1. Cell Biology
  2. Developmental Biology
Download icon

LUZP1, a novel regulator of primary cilia and the actin cytoskeleton, is a contributing factor in Townes-Brocks Syndrome

  1. Laura Bozal-Basterra
  2. María Gonzalez-Santamarta
  3. Veronica Muratore
  4. Aitor Bermejo-Arteagabeitia
  5. Carolina Da Fonseca
  6. Orhi Barroso-Gomila
  7. Mikel Azkargorta
  8. Ibon Iloro
  9. Olatz Pampliega
  10. Ricardo Andrade
  11. Natalia Martín-Martín
  12. Tess C Branon
  13. Alice Y Ting
  14. Jose A Rodríguez
  15. Arkaitz Carracedo
  16. Felix Elortza
  17. James D Sutherland  Is a corresponding author
  18. Rosa Barrio  Is a corresponding author
  1. Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Spain
  2. CIBERehd, Instituto de Salud Carlos III, Spain
  3. ProteoRed-ISCIII, Instituto de Salud Carlos III, Spain
  4. Department of Neurosciences, University of the Basque Country, Achucarro Basque Center for Neuroscience-UPV/EHU, Spain
  5. Analytical & High Resolution Biomedical Microscopy Core Facility, University of the Basque Country (UPV/EHU), Spain
  6. Department of Chemistry, Massachusetts Institute of Technology, United States
  7. Departments of Genetics, Chemistry and Biology, Stanford University, United States
  8. Chan Zuckerberg Biohub, United States
  9. Department of Genetics, Physical Anthropology and Animal Physiology, University of the Basque Country (UPV/EHU), Spain
  10. CIBERONC, Instituto de Salud Carlos III, Spain
  11. Ikerbasque, Basque Foundation for Science, Spain
  12. Biochemistry and Molecular Biology Department, University of the Basque Country (UPV/EHU), Spain
Research Article
  • Cited 1
  • Views 914
  • Annotations
Cite this article as: eLife 2020;9:e55957 doi: 10.7554/eLife.55957

Abstract

Primary cilia are sensory organelles crucial for cell signaling during development and organ homeostasis. Cilia arise from centrosomes and their formation and function is governed by numerous factors. Through our studies on Townes-Brocks Syndrome (TBS), a rare disease linked to abnormal cilia formation in human fibroblasts, we uncovered the leucine-zipper protein LUZP1 as an interactor of truncated SALL1, a dominantly-acting protein causing the disease. Using TurboID proximity labeling and pulldowns, we show that LUZP1 associates with factors linked to centrosome and actin filaments. Here, we show that LUZP1 is a cilia regulator. It localizes around the centrioles and to actin cytoskeleton. Loss of LUZP1 reduces F-actin levels, facilitates ciliogenesis and alters Sonic Hedgehog signaling, pointing to a key role in cytoskeleton-cilia interdependency. Truncated SALL1 increases the ubiquitin proteasome-mediated degradation of LUZP1. Together with other factors, alterations in LUZP1 may be contributing to TBS etiology.

eLife digest

Primary cilia are the ‘antennae’ of animal cells: these small, flexible protrusions emerge from the surface of cells, where they help to sense and relay external signals. Cilia are assembled with the help of the cytoskeleton, a dynamic network of mesh-like filaments that spans the interior of the cell and controls many different biological processes. If cilia do not work properly, human diseases called ciliopathies can emerge.

Townes-Brocks Syndrome (TBS) is an incurable disease that presents a range of symptoms such as malformations of the toes or fingers, hearing impairment, and kidney or heart problems. It is caused by a change in the gene that codes for a protein called SALL1, and recent work has also showed that the cells of TBS patients have defective cilia. In addition, this prior research identified a second protein that interacted with the mutant version of SALL1; called LUZP1, this protein is already known to help maintain the cytoskeleton.

In this study, Bozal-Basterra et al. wanted to find out if LUZP1 caused the cilia defects in TBS. First, the protein was removed from mouse cells grown in the laboratory, which dramatically weakened the cytoskeleton. In keeping with this observation, both the number of cilia per cell and the length of the cilia were abnormal. Cells lacking LUZP1 also had defects in a signalling process that transmits signals received by cilia to different parts of the cell. All these defects were previously observed in cells isolated from TBS patients. In addition, LUZP1-deficient mouse cells showed the same problems with their cilia and cytoskeleton as the cells from individuals with TBS. Crucially, the cells from human TBS patients also had much lower levels of LUZP1 than normal, suggesting that the protein may contribute to the cilia defects present in this disease.

The work by Bozal-Basterra et al. sheds light on how primary cilia depend on the cytoskeleton, while also providing new insight into TBS. In the future, this knowledge could help researchers to develop therapies for this rare and currently untreatable disease.

Introduction

Townes-Brocks Syndrome (TBS1 [MIM: 107480]) is an autosomal dominant genetic disease, caused by mutations in a transcription factor called SALL1, characterized by the presence of imperforate anus, dysplastic ears, thumb malformations and often renal and heart impairment, among other symptoms (Botzenhart et al., 2007; Kohlhase et al., 1998). Some of these features overlap those in the ciliopathic spectrum. It has been recently demonstrated that primary cilia defects are contributing factors to TBS etiology (Bozal-Basterra et al., 2018). Truncated SALL1, either by itself or in complex with full length protein (SALL1FL), can interact with CCP110 and CEP97. As a consequence, those negative regulators are reduced at the mother centriole (MC) and ciliogenesis is promoted (Bozal-Basterra et al., 2018).

Primary cilia are sensory organelles that have a crucial role in cell signaling and protein trafficking during development and organ homeostasis. Although several key pathways are influenced by cilia function (Wnt, TGFbeta, PDGFRalpha, Notch), the best characterized is the Sonic Hedgehog (Shh) pathway (Goetz and Anderson, 2010). Briefly, Shh binds to its receptor PTCH1 and leads to ciliary enrichment of the transmembrane protein Smoothened (SMO), with concomitant conversion of the transcription factor GLI3 from a cleaved repressor to a full-length activator form, leading to activation of Shh target genes. Two such genes are PTCH1 and GLI1 (encoding the Shh receptor and a transcriptional activator, respectively), exemplifying the feedback and fine-tuning of the Shh pathway.

Cilia arise from the centrosome, a cellular organelle composed of two barrel-shaped microtubule-based structures called the centrioles. Primary cilia formation is very dynamic throughout the cell cycle. Cilia are nucleated from the MC at the membrane-anchored basal body upon entry into the G0 phase, and they reabsorb as cells progress from G1 to S phase, completely disassembling in mitosis (Rezabkova et al., 2016). Centrioles are surrounded by protein-based matrix, the pericentriolar material (PCM) (Conduit et al., 2015; Vertii et al., 2016). In eukaryotic cells, PCM proteins are concentrically arranged around a centriole in a highly organized manner (Fu and Glover, 2012; Lawo et al., 2012; Mennella et al., 2012; Sonnen et al., 2012). Based on this observation, proper positioning and organization of PCM proteins may be important for promoting different cellular processes in a spatially regulated way (Kim et al., 2019). Not surprisingly, aberrations in the function of PCM scaffolds are associated with several human diseases, including cancer and ciliopathies (Gönczy, 2015; Nigg and Holland, 2018). Cilia assembly is regulated by diverse factors. Among them, CCP110 and CEP97 form a cilia suppressor complex that, when removed from the MC, allows ciliogenesis to proceed (Spektor et al., 2007). The actin cytoskeleton is also emerging as key regulator of cilia formation and function, with both negative and positive roles (Copeland, 2020).

Ciliary dysfunction often results in early developmental problems including hydrocephalus, neural tube closure defects (NTD) and left-right anomalies (Fliegauf et al., 2007). These features are often reported in a variety of diseases, collectively known as ciliopathies, caused by failure of cilia formation and/or cilia-dependent signaling (Hildebrandt et al., 2011). In the adult, depending on the underlying mutation, ciliopathies present a broad spectrum of phenotypes comprising cystic kidneys, polydactyly, obesity or heart malformation.

Truncated SALL1 likely interferes with multiple factors to give rise to TBS phenotypes. Here we focus on LUZP1, a leucine-zipper motif containing protein that was identified by proximity proteomics as an interactor of truncated SALL1 (Bozal-Basterra et al., 2018). LUZP1 has been previously identified as an interactor of ACTR2 (ARP2 actin related protein two homologue) and filamin A (FLNA) and, recently, as an actin cross-linking protein (Hein et al., 2015; Wang and Nakamura, 2019). Furthermore, LUZP1 shows homology to FILIP1, a protein interactor of FLNA and actin (Gad et al., 2012; Nagano et al., 2004). Interestingly, mutations in Luzp1 resulted in cardiovascular defects and cranial NTD in mice (Hsu et al., 2008), phenotypes within the spectrum of those seen in TBS individuals and mouse models of dysfunctional cilia (Botzenhart et al., 2007; Botzenhart et al., 2005; Klena et al., 2016; Kohlhase et al., 1998; Surka et al., 2001; Toomer et al., 2019). Both the non-canonical Wnt/PCP (Wingless-Integrated/planar cell polarity) and the Shh pathways are influenced by the presence of functional cilia and regulate neural tube closure and patterning (Campbell, 2003; Copp, 2005; Fuccillo et al., 2006). Remarkably, ectopic Shh was observed in the dorsal lateral neuroepithelium of the Luzp1-/- mice (Hsu et al., 2008). However, in spite of the phenotypic overlaps, a link between LUZP1 and ciliogenesis has not been explored.

Here we demonstrate that LUZP1 is associated with centrosomal and actin cytoskeleton-related proteins. We show that LUZP1 localizes to the PCM, actin cytoskeleton and the midbody, and also provide evidence towards its regulatory role on actin dynamics and its subsequent impact on ciliogenesis. Notably, we demonstrate that Luzp1-/- cells exhibit reduced filamentous actin (F-actin), longer primary cilia, higher rates of ciliogenesis and increased Shh signaling. Furthermore, TBS-derived primary fibroblasts show a reduction in LUZP1 and actin filaments, possibly through SALL1-regulated LUZP1 degradation via the ubiquitin (Ub)-proteasome system (UPS). As a novel regulator of ciliogenesis and the actin cytoskeleton, LUZP1 might contribute to the aberrant cilia phenotype in TBS.

Results

SALL1 interacts with LUZP1

Using proximity proteomics, we have previously shown that a truncated and mislocalized form of SALL1 present in TBS individuals (SALL1275) can interact aberrantly with cytoplasmic proteins (Bozal-Basterra et al., 2018). LUZP1 was found among the most enriched proteins in the SALL1275 proximal interactome. We confirmed this finding by independent BioID experiments analyzed by western blot using a LUZP1-specific antibody (Figure 1A and Figure 1—figure supplement 1). To further characterize the interaction of LUZP1 with truncated SALL1, we performed pulldowns using tagged SALL1275-YFP in HEK 293FT cells. Our results showed that endogenous LUZP1 was able to interact with SALL1275, confirming our proximity proteomics data (Figure 1—figure supplement 2A, lane 6, and Figure 1—figure supplement 1). The interaction with SALL1275 persisted in presence of overexpressed SALL1FL (Figure 1—figure supplement 2A, lane 9, and Figure 1—figure supplement 1), suggesting that heterodimerization of the truncated and FL forms does not inhibit the interaction with LUZP1. When expressed alone, we noted that SALL1FL-YFP also interacts with LUZP1 in pulldown assays (Figure 1—figure supplement 2A and Figure 1—figure supplement 1). As these proteins have distinct localizations (nuclear and cytoplasmic, respectively), the interaction likely occurs in post-lysis cell extracts (more in Discussion). These results show that the truncated form of SALL1 expressed in TBS individuals, either by itself or in complex with the FL form, can interact with LUZP1.

Figure 1 with 2 supplements see all
Proximity proteomics reveal LUZP1 interaction with truncated SALL1 and with centrosome- and actin cytoskeleton-associated proteins.

(A) Western blot analysis of BioID, streptavidin pulldown (PD) of HEK 293FT cells transfected with Myc-tagged BirA*-SALL1275 or BirA*-SALL1FL. Specific antibodies (LUZP1, actin, Myc) were used as indicated. Anti-Myc antibody detected the self-biotinylated form of BirA*-SALL1FL (asterisk) or BirA*-SALL1275 (black arrowhead). (B) STRING core cluster network analysis of LUZP1 interactors (confidence 0.7 or higher), visualized using Cytoscape software. Color and size of the nodes indicate Log2 of the TurboID-LUZP1 (TbID-LUZP1) versus TbID alone ratio. The most highly interconnected clusters, centrosome and actin, are indicated separately. (C) Volcano plot representing the distribution of the candidates identified by proximity proteomics in three independent experiments. Proteins with more than 1-fold change in TbID-LUZP1 intensity with respect to the TbID (Log2 ≥ 0) were considered as LUZP1-associated candidates (grey dots). Proteins associated with the actin cytoskeleton and the centrosome were colored in green and pink colors, respectively. (D) Graphical representation of the -Log10 of the p-value for each of the represented GO terms of the TbID experiment performed on RPE1 stably expressing near endogenous levels of TbID-LUZP1 vs TbID. Pink dotted line represents the cutoff of p-value<0.01.

LUZP1 interacts with centrosomal and actin cytoskeleton components

To gain insights into the function of LUZP1, we sought to identify its proximal interactome using the TurboID approach (Branon et al., 2018). We used RPE1 cells stably expressing low levels of FLAG-TurboID-LUZP1 (TbID-LUZP1) or FLAG-TurboID (TbID) as control. Transduced cells showed sub-endogenous expression levels of TbID-LUZP1 (Figure 1—figure supplement 2B, two asterisks; endogenous, two open arrowheads). Staining of transfected cells revealed that, proteins biotinylated by TbID are diffusely localized throughout the nucleus and cytoplasm, whereas those biotinylated by TbID-LUZP1 are localized primarily at the centrosome and actin cytoskeleton, as shown by fluorescent streptavidin (Figure 1—figure supplement 2C). Total lysates from TbID-LUZP1 or TbID-expressing cells were subjected to streptavidin pulldown and isolated proteins were analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS). 234 high-confidence proximity LUZP1 interactors were enriched in the TbID-LUZP1 vs the TbID proteome in three replicates (Source Data 1). Proteins enriched among the identified LUZP1 proximal interactors were centrosomal and actin cytoskeleton-related proteins (Figure 1B–C). With the purpose of obtaining a functional overview of the main pathways associated to LUZP1, a comparative Gene Ontology (GO) analysis was performed with all the hits enriched in TbID-LUZP1 versus TbID cells. In the Cellular Component domain, ‘actin cytoskeleton’, ‘microtubule cytoskeleton’, ‘centrosome’, ‘cilium’ and ‘midbody’ terms were highlighted among others (Figure 1D and Source Data 1). In the category of Biological Process, LUZP1 proteome showed enrichment in the ‘microtubule cytoskeleton organization’, ‘cell division’, ‘cilium assembly’, ‘vesicle-mediated transport’, ‘microtubule organizing center organization’ and ‘cell adhesion’ categories among others (Figure 1D and Source Data 1). With respect to Molecular Function, LUZP1 also showed enrichment in cytoskeleton-related proteins (‘actin binding’, ‘actinin binding’ and ‘microtubule binding’ terms; Figure 1D and Source Data 1). 37 or 96 of the verified or potential, respectively, centrosome/cilia gene products previously identified by proteomic studies (Alves-Cruzeiro et al., 2014; Gupta et al., 2015) were found as LUZP1 proximal interactors, supporting the enrichment of centrosome-related proteins among the potential interactors of LUZP1. In addition, 45 of LUZP1 proximal interactors were present among the actin-localized proteins identified by the Human Protein Atlas project based on subcellular localization to actin filaments (Uhlen et al., 2015).

LUZP1 localizes to the centrosome, actin cytoskeleton and midbody

We examined the subcellular localization of LUZP1 in diverse cell types. First, immunostainings showed that endogenous LUZP1 surrounds both centrioles, labelled by centrin-2 (CETN2) in human RPE1 cells (Figure 2A) and gamma-tubulin in human dermal fibroblasts (Figure 2—video 1) (for specificity of LUZP1 antibody, check Figure 5). We examined LUZP1 localization at the centrosome in synchronized RPE1 cells. LUZP1 was reduced at the centrosome during G2/M and G0 phases (Figure 2—figure supplement 1). Interestingly, LUZP1 levels increased upon treatment with the proteasome inhibitor MG132 in G0 phase arrested-RPE1 cells. All together, these results indicate that LUZP1 levels are reduced at the centrosome in G2/M phase and upon starvation, and this reduction might be mediated by the UPS. The localization of LUZP1 at the centrosome was reproduced in U2OS cells expressing LUZP1-YFP (Figure 2B–D). We did not observe colocalization of LUZP1 with the distal centriolar marker CCP110 (Figure 2B), indicating that LUZP1 is likely found at the proximal end of both centrioles. We further imaged LUZP1 along with pericentrin (PCNT) and PCM1, markers of PCM. Interestingly, we observed that LUZP1 enveloped PCNT (Figure 2C), with LUZP1 itself being surrounded by PCM1 (Figure 2D). These results suggest that LUZP1 might be a novel PCM associated-protein, decorating the proximal end of both centrioles. In concordance with this localization, LUZP1 was associated to PCM1 in TurboID experiments (Source Data 1).

