Research Article

Developmental Biology

Metabolic control of cellular immune-competency by odors in Drosophila

Institute for Stem Cell Science and Regenerative Medicine (inStem), India
Manipal Academy of Higher Education, India
Department of Life Science, College of Natural Science, Hanyang University, Republic of Korea
The University of Trans-Disciplinary Health Sciences & Technology (TDU), India
Research Institute for Natural Science, Hanyang University, Republic of Korea

Dec 29, 2020

https://doi.org/10.7554/eLife.60376

Version of Record

Accepted for publication after peer review and revision.

Download
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Version of Record published: January 14, 2021 (This version)
Accepted Manuscript published: December 29, 2020 (Go to version)
Accepted: December 28, 2020
Received: June 26, 2020

1. Of interest
Precise temporal control of neuroblast migration through combined regulation and feedback of a Wnt receptor

Erik S Schild, Shivam Gupta ... Hendrik C Korswagen

Research Article Updated Jun 7, 2023
Further reading

Article
Figures and data
Abstract
Introduction
Results
Discussion
Materials and methods
Data availability
References
Decision letter
Author response
Article and author information
Metrics

Abstract

Studies in different animal model systems have revealed the impact of odors on immune cells; however, any understanding on why and how odors control cellular immunity remained unclear. We find that Drosophila employ an olfactory-immune cross-talk to tune a specific cell type, the lamellocytes, from hematopoietic-progenitor cells. We show that neuronally released GABA derived upon olfactory stimulation is utilized by blood-progenitor cells as a metabolite and through its catabolism, these cells stabilize Sima/HIFα protein. Sima capacitates blood-progenitor cells with the ability to initiate lamellocyte differentiation. This systemic axis becomes relevant for larvae dwelling in wasp-infested environments where chances of infection are high. By co-opting the olfactory route, the preconditioned animals elevate their systemic GABA levels leading to the upregulation of blood-progenitor cell Sima expression. This elevates their immune-potential and primes them to respond rapidly when infected with parasitic wasps. The present work highlights the importance of the olfaction in immunity and shows how odor detection during animal development is utilized to establish a long-range axis in the control of blood-progenitor competency and immune-priming.

Introduction

Hematopoiesis in Drosophila gives rise to three blood cell types: plasmatocytes, crystal cells, and lamellocytes, with characteristics that are reminiscent of the vertebrate myeloid lineage. Of these, lamellocytes which are undetectable in healthy animals, appear upon infections with the parasitic wasp, Leptopilina boulardi (L. boulardi) which triggers their development (Crozatier et al., 2004). Within a few hours of wasp-egg deposition, the Drosophila larval hematopoietic system activates a series of cellular innate immune responses leading to massive differentiation of blood cells into lamellocytes. This includes trans-differentiation of circulating and sessile plasmatocytes and differentiation of multipotent blood-progenitor cells of the larval hematopoietic organ termed the ‘lymph gland’ (Anderl et al., 2016; Honti et al., 2010; Márkus et al., 2009; Stofanko et al., 2010). As lymph gland progenitor cells differentiate, the gland ultimately disintegrates to release its blood cells into circulation (Lanot et al., 2001). Together, these events contribute toward robust lamellocyte numbers which reach a maximum at 48 hr after wasp-egg laying (Lanot et al., 2001). Characterized by their large flattened appearance, lamellocytes encapsulate the deposited wasp-eggs and melanize them, facilitating their effective clearance (Rizki and Rizki, 1992). Lamellocyte differentiation is controlled by signals of both local and systemic origin. They encompass autonomous cell-fate-determining programs (Dragojlovic-Munther and Martinez-Agosto, 2012; Sinenko et al., 2011; Makki et al., 2010; Small et al., 2014) and global metabolic adaptation processes that are initiated upon infection (Bajgar et al., 2015; Dolezal et al., 2019). Blood cells therefore maintain a demand – adapted hematopoietic process to develop lamellocytes. This innate competitiveness provides a defence mechanism for the fly to limit parasitoid success. An understanding of developmental programs that prime immune-progenitor cells with potential to respond when in need forms the central focus of this investigation.

Development of multipotent blood-progenitor cells of the lymph gland relies on cues of autonomous (Benmimoun et al., 2012; Krzemień et al., 2007)and non-autonomous origin (Banerjee et al., 2019; Morin-Poulard et al., 2016). Of these, olfactory signaling has been implicated in their maintenance (Shim et al., 2013). Interestingly, studies in different model systems have revealed the impact of odors on immune cells (Strous and Shoenfeld, 2006), and revealed the influence of odors and their specificity in mediating cellular responses. Any understanding on why and how odors control cellular immunity, however, remains unclear. The present work highlights the importance of the olfaction/immune axis in immunity.

The Drosophila larval olfactory system contains 25 specific odorant receptors (OR) in 21 olfactory receptor neurons (ORNs). Orco (Or83b), an atypical OR protein, expressed in every ORN is necessary to respond to all odors. Odors are sensed by larval dorsal organ, which is innervated by dendrites of these ORNs that project to specific glomerulus of the larval antennal lobe. Here, ORNs form excitatory synapses with projection neurons (PN) whose axons innervate into regions of the brain representative of higher order information processing. The different glomeruli are interconnected by excitatory or inhibitory local interneurons that fine-tune the ORN-PN network. It has been previously shown that during Drosophila larval development, olfaction stimulates the release of GABA from neurosecretory cells of the brain, which systemically activates GABA_BR signaling in the progenitor cells to support their maintenance (Shim et al., 2013). In animals with olfactory dysfunction, this systemic cross-talk is perturbed and drives precocious differentiation of blood-progenitor cells. In the current study, we show that animals employ the olfactory/immune cross-talk to tune lamellocyte potential of hematopoietic-progenitor cells. The neuronally released GABA derived upon olfactory stimulation is utilized by blood-progenitor cells as a metabolite to stabilize Sima/HIFα protein. Sima is a well-characterized transcription factor known for its role in inducing hypoxia response (Romero et al., 2007; Semenza and Wang, 1992), which in immune progenitor cells is necessary to drive lamellocyte differentiation. While developmentally the olfaction/GABA systemic axis sustains the ability of progenitor cells to differentiate into lamellocytes, animals rearing in parasitoid threatened states co-opt this olfactory axis to prime immunity to respond to infections more rapidly and effectively. Overall, our study explores the mechanistic and physiological relevance of the olfaction/immune connection during Drosophila larval hematopoiesis and establishes its importance in the maintenance of a competent demand-adapted immune system.

