interesting and may indicate their role in balancing the neuronal voltage gradients but again their link to β-alanine may be misleading. Altogether, before it could be reconsidered, the paper requires substantial revision and addressing all important questions related to the previous β-alanine findings. The only link to β-alanine transport provided by the authors are the data shown in Figure 1, because the ERGs and phototaxis fail to differentiate between β-alanine and other factors involved in the process.

We performed β-alanine immunostaining to examine the in vivo levels of β-alanine in heads of Inx1/Inx3 double knockdown flies. These results have been added to Figure 4H, 4I and 4J, and described in the Results section (subsection “β-alanine levels and distributions are altered in balat mutant flies”, last paragraph”). In Inx1/Inx3 double knockdown flies, β-alanine levels were slightly increased and largely accumulated in the retinal layer compared with controls, which confirmed our hypothesis that Inx1/Inx3 functions to transport β-alanine back to glia cells.

To report a protein as a transporter requires more detailed analysis of the transporter kinetics than the data shown in the manuscript.

We have strong evidence to show that Balat is specific β-alanine transporter. Although kinetic data would be a nice addition to the manuscript, we do not think these data would dramatically improve the manuscript.

In addition, the flies used in the study all contained a background of w1118, which is itself an ABC-transporter-deficient mutant, and this may be a factor adding to the final results.

To rule out the influence of the white gene, we crossed the balat mutation into the w+ background. The “on” and “off” transients were still absent. We have added these data to Figure 2C and 2D, and to the Results section (subsection “BalaT is required for visual synaptic transmission”, second paragraph).

In the list of references for eLife, the authors should be listed in alphabetical order and not chronological one. This omission suggests a lack of care in preparation of the manuscript for submission. Overall I cannot recommend this submission for publication in its present form.

We have listed the references in alphabetical order.

Article and author information

Author details

  1. Yongchao Han

    1. Graduate School of Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, China
    2. National Institute of Biological Sciences, Beijing, China
    YH, Conceptualization, Funding acquisition, Validation, Writing—original draft, Project administration, Writing—review and editing
    Contributed equally with
    Liangyao Xiong
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1965-0161
  2. Liangyao Xiong

    1. National Institute of Biological Sciences, Beijing, China
    2. Peking University-Tsinghua University-National Institute of Biological Sciences Joint Graduate Program, School of Life Sciences, Peking University, Beijing, China
    LX, Conceptualization, Data curation, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing
    Contributed equally with
    Yongchao Han
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5205-8648
  3. Ying Xu

    1. National Institute of Biological Sciences, Beijing, China
    2. School of Life Sciences, Beijing Normal University, Beijing, China
    YX, Conceptualization, Validation, Investigation, Visualization, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    The authors declare that no competing interests exist.
  4. Tian Tian

    National Institute of Biological Sciences, Beijing, China
    TT, Conceptualization, Investigation, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  5. Tao Wang

    1. Graduate School of Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, China
    2. National Institute of Biological Sciences, Beijing, China
    TW, Investigation, Methodology
    For correspondence
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2395-3483


Chinese Ministry of Science (2014CB849700)

  • Tao Wang

National Natural Science Foundation of China (81670891)

  • Tao Wang

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank the Bloomington Stock Center, Tsinghua fly center, and the Developmental Studies Hybridoma Bank for stocks and reagents. We thank Y Wang and X Liu for assistance with fly injections. We are tremendously thankful for support provided by the Metabolomics Facility at the Technology Center for Protein Sciences, Tsinghua University. We thank Ms. Ping Wu from the Imaging Facility of the National Center for Protein Science in Beijing for assistance with microscopy. We thank Dr. D O’Keefe for comments on the manuscript.

Reviewing Editor

  1. Hugo J Bellen, Howard Hughes Medical Institute, Baylor College of Medicine, United States

Publication history

  1. Received: June 7, 2017
  2. Accepted: July 17, 2017
  3. Version of Record published: August 14, 2017 (version 1)


© 2017, Han et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,107
    Page views
  • 191
  • 14

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Yongchao Han
  2. Liangyao Xiong
  3. Ying Xu
  4. Tian Tian
  5. Tao Wang
The β-alanine transporter BalaT is required for visual neurotransmission in Drosophila
eLife 6:e29146.
  1. Further reading

Further reading

    1. Biochemistry and Chemical Biology
    2. Neuroscience
    Jinli Geng, Yingjun Tang ... Xiaodong Liu
    Research Article Updated

    Dynamic Ca2+ signals reflect acute changes in membrane excitability, and also mediate signaling cascades in chronic processes. In both cases, chronic Ca2+ imaging is often desired, but challenged by the cytotoxicity intrinsic to calmodulin (CaM)-based GCaMP, a series of genetically-encoded Ca2+ indicators that have been widely applied. Here, we demonstrate the performance of GCaMP-X in chronic Ca2+ imaging of cortical neurons, where GCaMP-X by design is to eliminate the unwanted interactions between the conventional GCaMP and endogenous (apo)CaM-binding proteins. By expressing in adult mice at high levels over an extended time frame, GCaMP-X showed less damage and improved performance in two-photon imaging of sensory (whisker-deflection) responses or spontaneous Ca2+ fluctuations, in comparison with GCaMP. Chronic Ca2+ imaging of one month or longer was conducted for cultured cortical neurons expressing GCaMP-X, unveiling that spontaneous/local Ca2+ transients progressively developed into autonomous/global Ca2+ oscillations. Along with the morphological indices of neurite length and soma size, the major metrics of oscillatory Ca2+, including rate, amplitude and synchrony were also examined. Dysregulations of both neuritogenesis and Ca2+ oscillations became discernible around 2–3 weeks after virus injection or drug induction to express GCaMP in newborn or mature neurons, which were exacerbated by stronger or prolonged expression of GCaMP. In contrast, neurons expressing GCaMP-X were significantly less damaged or perturbed, altogether highlighting the unique importance of oscillatory Ca2+ to neural development and neuronal health. In summary, GCaMP-X provides a viable solution for Ca2+ imaging applications involving long-time and/or high-level expression of Ca2+ probes.

    1. Neuroscience
    Maria Cecilia Martinez, Camila Lidia Zold ... Mariano Andrés Belluscio
    Research Article

    The automatic initiation of actions can be highly functional. But occasionally these actions cannot be withheld and are released at inappropriate times, impulsively. Striatal activity has been shown to participate in the timing of action sequence initiation and it has been linked to impulsivity. Using a self-initiated task, we trained adult male rats to withhold a rewarded action sequence until a waiting time interval has elapsed. By analyzing neuronal activity we show that the striatal response preceding the initiation of the learned sequence is strongly modulated by the time subjects wait before eliciting the sequence. Interestingly, the modulation is steeper in adolescent rats, which show a strong prevalence of impulsive responses compared to adults. We hypothesize this anticipatory striatal activity reflects the animals’ subjective reward expectation, based on the elapsed waiting time, while the steeper waiting modulation in adolescence reflects age-related differences in temporal discounting, internal urgency states, or explore–exploit balance.