Figure 2 with 2 supplements see all
LUZP1 localizes to the centrosome and the actin cytoskeleton.

(A) Immunofluorescence micrographs of LUZP1 (green) and Centrin-2 (CETN2, blue) in RPE1 cells. (B–D) Immunofluorescence micrographs of U2OS cells expressing LUZP1-YFP (green) stained with antibodies against CETN2 (blue) and CCP110 (B), Pericentrin (C) and PCM1 (D) in magenta. Plot profile of the different fluorophore intensities along the yellow lines in (C, D). Schematic representation of LUZP1 localization at the centrosome according to their respective micrographs in (A–D). Scale bar, 1 µm. Imaging in (A–D) was performed using confocal microscopy (Leica SP8, 63x objective). Lightning software (Leica) was applied. (E, F) Immunofluorescence micrographs of U2OS cells stained with an antibody against endogenous LUZP1 (green), phalloidin to detect F-actin (magenta), and counterstained with DAPI (blue). Single green and magenta channels are shown in black and white. (F) LUZP1 at the midbody in dividing cells (yellow arrowhead). Scale bar, 10 µm (E, F). Imaging in (E, F) was performed using widefield fluorescence microscopy (Zeiss Axioimager D1, 63x objective).

In addition to the localization at the centrosome/basal body, LUZP1 also localized to actin stress fibers (Figure 2E) and to the midbody (Figure 2F) in U2OS cells.

LUZP1 shows reduction at the centrosome in TBS fibroblasts and interacts with centrosome-associated proteins

Based on the LUZP1 interaction with truncated SALL1, we checked its subcellular localization in fibroblasts derived from a TBS individual (TBS275; see Materials and methods) as well as non-TBS control. We observed that LUZP1 was markedly decreased at the centrosome of TBS275 cells compared to control cells in non-starved conditions (Figure 3A–C). Furthermore, LUZP1 levels decreased in starved vs non-starved control cells (Figure 3A–C), while centrosomal size remained unaltered (Figure 3C, right panel). We previously found that SALL1275-YFP interacted with the centrosome-associated ciliogenesis suppressors, CCP110 and CEP97 (Bozal-Basterra et al., 2018), so we checked whether LUZP1 could also interact with these factors. Indeed, LUZP1-YFP interacts with CCP110 and CEP97 in both WT (293WT) and TBS model (293335) HEK 293FT cells (Figure 3D, lanes 5 and 7, respectively and Figure 3—figure supplement 1; Bozal-Basterra et al., 2018). Less CCP110 and CEP97 was recovered in LUZP1-YFP pulldowns from 293335 cells, but this is likely due to the reduced LUZP1-YFP seen in those cells (Figure 3D, Input, lanes 1 and 2 vs lane 3 and 4 and Figure 3—figure supplement 1). Beyond pulldowns, we found that immunoprecipitation of endogenous LUZP1 led to co-purification of endogenous CCP110 (Figure 3E and Figure 3—figure supplement 1) and that anti-CEP97 antibodies immunoprecipitated endogenous LUZP1 (Figure 3F and Figure 3—figure supplement 1). Both CCP110 and CEP97 were also identified as proximal interactors of TbID-LUZP1 (Source Data 1). Immunofluorescent colocalization on centrioles of LUZP1 (proximal) and CCP110 (distal) was not evident, suggesting that the interaction is indirect or occurs before proteins reach their destinations. However, these key regulators of ciliogenesis are just two of multiple centrosomal proteins associated with LUZP1, suggesting that LUZP1 may have a function at this dynamic organelle.

Figure 3 with 1 supplement see all
TBS cells show reduced LUZP1 levels at the centrosome.

(A, B) Immunofluorescence micrographs of non-starved and starved human-derived Control (A) and TBS275 fibroblasts (B) stained with antibodies against endogenous LUZP1 (green, yellow arrowheads), Centrin-2 (CETN2, blue) and acetylated alpha-tubulin (magenta). Black and white images show the isolated green channel. Note the reduction of LUZP1 in starved cells and in non-starved TBS275 compared to non-starved control fibroblasts. Imaging was performed using widefield fluorescence microscopy (Zeiss Axioimager D1, 63x objective). Scale bar, 4 µm. (C) Graphical representation of the LUZP1 mean intensities (left panel) or the centrosome area (right panel), corresponding to the experiments shown in (A–B); n ≥ 6 micrographs. Three independent experiments were pooled together. P-values were calculated using the unpaired two-tailed Student´s test or U- Mann-Whitney test. (D) Western blot of inputs (lanes 1 to 4) and GFP-Trap pulldowns (lines 5 to 8) performed in WT HEK 293FT cells or in 293335SALL1 mutant cells transfected with LUZP1-YFP (lanes 1, 3, 5 and 7) or YFP alone (lanes 2, 4, 6 and 8). Numbers under CCP110 and CEP97 panels result from dividing band intensities of each pulldown by their respective input levels. GAPDH was used as loading control. (E, F) Co-immunoprecipitation experiments show LUZP1-CCP110 (E) and CEP97-LUZP1 (F) interactions. Rabbit IgG was used for immunoprecipitation controls. GAPDH was used as loading and specificity control. In all panels, specific antibodies (LUZP1, GAPDH, CCP110, CEP97, GFP) were used as indicated. Blots shown here are representative of three independent experiments. Molecular weight markers are shown to the right.

LUZP1 localizes to actin and is altered in TBS fibroblasts

In addition to the centrosome/basal body, LUZP1 also localized to actin stress fibers, as well as the midbody in dividing cells (Figure 2). Intriguingly, when LUZP1 levels were examined in TBS275 cells, a reduction in both actin-associated LUZP1 and phalloidin-labelled stress fibers was observed when compared to control cells (Figure 4A–C). These results indicate that actin cytoskeleton might be altered in TBS cells. Using pulldown assays, we confirmed that LUZP1-YFP interacts with both actin and FLNA (Figure 4D and Figure 4—figure supplement 1). Notably, actin, FLNA, alpha-actinin, palladin, LIMA1/Eplin and other stress fiber-associated proteins are proximal interactors of TbID-LUZP1 (Source Data 1). To examine whether LUZP1 levels change upon F-actin perturbation, HEK 293FT cells were treated with Cytochalasin D (CytoD), an inhibitor of actin polymerization. No changes in LUZP1 levels upon actin depolymerization were observed when cells were lysed in strong lysis conditions (WB5) (Figure 4E–F and Figure 4—figure supplement 1). However, we observed increased LUZP1 levels using mild lysis conditions (0.1% Triton X-100; Figure 4E–F and Figure 4—figure supplement 1). These results reflect that the integrity of the actin cytoskeleton may influence the solubility but not the stability of LUZP1.

Figure 4 with 1 supplement see all
Reduction in LUZP1 coincides with decreased F-actin.

(A) Immunofluorescence micrographs of Control and TBS275 human fibroblasts stained with an antibody against endogenous LUZP1 (green), phalloidin to label F-actin (magenta), and counterstained with DAPI to label the nuclei (blue). Black and white images show the single green and magenta channels. Note the overall reduction in LUZP1 and F-actin levels in TBS275 compared to control fibroblasts. Scale bar, 10 µm. Imaging was performed using widefield fluorescence microscopy (Zeiss Axioimager D1, 63x objective). (B, C) Graphical representation of the LUZP1 (B) and F-actin (C) mean intensities, corresponding to the experiments shown in (A); n ≥ 6 micrographs. Three independent experiments were pooled together. P-values were calculated using the unpaired two-tailed Student´s test or U- Mann-Whitney test. (D) Western blot of inputs or GFP-Trap pulldowns performed in HEK 293FT cells transfected with LUZP1-YFP or YFP alone. Anti-GFP antibody detected YFP alone (two black arrowheads) and LUZP1-YFP (two white arrowheads). Blots shown here are representative of three independent experiments. Molecular weight markers are shown to the right. Specific antibodies (LUZP1, GAPDH, CCP110, CEP97, GFP) were used as indicated. (E) Western blot of total cell lysates of HEK 293FT treated or not with cytochalasin D (CytoD) in a mild lysis buffer (TX-100 0.1%, lanes 1, 2) or a strong lysis buffer (WB5, lanes 3, 4). Note the increase in LUZP1 levels upon actin polymerization blockage with CytoD, exclusively when cells were lysed on 01% TX-100-based lysis buffer. GAPDH was used as loading control. In (D) and (E) panels, specific antibodies (LUZP1, GAPDH, actin, FLNA, GFP) were used as indicated. (F) Graphical representation of LUZP1 vs GAPDH band intensities in (E) normalized to lane 1. Graphs represent Mean and SEM of three independent experiments. P-value was calculated using two tailed unpaired Student´s t-test. Molecular weight markers in (D) and (E) are shown to the right.

LUZP1 plays a role in primary cilia formation and shh signaling

Based on the localization of LUZP1 at the centrosome, its interaction with centrosomal proteins and the defects in ciliogenesis previously observed in TBS cells (Bozal-Basterra et al., 2018), we hypothesized that LUZP1 might have a role in cilia formation. To examine this, we analyzed ciliogenesis in Shh-LIGHT2 cells, a cell line derived from immortalized mouse NIH3T3 fibroblasts that can display primary cilia and report on Shh pathway status using integrated luciferase reporters (herein designated as WT) (Taipale et al., 2000). Using CRISPR/Cas9 gene editing directed to exon 1 of murine Luzp1, we generated Shh-LIGHT2 mouse embryonic fibroblasts null for Luzp1 (Luzp1-/- cells). For genetic rescue experiments, LUZP1 was restored to these cells by the expression of human LUZP1-YFP fusion (+LUZP1 cells). To examine the effect of the Luzp1 mutation and rescue strategies, we used anti-LUZP1 antibody and checked LUZP1 localization associated with the actin cytoskeleton and the centrosome by immunofluorescence (Figure 5A,B), and its levels of expression by western blot (Figure 5C and Figure 5—figure supplement 1) in WT, Luzp1-/- and +LUZP1 cells. These experiments showed the effectiveness of the knockout and rescue strategies.

Figure 5 with 1 supplement see all
Generation of LUZP1 mutant cells.

(A, B) Immunofluorescence micrographs of Shh-LIGHT2 control cells (WT), Luzp1 depleted Shh-LIGHT2 cells (Luzp1-/-) and Luzp1-/- cells rescued with human LUZP1 (+LUZP1 cells) stained with a specific antibody against endogenous LUZP1 (green) and DAPI (blue) (A) or gamma-tubulin (magenta) (B). Single green and magenta channels are shown in black and white. Scale bars, 10 µm (A) or 2.5 µm (B). Images were taken using widefield fluorescence microscopy (Zeiss Axioimager D1, 63x objective). Note the lack of LUZP1 in Luzp1-/- cells. (C) Western blot analysis of total lysates of WT, Luzp1-/- and +LUZP1 cells using anti-LUZP1 antibodies. Molecular weight markers are shown to the right. Note the lack of LUZP1 signal in Luzp1-/- cells by immunofluorescence and western blot.

To analyze the role of LUZP1 in ciliation, WT, Luzp1-/- and +LUZP1 cells were plated at equal densities and induced to ciliate for 48 hr by serum withdrawal (starved; Figure 6A). We quantified ciliation rates and primary cilia length in non-starved and starved cells. Luzp1-/- fibroblasts displayed higher ciliation rate (60%) than WT (10.5%) and +LUZP1 (22.2%) when the cells were not subjected to starvation (Figure 6B). However, Luzp1-/- cells were not significantly more ciliated than WT or +LUZP1 fibroblasts upon 48 hr of starvation (Figure 6B). In addition, primary cilia in Luzp1-/- cells were significantly longer than in non-starved WT cycling cells (Figure 6A and C), while under starvation the differences were not significant (Figure 6A and C). Note that, differently than the ciliation rate, cilia length was not rescued by adding human LUZP1. Taken together, these results confirm that Luzp1-/- cells display longer and more abundant primary cilia compared to WT cells in cycling conditions and indicate that LUZP1 might affect primary cilia dynamics.

Loss of Luzp1 causes aberrant cilia frequency and length and Shh signaling.

(A) Micrographs of Shh-LIGHT2 cells (WT), Shh-LIGHT2 cells lacking Luzp1 (Luzp1-/-) and Luzp1-/- cells rescued with human LUZP1-YFP (+LUZP1) analyzed in cycling conditions (non-starved), or during cilia assembly (48 hr starved). Cilia were visualized by acetylated alpha-tubulin (magenta), basal body by ODF2 (green) and nuclei by DAPI (blue). Scale bar 2.5 µm. (B, C) Graphical representation of percentage of ciliated cells per micrograph (B) and cilia length (C) measured in WT (blue circles, n > 34 micrographs), Luzp1-/- (orange circles, n > 44 micrographs) or +LUZP1 cells (green circles, n > 30 micrographs) from three independent experiments. No starvation: WT 2.3 µm; Luzp1-/- cells 3.0 µm; +LUZP1 cells 2.9 µm; 48 hr starvation: WT 4.2 µm; Luzp1-/- cells 4.1 µm; +LUZP1 cells 4.8 µm; all average measures. (D) Immunofluorescence micrographs of WT and LUZP1-/- cells stained with antibodies against endogenous CCP110 (green), gamma-tubulin (gTub) to label the centrioles (magenta) and DAPI to label the nuclei (blue). Black and white images show the single green and magenta channels. Note the different distribution of CCP110 to the centrosome in LUZP1-/- compared to WT cells. Scale bar, 1 µm. (E) Graphical representation of the percentage of cells showing the presence of CCP110 to both centrioles per micrograph corresponding to the experiments in (D); n = 10 micrographs. Three independent experiments were pooled together.

One key event in ciliogenesis is the depletion of CCP110 and its partner CEP97 from the distal end of the MC, promoting the ciliary activating program in somatic cells (Goetz et al., 2012; Kleylein-Sohn et al., 2007; Prosser and Morrison, 2015; Spektor et al., 2007; Tsang et al., 2008). We analyzed the centrosomal localization of CCP110 in WT and Luzp1-/- cells by immunofluorescence. Consistent with the higher ciliogenesis rate, CCP110 was present at two centrosomal spots at a lower proportion in Luzp1-/- cells (19%) compared to WT (84%; Figure 6D and E). This result suggests that the lack of LUZP1 might result in CCP110 reduction at the centrosome, leading to higher frequency of ciliogenesis in Luzp1-/- cells, and is reminiscent to the results obtained in TBS cells (Bozal-Basterra et al., 2018).

It is well-established that mammalian Shh signal transduction is dependent on functional primary cilia (Huangfu et al., 2003; Yin et al., 2009). Therefore, we examined whether Shh signaling is altered in Luzp1-/- cells. Cells were starved for 24 hr and incubated in the presence or absence of purmorphamine (a SMO agonist) for 24 hr to activate the Shh pathway. The mRNA expression of two Shh target genes (Gli1 and Ptch1) was quantified by qRT-PCR (Figure 7A,B). We found that Gli1 and Ptch1 expression levels in non-treated Luzp1-/- cells were higher than in WT cells (Gli1 1.5 fold and Ptch1 2.3 fold increase in Luzp1-/- vs WT cells without purmorphamine) (Figure 7A,B). To further study the role of LUZP1 in Shh signaling, we analyzed GLI3 processing by western blot using total lysates extracted from WT vs Luzp1-/- cells. Without purmorphamine induction, we found a significantly higher ratio of GLI3 activating form vs GLI3 repressive form (GLI3-A:GLI3-R) in Luzp1-/- cells compared to WT (2.9 fold increase in Luzp1-/- cells vs WT) (Figure 7C and Figure 7—figure supplement 1). After induction, the values were similar for Luzp1-/- and WT cells. We also examined the effects of lacking Luzp1 on Shh signaling by measuring the activity of the Shh-responsive Firefly luciferase reporter in the presence or absence of purmorphamine for 24 hr to activate the Shh pathway (Figure 7D,E). Consistent with the Gli1 and Ptch1 qRT-PCR data, non-treated Luzp1-/- cells showed higher Shh activity compared to control or +LUZP1 cells, as observed in TBS-derived cells (Figure 7D). However, the induction capacity of Luzp1-/- cells upon purmorphamine treatment was reduced compared to WT or +LUZP1 cells (Figure 7E). Altogether, the observed defects in Ptch1 and Gli1 gene expression and Shh reporter misregulation point to a role for LUZP1 in Shh signaling.

Figure 7 with 1 supplement see all
Luzp1-/-cells show aberrant Shh signaling.

(A, B) Graphical representation of the fold-change in the expression of Gli1 (n = 5) (A) and Ptch1 (n = 7) (B) obtained by qRT-PCR from wild-type Shh-LIGHT2 cells (WT; blue dots) or Shh-LIGHT2 cells lacking Luzp1 (Luzp1-/-; orange dots), treated (+) or not (-) with purmorphamine for 24 hr. (C) Western blot analysis of lysates from WT and Luzp1-/- cells. Samples were probed against GLI3 using an antibody that detects both GLI3-activator form (GLI3-A) and GLI3-repressor form (GLI3-R); GAPDH was used as loading control. Numbers under the lanes are the Mean of 3 independent experiments, resulting of dividing the activator by the repressor intensities, taking WT non-induced value as 1. Molecular weight markers are shown to the right. (D, E) Graphical representation of fold-change in luciferase activation when WT (n > 7; blue dots), Luzp1-/- (n > 7; orange dots) or +LUZP1 (n = 4; green dots) cells are treated for 6 and 24 hr or not (-) with purmorphamine. (E) Each treated condition was normalized against its respective non treated condition, taking the non-induced value as 1 (dashed line). All graphs represent the Mean and SEM. P-values were calculated using two-tailed unpaired Student´s t-test or One-way ANOVA and Bonferroni post-hoc test.