Results

Olfaction controls cellular immune response necessary to combat parasitic wasp infections

In order to assess the influence of olfaction on the immunity, we infected Drosophila larvae with olfactory dysfunction, with parasitic wasps, L. boulardi and assessed for cellular immune response. We analyzed: (1) orco mutant (Neuhaus et al., 2005), the common odorant co-receptor 83b necessary for all odor responsiveness (Larsson et al., 2004) (orco¹/orco¹; Figure 1A–D), (2) Orco>Hid, rpr, which genetically ablated all ORNs (Figure 1—figure supplement 1A,B), and (3) Or42a>Hid, which specifically ablated Or42a, the ORN implicated in sensing of food-related odors (Figure 1E–G). We addressed the cellular immune response to wasp-infection in genetic and physiological conditions with altered odor environment. Lamellocytes were assessed in the lymph gland at 24 hr post-infection (HPI) (Figure 1A), and in circulation at 48 HPI (Figure 1A’). A comparative analysis of immune cells was also undertaken in uninfected conditions both in the lymph gland and circulation (shown in Supplementary files 1 and 2). We found that animals with olfactory dysfunction demonstrated a specific loss in lamellocyte formation (Figure 1A–G, Figure 1—figure supplement 1A–E). The formation of mature immune cell types seen in homeostasis like the crystal cells (Figure 1—figure supplement 1F) and plasmatocytes (Shim et al., 2013), however, remained unaffected. This implied a specific role for olfaction in controlling lamellocyte formation. Upon wasp-infection, apart from Orco>Hid, rpr where a reduction in total cell numbers was apparent in comparison to its control, all other genetic contexts showed comparable cell densities with respect to their stage matched control (Figure 1—figure supplement 1E). The reduction in Orco>Hid, rpr seemed specific to Orco> background as any such change in orco mutants was undetectable. These data implied that the lamellocyte defect was not a consequence of general dampening of immune cell numbers and was specific to the loss of lamellocyte potential in olfactory mutants. In uninfected conditions, analysis of lymph gland and circulating hemocytes for lamellocytes and immune cell densities in olfactory mutant genetic contexts did not reveal any difference and were comparable to controls (Supplementary files 1 and 2). These data strengthened the importance of olfaction in wasp-infection-mediated lamellocyte response.

Figure 1 with 2 supplements see all

Download asset Open asset

Odor-mediated neuronal GABA availability specifies lamellocyte potential.

DNA is stained with DAPI (blue). Phalloidin (red) marks blood cells and lamellocytes are characterized by their large flattened morphology. Scale bars in panels A, **B, E**, H = 20 µm and **A’, B’, E’, H’** = 50 µm. HPI indicates hours post wasp-infection, and LG is lymph gland. In lymph gland, lamellocytes analyzed at 24HPI and in circulation at 48HPI. In panels (**C, D, F, G, I, J**), median is shown in box plots and vertical bars represent upper and lowest cell-counts and statistical analysis is Mann-Whitney test, two-tailed. ‘n’ represents the total number of larvae analyzed, and for lymph gland ‘n’ represents lymph gland lobes analyzed. White dotted lines demarcate lymph glands. For better representation of the lymph gland primary lobes, the images shown, have been edited for removal of adjacent tissues (like dorsal vessel and ring gland). (**A–A’**) Control (*w¹¹¹⁸*) infected larvae showing lamellocyte induction in (A) lymph gland and (A’) circulation. (**B–D**) Compared to (**A–A’**) control (*w¹¹¹⁸*), *orco¹/orco¹* mutant larvae show reduction in lamellocyte in (**B, C**) lymph gland (n = 20, ***p<0.0001 compared to *w¹¹¹⁸*, n = 18) and (**B’, D**) circulation (n = 18, ***p<0.0001 compared to *w¹¹¹⁸*, n = 23). (**E–G**) Specifically ablating *Or42a (Or42a-Gal4; UAS-Hid)* causes reduction in lamellocytes in (**E, F**) lymph gland (n = 24, ***p<0.0001 compared to *Or42a-Gal4*/+, n = 24) and (**E’, G**) circulation (n = 20, **p=0.004 compared to *Or42a-Gal4*/+, n = 19). (**H–J**) Blocking neuronal GABA bio-synthesis in Kurs6⁺ neurons (*Kurs6-Gal4; UAS-Gad1^RNAi*) recapitulates lamellocyte reduction in (**H, I**) lymph gland (n = 22, ***p<0.0001 compared to *Kurs6-Gal4*/+, n = 18) and (**H’, J**) circulation (n = 25, ***p<0.0001 compared to *Kurs6-Gal4*/+, n = 22).

Figure 1—source data 1 Contains numerical data plotted in Figure 1C,D,F,G,I and J.: https://cdn.elifesciences.org/articles/60376/elife-60376-fig1-data1-v2.xlsx
Download elife-60376-fig1-data1-v2.xlsx

The genetic perturbation of Or42a suggested a specific requirement of food-odor sensing in lamellocyte development (Figure 1E–G). This was further supported by a physiological experimental set up designed to test the involvement of food odors in cellular immune response toward infection (Figure 1—figure supplement 1C,D). For this, Drosophila larvae were reared from early embryonic stage in food medium with minimal odors but nutritionally equivalent to regular diet (Shim et al., 2013). These animals were then infected with wasps and their lamellocyte response was analyzed. Interestingly, this condition recapitulated the lamellocyte formation defect seen upon loss of Or42a. Supplementing the minimal medium with food odors corrected the defect (Figure 1—figure supplement 1C,D). Together, with the loss-of-function mutation and food-odor experiment, the data demonstrated the importance of food odors and their sensing in lamellocyte cell fate specification.

Downstream of odor detection, activation of PN is necessary to mediate systemic release of GABA from neurosecretory cells of the larval brain. The GABA-producing neurosecretory cells are marked with Kurs6-Gal4 driver (Kurs6⁺)-based expression of reporter transgenes (Shim et al., 2013). Blocking PN signaling (GH146>ChAT^RNAi) abrogated lamellocyte formation (Figure 1—figure supplement 1G). Similarly, blocking GABA biosynthesis in GABA-producing neurosecretory cells (Kurs6>Gad1^RNAi) led to specific loss in lamellocyte formation in response to infection (Figure 1H–J, Figure 1—figure supplement 1E). This genetic condition did not impede differentiation into crystal cells (Figure 1—figure supplement 1F) or formation of plasmatocytes (Shim et al., 2013), in homeostatic (uninfected) conditions. Expression of the aforementioned neuronal driver lines is limited to the nervous system (Figure 1—figure supplement 2A,B,F,G,K,L,P and Q; Shim et al., 2013). Therefore, the lamellocyte phenotypes detected, report genetic manipulations in the neuronal tissue and are not a consequence of nonspecific expression of the drivers in the lymph gland in the conditions tested (Figure 1—figure supplement 2C,D,H,I,M,N,R and S). Moreover, the above-mentioned neuronal manipulations did not affect PSC (posterior signaling center, niche) cell numbers, whose function in cellular immune response has been well established (Makki et al., 2010; Louradour et al., 2017; Figure 1—figure supplement 2E,J,O and T). Hence, these data revealed a specific role for olfactory stimulation-dependent, downstream PN signaling and neuronally derived GABA, in priming immune cells with lamellocyte potential.

Lamellocytes are derived from both circulating pool of immune cells and also from multipotent-progenitor cells of the lymph gland (Louradour et al., 2017; Sorrentino et al., 2002). Olfaction has been shown to control maintenance of lymph gland progenitor cells through the systemic use of neuronally derived GABA (Shim et al., 2013). The accompanying lamellocyte defect detected within the lymph gland samples of the olfactory and neuronal mutant animals, led us to investigate the mechanistic underpinnings of this systemic axis on lamellocyte differentiaion within the lymph gland blood progenitor-cells.

GABA uptake and metabolism in blood-progenitor cells controls lamellocyte formation

Neuronally derived GABA activates GABA_BR/Ca²⁺-CaMKII signaling in blood-progenitor cells of the lymph gland (Shim et al., 2013). Hence, we reasoned a role for GABA_BR function in progenitor cells and examined lamellocyte formation upon progenitor-specific loss of GABA_BR1, achieved by expressing GABA_BR1^RNAi using progenitor-specific drivers, dome-MESO-Gal4 and Tep4-Gal4. Both the driver lines in 2nd and 3rd instar larval lymph glands showed restricted expression within blood-progenitor cells of uninfected and infected animals and not in the cells of PSC (Makki et al., 2010; Figure 2—figure supplement 1A–H’, I and J). In an analysis of 2nd and 3rd instar larval circulating blood cells in uninfected and infected conditions, dome-MESO-Gal4 expression was minimally detected in circulating immune cells (Figure 2—figure supplement 1A’'-C''). However, at 24HPI, dome-MESO-Gal4 expression was detected in circulating blood cells as well (Figure 2—figure supplement 1D’’). Tep4-Gal4 expression was undetectable in circulation (Figure 2—figure supplement 1E’-H'').

Abrogating GABA_BR function in progenitor cells did not impede lamellocyte development in response to wasp-infection. A significant increase in lymph gland lamellocyte numbers was evident at 24HPI (Figure 2—figure supplement 1K). Their numbers in circulation at 48HPI, however, remained comparable to control genetic backgrounds (Figure 2—figure supplement 1L,N and O). The formation of a few lamellocytes could be detected in GABA_BR1^RNAi expressing animals in uninfected conditions (Supplementary file 1 and 2). Together, these data implied that progenitor loss of GABA_BR1 did not affect lamellocyte formation. The overall cellular response to infection also remained unaffected (Figure 2—figure supplement 1M and Supplementary file 1 and 2). pCaMKII expression, a downstream read out of GABA_BR signaling was also analyzed in lymph glands obtained from animals post wasp-infection which remained unchanged (Figure 2—figure supplement 1P–R). These data implied a GABA_BR-signaling-independent function for GABA in lamellocyte differentiation. The mechanism by which neuronally derived GABA influenced blood-progenitor cell differentiation into lamellocytes was explored next.