LUZP1 and F-actin levels are correlated

Based on the localization of LUZP1 to actin stress fibers and interaction with cytoskeletal proteins, we hypothesized that LUZP1 might also affect F-actin cytoskeleton. We observed a reduction in F-actin (labelled by phalloidin) in the Luzp1-/- cells compared to WT, which was recovered in +LUZP1 cells (Figure 8A). We also note the correlation between LUZP1 levels and actin filaments in non-starved versus starved WT fibroblasts (Figure 8B,C). These results suggest that LUZP1 can stabilize actin stress fibers and that starvation triggers both LUZP1 and F-actin reduction.

Cells missing Luzp1 show reduced F-actin levels.

(A) Immunofluorescence micrographs of WT, Luzp1-/- and +LUZP1 cells stained with an antibody against endogenous LUZP1 (green), phalloidin to detect F-actin (magenta), and counterstained with DAPI (blue). Single green and magenta channels are shown in black and white. Note the lack of LUZP1 signal in Luzp1-/- cells. Scale bar, 10 µm. (B) Immunofluorescence micrographs of non-starved and starved WT cells stained with antibodies against endogenous LUZP1 (green), phalloidin (magenta) and DAPI (blue). Single green and magenta channels are shown in black and white. Scale bar, 5 µm. Imaging was performed using widefield fluorescence microscopy (Zeiss Axioimager D1, 63x objective). (C) Graphical representation of the LUZP1 or F-actin mean intensity (arbitrary units) as shown in (B). Graphs represent Mean and SEM of three independent experiments pooled together. P-values were calculated using One-way ANOVA and Bonferroni post-hoc test.

Truncated SALL1 promotes LUZP1 degradation via the ubiquitin proteasome system

In concordance with immunofluorescence results in Figures 3 and 4, we confirmed a reduction in total LUZP1 levels in TBS275 cells compared to controls by western blot (Figure 9A,B and Figure 9—figure supplement 1). No transcriptional changes in LUZP1 expression were detected between control and TBS275 samples (Figure 9—figure supplement 2), so we hypothesized that truncated SALL1 might lead to UPS-mediated LUZP1 degradation. We analyzed LUZP1 levels after treatment with the proteasome inhibitor MG132, both in control and TBS275 cells, and LUZP1 levels were increased to a higher extent in TBS275 compared to control cells (1.8 fold increase in control vs 2.4 fold increase in TBS275 cells) (Figure 9A,B). Moreover, we confirmed the reduction of LUZP1 levels in the CRISPR/Cas9 TBS model cell line (293335), compared to its parental cell line (293WT) (Figure 9C,D and Figure 9—figure supplement 1), and likewise in HEK 293FT cells stably overexpressing truncated SALL1 (SALL1275-YFP) compared to cells with YFP as control (Figure 9E,F and Figure 9—figure supplement 1). A more prominent increase in LUZP1 accumulation upon MG132 treatment was also observed in 293335 and HEK 293FT cells overexpressing SALL1275-YFP compared to controls (Figure 9C,D and Figure 9E,F, respectively, and Figure 9—figure supplement 1). Additionally, we also observed LUZP1 accumulation upon MG132 treatment by immunofluorescence in RPE1 cells, both at the actin cytoskeleton (Figure 9G, upper panels) and at the centrosome (Figure 9G, lower panels). All together, these results show that LUZP1 levels are sensitive to degradation via the UPS pathway and suggest that truncated SALL1 may contribute to this process. Furthermore, we compared LUZP1 ubiquitination in 293WT vs 293335 cells using the BioUb strategy (see Materials and methods) (Pirone et al., 2017). In the pulldowns, we could observe a prominent band in presence of BioUb, possibly corresponding to a monoubiquitinated form of LUZP1 (Figure 9H and Figure 9—figure supplement 1). This form was present in 293WT and 293335 cells, and increased in the presence of MG132 in both cell lines. In addition, we observed a smear at higher molecular weight corresponding to polyubiquitinated forms of LUZP1 (Figure 9H, Biotin PD and Figure 9—figure supplement 1). Notably, the LUZP1 ubiquitinated pool relative to the input levels was higher in 293335 compared to 293WT cells upon MG132 treatment (Figure 9H, Biotin PD, lane 8 vs lane 11 and Figure 9—figure supplement 1). These results suggest that truncated SALL1 promotes LUZP1 degradation through the UPS pathway.

Figure 9 with 2 supplements see all
Truncated SALL1 leads to LUZP1 degradation through the UPS.

(A) Representative western blot of Control and TBS275 total cell lysates treated or not with MG132. A specific antibody detected endogenous LUZP1, and GAPDH was used as loading control. (B) Graphical representation of the fold changes of LUZP1/GAPDH ratios obtained in (A) for of Control (blue dots) and TBS275 (orange dots) treated (+) or not (-) with the proteasome inhibitor MG132. Note the increase of LUZP1 until reaching control levels in TBS275 cells upon MG132 treatment. (C) Representative western blot of 293WT and 293335 total cell lysates treated or not with MG132. A specific antibody against LUZP1 detected endogenous LUZP1, and GAPDH was used as loading control. (D) Graphical representation of the fold changes of LUZP1/GAPDH ratios obtained in panel C for 293WT (blue dots) and 293335 (orange dots) treated (+) or not (-) with MG132. Note that LUZP1 in 293335 reaches control levels with MG132 treatment. (E) Representative western blot of total lysates of HEK 293FT cells transfected with SALL1275-YFP (lanes 1 and 3) or YFP alone (lanes 2 and 4) treated (+) or not (-) with MG132. Specific antibodies against LUZP1, GFP and GAPDH were used. One black arrowhead indicates SALL1275-YFP, two back arrowheads YFP alone. (F) Graphical representation of the fold changes of LUZP1/GAPDH ratios obtained in (E) for HEK 293FT cells transfected with SALL1275-YFP (orange dots) or YFP alone (blue dots) treated (+) or not (-) with MG132. Note that LUZP1 increases in the presence of MG132 when SALL1275-YFP was transfected. Data from at least three independent experiments pooled together are shown. P-values were calculated using two-tailed unpaired Student´s t-test. (G) Immunofluorescence micrographs of RPE1 cells treated (+MG132) or not (-MG132) with proteasome inhibitor showing LUZP1 associated with the cytoskeleton (upper panels) or in the centrosome (lower panels). Antibodies against endogenous LUZP1 (green), Centrin-2 (CETN2, blue) and CEP164 (magenta) were used. DAPI labelled the nuclei (blue). Single green channels are shown in black and white. Note the overall increase of LUZP1 upon MG132 treatment. Scale bar 10 µm (cytoskeleton panels) or 0.5 µm (centrosome panels). Imaging was performed using widefield fluorescence microscopy (Zeiss Axioimager D1, 63x objective). (H) Western blot analysis of input and biotin pulldown (PD) of HEK 293FT cells transfected with CMV-LUZP1-YFP and BioUb or BirA alone treated (+) or not (-) with MG132. Specific antibodies (GFP, GAPDH, Biotin) were used as indicated. Numbers under GFP panel are the result of dividing each biotin PD band intensity by the respective input band intensity and normalize them to lane 1. Molecular weight markers in kDa are shown to the right. Two asterisks indicate monoubiquitinated LUZP1.

LUZP1 overexpression represses cilia formation and increases F-actin levels in TBS fibroblasts

Our results suggest that LUZP1 could be a mediator of TBS cilia phenotype and that this could be caused, at least in part, by the increased degradation of LUZP1 triggered by truncated SALL1. Therefore, increasing LUZP1 levels in TBS cells might affect the cilia and actin cytoskeleton phenotypes. To check whether an increase in LUZP1 levels is sufficient to repress ciliogenesis in primary human fibroblasts, Control and TBS275 cells were transduced with YFP or LUZP1-YFP using lentivirus (Figure 10A). Whereas most non-transduced surrounding cells, as well as 100% of the TBS275 cells expressing YFP were ciliated, only 40% of the Control and TBS275 cells transduced with LUZP1-YFP displayed cilia (Figure 10B). Furthermore, we checked the actin cytoskeleton defects observed in TBS275 cells to see the effect of overexpressing LUZP1-YFP. Immunostaining showed that LUZP1-YFP overexpression led to an increase in F-actin levels both in control and in TBS275 cells compared to the surrounding non-transfected cells or TBS275 cells overexpressing YFP (Figure 10C).

Figure 10 with 1 supplement see all
LUZP1 overexpression suppresses ciliogenesis and increases F-actin levels.

(A) Representative micrographs of ciliated Control and TBS275 cells transduced with YFP or LUZP1-YFP expressing lentivirus. Yellow arrowhead and white asterisk point at a magnified region shown in the lower right panel in black and white. Note the lack of cilia in cells transduced with LUZP1-YFP (white asterisk) compared to non-transduced cells (yellow arrow). AcTub: acetylated alpha-tubulin (magenta); CETN2: Centrin-2 (blue). (B) Graphical representation of the number of ciliated cells per micrograph in Control and TBS275 cells overexpressing YFP or LUZP1-YFP (n > 10 micrographs). Graphs represent Mean and SEM of ciliation frequencies per micrograph in three independent experiments pulled together. P-values were calculated using One-way ANOVA and Bonferroni post-hoc test or two-tailed unpaired Student´s t-test. (C) Representative micrographs of Control and TBS275 cells transduced with YFP (yellow arrowhead) or LUZP1-YFP (white asterisk) co-stained with phalloidin to label F-actin (magenta) and DAPI (blue). Note the increase in F-actin levels in cells transduced with LUZP1-YFP (white asterisk) compared to non-transfected cells (yellow arrow). Scale bar, 10 µm. Imaging was performed using widefield fluorescence microscopy (Zeiss Axioimager D1, 63x objective). (D) Schematic model representing how the presence of truncated SALL1 might cause cilia and actin malformations in TBS through LUZP1 interaction and UPS-mediated degradation. In control (or fed) cells (left), LUZP1 (in green) localizes to F-actin and to the proximal ends of the two centrioles, inhibiting cilia formation. LUZP1 proteostasis is maintained by the Ubiquitin Proteasome System (UPS). By contrast, in TBS (or starved) cells (right) the truncated form of SALL1 interacts with LUZP1 and promotes its UPS-mediated degradation. Likewise, others have shown ubiquitination and proteasome-mediated degradation of CCP110 at the mother centriole (MC) is permissive for ciliogenesis (Li et al., 2013). LUZP1 reduction at the centrosome and at the cytoskeleton favors the formation of the primary cilia.

F-actin has a suppressive effect on ciliogenesis, and CytoD-mediated actin depolymerization has been shown to be permissive to cilia formation in cultured cells (Kim et al., 2010). To corroborate the relationship between LUZP1, actin and ciliogenesis, we performed CytoD treatment experiments. We observed that LUZP1-YFP overexpression can counteract the positive effects of CytoD on cilia formation (Figure 10—figure supplement 1). All together, these results support the notion that LUZP1 is a negative regulator of cilia formation and an F-actin stabilizing protein.

Discussion

We conclude that LUZP1 might be a contributing factor to the TBS phenotype via its interaction with truncated SALL1 and its effect on ciliogenesis, based on several findings: i) LUZP1 levels are reduced in TBS-derived cells likely due to truncated SALL1-mediated degradation through the UPS; ii) LUZP1 interacts with proteins of the centrosome and of the actin cytoskeleton; iii) In the absence of LUZP1, the assembly and growth of primary cilia is enhanced in cycling cells, accompanied by an increase in basal Shh signaling, and the actin cytoskeleton is reduced; iv) Increase of LUZP1 reduces the levels of ciliogenesis in TBS-individuals derived cells. All these results do not rule out the possibility that, in addition to LUZP1, other factors might be contributing to TBS etiology.

LUZP1 localizes to the centrosome and actin cytoskeleton

LUZP1 was previously described as a nuclear protein, with expression limited to the mouse brain (Lee et al., 2001; Sun et al., 1996). We tested two different commercial antibodies against LUZP1 by immunofluorescence and, while nuclear localization was sporadic and weak, the most prominent localization of LUZP1 was observed in the actin cytoskeleton and centrosome, both in human and mouse cells. This localization is consistent with our TurboID analysis that showed an enrichment of factors associated with the actin cytoskeleton and/or centrosomes among the potential interactors of LUZP1. The localization of LUZP1 to the actin cytoskeleton, as well as its expression in tissues beyond the brain, is consistent with independent validation in cell lines by the Human Protein Atlas (HPA; proteinatlas.org) and other expression databases (e.g. EMBL EBI Expression Atlas ebi.ac.uk/gxa). Two independent proximity labeling studies identified LUZP1 as a proximal interactor of centriole (Gupta et al., 2015) and centriolar satellite-related proteins (Gheiratmand et al., 2019). Moreover, LUZP1 has been recently reported as a centrosomal protein involved in cilia regulation (Gonçalves et al., 2019). These localizations are also consistent with fluorescent LUZP1 fusion proteins (this work; [Gupta et al., 2015; Gonçalves et al., 2019] #117). Discrepancies with the previously reported LUZP1 localization and distribution might be due to technical differences, such as epitope specificity for the antisera used in the immunohistochemistry.

Here, we report that LUZP1 surrounds the proximal end of both centrioles. Like LUZP1, a large number of centrosomal scaffold proteins contain coiled-coil regions, and the proteins are concentrically localized around a centriole in a highly organized fashion (e.g. Cep120, Cep57, Cep63, Cep152, CPAP, Cdk5Rap2, PCNT) (Fu and Glover, 2012; Lawo et al., 2012; Mennella et al., 2012). Furthermore, we show that LUZP1 interacts with centrosome and actin-related proteins (Figure 3 and Figure 4). LUZP1 is associated with CCP110 and CEP97, using pull down, immunoprecipitation and proximity proteomics approaches. This association is likely to be dynamic and potentially indirect, via other bridging factors, since our immunostainings show that LUZP1 and CCP110 are located in different areas of the centrioles. LUZP1 has also been identified as an interactor of ACTR2 (ARP2 actin related protein two homologue) and FLNA (Hein et al., 2015; Wang and Nakamura, 2019), and it has been recently described as an actin cross-linking protein (Wang and Nakamura, 2019). We found that LUZP1 localizes not only to centrioles and actin cytoskeleton, but also to the midbody in dividing cells, which was recently reported to influence ciliogenesis in polarized epithelial cells (Bernabé-Rubio et al., 2016). Our data suggest that the association of LUZP1 to centrosomes and actin filaments may contribute to its overall roles.

LUZP1 as an integrator of actin and primary-cilium dynamics

Actin dynamics coordinate several processes that are crucial for ciliogenesis. For example, positioning the MC to the appropriate area at the cell cortex is an actin-dependent process (Boisvieux-Ulrich et al., 1990; Euteneuer and Schliwa, 1985). A reduction in cortical actin should promote ciliogenesis, since there is less physical restriction for docking of the MC. Supporting this hypothesis, several studies have found that disruptions in the actin cytoskeleton, induced either chemically or genetically, promote ciliogenesis or affect cilia length (Cao et al., 2012; Drummond et al., 2018; Hernandez-Hernandez et al., 2013; Kang et al., 2015; Kim et al., 2015; Kim et al., 2010). How actin regulates cilium length is not clear. Recently, a role for actin has been implicated in ectocytosis and cilium tip scission, preventing the axoneme from growing too long (Nager et al., 2017; Phua et al., 2017). Whether LUZP1 at the centrosome is complexed with filamin and actin is unknown, but if so, they could together serve to stabilize the basal body as the axoneme extends or is subjected to mechanical stress.

LUZP1 is altered in TBS-derived cells

TBS is caused by mutations in SALL1 gene, which give rise to truncated proteins that interfere with the normal function of the cell. We show that LUZP1interacts with truncated SALL1 and with SALL1FL, suggesting that interaction occurs through an N-terminal domain shared by both. In control cells, LUZP1 and SALL1FL likely have minimal or no interaction due to their respective localizations to the cytoplasm and nucleus. However, truncated SALL1, alone or together with SALL1FL that is retained in the cytoplasm, can interact with cytoplasmic LUZP1, promoting its degradation and functional inhibition. Importantly, we detected an increase in LUZP1 levels upon treatment with the proteasome inhibitor MG132 (Figure 9), suggesting that LUZP1 degradation is proteasome-dependent. Next, we demonstrated that LUZP1 is ubiquitinated, and that truncated SALL1 both increases LUZP1 ubiquitination and decreases its stability. In agreement with our findings, LUZP1 ubiquitination has been detected in several proteomic screens for ubiquitinated proteins (Akimov et al., 2018; Mertins et al., 2013; Povlsen et al., 2012; Udeshi et al., 2013; Wagner et al., 2012).

Further experiments would be required to understand the precise mechanism by which truncated SALL1 can influence LUZP1 ubiquitination, but one possibility could be de novo complexes involving specific Ub E3 ligases or de-ubiquitinases which could influence LUZP1 stability. In fact, various E3s/de-ubiquitinases, as well as other components of the UPS, were found as proximal interactors of truncated SALL1 and LUZP1. Furthermore, regulation by the UPS system has been reported for centrosomal factors, including the cilia regulator CCP110 (D'Angiolella et al., 2010; Hossain et al., 2017; Li et al., 2013).