Independent of activating GABA_BR signaling, GABA function as a metabolite is well described (Bouché and Fromm, 2004; Shelp et al., 1999; Maguire et al., 2015). This led us to explore the metabolic implications of GABA in the immune response. This was undertaken by an expression analysis of Gat, a functional GABA-transporter that facilitates GABA uptake (Figure 2A, Thimgan et al., 2006) and analysis of intracellular GABA levels (iGABA, see methods for staining details) in lymph gland tissues. In homeostatic conditions, Gat expression, using an anti-Gat antibody (Muthukumar et al., 2014), revealed uniform levels in all cells of the lymph gland (Figure 2B). Within 6 hr of wasp-infection (6HPI), a twofold upregulation was detected in all blood cells of the lymph gland (Figure 2C,D). Correspondingly, at 6HPI a twofold increase in iGABA levels was also noticed (Figure 2E–G). The iGABA levels were sensitive to changes in blood-progenitor Gat expression (Figure 2H–K). Downregulating Gat in blood-progenitor cells using Gat^RNAi, (dome-MESO>Gat^RNAi) was sufficient to substantially reduce iGABA levels in homeostasis (Figure 2H,J) and post-infection (Figure 2I,K). This suggested a role for Gat in moderating intracellular GABA levels in blood-progenitor cells. Downregulating Gat (dome-MESO>Gat^RNAi and Tep4>Gat^RNAi) resulted in a dramatic loss in lamellocyte formation in the lymph gland (Figure 2L,M and P and Figure 2—figure supplement 2A,J) and circulation (Figure 2Q and Figure 2—figure supplement 2B,E,F and K). Using additional RNAi lines we corroborated the lamellocyte phenotype, and observed a reduction at 48HPI in circulation (Figure 2—figure supplement 2A,B). On the other hand, over-expression of Gat in progenitor cells (dome-MESO>Gat), which elevated intracellular GABA levels in lymph gland blood cells (Figure 2—figure supplement 2C,D) was sufficient to expand lamellocyte numbers both in lymph gland (Figure 2N,P) and circulation (Figure 2Q and Figure 2—figure supplement 2G). Unlike other genetic conditions, Gat over-expressing animals showed sporadic formation of lamellocytes even in uninfected conditions albeit at lesser numbers than seen in response to infection (Supplementary file 1 and 2). This showed that Gat function in progenitor cells was necessary and sufficient for lamellocyte determination. Gat expression in progenitor cells was limiting and raising its levels either genetically or upon infection led to expansion of lamellocyte numbers. These genetic perturbations did not alter blood-cell densities post-infection or in uninfected states (Figure 2—figure supplement 2I and Supplementary file 2), implying specificity in Gat function in controlling lamellocyte differentiation without affecting overall blood development.

Figure 2 with 5 supplements see all

Download asset Open asset

GABA-uptake and catabolism is necessary for lamellocyte formation.

DNA is marked with DAPI (blue), GABA Transporter (Gat, red), intracellular GABA (iGABA, green), and blood cells are marked with phalloidin (red). Myospheroid (Mys) antibody staining (in panels, (**L–O**), red) is employed to mark the lamellocytes in lymph gland. Scale bars in panels (**B, C, E, F, H, I, L-O** = 20 µm). UI indicates uninfected, HPI indicates hours post-wasp-infection. In lymph gland, lamellocytes analyzed at 24HPI and in circulation at 48HPI. In panels (**D, G, J** and K), mean with standard deviation is shown and in panels (P and Q), median is shown in the box plots and vertical bars represent upper and lowest cell counts. Statistical analysis applied in panels (**D, G, J**, and K) is unpaired t-test, two-tailed and in panels (P and Q) is Mann-Whitney test, two-tailed. ‘n’ is the total number of larvae analyzed, and for lymph gland ‘n’ represents lymph gland lobes analyzed. White dotted lines demarcate lymph glands. For better representation of the lymph gland primary lobes, the images shown, have been edited for removal of adjacent tissues (like dorsal vessel and ring gland). (A) Schematic of the GABA-shunt pathway. Uptake of extra cellular GABA (eGABA) via GAT (yellow bars) in blood-progenitor cells and its intracellular catabolism through GABA-transaminase (GABA-T) which catalyzes the conversion of GABA into succinic semi-aldehyde (SSA) and its further breakdown into succinate by succinic semi-aldehyde dehydrogenase (SSADH, rate limiting step). (**B, C**) Uniform GABA transporter (Gat) expression is detected in control (*Hml^△-Gal4, UAS-GFP*) lymph gland from (B) Uninfected *Drosophila* larvae. In comparison to uninfected lymph gland, (C) Gat expression is elevated in lymph gland at 6HPI. Inset in both **A, B** shows zoomed image for the selected region in lymph gland for better clarity. Scale bars correspond to the main lymph gland image and not the inset. See corresponding quantifications in (D). (D) Relative fold change in Gat expression in control lymph gland from uninfected and infected states at 6HPI. Compared to uninfected control lymph gland (*Hml^△-Gal4, UAS-GFP/+*, n = 15), almost twofold increase in Gat expression is observed at 6HPI (*Hml^△-Gal4, UAS-GFP/+,* n = 16, ***p<0.0001). (**E, F**) Control (*dome-MESO>GFP/+*) lymph glands from (E) Uninfected *Drosophila* larvae show punctated iGABA staining in all blood cells (anti-GABA antibody staining in 1X PBS + 0.3%Triton X-100). In comparison to (E), iGABA levels detected in (F) lymph gland at 6HPI is elevated. See corresponding quantifications in (G). (G) Relative fold change in iGABA levels in uninfected and infected control lymph glands at 6HPI. Compared to uninfected control lymph gland (*dome-MESO-Gal4, UAS-GFP/+*, n = 9), a twofold increase in iGABA expression is observed at 6HPI (*dome-MESO-Gal4, UAS-GFP/+*, n = 11, ***p<0.0001). (**H, I**) Loss of progenitor *Gat* function (*dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi*) leads to reduced iGABA levels both in (H) uninfected and (I) infected states as compared to control (*dome-MESO-Gal4, UAS-GFP/+*) in (E) uninfected and (F) infected states, respectively. See corresponding quantifications in (J and K). (J) Relative fold change in iGABA levels in lymph glands from uninfected *dome-MESO-Gal4, UAS-GFP/+* (control, n = 10) and *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* (n = 10, **p=0.0097). (K) Relative fold change in iGABA expression in lymph glands at 6HPI in *dome-MESO-Gal4, UAS-GFP/+* (control, n = 11) and *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* (n = 11, *p=0.0286). (**L–O**) In response to wasp-infection, lamellocytes detected in (L) Control lymph gland. (M) Expressing *Gat^RNAi* in progenitor cells (*dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi*) causes reduction in lamellocyte numbers in lymph gland. However, (N) Expressing *Gat* in progenitor cells (*dome-MESO-Gal4, UAS-GFP; UAS-Gat*) leads to increased number of lamellocytes in lymph gland. (O) Expressing *Ssadh^RNAi* in progenitor cells (*dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi*) causes reduction in lamellocyte numbers in lymph gland compared to (L) Control lymph gland response. See corresponding quantifications in (P). (P) Quantifications of progenitor-specific knock-down of *Gat*, over-expression of *Gat* and *Ssadh* knock-down showing lymph gland lamellocyte numbers, *dome-MESO-Gal4, UAS-GFP/+* (control, n = 68), *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* (n = 42, ***p<0.0001), *dome-MESO-Gal4, UAS-GFP; UAS-Gat* (n = 63, ***p<0.0001), *dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi* (n = 57, ***p=0.0001). (Q) Quantifications of progenitor-specific knock-down of *Gat*, over-expression of *Gat* and *Ssadh* knock-down showing lamellocytes numbers in circulation, *dome-MESO-Gal4, UAS-GFP/+* (control, n = 42), *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* (n *= 37*, ***p<0.0001), *dome-MESO-Gal4, UAS-GFP; UAS-Gat* (n *= 40*, ***p<0.0001) and *dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi* (n = 22, ***p<0.0001).