Both Luzp1-/- and TBS cells showed a reduction in F-actin accompanied by an increase in ciliation. We suggest that the reduction in F-actin in TBS cells might contribute to their higher cilia abundance, longer cilia and increased Shh signaling. An increase in LUZP1 in control and TBS275 cells is sufficient to increase F-actin levels and reduce cilia frequency, supporting that LUZP1 may have a contributing role in the TBS phenotype.

The role of LUZP1 in TBS phenotype

Cilia formation, Shh signaling, and the actin cytoskeleton is aberrant in TBS patient-derived fibroblasts (this work; [Bozal-Basterra et al., 2018]). Changes in Shh signaling have not been reported in mouse models for TBS, nor in any other cell types or tissues derived from TBS patients. Nevertheless, the phenotypes observed in TBS individuals fall within the spectrum of those observed in ciliopathies, characterized by malformations in digits, ears, heart, brain, kidneys and urogenital anomalies, phenotypes that are consistent with misregulated Shh signaling. Preaxial polydactyly has been associated with ectopic Shh expression in limbs (Dunn et al., 2011; Johnson et al., 2014; Lettice et al., 2003; Lettice et al., 2008; Liem et al., 2009; Zhulyn and Hui, 2015); Anal stenosis or imperforate anus have been related to misregulation of Shh pathway (Kang et al., 1997; Mo et al., 2001; Roberts et al., 1995), as well as deafness and dysplastic ears (Driver et al., 2008).

We observed primary cilia, Shh signaling and cytoskeletal defects in Luzp1-/- cells. Several studies have implicated defective primary cilia and Shh signaling in the etiology of neural tube closure defects, as well as crucial roles for the actin cytoskeleton (Wallingford, 2005). There are certain parallels between phenotypes observed in animal models of Luzp1 and Sall1. Exencephaly and neural tube defects were detected in mice and Xenopus Sall1 mutants (Böhm et al., 2008; Exner et al., 2017; Kiefer et al., 2003). Luzp1 KO mice exhibit ectopic Shh expression in the hindbrain neuroepithelium and display NTDs, however the expression of Shh-responsive genes (such as Gli1 or Ptch1) was not reported (Hsu et al., 2008). Perhaps the role of LUZP1 in Shh signaling, in spatial control of the signal or the response (or both), contributes to the NTD phenotype. Exencephaly may also be caused by failure in bending at the dorsolateral hinge point of the neural folds, where cells undergo changes in apical actin architecture (Sadler et al., 1982). Luzp1 KO embryos exhibited dorsolateral neural folds that were convex instead of the concave morphology observed in WT embryos (Hsu et al., 2008), suggested that defective actin dynamics may contribute to the NTD phenotype. Taken together, defective actin dynamics, aberrant primary cilia and changes in Shh signaling might lead to NTDs observed in the LUZP1 mouse model, as well as other animal models of TBS and loss of Sall-related proteins.

In addition to NTDs, cardiac malformations are another feature found in human ciliopathies (Klena et al., 2017). Cardiac defects are observed in Luzp1 knockout mice (Hsu et al., 2008), as well as TBS patients (Kohlhase, 1993). TBS cardiac defects include atrial or ventricular septal defect, the latter of which is seen in Luzp1 knockout mice. Moreover, compound Sall1/Sall4 KO mutant mice exhibit both NTDs and cardiac problems (Böhm et al., 2008). While Luzp1 and Sall1 may both contribute to neural tube and heart development, a novel crosstalk may arise in TBS due to dominantly-acting truncated SALL1 that could derail these processes and cause deformities.

In conclusion, our data indicate that LUZP1 functions as a cilia suppressor (Figure 10D). It localizes to actin stress fibers and to the centrosome. In starved cells, likewise in TBS cells, overall LUZP1 levels are diminished in both structures, which facilitates the formation of the primary cilia. In TBS cells, the truncated form of SALL1 localizes to the cytoplasm, interacting with LUZP1 and other factors, leading to the degradation of LUZP1, simulating what happens when control cells undergo starvation. As a result, the frequency of cilia formation increases, and cilia are longer than in control cells.

Ciliogenesis requires communication between the actin cytoskeleton and the centrosome. Here, we propose that LUZP1 might contribute as a nexus in this complex intracellular network that is disrupted by truncated SALL1. Our findings point to the intriguing possibility that LUZP1 might be a key relay switch in this network that, together with other factors, might contribute to the phenotypes observed in TBS.

Materials and methods

Cell culture

Request a detailed protocol

TBS-derived primary fibroblasts, U2OS (ATCC HTB-96), HEK 293FT (Invitrogen R70007), and mouse Shh-LIGHT2 cells (Taipale et al., 2000) were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin (Gibco). Human telomerase reverse transcriptase immortalized retinal pigment epithelial cells (hTERT-RPE1, ATCC CRL-4000; designated here as RPE1) were cultured in DMEM:F12 (Gibco) supplemented with 10% FBS and 1% penicillin and streptomycin. Dermal fibroblasts carrying the SALL1 pathogenic variant c.826C > T (SALL1c.826C>T), that produce a truncated protein p.Leu275* (SALL1275), were derived from a male TBS individual UKTBS#3 (called here TBS275) (Bozal-Basterra et al., 2018). Adult female dermal fibroblasts (ESCTRL#2) from healthy donors were used as controls. Cell lines were authenticated by commercial providers (Invitrogen, ATCC). Additional validation was done by TBS allele genotyping (primary fibroblasts) and reporter selection (zeoR, neoR; Shh-LIGHT2). Cultured cells were maintained between 10 and 20 passages, tested for senescence by γ-H2AX staining and mycoplasma contamination and grown until confluence (6-well plates for RNA extraction and western blot assays; 10 cm dishes for pulldowns). The use of human samples in this study was approved by the institutional review board (Ethics Committee at CIC bioGUNE, protocol P-CBG-CBBA-2111) and appropriate informed consent was obtained from human subjects or their parents.

Cell synchronization and drug treatment

Request a detailed protocol

RPE1 cells were arrested in G1 phase by treatment with mimosine (Sigma, 400 µM) for 24 hr. For S phase arrest, cells were subjected to thymidine treatment (Sigma, 2.5 mM) for 16 hr, followed by release for 8 hr, and subsequently blocked again for 16 hr. For G2/M phase arrest, cells were treated with RO-3306 (Sigma, 10 µM) for 20 hr. For G0 phase synchronization and inducing primary cilia formation, cells were starved for 48 hr (DMEM, 0% FBS, 1% penicillin and streptomycin). Treatments with the proteasome inhibitor MG132 (Calbiochem, 5 µM) were for 15 hr and with CytoD (Sigma, 50 nM) for 16 hr to stimulate actin depolymerization. HEK 293FT cells were transfected using calcium phosphate method and U2OS cells using Effectene Transfection Reagent (Qiagen).

CRISPR-Cas9 genome editing

Request a detailed protocol

CRISPR-Cas9 targeting of SALL1 locus was performed to generate a HEK 293FT cell line carrying a TBS-like allele (Bozal-Basterra et al., 2018). The mouse Luzp1 locus was targeted in NIH3T3-based Shh-LIGHT2 fibroblasts (Taipale et al., 2000) (kind gift of A. McGee, Imperial College). These are NIH3T3 mouse fibroblasts that carry an incorporated Shh reporter (firefly luciferase under control of Gli3-responsive promoter). Cas9 was introduced into Shh-LIGHT2 cells by lentiviral transduction (Lenti-Cas9-blast; Addgene #52962; kind gift of F. Zhang, MIT) and selection with blasticidin (5 µg/ml). Two high-scoring sgRNAs were selected (http://crispr.mit.edu/) to target near the initiation codon (sg2: 5’-CTTAAATCGCAGGTGGCGGT_TGG-3’; sg3: 5’-CTTCAATCTTCAGTACCCGC_TGG-3’). These sequences were cloned into px459 2.0 (Addgene #62988; kind gift of F. Zhang, MIT), for expressing both sgRNAs and additional Cas9 with puromycin selection. Transfections were performed in Shh-LIGHT2/Cas9 cells with Lipofectamine 3000 (Thermo). 24 hr after transfection, transient puromycin selection (0.5 µg/ml) was applied for 48 hr to enrich for transfected cells. Cells were plated at clonal density, and well-isolated clones were picked and propagated individually. Western blotting was used to identify clones lacking Luzp1 expression. Further propagation of a selected clone (#6) was carried out with G418 (0.4 mg/ml) and zeocin (0.15 mg/ml) selection to maintain expression of luciferase reporters. Genotyping was performed using genomic PCR (MmLuzp1_geno_for: 5’-GTTGCCAAAGAAGGTTGTGGATGCC-3’; MmLuzp1_geno_rev: 5’-CGTAAGGTTTTCTTCCTCTTCAAGTTTCTC-3’). We found that Luzp1-/- cells presented a homozygous deletion of the sequence: 5’-ccacctgcgatttaagttacagagcctgagccgccgcctcgatgagttagaggaagctacaaaaaacctccagagagcagaggatgagctcctggacctccaggacaaggtgatccaggcagagggcagcgactccagcacgctggctgagatcgaggtgctgcgccagcgg-3’. This generated a truncation and a stop codon early in the N-terminal part of the protein. The resulting peptide was: MAELTNYKDAASNRY*. A rescue cell line was generated by transducing Shh-LIGHT2 Luzp1 KO clone #6 with a lentiviral expression vector carrying EFS-LUZP1-YFP-P2A-blastR, with a positive population selected by fluorescence-activated cell sorting.

Plasmid construction

Request a detailed protocol

SALL1 truncated (SALL1275-YFP or Myc-BirA*-SALL1275) and FL versions (SALL1FL-YFP, SALL1FL-2xHA or Myc-BirA*-SALL1FL) were previously described (Bozal-Basterra et al., 2018). Human LUZP1 ORF was amplified by high-fidelity PCR (Platinum SuperFi; Thermo) from RPE1 cell cDNA and cloned to generate CB6-GFP-LUZP1. This was used as a source clone to generate additional variants, including CMV-LUZP1-YFP. The LUZP1-YFP and TbID-LUZP1 lentiviral expression vectors were generated by replacing Cas9 in Lenti-Cas9-blast (Addgene #52962). All constructs were verified by Sanger sequencing. Plasmids CAG-BioUBC(x4)_BirA_V5_puro (called here BioUb) and CAG-BirA-puro (called here BirA) were reported previously (Pirone et al., 2017).

Biotin pulldowns

Request a detailed protocol

Using the BioID and the TurboID methods (Branon et al., 2018; Roux et al., 2012), proteins in close proximity to SALL1 and LUZP1, respectively, were biotinylated and isolated by streptavidin-bead pulldowns. For transient transfections, Myc-BirA*-SALL1c.826C>T or Myc-BirA*-SALL1FL were used in HEK 293FT cells (10 cm dishes). For TurboID experiments, TbID-LUZP1-P2A-blast or TbID-P2A-blast alone were transduced in RPE1 cells and a stable population was selected. For the isolation of BioUb-conjugates 10 cm dishes were transfected with BioUb or BirA as control (Pirone et al., 2017). Briefly, 24 hr after transfection, medium was supplemented with biotin at 50 μM. Cells were collected 48 hr after transfection, washed 3 times on ice with cold phosphate buffered saline (PBS) and scraped in lysis buffer [8 M urea, 1% SDS, 1x protease inhibitor cocktail (Roche), 60 μM NEM in 1x PBS; 1 ml per 10 cm dish]. At room temperature, samples were sonicated and cleared by centrifugation. Cell lysates were incubated overnight with 40 μl of equilibrated NeutrAvidin-agarose beads (Thermo Scientific). Beads were subjected to stringent washes using the following washing buffers (WB), all prepared in PBS: WB1 (8 M urea, 0.25% SDS); WB2 (6 M Guanidine-HCl); WB3 (6.4 M urea, 1 M NaCl, 0.2% SDS), WB4 (4 M urea, 1 M NaCl, 10% isopropanol, 10% ethanol and 0.2% SDS); WB5 (8 M urea, 1% SDS); and WB6 (2% SDS). For elution of biotinylated proteins, beads were heated at 99°C in 50 μl of Elution Buffer (4x Laemmli buffer, 100 mM DTT). Beads were separated by centrifugation (18000 x g, 5 min).

Lentiviral transduction

Request a detailed protocol

Lentiviral expression constructs were packaged using psPAX2 and pVSV-G (Addgene) in HEK 293FT cells, and lentiviral supernatants were used to transduce Shh-LIGHT2 cells, RPE1 cells, or TBS275 and control human fibroblasts. Stable-expressing populations were selected using puromycin (1 µg/ml) or blasticidin (5 µg/ml). The vectors EFS-LUZP1-YFP-P2A-blastR, EFS-YFP-P2A-blastR, LL-GFS-SALL1c.826C>T-IRES-puroR, LL-GFS-stop-IRES-puroR, EFS-TbID-LUZP1-P2A-blastR and EFS-TbID-P2A-blastR were used. Lentiviral supernatants were concentrated 100-fold before use (Lenti-X concentrator, Clontech). Concentrated virus was used for transducing primary fibroblasts and RPE1 cells.

Mass spectrometry

Request a detailed protocol

Analysis was done in RPE1 cells stably expressing TbID or TbID-LUZP1 at sub-endogenous levels. Three independent pulldown experiments (1.5 × 108 cells per replicate) were analyzed by MS. Samples eluted from the NeutrAvidin beads were separated in SDS-PAGE (50% loaded) and stained with Sypro-Ruby (Biorad) according to manufacturer’s instructions. Entire gel lanes were excised, divided into pieces and in-gel digested with trypsin. Recovered peptides were desalted using stage-tip C18 microcolumns (Zip-tip, Millipore) and resuspended in 0.1% FA prior to MS analysis. Samples were analyzed in a novel hybrid trapped ion mobility spectrometry – quadrupole time of flight mass spectrometer (timsTOF Pro with PASEF, Bruker Daltonics) coupled online to a nanoElute liquid chromatograph (Bruker). This mass spectrometer takes advantage of a novel scan mode termed parallel accumulation – serial fragmentation (PASEF), which multiplies the sequencing speed without any loss in sensitivity (Meier et al., 2015), providing outstanding analytical speed and sensibility for proteomics analyses (Meier et al., 2018). Sample (200 ng) was directly loaded in a 15 cm Bruker nanoelute FIFTEEN C18 analytical column (Bruker) and resolved at 400 nl/min with a 100 min gradient. Column was heated to 50°C using an oven. Protein identification and quantification was carried out using PEAKS software (Bioinformatics solutions). Searches were carried out against a database consisting of human entries (Uniprot/Swissprot), with precursor and fragment tolerances of 20 ppm and 0.05 Da. Only proteins identified with at least two peptides at FDR < 5% were considered for further analysis. Data were loaded onto Perseus platform (Tyanova et al., 2016) and further processed (Log2 transformation, selection of proteins with at least two valid values in at least one condition, imputation). A t-test was applied in order to determine the statistical significance of the differences detected, and heatmaps were generated using this tool. Protein IDs were ranked according to the number of peptides found and their corresponding intensities. Gene ontology (GO) term enrichment was analyzed using g:GOSt Profiler, a tool integrated in the g:Profiler web server (Reimand et al., 2016). GO enrichment was obtained by calculating –Log10 of the P-value.

Network analysis of LUZP1 interactors was performed using the String app version 1.4.2 in Cytoscape version 3.7.2, with a high confidence interaction score (0.7). Transparency and width of the edges were continuously mapped to the String score (textmining, databases, coexpression, experiments, fusion, neighborhood and cooccurrence). Color, transparency and size of the nodes were discretely mapped to the Log2 enrichment value as described in Figure 1. The Molecular COmplex DEtection (MCODE) plug-in version 1.5.1 was used to identify highly connected subclusters of proteins (degree cutoff of 2; Cluster finding: Haircut; Node score cutoff of 0.5; K-Core of 2; Max. Depth of 100).

GFP-trap pulldowns

Request a detailed protocol

All steps were performed at 4°C. HEK 293FT transfected cells were collected after 48 hr, washed 3 times with 1x PBS and lysed in 1 ml of lysis buffer [25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% Triton X-100, 5% glycerol, protease inhibitors (Roche)]. Lysates were kept on ice for 30 min vortexing every 5 min and spun down at 25,000 x g for 20 min. After saving 40 μl of supernatant (input), the rest was incubated overnight with 30 μl of pre-washed GFP-Trap resin (Chromotek) in a rotating wheel. Beads were washed 5 times for 5 min each with WB (25 mM Tris-HCl pH 7.5, 300 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% TX-100, 5% glycerol). Beads were centrifuged at 2000 x g for 2 min after each wash. For elution, samples were boiled for 5 min at 95°C in 2x Laemmli buffer.

Immunoprecipitation

Request a detailed protocol

All steps were performed at 4°C. Cells were collected and lysates were processed as described for GFP-trap pulldowns. After saving 40 μl of supernatant (input), the rest was incubated overnight with 1 µg of anti-CEP97 antibody (Proteintech), or anti-LUZP1 antibody (Sigma HPA028506) and for additional 4 hr with 40 μl of pre-washed Protein G Sepharose 4 Fast Flow beads (GE Healthcare) on a rotating wheel. Beads were washed 5 times for 5 min each with WB (10 mM Tris-HCl pH 7.5, 137 mM NaCl, 1 mM EDTA, 1% Triton X-100). Beads were centrifuged at 2000 x g for 2 min after each wash. For elution, samples were boiled for 5 min at 95°C in 2x Laemmli buffer.

Western blot analysis

Request a detailed protocol

Cells were lysed in cold RIPA buffer (Cell Signaling Technology), WB5 (8 M urea, 1% SDS) or weak buffer (10 mM PIPES pH 6.8, 100 mM NaCl, 1 mM EGTA, 3 mM MgCl2, 300 mM sucrose, 0.5 mM DTT, 1% Triton X-100) supplemented with 1x protease/phosphatase inhibitor cocktail (Roche). Lysates were kept on ice for 30 min vortexing every 5 min and then cleared by centrifugation (25,000 x g, 20 min, 4°C). Supernatants were collected and protein content was quantified by BCA protein quantification assay (Pierce). After SDS-PAGE and transfer to nitrocellulose membranes, blocking was performed in 5% milk, or in 5% BSA (Bovine Serum Albumin, Fraction V, Sigma) in PBT (1x PBS, 0.1% Tween-20). In general, primary antibodies were incubated overnight at 4°C and secondary antibodies for 1 hr at room temperature (RT). Antibodies used: rabbit anti-LUZP1 (Proteintech, 1:1,000) for Figure 1 and rabbit anti-LUZP1 (Sigma HPA028506, 1:1,000) for the rest of the experiments, rabbit anti-CCP110 (Proteintech, 1:1,000), rabbit anti-CEP97 (Proteintech, 1:1,000), mouse anti-GFP (Roche, 1:1,000), mouse anti-GAPDH (Proteintech, 1:1,000), mouse anti-FLNA (Merck, 1:1,000), rabbit anti-BirA (Sino Biological, 1:1000), HRP-conjugated anti-biotin (Cell Signaling Technology, 1:2,000), rabbit anti Myc (Cell Signaling Technology, 1:2,000), mouse anti-actin (Sigma, 1:1,000), goat anti-GLI3 (R and D, 1:1,000) and mouse anti-SALL1 (R and D, 1:1,000). Secondary antibodies were anti-mouse or anti-rabbit HRP-conjugates (Jackson Immunoresearch). Proteins were detected using Clarity ECL (BioRad) or Super Signal West Femto (Pierce). Quantification of bands was performed using ImageJ software and normalized against GAPDH or actin levels. At least three independent blots were quantified per experiment.

Immunostaining

Request a detailed protocol

Shh-LIGHT2 cells, RPE1, U2OS cells and primary fibroblasts from control and TBS individuals were seeded on 11 mm coverslips (15,000–25,000 cells per well; 24well plate). After washing 3 times with cold 1xPBS, cells were fixed with 100% methanol for 10 min at −20°C or with 4% PFA supplemented with 0.1% Triton X-100 in PBS for 15 min at RT. Then, coverslips were washed 3 times with 1x PBS. Blocking was performed for 1 hr at 37°C in blocking buffer (BB: 2% fetal calf serum, 1% BSA in 1x PBS). Primary antibodies were incubated overnight at 4°C and cells were washed with 1x PBS 3 times. To label the ciliary axoneme and the basal body/pericentriolar region, we used mouse antibodies against acetylated alpha-tubulin (Santa Cruz Biotechnologies, 1:160) and gamma-tubulin (Proteintech, 1:160). Other antibodies include: rat anti-Centrin-2 (CETN2, Biolegend, 1:160), rabbit anti-LUZP1 (Sigma HPA028506, 1:100), rabbit anti-CCP110 (Proteintech, 1:200), rabbit anti-PCM1 (Cell Signaling Technology, 1:100), rabbit anti ODF2 (Atlas, 1:100), mouse anti-CEP164 (Genetex, 1:100), mouse anti beta-tubulin (DSHB, 1:100) and pericentrin (Abcam, 1:100).

Donkey anti-rat, anti-mouse or anti-rabbit secondary antibodies (Jackson Immunoresearch) conjugated to Alexa 488, Alexa 594 or Alexa 633 (1:200), GFP-booster (Chromotek, 1:500), Alexa-594-conjugated Streptavidin (Jackson Immunoresearch, 1:100) and Alexa 568-conjugated phalloidin (Invitrogen, 1:500), were incubated for 1 hr at 37°C, followed by nuclear staining with DAPI (10 min, 300 ng/ml in PBS; Sigma). Fluorescence imaging was performed using an upright wide-field fluorescent microscope (Axioimager D1, Zeiss) or super-resolution microscopy (Leica SP8 Lightning and Zeiss LSM 880 Fast Airyscan) with 63x Plan ApoChromat NA1.4. For cilia measurements and counting, primary cilia from at least fifteen different fluorescent micrographs taken for each experimental condition were analyzed using the ruler tool from Adobe Photoshop. Cilia frequency was obtained dividing the number of total cilia by the number of nuclei on each micrograph. Number of cells per micrograph was similar in both TBS and control fibroblasts. To estimate the level of fluorescence in a determined region, we used the mean intensity obtained by ImageJ. To obtain the signal histograms on Figure 2C–D, we used the plot profile tool in FIJI.

qRT-PCR analysis

Request a detailed protocol

Shh-LIGHT2 cells were starved for 48 hr. Total RNA was obtained with EZNA Total RNA Kit (Omega) and quantified by Nanodrop spectrophotometer. cDNAs were prepared using the SuperScript III First-Strand Synthesis System (Invitrogen) in 10 µl volume per reaction. LUZP1, GAPDH, Gli1, Ptch1, and Rplp0 primers were tested for efficiency and products checked for correct size before being used in test samples. qPCR was done using PerfeCTa SYBR Green SuperMix Low (Quantabio). Reactions were performed in 10 µl, adding 1 µl of cDNA and 0.5 µl of each primer (10 µM), in a CFX96 thermocycler (BioRad) using the following protocol: 95°C for 10 min and 40 cycles of 95°C for 10 s and 55–60°C for 30 s. Melting curve analysis was performed for each pair of primers between 65°C and 95°C, with 0.5°C temperature increments every 5 s. Relative gene expression data were analyzed using the ΔΔCt method. Reactions were done in triplicates and results were derived from at least three independent experiments normalized to GAPDH and Rplp0 and presented as relative expression levels. Primer sequences: LUZP1-F: 5´-GGAATCGGGTAGGAGACACCA-3´; LUZP1-R: 5´-TTCCCAGGCAGTTCAGACGGA-3; GAPDH-F: 5'-AGCCACATCGCTCAGACAC-3'; GAPDH-R: 5'-GCCCAATACGACCAAATCC-3'; Gli1-F: 5'-AGCCTTCAGCAATGCCAGTGAC-3'; Gli1-R: 5'-GTCAGGACCATGCACTGTCTTG-3'; Ptch1-F: 5'-AAGCCGACTACATGCCAGAG-3'; Ptch1-R: 5'-TGATGCCATCTGCGTCTACCAG-3', Rplp0-F: 5'-ACTGGTCTAGGACCCGAGAAG-3'; Rplp0-R: 5'-CTCCCACCTTGTCTCCAGTC-3'.

Luciferase assays

Request a detailed protocol

Shh-LIGHT2 cells were starved for 48 hr, and treated or not for the last 24 hr with purmorphamine (5 μM, ChemCruz) to induce Shh signaling pathway. Firefly luciferase expression was measured using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions. Luminescence was measured and data were normalized to the Renilla luciferase readout. For each construct, luciferase activity upon purmorphamine treatment was divided by the activity of cells before treatment to obtain the fold change value. Experiments were performed with both biological (n = 3) and technical (n = 6) replicates.

Statistical analysis

Request a detailed protocol

Statistical analysis was performed using GraphPad 6.0 software. Data were analyzed by Shapiro-Wilk normality test and Levene´s test of variance. We used two-tailed unpaired Student´s t-test or Mann Whitney-U tests for comparing two groups, One-way ANOVA or Kruskall-Wallis and the corresponding post-hoc tests for more than two groups and two-way ANOVA to compare more than one variable in more than two groups. P values were represented by asterisks as follows: (*) p-value<0.05; (**) p-value<0.01; (***) p-value<0.001; (****) p-value<0.0001. Differences were considered significant when p<0.05. Values used for graphical representations and statistical analysis are available in Source Data 2.

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
    Role of Cilia and Left-Right Patterning in Congenital Heart Disease
    1. N Klena
    2. G Gabriel
    3. X Liu
    4. H Yagi
    5. Y Li
    6. Y Chen
    7. M Zahid
    8. K Tobita
    9. L Leatherbury
    10. G Pazour
    11. CW Lo
    (2016)
    In: T Nakanishi, R. R Markwald, H. S Baldwin, B. B Keller, D Srivastava, H Yamagishi, editors. Etiology and Morphogenesis of Congenital Heart Disease: From Gene Function and Cellular Interaction to Morphology. Tokyo: Springer. pp. 67–79.
    https://doi.org/10.1007/978-4-431-54628-3
  45. 45
  46. 46
  47. 47
    GeneReviews((R))
    1. J Kohlhase
    (1993)
    Townes-Brocks Syndrome, GeneReviews((R)), Genetic Counseling.
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
    Sonic hedgehog is an endodermal signal inducing Bmp-4 and hox genes during induction and regionalization of the chick hindgut
    1. DJ Roberts
    2. RL Johnson
    3. AC Burke
    4. CE Nelson
    5. BA Morgan
    6. C Tabin
    (1995)
    Development 121:3163–3174.
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87

Decision letter

  1. Lotte Pedersen
    Reviewing Editor; University of Copenhagen, Denmark
  2. Anna Akhmanova
    Senior Editor; Utrecht University, Netherlands
  3. Elmar Schiebel
    Reviewer; Universität Heidelberg, Germany

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This paper provides biochemical and cell biological evidence demonstrating that the leucine-zipper protein LUZP1 is a cytoskeletal regulator involved in controlling ciliogenesis and Sonic Hedgehog signaling, and that altered function of LUZP1 may contribute to the Townes-Brocks Syndrome.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting your work entitled "LUZP1, a novel regulator of primary cilia and the actin cytoskeleton, is altered in Townes-Brocks Syndrome" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous.

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

While the reviewers found your manuscript interesting, they also raised several concerns implying that your manuscript would require very substantial revision to be acceptable for publication. One major concern is the quality of the LUZ1P centriole localization data, and the lack of several critical control experiments. In addition, there are some important concerns regarding the Shh signaling data and the proposed mechanistic link between LUZP1 and Townes-Brocks Syndrome. Although we are unable to consider your work for publication at this stage, we will be prepared to reconsider a substantially revised version of your manuscript, which would address the comments of the reviewers. If you decide to submit a revised manuscript, it will be treated as a new submission, but we will do our best to send it to the same reviewers.

Reviewer #1:

In their manuscript, "LUZP1, a novel regulator of primary cilia and the actin cytoskeleton, is altered in Townes-Brocks Syndrome", Bozal-Basterra et al. identify LUZP1 as a key component regulating cilia and actin dynamics and propose it may be key in the etiology of Townes-Brocks Syndrome (TBS). The authors propose that LUZP1 is central to the mechanism linking cytoskeletal rearrangements and cilia assembly, which in turns impacts cell signaling. Based on the interaction of LUZP1 with truncated SAL1, which causes TBS, the authors link LUZP1 to TWS. The strength of the manuscript is the extensive data which are generally well controlled and the data supporting a detailed mechanism of how LUZP1 functions normally at centrosomes to suppress ciliogenesis, stabilize F-actin and regulate Shh signaling. Additionally, the authors show LUZP1 is diminished in the presence of truncated SAL1 which in turn promotes ciliogenesis and abnormal Shh signaling. Thus, the authors present a solid cell biology story.

My enthusiasm for these data supporting the conclusion that this LUZP1 mechanism may underlie TBS is not high. It is one possibility but the mechanistic link is not secure. The data in the paper is in cell lines and it is not clear that the mechanism underlies the phenotypes in the patients. While the authors point out that Luzp1 mouse mutants display some overlapping phenotypes with TBS patients, the major reported phenotype in the mice involves neural tube closure defects and increased Shh expression which are not apparent in TBS. The authors show that there is increased Shh response in LUZP1 mutant cells which aligns with the authors' previous work in cell lines with truncated SAL1. However, it is not clear that increased Shh response would lead to TBS phenotypes as proposed. Generally how the proposed LUZP1 mechanism links to the tissue-specific patient phenotypes remains unclear.

Reviewer #2:

In this manuscript Bozal-Basterra et al. analyse the function of the leucine zipper protein LUZP1 in cilia formation. They identified LUZP1 as BioID interactor of SALL1. Mutations in SALL1 are associated with Townes-Brocks Syndrome (TBS1). In the first part, they show that LUZP1 associates with the proximal end of centrioles and interacts with CEP97 and CCP110 (although they are at the distal end of centrioles). In the second part of the manuscript, the authors show that LUZP1 associates with the actin cytoskeleton and that its deletion in NIH3T3 fibroblasts promotes cilia formation even without serum starvation. They continue with data suggesting that LUZP1 is subject to degradation by the proteasome. Furthermore, they suggest that SALL1 regulates LUZP1 stability. In particular, a truncation in SALL1 that arises in TBS1 seems to reduce LUZP1 levels. This may cause cilia formation in interphase and activation of Shh.

The middle part of the manuscript is the most significant, convincing and exciting one. It is convincingly shown that LUZP1 suppresses the formation of cilia in interphase via the actin cytoskeleton and its degradation in G2/M and G0 probably contributes to primary cilia formation. The first part of the manuscript is much less convincing and I am not sure what the centriole association of LUZP1 means. The impact of the final part of the paper, the regulation of LUZP1 by SALL1, is limited by the very mild effect of 293335 on LUZP1 levels (20%) (Figure 7C).

This is an interesting paper, however, it needs clearly more work to make it suitable for publication in eLife. I would remove the centriole localization of LUZP1 from the manuscript and invest more efforts in showing the mechanistic principals and relevance of the regulation of LUZP1 by SALL1 and the proteasome.

1) The images in Figure 2 are unusual. The authors use the Z stacks with low resolution to reconstitute the side views of centrioles. This results in distorted images. To increase quality of the images, the authors have to analyse centrioles in side views in X-Y. This will give them a much better localization of LUPZ1 relative to know proteins of the centriole/centrosome. Furthermore, to show specificity of the LUZP1 signal at centrosomes of RPR1 and U2OS cells, the authors have to deplete LUZP1 and show reduction or disappearance of the signal. Further suggest to use PCNT as a PCM marker in IF.

2) Figure 3A and B should have gamma-tubulin staining. However, according to the figure it shows acetylated alpha-tubulin. According to the legend it has acetylated alpha-tubulin and gamma-tubulin both in magenta. I do not agree with the statement: "Our results showed that LUZP1 was markedly decreased in TBS275 cells.… and LUZP1 was visualized as two rings that encircle each of the centrioles,.…". First, I do not see the decrease of LUZP1 and second the LUZP1 signal localizes dot-like in the periphery of centrioles. It is not a circle.

3) In Figure 3 that authors show that LUZP1 associates with CCP110 and CEP97 in pull downs and IP experiments. How does this fit with the localization of LUZP1 at the proximal end of centrioles?

4) I do not understand the data points in Figure 8B – how do the author explain this big variation?

5) Figure 8 shows transient transfection experiments without controlling expression levels.

6) Why is the loading control GAPDH not present in all lanes of Figure 7E?

Reviewer #3:

In this manuscript, Bozal-Basterra and colleagues identified the leucine-zipper containing protein LUZP1 as a novel component of the centrosome and actin cytoskeleton. They generated LUZP1 KO cells, which had higher rates of ciliogenesis and longer primary cilia, increased Shh signaling and decreased F-actin levels. Moreover, overexpression of LUZP1 repressed ciliogenesis and increased F-actin levels. In previous work, they identified LUZP1 as a proximity interactor of SALL1 protein, which is mutated in Townes-Brocks syndrome. Following on this finding, they identified physical and proximity interactions between truncated and full-length SALL1 and LUZP1 and showed that TBS cells had a reduction in LUZP1 and F-actin levels. Finally, they show that truncated SALL1 promotes LUZP1 degradation through regulation of its ubiquitination. Based on these findings, they propose LUZP1 as a key factor integrating cytoskeletal changes to cilia formation and function.

The manuscript is of general interest to the field because LUZP1 mutations were previously linked to cardiovascular defects and cranial NTC in mice and thus dissecting the function and regulation of this protein will contribute to our understanding of disease mechanisms. Additionally, the results of this paper identify LUZP1 as a negative regulator of ciliogenesis as a protein at the intersection of centrosome and actin cytoskeleton. However, given the complexity of interactions and functions associated with LUZP1 presented in this paper and published previously, it is not clear how LUZP1 mediates the reported functions, which weakens the model they present. Moreover, for some of the results, the data included is not sufficient to derive these conclusions and appropriate controls are missing. The following points must be addressed before publication of this paper in eLife:

1) One of the weakest points of the manuscript is the endogenous localization of the protein. The data presented for endogenous localization in Figure 2, Figure 3 and Figure 4 are somewhat contradictory. For example, in Figure 4, actin staining but not the centrosome staining is visible. However, in Figure 2, there is strong centrosome staining for LUZP1. Finally, in Figure 3, there are also LUZP1-positive puncta around the centrosome. To test the specificity, the authors must stain wt and LUZP1-/- cells with the antibody and include data on which cellular localizations of LUZP1 is specific. Given that their model is based on LUZP1 localization to both the centrosome and actin cytoskeleton, this point is very important.