Figure 2—source data 1 Contains numerical data plotted in Figure 2D,G,J,K,P and Q.: https://cdn.elifesciences.org/articles/60376/elife-60376-fig2-data1-v2.xlsx
Download elife-60376-fig2-data1-v2.xlsx

To address the underlying cause for the lamellocyte defect seen in Gat^RNAi, we investigated the intracellular functions of GABA. Intracellularly, GABA can be catabolized via the GABA-shunt pathway to generate succinate in two steps (Shelp et al., 1999). The final step catalyzed by succinic-semialdehyde dehydrogenase (Ssadh, Figure 2A) is the rate-limiting and critical step of the GABA-catabolic pathway (Shelp et al., 1999). Hence, we manipulated this step by expressing Ssadh^RNAi in blood-progenitor cells. Recapitulating the lamellocyte defect seen in olfactory and Gat loss-of-function conditions, loss of Ssadh in progenitor cells resulted in a lamellocyte reduction phenotype both in the lymph gland (Figure 2O and P and Figure 2—figure supplement 2A and J) and in circulation (Figure 2Q and Figure 2—figure supplement 2B,H and K). Again, the loss of progenitor Ssadh expression did not affect overall blood cell density, in development (Supplementary file 1 and 2) or in response to infection (Figure 2—figure supplement 2I). The requirement for Ssadh function in lamellocyte formation also correlated with its expression in lymph gland blood cells (Figure 2—figure supplement 2L,M). This was determined using in situ hybridization (Figure 2—figure supplement 2L) and quantitative real-time PCR (Figure 2—figure supplement 2M).

If the lack of lamellocyte formation in Gat or Ssadh loss-of-function condition was a consequence of aberrant lymph gland blood development was investigated (Figure 2—figure supplement 3). For this, hematopoiesis in homeostatic condition in dome-MESO>Gat^RNAi and dome-MESO>Ssadh^RNAi expressing lymph glands was assessed. Overall analysis of lymph gland development did not reveal dramatic changes in differentiation of progenitor population (measured by assessing DomeGFP⁺ area), their maintenance (Figure 2—figure supplement 3A–C) or the proportion of differentiated mature blood cells (Figure 2—figure supplement 3A–F,P and Q, Supplementary file 3 and 5) except for a marginal increase in intermediate progenitor population co-expressing Dome and Pxn (Dome⁺Pxn⁺, Figure 2—figure supplement 3P and Supplementary file 3). This increase, however, did not lead to any increase in mature blood cells of crystal cells and plasmatocyte population; with numbers remained comparable to controls (Figure 2—figure supplement 3A–F,P and Q, Supplementary file 3 and Supplementary file 5). Expression analysis of pCaMKII, Wingless, Ci¹⁵⁵ levels and PSC cell number, parameters implicated in progenitor homeostasis, did not reveal any changes in expression patterns or levels (Figure 2—figure supplement 3G–O,R). These data showed that Gat and Ssadh function in progenitor cells was largely dispensable for steady-state hematopoiesis, but these proteins were critical for demand-induced hematopoiesis in response to wasp-infections.

GABA-catabolism-derived succinate is necessary for lamellocyte formation

The metabolic output of Ssadh enzymatic reaction is the generation of succinate (Figure 2A). Hence, we explored if supplementing succinate to Drosophila larvae expressing Gat^RNAi or Ssadh^RNAi in blood-progenitor cells corrected their lamellocyte defects. For this, synchronized first instar larvae were raised on food containing 3–5% succinate and then subjected to wasp-infections, which was followed by analysis of their cellular immune response. This diet did not affect general aspects of lymph gland development and hematopoiesis. Progenitor and differentiated blood-cell profiles showed no changes and remained comparable to larvae raised on regular food (Figure 2—figure supplement 4A–C and Supplementary file 3). Compared to Gat^RNAi or Ssadh^RNAi mutants raised on regular food, the succinate supplemented diet significantly restored lamellocyte numbers in response to infection (Figure 2—figure supplement 4D–J). This was evident both in lymph glands (Figure 2—figure supplement 4D–H and I) and circulating lamellocyte counts (Figure 2—figure supplement 4D'–H' and J). These data suggested an importance of GABA-catabolism-derived succinate in lamellocyte induction.

Succinate is also derived from the tricarboxylic acid cycle (TCA) via the conversion of α-ketoglutarate, which is catalyzed in a two-step process by α-ketoglutarate dehydrogenase, αKDH (CG33791) (Zhou et al., 2008) and succinyl CoA synthetase, skap (CG11963) (Gao et al., 2008). Downregulating these TCA enzymes did not lead to any defect in lamellocyte formation (Figure 2—figure supplement 5A–C). Even though the expression of these enzymes is detected in lymph glands (Figure 2—figure supplement 5D and E) their loss-of-function data highlighted a TCA-independent but GABA-catabolism-dependent control of lamellocyte differentiation in blood-progenitor cells. The independence of TCA in this context is intriguing, and we speculate separate pools of succinate in blood cells that are maintained to control basal cellular metabolism and specialized immune requirements. The TCA-derived succinate most likely conducts basal metabolic functions, and the GABA-catabolism-derived succinate sustains the immune requirement of these blood cells. As a result, blocking GABA uptake and its catabolism without compromising basal cellular metabolism still allowed the development and differentiation to other blood cell types, but nevertheless impeded lamellocyte potential. Together, these data revealed a role for GABA-catabolic pathway in supporting succinate availability in blood cells upon wasp-infections that is necessary toward mounting a lamellocyte response.

Lamellocyte differentiation is Sima dependent

We next explored the downstream effector role of succinate in lamellocyte differentiation. As a metabolite, succinate can fuel the activity of succinate dehydrogenase (SDH) complex, which is the complex II of the mitochondrial respiratory chain that converts succinate to fumarate (Rutter et al., 2010). We expressed RNAi against the catalytic subunit of Sdh (SdhA^RNAi) in progenitor cells as the means to inhibit SDH function and prevent succinate utilization within the TCA. This genetic perturbation failed to show any reduction in lamellocyte numbers (Figure 2—figure supplement 5A–C) and implied an alternative route for succinate function in lamellocyte formation.

Multiple studies across model systems and cell types have reported an integral role for succinate in hypoxia-independent stabilization of Hypoxia-inducible factor (HIF1α via inhibition of prolyl hydroxylases that mark HIF1α protein for degradation [Brière et al., 2005; Selak et al., 2005; Tannahill et al., 2013]). Within the Drosophila larval hematopoietic tissue, Sima protein, orthologous to mammalian HIF1α (Lavista-Llanos et al., 2002) is detected at basal levels in all cells of the larval lymph gland and cells of the PSC (Figure 3A, Figure 3—figure supplement 1A,B) with comparatively higher expression in crystal cells as previously reported (Mukherjee et al., 2011; Figure 3A and Figure 3—figure supplement 1C–D’). Within a few hours of wasp-infection (6HPI), a twofold upregulation in expression of Sima protein in lymph gland blood cells was noticed (Figure 3B and E). This was observed prior to detection of any lamellocyte formation. Later, when formation of lamellocyte was detected (12HPI and 24 HPI), Sima protein expression was seen in them as well (Figure 3—figure supplement 1E–H’). The increase in Sima protein levels in response to infection did not corroborate with a similar increase in sima mRNA levels at 6HPI, when only a mild increase in sima mRNA levels was noticed (Figure 3—figure supplement 1I). These indicated additional translational or post-translational control of Sima protein expression in blood cells upon wasp-infections.

Figure 3 with 2 supplements see all

Download asset Open asset

GABA-shunt-dependent control of Sima protein stabilization in immune-progenitor cells promotes lamellocyte induction.