2) The presented TurboID data presented for LUZP1 lacks the required controls and analysis. First, the localization and biotinylation activity of TurboID-LUZP1 must be shown by immunofluorescence and immunoblotting. Does the biotinylation activity reflect localization of endogenous protein at the centrosome and actin cytoskeleton? Second, what were the controls used for distinguishing the specific proximity interactors of LUZP1 form the non-specific for the application of the TurboID approach (there are none included in the paper)? An empty TurboID control must be included as a control.

3) Wang and Nakamura, 2019 paper identified LUZP1 as an interactor of Filamin, in which they mapped the actin binding site to 400-500 aa region of LUZP1. The authors can perform rescue experiments with this fragment in LUZP1-/- cells to distinguish the contribution of actin binding activity of LUZP1 to ciliogenesis from its centrosomal localization.

4) To corroborate the relationship between LUZP1, actin and ciliogenesis, the authors should test whether cytoD treatment antagonizes the effect of YFP-LUZP1 overexpression on ciliogenesis?

5) LUZP1 KO cells must be validated by immunofluorescence, immunoblotting and/or sequencing of the mutated region to show the frameshift.

6) The quality of the high resolution data in Figure 2 must be improved, the images look distorted in some, maybe due to deconvolution settings that were applied. Additionally, PCM1 staining in Figure 2E does not reflect the granular localization of centriolar satellites.

7) Given that LUZP1 and CP110/Cep97 localize to different parts of the centrosome (distal versus proximal), what is the authors hypothesis about how LUZP1 regulates CP110/Cep97 localization at the centrosome? Do these interactions occur at the cytoplasm? The model presented at the end of the paper focuses on LUZP1, SALL1, actin and ciliogenesis. How do CP110 and Cep97 fit to this model based on their data?

8) The authors switch between using RPE1 cells, U2OS cells, HEK293 cells, NIH3T3 cells and patient fibroblasts in different experiments. For the experiments related to LUZP1 phenotypic characterization, results for the same line should be included (additional cell lines can be kept as long as same one is carried along for all).

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "LUZP1, a novel regulator of primary cilia and the actin cytoskeleton, is a contributing factor in Townes-Brocks Syndrome" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Anna Akhmanova as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Elmar Schiebel (Reviewer #1).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data.

Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in eLife, either of which would be linked to the original paper.

Summary:

In this revised manuscript Bozal-Basterra et al. report on the leucin-zipper protein LUZP1 as an interactor of a truncated form SALL1 that is causing in a dominant way Townes-Brocks-Syndrome. They provide evidence that LUZP1 associates with cilia and actin filaments and that loss of LUZP1 reduces F-actin levels and impacts on cilia function. Interestingly, the truncated SALL1 increases LUZP1 ubiquitination and degradation, and although the underlying mechanism is unclear this suggests that reduced levels of LUZP1 might contribute to how the truncated SALL1 causes the disease. The manuscript is generally convincing and of importance even though the authors do not demonstrate a causative link of reduced LUZP1 levels to TBS.

Essential revisions:

The authors propose that LUZP1 is central to the mechanism linking cytoskeletal rearrangements and cilia assembly, which in turn impacts cell signaling and suggest that this underlies the etiology of TBS. While this speculation is certainly possible, the authors do not demonstrate a causative link of this mechanism to TBS. Additionally, the mechanism through which SALL1 and the proteasome regulate LUZP1 is not fully developed. In order for this manuscript to be acceptable for publication, the authors must modify the manuscript to very clearly indicate that they have not nailed the etiology of the disease. Furthermore, all suggestions about the therapeutic implications of their work should also be removed.

https://doi.org/10.7554/eLife.55957.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

While the reviewers found your manuscript interesting, they also raised several concerns implying that your manuscript would require very substantial revision to be acceptable for publication. One major concern is the quality of the LUZ1P centriole localization data, and the lack of several critical control experiments. In addition, there are some important concerns regarding the Shh signaling data and the proposed mechanistic link between LUZP1 and Townes-Brocks Syndrome. Although we are unable to consider your work for publication at this stage, we will be prepared to reconsider a substantially revised version of your manuscript, which would address the comments of the reviewers. If you decide to submit a revised manuscript, it will be treated as a new submission, but we will do our best to send it to the same reviewers.

Reviewer #1:

In their manuscript, "LUZP1, a novel regulator of primary cilia and the actin cytoskeleton, is altered in Townes-Brocks Syndrome", Bozal-Basterra et al. identify LUZP1 as a key component regulating cilia and actin dynamics and propose it may be key in the etiology of Townes-Brocks Syndrome (TBS). The authors propose that LUZP1 is central to the mechanism linking cytoskeletal rearrangements and cilia assembly, which in turns impacts cell signaling. Based on the interaction of LUZP1 with truncated SAL1, which causes TBS, the authors link LUZP1 to TWS. The strength of the manuscript is the extensive data which are generally well controlled and the data supporting a detailed mechanism of how LUZP1 functions normally at centrosomes to suppress ciliogenesis, stabilize F-actin and regulate Shh signaling. Additionally, the authors show LUZP1 is diminished in the presence of truncated SAL1 which in turn promotes ciliogenesis and abnormal Shh signaling. Thus, the authors present a solid cell biology story.

My enthusiasm for these data supporting the conclusion that this LUZP1 mechanism may underlie TBS is not high. It is one possibility but the mechanistic link is not secure. The data in the paper is in cell lines and it is not clear that the mechanism underlies the phenotypes in the patients.

We appreciate the positive comments of the reviewer.

While we performed numerous experiments in established, widely-used cell lines in order to characterize LUZP1, including a novel CRISPR/Cas9-mediated LUZP1 knockout model (in NIH3T3 fibroblasts), the experiments linking LUZP1 to TBS were performed in primary patient-derived TBS275 and control dermal fibroblasts (featured in Figures 3A-C, 4A-C, 9A-B, 10A-C). Access to other cell types is impractical, even more because TBS is a very rare genetic syndrome. We attempted to obtain LUZP1-KO primary cells and/or mice from the Chang Lab (Hsu et al., 2008) but we were unsuccessful. Primary cilia analysis in that model would have been informative. In the future, we aim to analyze LUZP1 levels and cilia dysfunction in a mouse TBS model (Kiefer et al., 2003), even if the mouse has variable penetrance and phenocopies some (but not all) hallmarks of human TBS.

Caveats aside, throughout the manuscript, we present evidence that suggest a relationship between LUZP1 and TBS:

– Interaction of LUZP1 with truncated SALL1 by BioID, pulldown and immunoprecipitation (Figure 1 and Figure 1—figure supplement 2A)

– Truncated SALL1 can cause reduction of LUZP1 levels through ubiquitination and proteasomal degradation (WB: Figures 1A, 3D, Figure 9C-F), and in TBS cells (WB: Figure

9A-B; IF: Figures 3B, 4A, 10C)

– Cellular loss of LUZP1 promotes more and longer cilia, phenocopying TBS cells (Figure

6A, B, C)

– Loss of LUZP1 leads to a reduction of CCP110 levels in the mother centriole, phenocopying TBS cells (Figure 6D, E)

– Loss of LUZP1 leads to alterations in SHH pathway similar to TBS (Figure 7F-H)

– Importantly, cytoskeletal and cilia phenotypes in TBS cells are modified by exogenous

LUZP1 (Figure 10)

While the evidence for a LUZP1-TBS link is supportive, we believe that LUZP1 is only one of multiple factors affected by the dominant action of truncated SALL1, which collectively contribute to the TBS phenotype. We clarified this repeatedly in the text and state that LUZP1 might be a “contributing factor” to TBS.

While the authors point out that Luzp1 mouse mutants display some overlapping phenotypes with TBS patients, the major reported phenotype in the mice involves neural tube closure defects and increased Shh expression which are not apparent in TBS.

Mutant mice for combinations of SALL gene (Sall1, Sall2, Sall4) display exencephaly (Böhm et al., 2008) and a TBS mouse model displays exencephaly when in homozygosity (Kiefer et al., 2003). These defects are the same as the exencephaly reported for LUZP1 KOs. In Xenopus, Sall1 morphants also present neural tube defects (Exner et al., 2017). This information has been now added to the Discussion in a specific section entitled “The role of LUZP1 in TBS phenotype”. To our knowledge, Shh expression status has not been examined in these mouse/Xenopus models, in the Rauchman TBS mouse model, or in any human TBS-derived samples. Likewise, the septal defects in cardiac development reported for the Luzp1 KO mice are similar to septal defects reported in up to 25% of TBS patients

(https://www.ncbi.nlm.nih.gov/pubmed/11102974/, https://www.ncbi.nlm.nih.gov/books/NBK1445/)

In the case of Luzp1 KO mice, it would be informative to check cilia length and frequency, as well as response to Shh, to see whether it coincides with our LUZP1-KO or TBS cellular models. Other TBS phenotypes, such as subtle morphological changes to digits, small kidney cysts, or hearing impairment, may have been overlooked in the Luzp1 KO mice. As mentioned, we could not obtain Luzp1 KO mice or derived MEFs. Since the authors have retired/relocated, it is unclear if any mice/samples/antibodies from their report have been maintained.

The authors show that there is increased Shh response in LUZP1 mutant cells which aligns with the authors' previous work in cell lines with truncated SAL1. However, it is not clear that increased Shh response would lead to TBS phenotypes as proposed.

Whether TBS developmental malformations all arise from higher basal activity or increased expression of Shh targets as we see in our cell models is difficult to discern. The characteristic TBS phenotypes include digit malformations, misshapen outer ears and hearing problems, and gastrointestinal anomalies, which can all be linked with misregulated Shh signaling. Since primary cilia can also influence other developmental signaling pathways (Wnt, TGFbeta, Notch, FGF, PDGF), ciliary changes driven by truncated SALL1 could have effects beyond Shh.

We added this information now in the Discussion section in a specific section entitled “The role of LUZP1 in TBS phenotype”.

Preaxial polydactyly has been associated with ectopic SHH expression in limbs. Examples:

Johnson et al., 2014; Lettice et al., 2003, 2008; Dunn et al., 2011.

Ectopic activation of Shh signaling is seen in Kif7 mouse models, characterized by polydactyly: Zhulyn and Hui, 2015; Ibisler A et al. Mol Syndromol. 2015. PMID: 26648833; Lam et al. J Hand Surg Eur Vol. 2019. PMID: 29587601; Amano et al. G3 (Bethesda). 2017. PMID: 28710291; Liem et al., 2009.

Misregulation of the Shh pathway has been also related to anal stenosis/imperforate anus. For example, overexpression of Shh can induce the expression of Bmp4 and Hoxd13 in hindgut mesoderm (Roberts et al., 1995 Gli2/Gli3 loss-of-function is related to anal malformations: “Gli2-/- mice exhibit imperforate anus, whereas Gli3-/- mice display less severe anal stenosis (Mo et al., 2001), both of which are observed in TBS. In humans, some individuals with Pallister-Hall syndrome [PHS (MIM: 165240)], which is caused by mutations in the Shh effector GLI3, also exhibit anorectal malformations, such as imperforate anus (Kang et al., 1997).

Shh has also been linked to deafness and dysplastic ears. For example, Shh signaling regulates sensory cell formation and auditory function in mice and humans (Driver et al., 2008), as well inner ear patterning (Bok et al. Development, 2007. PMID 17395647). The external ear is thought to derive from the first and second pharyngeal pouches, the correct patterning of which is dependent on Shh signaling (MooreScott BA, Manley NR. Dev. Biol. 2005. PMID 15680353).

TBS show similar phenotypes to those of VACTERL association (acronym for vertebral anomalies, anal atresia, congenital cardiac disease, tracheoesophageal fistula, renal anomalies, radial dysplasia, and other limb defects). Due to the similarity of phenotypes of Gli mutant mice, it has been proposed that defective Shh signaling leads to a spectrum of developmental anomalies in mice strikingly similar to those of VACTERL (Kim et al. Clin. Genet, 2001. PMID: 11359461; Lubinsky Am J Med Genet A. 2015. PMID: 26198446; Lubinsky Am J Med Genet A. 2015. PMID: 26174174).

Therefore, based on the previous literature and the fact that TBS patient-derived fibroblasts show alterations in Shh signaling (Bozal-Basterra et al., 2018), we believe that an association between TBS phenotypes and alterations of Shh pathway during development is plausible. However, to clarify for readers, we state in the manuscript that changes in Shh signaling have not been checked in other TBS patient-derived tissues (e.g. embryos), nor in mouse models for TBS.

Generally how the proposed LUZP1 mechanism links to the tissue-specific patient phenotypes remains unclear.

The effect of LUZP1 on the actin cytoskeleton in general, or especially as it pertains to centrosome/cilia function, could definitely contribute to TBS phenotypes. Our conclusion that LUZP1 and TBS phenotypes are linked is based on observations in cells and comparisons between reports on LUZP1-KO mouse, TBS models/case reports, and other ciliopathies/cilia-related phenotypes:

– Both TBS and Luzp1 KO cells show longer and more frequent cilia than control cells, which correlates with a lower occupancy of the mother centriole by CCP110. This is accompanied by an increase in Shh response (Bozal-Basterra et al., 2018; and this work).

– Longer cilia have been related previously to polydactyly (Liem et al., 2009; He et al. Nat Cell Biol. 2014. PMID: 24952464).

– TBS patient-derived fibroblasts show lower levels of LUZP1 than control cells. Increasing the levels of LUZP1 in TBS cells reduces the number of ciliated cells. –

Regarding the tissue-specific phenotypes:

It is important to bear in mind that SALL1 is a highly regulated factor that is not expressed in all tissues. For instance, mRNA has been detected in human brain, liver and kidneys (Kohlhase et al. Genomics. 1996 Dec 15;38(3):291-8. PMID: 8975705). In mice, SALL1 protein expression is very prominent in brain and limbs, as well as kidneys, lens, olfactory bulbs, heart, primitive streak and the genital tubercle. These correspond to the organs affected in human TBS (Buck et al. Mech Dev. 2001. PMID: 11404093).

LUZP1 expression appears to be broader. Using an in-house antibody (that we were unable to obtain) and western blotting (Hsu et al., 2008), LUZP1 was reported to be primarily expressed in brain, with weak expression in heart, lungs, and kidneys. More recent validation by the Human Protein Atlas, using two independent rabbit polyclonal antibodies (one of which we have used in our report, Σ HPA028506), shows a more extensive distribution. 45 different adult human tissues showed LUZP1 expression with the two antibodies, with 36 tissues also showing correlation with RNA levels (https://www.proteinatlas.org/ENSG00000169641-

LUZP1/tissue). These antibodies have not been used thus far to examine LUZP1 distribution and levels in developing mouse embryos.

We expect that the tissues affected are those that express the truncated SALL1 and LUZP1, and undergo morphological changes dependent on actin cytoskeleton and/or cilia-based signaling. This argues for a partial, but not necessarily complete, overlap in TBS and LUZP1-KO phenotypes and is compatible with a role for LUZP1 in TBS etiology. Also, we believe that LUZP1 is one of multiple factors affected by the dominant action of truncated SALL1, so only a partial overlap is expected. To make this more evident to the readers, we included a more extended explanation in the Discussion section.

Reviewer #2:

In this manuscript Bozal-Basterra et al. analyse the function of the leucine zipper protein LUZP1 in cilia formation. They identified LUZP1 as BioID interactor of SALL1. Mutations in SALL1 are associated with Townes-Brocks Syndrome (TBS1). In the first part, they show that LUZP1 associates with the proximal end of centrioles and interacts with CEP97 and CCP110 (although they are at the distal end of centrioles). In the second part of the manuscript, the authors show that LUZP1 associates with the actin cytoskeleton and that its deletion in NIH3T3 fibroblasts promotes cilia formation even without serum starvation. They continue with data suggesting that LUZP1 is subject to degradation by the proteasome. Furthermore, they suggest that SALL1 regulates LUZP1 stability. In particular, a truncation in SALL1 that arises in TBS1 seems to reduce LUZP1 levels. This may cause cilia formation in interphase and activation of Shh.

The middle part of the manuscript is the most significant, convincing and exciting one. It is convincingly shown that LUZP1 suppresses the formation of cilia in interphase via the actin cytoskeleton and its degradation in G2/M and G0 probably contributes to primary cilia formation. The first part of the manuscript is much less convincing and I am not sure what the centriole association of LUZP1 means. The impact of the final part of the paper, the regulation of LUZP1 by SALL1, is limited by the very mild effect of 293335 on LUZP1 levels (20%) (Figure 7C).

We appreciate the reviewer’s positive comments. While LUZP1 localizes both to centrioles and to actin filaments, we cannot say that its role in cilia regulation is through one structure or the other, or both. After our submission to bioRxiv and eLife, another LUZP1 preprint was submitted to bioRxiv which supports our conclusions, specifically that LUZP1 has a role in actin cytoskeleton and cilia formation (Goncalves et al. bioRxiv. https://doi.org/10.1101/736389). Also, in agreement with our results, the authors showed that exogenous LUZP1 could counteract the permissive role of CytoD on cilia formation.

While the reviewer mentions the mild variation of LUZP1 levels, the differences with control cells are statistically significant not only in 293335 cells, but also in 293 cells expressing exogenous truncated SALL1 (WB: Figures 1A, 3D, Figure 9C-F) and in TBS patient-derived cells (WB: Figure 9A-B; IF: Figures 3B, 4A-C, 10C ). Although the change is modest, it is consistent in the different models, therefore it might be biologically relevant for the TBS phenotype.

This is an interesting paper, however, it needs clearly more work to make it suitable for publication in eLife. I would remove the centriole localization of LUZP1 from the manuscript and invest more efforts in showing the mechanistic principals and relevance of the regulation of LUZP1 by SALL1 and the proteasome.

In order to understand how truncated SALL1 might be compromising LUZP1 function, it is only correct to consider all the subcellular sites where the protein is detected (actin filaments, centrosome, and the midbody). These sites are all labelled with LUZP1 antibody and with exogenous LUZP1-YFP (in WT and rescued LUZP1-KO cells). Therefore, we believe that it is important to keep manuscript data showing centriole localization of LUZP1 to allow us and others to pursue further work on the mechanisms at play in these diverse (but interrelated) subcellular locations.

We agree with the reviewer that the regulation of LUZP1 degradation by truncated SALL1 is an important subject to be investigated. From the literature and especially our BioID experiments, we have some clues for potential deubiquitinases (USP9X, USP14) and E3 ligases (MIB1) that might be involved in this regulation, but to screen candidates thoroughly and have a clear idea of this mechanism will require additional resources and time that does not justify delaying our report. In this paper, we aimed to characterize LUZP1 as a contributor to TBS phenotypes, with focus on the primary cilia. We expect that other factors affected by truncated SALL1, including those that regulate LUZP1/CP110 stability, will also have features that phenocopy TBS and will lead to interesting complementary studies in the future.

1) The images in Figure 2 are unusual. The authors use the Z stacks with low resolution to reconstitute the side views of centrioles. This results in distorted images. To increase quality of the images, the authors have to analyse centrioles in side views in X-Y. This will give them a much better localization of LUPZ1 relative to know proteins of the centriole/centrosome.

As suggested by the reviewer, we substituted the images in Figure 2 by 2D images. We took high resolution images and chose side views of the centrioles, using diverse markers.

Furthermore, to show specificity of the LUZP1 signal at centrosomes of RPR1 and U2OS cells, the authors have to deplete LUZP1 and show reduction or disappearance of the signal. Further suggest to use PCNT as a PCM marker in IF.

An immunofluorescence control for LUZP1 antibody specificity was included in the “old” Figure 5—figure supplement 1. We show this data now in the new main Figure 5 to make it more visible for the readers. Immunofluorescence of Luzp1 CRISPR KO cells reveals no LUZP1 staining at centrosomes, nor at the cytoskeleton. LUZP1 antibody specificity is also shown by Western blot in Figure 5C.

Following the useful suggestion, we purchased PCNT mouse monoclonal antibody (Abcam ab28144) and performed new stainings and high resolution imaging using PCNT to label pericentriolar material, together with rat anti-centrin2 (centrioles) and rabbit anti-LUZP1. These images are featured in the new Figure 2C.

2) Figure 3A and B should have gamma-tubulin staining. However, according to the figure it shows acetylated alpha-tubulin. According to the legend it has acetylated alpha-tubulin and gamma-tubulin both in magenta. I do not agree with the statement: "Our results showed that LUZP1 was markedly decreased in TBS275 cells.… and LUZP1 was visualized as two rings that encircle each of the centrioles,.…". First, I do not see the decrease of LUZP1 and second the LUZP1 signal localizes dot-like in the periphery of centrioles. It is not a circle.

In the “old” Figure 3A/B, we simultaneously used mouse anti-acetylated alpha-tubulin to label ciliary axonemes, and mouse anti-gamma-tubulin to label basal bodies, or centrosomes in non-ciliated cells, together with the same anti-mouse fluorophore. This was done so we could use the remaining two channels for other markers (anti-rabbit, anti-rat primary Abs). These panels have now been changed in the new Figure 3 where we used mouse antiacetylated alpha-tubulin to label the primary cilia and rat centrin to label the centrioles in different channels.

On closer inspection, we agree with the reviewer that the reduction of LUZP1 at the centrosomes in TBS cells was not clearly evident in those images (“old” Figure 3A/B), taken on the confocal microscope and processed by reconstruction and Lightning software algorithm (Leica). Therefore we re-examined the labelled cells using wide-field fluorescence microscope, capturing multiple fields, using identical settings between the control and TBS samples. These images have been included in the new Figure 3A-C. Quantification of LUZP1 fluorescence at the centrioles (defined by CETN2 staining) shows a significant reduction of LUZP1 intensity in TBS cells compared to control, and this is even more reduced by starvation.

To avoid misunderstandings, we changed the text to say now that LUZP1 surrounds the centrioles at the proximal end of both centrioles.

3) In Figure 3 that authors show that LUZP1 associates with CCP110 and CEP97 in pull downs and IP experiments. How does this fit with the localization of LUZP1 at the proximal end of centrioles?

Our pulldown and coimmunoprecipitation experiments show interaction between LUZP1 and CCP110/CEP97. Also this interaction has been corroborated by our new proximity proteomics data. Nevertheless, these techniques (pulldown, co-immunoprecipitation, or proximity TurboID) do not always define direct interactions of the analyzed proteins. We specify this point in the new version of the manuscript to make it more clear to the readers.

We speculate that, even though localization by IF implies that LUZP1 is proximal and CCP110/CEP97 is distal on the centrioles, the centrosomal “environment” is in flux and dynamic. These proteins may encounter each other as steady-state patterns are established. Also, the proteins could be transported to the centrosome in complexes, which then disassemble and resolve into the patterns that we see by IF. LUZP1 and CCP110, as well as many other centrosomal proteins, are coiled-coil proteins that might be forming higher order assemblies, so the interaction could be through bridging factors.

4) I do not understand the data points in Figure 8B – how do the author explain this big variation?

Regarding “old” Figure 8B, now “new Figure 10B: As we mentioned in Materials and methods, primary cilia from at least fifteen different fluorescent micrographs taken for each experimental condition were analyzed using the ruler tool from Adobe Photoshop. Cilia frequency was obtained dividing the number of total cilia by the number of nuclei on each micrograph. In order to measure the cilia properly, we used 63x objective, which covers 2-4 cells per micrograph. Therefore, the division of cilia per total nuclei gives this type of variation.

5) Figure 8 shows transient transfection experiments without controlling expression levels.

We thank the reviewer for this comment, as it revealed a mistake in the previous submission. The experiments shown in “old” Figure 8 (now Figure 10) were not transient transfections but lentiviral transductions. As shown in Figure 5C, the levels of transduced LUZP1-YFP (at least in the rescued mouse 3T3 Luzp1 KO cells) are not very different from the endogenous LUZP1 levels. Lentiviral transductions into primary human fibroblasts were done for immunofluorescence only. Since the same viral preparations were used for 3T3 and human fibroblast experiments, exogenous levels of LUZP1-YFP are expected to be similar to endogenous LUZP1.

6) Why is the loading control GAPDH not present in all lanes of Figure 7E?

We also thank the reviewer for this comment, as it revealed a mistake in the previous submission: GFP and GAPDH labels were mislabeled in old Figure 7E (now Figure 9E), while they were correct in the supplementary figure showing the full blots. This mistake has been corrected, with these blots included in new Figure 9E and Figure 9—figure supplement 1.

Reviewer #3:

[…] The manuscript is of general interest to the field because LUZP1 mutations were previously linked to cardiovascular defects and cranial NTC in mice and thus dissecting the function and regulation of this protein will contribute to our understanding of disease mechanisms. Additionally, the results of this paper identify LUZP1 as a negative regulator of ciliogenesis as a protein at the intersection of centrosome and actin cytoskeleton. However, given the complexity of interactions and functions associated with LUZP1 presented in this paper and published previously, it is not clear how LUZP1 mediates the reported functions, which weakens the model they present. Moreover, for some of the results, the data included is not sufficient to derive these conclusions and appropriate controls are missing. The following points must be addressed before publication of this paper in eLife:

1) One of the weakest points of the manuscript is the endogenous localization of the protein. The data presented for endogenous localization in Figure 2, Figure 3 and Figure 4 are somewhat contradictory. For example, in Figure 4, actin staining but not the centrosome staining is visible. However, in Figure 2, there is strong centrosome staining for LUZP1. Finally, in Figure 3, there are also LUZP1-positive puncta around the centrosome.

We believe that these discrepancies can be mostly attributed to the different microscopic techniques used, but we will attempt to clarify:

We describe three main sites of LUZP1 localization: actin filaments, centrosome/basal body, and the cytokinetic midbody. Actin filaments can be found throughout the cell, but most prominently in actin stress fibers that stretch across the basal side of cells. Centrosomes tend to stay close to the nucleus, usually in an apical manner, even more when the centrosome engages with the apical plasma membrane, converting to a basal body as the mother centriole serves to template the growing ciliary axoneme. The midbody is only seen briefly during cytokinesis and abscission, so very few cells in an unsynchronized population are at this stage.

Depending on the cell type, the distance between the basal and apical sides can vary, and confocal microscopy usually focuses at one level or the other to reveal the LUZP1 localization. Opening the pinhole (to allow more out-of-focus light and increasing plane thickness) or doing Z-stacks and reconstructions can reveal localizations to different planes in the same image. Some images were taken using wide-field fluorescence microscopy and often LUZP1 localization to the centrosome and actin stress fibers can be seen simultaneously.

While various imaging techniques and planes are shown, the LUZP1 localization at actin filaments, centrosomes and midbody is consistent in all the cell types that we have examined using specific antibodies, as well as with exogenous expression of LUZP1-YFP. After our submission to eLife and posting on bioRxiv, another preprint on LUZP1 was posted that strongly supports our conclusions (Goncalves et al. bioRxiv. https://doi.org/10.1101/736389). Using a different antibody, the authors also observed LUZP1 in actin filaments, centrosomes, and the midbody. Another recent study (Wang and Nakamura, 2019) also localizes LUZP1 to actin filaments.

Regarding LUZP1-positive puncta around the centrosome: In most of the stainings, LUZP1 intensity at the centrosome is much higher, but it is true that weaker punctae are often observed. We believe that the Lightning software algorithm (Leica) used in old Figure 3 increases the intensity of the puncta, which looked then more prominent than in other pictures. Old Figure 3A/B have been now substituted by fluorescence micrographs, which reflect better the reduction of intensity of LUZP1 at the centrosome in TBS cells.

We also note that a recent publication from the Pelletier and Raught groups used BioID to explore the proximal interactors of known centriolar satellite proteins (e.g. PCM1, CEP131; Gheiratmand et al., 2019). With multiple baits, they identified LUZP1, suggesting that these punctae mentioned by the reviewer could be sporadic centriolar satellites. In the LUZP1-TurboID experiments that we report here, as well as BioIDLUZP1 experiments presented in the Pelletier group preprint (posted on bioRxiv after ours), PCM1 is found as a proximal interactor to LUZP1. However, unlike PCM1, we have never seen strong, frequent, clustered LUZP1 punctae around the centrosome using antibodies or LUZP1-YFP fusion. As many centriolar satellite proteins eventually contact the centrosome, the proximity interactions with LUZP1 are likely occurring there, rather than in the satellites.

To test the specificity, the authors must stain wt and LUZP1-/- cells with the antibody and include data on which cellular localizations of LUZP1 is specific. Given that their model is based on LUZP1 localization to both the centrosome and actin cytoskeleton, this point is very important.

We agree with the reviewer that the proper control of the antibodies is very important. A control of the antibodies used for immunofluorescence was already included in the “old Figure 5—figure supplement 1”. We show this data now in the new Figure 5 to make it more visible for the readers. Immunofluorescence of Luzp1 KO cells show no LUZP1 staining at actin filaments or centrosomes. The midbody is also LUZP1-negative in those cells (data not shown). The specificity of the antibodies is also shown by western blot in Figure 5C.

2) The presented TurboID data presented for LUZP1 lacks the required controls and analysis. First, the localization and biotinylation activity of TurboID-LUZP1 must be shown by immunofluorescence and immunoblotting. Does the biotinylation activity reflect localization of endogenous protein at the centrosome and actin cytoskeleton?

According to the reviewer’s request, we redid the TurboID-LUZP1 experiment in RPE1 cells, together with a matching control, and present here new proteomics data. GO analysis of the proteins enriched in TurboID-LUZP1 versus TurboID alone show similar enrichments as our initial experiment, with centrosomal and actin cytoskeletal networks prominently featured (new Figure 1 and Figure 1—figure supplement 2).

In new Figure 1—figure supplement 2B, we show that TurboID-LUZP1 expression levels are even lower than those of endogenous protein, so massive exogenous expression is not an issue. In addition, biotinylation activity detected by fluorescent streptavidin reflects the localization of the endogenous protein in centrosome and actin filaments by using Pericentrin and Phalloidin as markers (new Figure 1—figure supplement 2C).

Of note: No streptavidin was detected in microtubules. Author response image 1 shows RPE1 cells expressing TurboID-LUZP1 (labelled with BirA antibody), localized to the centrosome and out-of-focus actin filaments. The resulting biotinylation is visualized by fluorescent streptavidin, with centrosome and actin filament labelling. Dot-like biotinylation could reflect sporadic centriolar satellites as mentioned above.

Author response image 1

Biotinylated proximal proteins were captured on streptavidin-conjugated agarose, eluted, separated by PAGE and visualized with Sypro-Ruby (Biorad) in Author response image 2. We considered that it is not necessary to add this figure to the manuscript, although we can add it upon the reviewer’s request.

Author response image 2

Second, what were the controls used for distinguishing the specific proximity interactors of LUZP1 form the non-specific for the application of the TurboID approach (there are none included in the paper)? An empty TurboID control must be included as a control.

The best control for the BioID and TurboID experiments is always a matter of discussion. BirA and its derivatives are bacterial in origin and do not have a specific subcellular localization in mammalian cells, therefore localize throughout the cell. Abundant proteins (like actin) might be randomly biotinylated. Consequently, if this “control” protein set is subtracted from a localized BioID fusion (i.e. TurboID-LUZP1) the certain interactors might be overlooked, so enrichment analysis must be considered. Following the recommendations of the reviewer, we performed a new proximity proteomics analysis comparing three replicas of TurboID alone versus three replicas of TurboID-LUZP1, which is shown in the new Figure 1 and Figure 1—figure supplement 2 and Source data 1. A good overlap with our initial TurboID-LUZP1 dataset was observed.

3) Wang and Nakamura, 2019 paper identified LUZP1 as an interactor of Filamin, in which they mapped the actin binding site to 400-500 aa region of LUZP1. The authors can perform rescue experiments with this fragment in LUZP1-/- cells to distinguish the contribution of actin binding activity of LUZP1 to ciliogenesis from its centrosomal localization.

Wang and Nakamura, 2019, showed that in cells, tagged fimbacin 1-500 localizes to actin filaments, whereas fimbacin 1-400 does not. Recombinant fimbacin 400-500 can bind actin in a pulldown assay, but cannot bundle actin filaments. Also tagged fimbacin 360-729 does not fully colocalize with F-actin, suggesting that fimbacin 400500 may be necessary (but not sufficient) for proper localization. No mention was made of centrosomal localization. Therefore, we believe rescue experiments using that fragment would be inconclusive. Using LUZP1 knockout cells may help (to remove the complicating effects of endogenous LUZP1 and formation of multimeric forms), but it is unknown whether LUZP1 can form multimers with the closely-related FILIP1/FILIP1L (also filamin-interacting proteins with coiled-coil domains). In fact, FILIP1L was found as a proximal interactor of TurboID-LUZP1 (this work), as well as a proximal interactor of many centriolar satellite proteins (Gheiratmand et al., 2019).

In line with the reviewer’s suggestion, we created various LUZP1 constructs, but we could not find a construct that directed the localization of LUZP1 to centrosome versus actin filaments. And perhaps LUZP1 at the centrosome is also actin-associated, since actin filaments have been observed emanating from isolated centrosomes (Farina et al. Nat Cell Biol 2016; PMID 2665583). These mapping experiments will require a more detailed analysis, with biochemistry and possibly in vitro reconstitution, beyond the scope of the current work.

4) To corroborate the relationship between LUZP1, actin and ciliogenesis, the authors should test whether cytoD treatment antagonizes the effect of YFP-LUZP1 overexpression on ciliogenesis?

Following the reviewer’s suggestion, we performed CytoD treatment experiments. As expected, the treatment with CytoD increased significantly the ciliogenesis in RPE1 cells. Our data showed that the overexpression of LUZP1-YFP suppressed the positive effects of CytoD. The new CytoD results have been added to the manuscript in the new Figure 10—figure supplement 1. These results are in agreement with the results shown by Goncalves et al. (bioRxiv, https://doi.org/10.1101/736389).

Exogenous LUZP1 increases intensity of actin fibers in WT and TBS cells, as we have shown in Figure 10C. With the understanding that LUZP1 is regulator of actin crosslinking (i.e. bundling of actin filaments Wang and Nakamura, 2019), exogenous expression of LUZP1 may act to bundle residual fibers after CytoD treatment, or protect filaments from CytoD action. The exact roles of F-actin in ciliogenesis are debated (Copeland, 2019), so it is difficult to say where exactly CytoD-mediated inhibition of actin polymerization is having its effect (stress fibers, cortical actin, centrosome-associated actin), but exogenous LUZP1 does counteract it.