DNA is marked with DAPI (blue). In panels (**C, D, P–S**), Myospheroid (Mys) antibody staining (red) is employed to mark the lamellocytes in lymph gland. In panels (**A-D, F-I, K-N** and **P-S**) scale bars = 20 µm. UI indicates uninfected, HPI indicates hours post-wasp-infection. In lymph gland, lamellocytes analyzed at 24HPI and in circulation at 48HPI. In panel (**E, J, O**) mean with standard deviation is shown and in panels (T and U) median is shown in the box plots and vertical bars represent upper and lowest cell counts. Statistical analysis applied in panel (**E, J, O**), is unpaired t-test, two-tailed and in panel, (T and U), is Mann-Whitney test, two-tailed. ‘n’ is the total number of larvae analyzed, and for lymph gland ‘n’ represents lymph gland lobes analyzed. White dotted lines demarcate lymph glands. For better representation of the lymph gland primary lobes, the images shown, have been edited for removal of adjacent tissues (like dorsal vessel and ring gland). (**A–B**) Sima expression detected in control (*dome-MESO-Gal4, UAS-GFP/+*) lymph gland obtained from (A) uninfected animals (crystal cells marked with white arrows), (B) Sima expression is elevated at 6HPI. See corresponding quantifications in (E). (**C, D**) Wasp-infection response in (C) control (*dome-MESO-Gal4, UAS-GFP/+*) showing lamellocytes in lymph gland, (D) Expressing *sima^RNAi* (*dome-MESO-Gal4, UAS-GFP; UAS-sima^RNAi*) in progenitor cells causes reduction in lamellocyte numbers in lymph gland. See corresponding quantifications in (T). (E) Relative fold change in Sima expression in control lymph glands (*dome-MESO-Gal4, UAS-GFP/+*) from uninfected and infected states at 6HPI. Compared to uninfected control lymph gland (*dome-MESO>GFP/+,* n = 12), almost twofold increase in Sima expression is observed at 6HPI (*dome-MESO>GFP/+,* n = 16, ***p=0.0007). (**F–I**) Compared to Sima levels detected in developing uninfected lymph glands from (A) control (*dome-MESO-Gal4, UAS-GFP/+*), (F) *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* show reduction in Sima expression which gets elevated (G) when supplemented succinate in food (SF). Similarly, (H) Sima expression in *dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi* also show reduction, (I) which gets elevated on succinate food (SF). See corresponding quantifications in (J). (J) Relative fold change in Sima expression in uninfected lymph glands control (*dome-MESO-Gal4, UAS-GFP/+,* n = 13), *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* on RF (n = 23, ***p<0.0001) and on succinate food, SF (*dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi*, SF, n = 13, ***p<0.0001). Similarly compared to control (*dome-MESO-Gal4, UAS-GFP/+*, n = 9), *dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi* on RF (n = 11, ***p<0.0001) and on SF, (*dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi,* SF, n = 8, ***p<0.0001). (**K–N**) Compared to Sima level elevation seen in (B) control at 6HPI, (K) *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* failed to show the elevation at 6HPI; however, it gets restored on (L) succinate food (SF). Similarly, (M) *dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi* failed to show the elevation at 6HPI which gets restored on (N) succinate food (SF). See corresponding quantifications in (O). (O) Relative fold change in Sima expression in lymph glands at 6HPI, compared to control on RF (*dome-MESO-Gal4, UAS-GFP/+,* n = 11), *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* on RF (n = 11, ***p<0.0001), and on succinate food, *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* on SF (n = 9, ***p<0.0001). Similarly compared to control, *dome-MESO-Gal4, UAS-GFP/+, dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi* on RF (n = 8, *p=0.0316), and on SF (*dome-MESO-Gal4, UAS-GFP; UAS-Ssadh^RNAi*, SF, n = 9, **p=0.0097). (**P–S**) Compared to (C) control, (*dome-MESO-Gal4, UAS-GFP/+*) lymph gland response, (P) expressing *Hph* (*dome-MESO-Gal4, UAS-GFP; UAS-Hph*) in progenitor cells causes reduction in lamellocyte numbers in lymph gland. However, (Q) expressing *Hph ^RNAi* (*dome-MESO-Gal4, UAS-GFP; UAS-Hph ^RNAi*) leads to comparable number of lamellocytes in lymph gland, (R) *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* which shows reduction in lymph gland as compared to (C) control, (S) expressing *Hph^RNAi* (*dome-MESO-Gal4, UAS-GFP/UAS-Gat^RNAi; UAS-Hph^RNAi*) in *Gat^RNAi* background results into restoration of lamellocyte formation in lymph gland. See corresponding quantifications in (T). (T) Quantifications of lymph gland lamellocyte counts in *dome-MESO-Gal4, UAS-GFP*/+ (control, n = 81), *dome-MESO-Gal4, UAS-GFP; UAS-sima^RNAi* (n = 77, ***p<0.0001), *dome-MESO-Gal4, UAS-GFP; UAS-Hph* (n = 19, **p=0.0046) and *dome-MESO-Gal4, UAS-GFP; UAS-Hph^RNAi* (n = 52, ns), *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* (n = 26, ***p=0.0003) and *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi; UAS-Hph^RNAi* (n = 16, *p=0.0219). (U) Quantifications of circulating lamellocyte counts in *dome-MESO-Gal4, UAS-GFP*/+ (control, n = 20), *dome-MESO-Gal4, UAS-GFP; UAS-sima^RNAi* (n = 29, ***p<0.0001), *dome-MESO-Gal4, UAS-GFP; UAS-Hph* (n = 22, **p=0.0067) and *dome-MESO-Gal4, UAS-GFP; UAS-Hph^RNAi* (n = 18, **p=0.0019), *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi* (n = 24, **p=0.0014) and *dome-MESO-Gal4, UAS-GFP; UAS-Gat^RNAi; UAS-Hph^RNAi* (n = 9, ***p=0.0001).

Figure 3—source data 1 Contains numerical data plotted in Figure 3E,J,O,T and U.: https://cdn.elifesciences.org/articles/60376/elife-60376-fig3-data1-v2.xlsx
Download elife-60376-fig3-data1-v2.xlsx

Genetic perturbation of Sima expression in blood-progenitor cells by expressing sima^RNAi, severely impaired lamellocyte formation (Figure 3C,D and T,U, Figure 3—figure supplement 1J,K and L). The knock-down efficiency of this RNAi line in the lymph gland was confirmed by staining with Sima antibody. A significant downregulation of Sima protein expression in domeMESO>sima^RNAi-expressing progenitor cells was seen (Figure 3—figure supplement 1M–N’ and Q). Similar to Gat and Ssadh knock-down, loss of Sima function did not result in dramatic defects in cell densities (Figure 3—figure supplement 1L and Supplementary file 2). Like Gat^RNAi and Ssadh^RNAi conditions, progenitor analysis revealed a marginal increase in Dome⁺Pxn⁺ intermediate progenitor cells but not overall differentiation (Figure 3—figure supplement 1R–T and Supplementary file 3 and 5).

Sima transcriptionally controls the upregulation of lactate dehydrogenase (Ldh) (Lavista-Llanos et al., 2002). Ldh is a key enzyme of the glycolytic pathway and in conditions of infection its upregulation has been implicated in metabolically reprogramming immune cells for an efficient cellular immune response (Bajgar et al., 2015; Dolezal et al., 2019; Krejčová et al., 2019). We observed a 30-fold increase in Ldh mRNA expression in lymph glands post-wasp-infection (Figure 3—figure supplement 2A). Downregulating Ldh expression in progenitor cells was sufficient to mimic lamellocyte reduction and indicated a requirement in the lamellocyte differentiation process as well (Figure 3—figure supplement 2B–C’, D and F).