5) LUZP1 KO cells must be validated by immunofluorescence, immunoblotting and/or sequencing of the mutated region to show the frameshift.

The Luzp1 KO cells were validated by immunofluorescence and Western blot. Those results constituted the “old Figure 5—figure supplement 1” and now are shown as main Figure 5.

We did sequence the DNA of CRISPR Luzp1-/- cells. Two sgRNAs were used in the experiment. Using flanking primers for genomic PCR, amplicons were sequenced and we found that cells have a homozygous deletion of the sequence:

5’ccacctgcgatttaagttacagagcctgagccgccgcctcgatgagttagaggaagctacaaaaaacctccagagagcagagga tgagctcctggacctccaggacaaggtgatccaggcagagggcagcgactccagcacgctggctgagatcgaggtgctgcgccagc gg-3’.

This generates a frameshift and early stop codon, resulting in a short N-terminal peptide: MAELTNYKDAASNRY*. This information is now included in the Materials and methods section.

6) The quality of the high resolution data in Figure 2 must be improved, the images look distorted in some, maybe due to deconvolution settings that were applied. Additionally, PCM1 staining in Figure 2E does not reflect the granular localization of centriolar satellites.

As suggested by reviewers 2 and 3, we substituted Figure 2 with new 2D images. We took high resolution images and chose side views of the centrioles, using diverse markers.

In relation to the PCM1 staining, we substituted the panel for another image in which the centriolar satellites were more visible.

7) Given that LUZP1 and CP110/Cep97 localize to different parts of the centrosome (distal versus proximal), what is the authors hypothesis about how LUZP1 regulates CP110/Cep97 localization at the centrosome? Do these interactions occur at the cytoplasm?

Our pulldown and coimmunoprecipitation experiments show interaction between LUZP1 and CCP110/CEP97. Also this interaction has been corroborated by our new proximity proteomics data. Nevertheless, these techniques (pulldown, co-immunoprecipitation, or proximity TurboID) do not always define direct interactions of the analyzed proteins. We specify this point in the new version of the manuscript to make it more clear to the readers.

We speculate that, even though localization by IF implies that LUZP1 is proximal and CCP110/CEP97 is distal on the centrioles, the centrosomal “environment” is in flux and dynamic. These proteins may encounter each other as steady-state patterns are established. Also, the proteins could be transported to the centrosome in complexes, which then disassemble and resolve into the patterns that we see by IF. LUZP1 and CCP110, as well as many other centrosomal proteins, are coiled-coil proteins that might be forming higher-order assemblies, so the interaction could be through bridging factors.

The model presented at the end of the paper focuses on LUZP1, SALL1, actin and ciliogenesis. How do CP110 and Cep97 fit to this model based on their data?

The destabilization of CCP110 at the mother centriole in absence of LUZP1 might be caused by the dysregulation of specific E3 ubiquitin ligases and deubiquitinases. Regulation of CCP110/CEP97 via the ubiquitin-proteasome system has been shown before (examples: Li et al., 2013; D'Angiolella et al., 2010; Wang et al. eLife. 2016. PMID: 27146717; Nagai et al. J Cell Sci. 2018. PMID: 30404837). In addition to the ones described to have a function at the centrosome, a higher number of E3s and DUBs have been recently identified at the centrosome by proteomics methods (https://cellmap.org/), increasing the landscape of potential centrosomal regulators. To understand how truncated SALL1 and/or LUZP1 modulates these E3s/DUBs would constitute a new project and cannot be done in the context of this manuscript. We integrated our data on CCP110 in our revised model in the new Figure 10D.

8) The authors switch between using RPE1 cells, U2OS cells, HEK293 cells, NIH3T3 cells and patient fibroblasts in different experiments. For the experiments related to LUZP1 phenotypic characterization, results for the same line should be included (additional cell lines can be kept as long as same one is carried along for all).

As with many published studies, different cell lines were used according to our particular objectives. For instance, HEK 293FT cells, where transient transfections are straightforward, were used for experiments that required decent protein levels (pulldowns). NIH3T3 ShhLight2 cells were used unmodified or for CRISPR-Cas9 LUZP1-knockouts, since they efficiently make primary cilia when starved and have a “built-in” Shh-responsive luciferase assay; U2OS cells do not form cilia, but have been used in many IF studies for centrosome/actin cytoskeleton. hTERT-RPE1 is a commonly used immortalized cell line that efficiently forms uniform primary cilia, mostly in a horizontal plane to allow easier length measurements. While they have nice primary cilia, RPE1 are poor or deficient in Shh signaling, which depends on many factors both upstream and downstream of the cilia. TBS patient-derived and control fibroblasts were used to demonstrate that the changes of LUZP1 are relevant in the context of the disease. While HEK 293FT cells can make primary cilia, they are poorly adherent and have few actin stress fibers, so they were rarely used for IF and quantifications of cellular structures. Aside from HEK 293FT, all other cells have much lower transfection efficiencies and sometimes lentiviral transductions were used. Considering the wide variety of techniques used in this manuscript, we had to use the most appropriate cell type for each technique.

At least for the LUZP1 localization by immunofluorescence, we believe that the same three localizations (actin filaments, centrosome, and midbody) have been observed in all cells used in the study throughout the course of our studies. We consider that using more than one cell type actually enriches the manuscript and makes our conclusions stronger.

[Editors’ note: what follows is the authors’ response to the second round of review.]

Essential revisions:

The authors propose that LUZP1 is central to the mechanism linking cytoskeletal rearrangements and cilia assembly, which in turn impacts cell signaling and suggest that this underlies the etiology of TBS. While this speculation is certainly possible, the authors do not demonstrate a causative link of this mechanism to TBS. Additionally, the mechanism through which SALL1 and the proteasome regulate LUZP1 is not fully developed. In order for this manuscript to be acceptable for publication, the authors must modify the manuscript to very clearly indicate that they have not nailed the etiology of the disease. Furthermore, all suggestions about the therapeutic implications of their work should also be removed.

We are grateful for the feedback provided and now we present text revision, clarification, and new figures that we had already available to address the reviewers’ concerns. In brief, the main changes are the following:

– Mechanistic link between LUZP1 and Townes-Brocks Syndrome: we would like to clarify that it was not our intention to propose LUZP1 as the key regulator or the causative factor of TBS. Since truncated SALL1 acts dominantly and likely affects multiple factors, we believe that the reduction in LUZP1 levels might be one of the contributing factors in TBS etiology. As suggested by the reviewers, we clearly indicated this point in the new version of the manuscript. The link between LUZP1 and TBS is based in the following observations:

– Interaction of LUZP1 with truncated SALL1 by BioID, pulldown and immunoprecipitation (Figure 1 and Figure 1—figure supplement 2A).

– Truncated SALL1 can cause reduction of LUZP1 levels through ubiquitination and proteasomal degradation (WB: Figures 1A, 3D, Figure 9C-F), and in TBS cells (WB: Figure 9A-B; IF: Figures 3B, 4A, 10C).

– Cellular loss of LUZP1 promotes more and longer cilia, phenocopying TBS cells (Figure 6A, B, C).

– Loss of LUZP1 leads to a reduction of CCP110 levels in the mother centriole, phenocopying TBS cells (Figure 6D, E).

– Loss of LUZP1 leads to alterations in SHH pathway similar to TBS (Figure 7F-H).

– Importantly, cytoskeletal and cilia phenotypes in TBS cells are modified by exogenous LUZP1 (Figure 10).

– Mechanism through which SALL1 and the proteasome regulate LUZP1: many E3 ligases and deubiquitinases are known to function at the centrosome. To understand how truncated SALL1 exerts its effect on LUZP1 requires work beyond the scope of the current study. In the new version, we modified the Discussion explicitly stating, “Further experiments would be required to understand the precise mechanism by which truncated SALL1 can influence LUZP1 ubiquitination, but one possibility could be de novo complexes involving specific Ub E3 ligases or deubiquitinases which could influence LUZP1 stability”.

– Therapeutic implications of our findings: as proposed by the reviewers, we removed all the statements suggesting the potential therapeutic implications of our work.

https://doi.org/10.7554/eLife.55957.sa2

Article and author information

Author details

  1. Laura Bozal-Basterra

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Methodology, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
  2. María Gonzalez-Santamarta

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Present address
    ITAV-CNRS, Centre Pierre Potier Oncopole, Toulouse, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  3. Veronica Muratore

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  4. Aitor Bermejo-Arteagabeitia

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  5. Carolina Da Fonseca

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  6. Orhi Barroso-Gomila

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  7. Mikel Azkargorta

    1. Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    2. CIBERehd, Instituto de Salud Carlos III, Madrid, Spain
    3. ProteoRed-ISCIII, Instituto de Salud Carlos III, Madrid, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-9115-3202
  8. Ibon Iloro

    1. Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    2. CIBERehd, Instituto de Salud Carlos III, Madrid, Spain
    3. ProteoRed-ISCIII, Instituto de Salud Carlos III, Madrid, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  9. Olatz Pampliega

    Department of Neurosciences, University of the Basque Country, Achucarro Basque Center for Neuroscience-UPV/EHU, Leioa, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7924-6374
  10. Ricardo Andrade

    Analytical & High Resolution Biomedical Microscopy Core Facility, University of the Basque Country (UPV/EHU), Leioa, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  11. Natalia Martín-Martín

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  12. Tess C Branon

    1. Department of Chemistry, Massachusetts Institute of Technology, Cambridge, United States
    2. Departments of Genetics, Chemistry and Biology, Stanford University, Stanford, United States
    Contribution
    Resources
    Competing interests
    No competing interests declared
  13. Alice Y Ting

    1. Department of Chemistry, Massachusetts Institute of Technology, Cambridge, United States
    2. Departments of Genetics, Chemistry and Biology, Stanford University, Stanford, United States
    3. Chan Zuckerberg Biohub, San Francisco, United States
    Contribution
    Resources
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8277-5226
  14. Jose A Rodríguez

    Department of Genetics, Physical Anthropology and Animal Physiology, University of the Basque Country (UPV/EHU), Leioa, Spain
    Contribution
    Resources
    Competing interests
    No competing interests declared
  15. Arkaitz Carracedo

    1. Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    2. CIBERONC, Instituto de Salud Carlos III, Madrid, Spain
    3. Ikerbasque, Basque Foundation for Science, Bilbao, Spain
    4. Biochemistry and Molecular Biology Department, University of the Basque Country (UPV/EHU), Bilbao, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  16. Felix Elortza

    1. Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    2. CIBERehd, Instituto de Salud Carlos III, Madrid, Spain
    3. ProteoRed-ISCIII, Instituto de Salud Carlos III, Madrid, Spain
    Contribution
    Methodology
    Competing interests
    No competing interests declared
  17. James D Sutherland

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Contribution
    Conceptualization, Resources, Supervision, Investigation, Methodology, Writing - original draft, Writing - review and editing
    For correspondence
    jsutherland@cicbiogune.es
    Competing interests
    No competing interests declared
  18. Rosa Barrio

    Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Technology Park, Derio, Spain
    Contribution
    Conceptualization, Formal analysis, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    rbarrio@cicbiogune.es
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9663-0669

Funding

Ministerio de Economía y Competitividad (BFU2017-84653-P)

  • Rosa Barrio

Ministerio de Economía y Competitividad (SEV-2016-0644)

  • Arkaitz Carracedo
  • Felix Elortza
  • James D Sutherland
  • Rosa Barrio

Ministerio de Economía y Competitividad (SAF2017-90900-REDT)

  • Rosa Barrio

European Commission (765445-EU)

  • Orhi Barroso-Gomila
  • James D Sutherland
  • Rosa Barrio

Basque Government (IT634-13)

  • Arkaitz Carracedo

Asociacion Espanola Contra el Cancer (POSTD19048BOZA)

  • Arkaitz Carracedo

Instituto de Salud Carlos III (PT13/0001/0027)

  • Arkaitz Carracedo

Basque Government (IKERTALDE IT1106-16)

  • Arkaitz Carracedo

Ministerio de Ciencia, Investigacion y Universidades (SAF2016-79381-R)

  • Arkaitz Carracedo

Asociacion Espanola Contra el Cancer (IDEAS175CARR)

  • Arkaitz Carracedo

Asociacion Espanola Contra el Cancer (GCTRA18006CARR)

  • Arkaitz Carracedo

La Caixa Foundation (ID 100010434, agreement LCF/PR/HR17)

  • Arkaitz Carracedo

European Commission (336343)

  • Arkaitz Carracedo

European Commission (PoC 754627)

  • Arkaitz Carracedo

European Commission (819242)

  • Arkaitz Carracedo

Ministerio de Economía y Competitividad (RYC-2016-20480)

  • Olatz Pampliega

International Brain Research Organization (ReturnHomeFellowship18-3)

  • Olatz Pampliega

Ministerio de Ciencia e Innovación (RTI2018-097948-A-I00)

  • Olatz Pampliega

Instituto de Salud Carlos III (PT13/0001/0027)

  • Felix Elortza

Instituto de Salud Carlos III (CIBERehd)

  • Felix Elortza

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

RB acknowledges A Cenigaonandia for her assistance in the experiments. We are grateful to the Fundación Inocente, Inocente for their support. We thank the Servicio General de Microscopía Analítica y de Alta Resolución en Biomedicina, SGIker at the UPV/EHU. We also acknowledge funding by grants BFU2017-84653-P (MINECO/FEDER, EU), SEV-2016–0644 (Severo Ochoa Excellence Program), 765445-EU (UbiCODE Program), SAF2017-90900-REDT (UBIRed Program), IT634-13 (Basque Country Government) and POSTD19048BOZA (Fundación Científica AECC). Additional support was provided by the Department of Industry, Tourism, and Trade of the Basque Country Government (Elkartek Research Programs) and by the Innovation Technology Department of the Bizkaia County. FE is at Proteomics Platform, member of ProteoRed-ISCIII (PT13/0001/0027) and CIBERehd. AC acknowledges the Basque Department of education (IKERTALDE IT1106-16), the MCIU (SAF2016-79381-R (FEDER/EU)), the AECC (IDEAS175CARR; GCTRA18006CARR), La Caixa Foundation (HR17-00094) and the European Research Council (Starting Grant 336343, PoC 754627, Consolidator grant 819242). CIBERONC was co-funded with FEDER funds.

Ethics

Human subjects: The use of human samples in this study was approved by the institutional review board (Ethics Committee at CIC bioGUNE) and appropriate informed consent was obtained from human subjects or their parents. protocol P-CBG-CBBA-2111).

Senior Editor

  1. Anna Akhmanova, Utrecht University, Netherlands

Reviewing Editor

  1. Lotte Pedersen, University of Copenhagen, Denmark

Reviewer

  1. Elmar Schiebel, Universität Heidelberg, Germany

Publication history

  1. Received: February 12, 2020
  2. Accepted: June 18, 2020
  3. Accepted Manuscript published: June 18, 2020 (version 1)
  4. Version of Record published: July 15, 2020 (version 2)

Copyright

© 2020, Bozal-Basterra et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 914
    Page views
  • 188
    Downloads
  • 1
    Citations

Article citation count generated by polling the highest count across the following sources: PubMed Central, Crossref, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Catherine G Triandafillou et al.
    Research Article

    Heat shock induces a conserved transcriptional program regulated by heat shock factor 1 (Hsf1) in eukaryotic cells. Activation of this heat shock response is triggered by heat-induced misfolding of newly synthesized polypeptides, and so has been thought to depend on ongoing protein synthesis. Here, using the budding yeast Saccharomyces cerevisiae, we report the discovery that Hsf1 can be robustly activated when protein synthesis is inhibited, so long as cells undergo cytosolic acidification. Heat shock has long been known to cause transient intracellular acidification which, for reasons which have remained unclear, is associated with increased stress resistance in eukaryotes. We demonstrate that acidification is required for heat shock response induction in translationally inhibited cells, and specifically affects Hsf1 activation. Physiological heat-triggered acidification also increases population fitness and promotes cell cycle reentry following heat shock. Our results uncover a previously unknown adaptive dimension of the well-studied eukaryotic heat shock response.

    1. Cell Biology
    Vasyl Ivashov et al.
    Research Article

    How cells adjust nutrient transport across their membranes is incompletely understood. Previously, we have shown that S. cerevisiae broadly re-configures the nutrient transporters at the plasma membrane in response to amino acid availability, through endocytosis of sugar- and amino acid transporters (AATs) (Müller et al., 2015). A genome-wide screen now revealed that the selective endocytosis of four AATs during starvation required the α-arrestin family protein Art2/Ecm21, an adaptor for the ubiquitin ligase Rsp5, and its induction through the general amino acid control pathway. Art2 uses a basic patch to recognize C-terminal acidic sorting motifs in AATs and thereby instructs Rsp5 to ubiquitinate proximal lysine residues. When amino acids are in excess, Rsp5 instead uses TORC1-activated Art1 to detect N-terminal acidic sorting motifs within the same AATs, which initiates exclusive substrate-induced endocytosis. Thus, amino acid excess or starvation activate complementary α-arrestin-Rsp5-complexes to control selective endocytosis and adapt nutrient acquisition.