GABA catabolism establishes lamellocyte potential by regulating Sima protein stability in blood-progenitor cells

Based on these findings, Sima protein levels in Gat and Ssadh loss-of-function conditions was investigated. This was undertaken by staining Gat^RNAi and Ssadh^RNAi mutant lymph glands with anti-Sima protein antibody in uninfected and wasp-infected scenarios. Compared to uninfected control 3rd instar lymph glands (Figure 3A), Sima protein levels in dome-MESO>Gat^RNAi (Figure 3F) and dome-MESO>Ssadh^RNAi (Figure 3H) conditions was significantly reduced (Figure 3J). These mutants also demonstrated a failure to raise Sima protein levels post-infection (Figure 3K,M and O). Succinate supplementation of these animals revealed a dramatic recovery in Sima protein levels almost comparable to that seen in controls on regular food (Figure 3F–O). This data was consistent with succinate-mediated restoration of lamellocyte phenotypes in Gat^RNAi and Ssadh^RNAi backgrounds and implied GABA function in moderating progenitor Sima levels. Further, Gat over-expressing lymph glands (dome-MESO>Gat) with elevated intracellular GABA (Figure 2—figure supplement 2D), when stained for Sima protein revealed elevated expression (Figure 3—figure supplement 1O,O’ and Q). Taken together, these data showed an important requirement for intracellular GABA-catabolism in regulating Sima protein expression in lymph gland blood-progenitor cells. These data are also suggestive of GABA-breakdown into succinate whose availability moderated Sima protein levels.

Sima protein is marked for proteasomal-mediated degradation by hydroxy-prolyl hydroxylase (Hph [Schofield and Ratcliffe, 2005]) whose enzymatic activity is inhibited by succinate (Mills and O'Neill, 2014; Pappalardo et al., 1992; Tannahill et al., 2013). Hence, GABA-breakdown can moderate progenitor Sima protein levels by inhibiting Hph function through regulating succinate availability. This was tested by conducting genetic perturbations to modulate Hph expression in blood-progenitor cells. Over-expression of Hph that would downregulate Sima protein stability, recapitulated Sima loss-of function phenotype (Figure 3P,T and U). The lamellocyte numbers were significantly downregulated in the lymph gland (Figure 3P and Figure 3—figure supplement 1J) and in circulation (Figure 3U and Figure 3—figure supplement 1K and L). Conversely, downregulating Hph function by expressing Hph^RNAi in progenitor cells as the means to increase Sima protein, led to a concomitant increase in lamellocyte numbers (Figure 3Q,T and U). In comparison to the numbers detected at 24HPI in the lymph glands (Figure 3Q), the extent of increase was more evident at 48HPI in circulation (Figure 3U). Finally, expressing Hph^RNAi in blood progenitor-cells lacking Gat expression (dome-MESO>UAS-Gat^RNAi; UAS-Hph^RNAi) rescued the Gat^RNAi lamellocyte defect significantly, both in the lymph gland (Figure 3R–T) and circulation (Figure 3U). These results confirmed a role for Hph function in progenitor cells in moderating lamellocyte development. They also confirmed an epistatic relationship between Gat and Hph function in blood-progenitor cells. Over-expressing Sima in progenitor cells using dome-MESO> or Tep1V> led to larval lethality, which hindered the epistatic relationship between Gat and Sima in progenitor cells. The lethality seen with Sima over-expression with these drivers may be a consequence of non-autnomous expression in tissues other than blood that compromised viability. However, an alternative approach where wild-type larvae were rasied on diets supplemented with additional GABA or succinate, showed elevated Sima protein expression in lymph gland blood-progenitor cells as compared to regular dietary states (Figure 4—figure supplement 1A–D). In response to wasp-infection, diet-supplemented animals mounted a superior lamellocyte response than seen in regular dietary condition (Figure 4—figure supplement 1E). The immune benefit of GABA and succinate supplementation was lost with progenitor-cell-specific (Dome⁺) abrogation of sima expression (Figure 4—figure supplement 1E). These data implicated Sima function in Dome⁺ blood-progenitor cells, downstream of GABA and succinate, in mediating the lamellocyte response. The data also showed that systemic GABA levels were limiting and when supplemented, animals were capable of mounting a superior lamellocyte response.

Olfaction systemically controls blood-progenitor Sima stabilization

Animals with olfactory dysfunction (orco¹/orco¹, Orco>Hid, rpr) or abrogated for neuronal GABA synthesis (Kurs6>Gad1^RNAi) have reduced levels of systemic hemolymph GABA (Shim et al., 2013). We therefore hypothesized that in these animals the reduced systemic GABA levels could explain the loss of lamellocyte formation. Hence, animals with olfactory dysfunction and Kurs6>Gad1^RNAi were raised on a diet supplemented with GABA and succinate which successfully rescued lamellocyte numbers almost comparable to controls raised on regular diet. This was evident both in the lymph gland (Figure 4A–D and F–H, Figure 4—figure supplement 1F) and circulating lamellocyte counts (Figure 4E and I and Figure 4—figure supplement 1G). More importantly, the expression of Sima protein in lymph glands from these genetic conditions was also reduced (Figure 4J,K and M and Figure 4—figure supplement 1H,I), which was restored back to control levels in succinate supplemented diet (Figure 4L,N and Figure 4—figure supplement 1J and K).

Figure 4 with 1 supplement see all

Download asset Open asset

Olfaction-derived GABA and its metabolism to succinate controls lamellocyte potential.

DNA is marked with DAPI (blue). Lamellocytes in panels (**A-C, F** and G) are marked with Myospheroid (Mys, red). Lamellocytes are characterized by their large flattened morphology. Scale bars in panels (**A-C, F, G** and **J-N** = 20 µm). HPI indicates hours post wasp-infection, RF is regular food, GF is GABA supplemented food, SF is succinate supplemented food. In lymph gland, lamellocytes analyzed at 24HPI and in circulation at 48HPI. In panels (**D, E, H** and I) median is shown in the box plots and vertical bars represent upper and lowest cell counts. Mann-Whitney test, two-tailed is applied for statistical analysis. ‘n’ represents the total number of larvae analyzed, and for lymph glands ‘n’ represents lymph gland lobes analyzed. White dotted lines demarcate lymph glands. For better representation of the lymph gland primary lobes, the images shown, have been edited for removal of adjacent tissues (like dorsal vessel and ring gland). (**A–C**) In response to wasp-infection, lamellocytes in lymph gland (A) control (*Kurs6-Gal4/+*) in regular food (RF), (B) *orco¹/orco¹* rescue in GABA supplemented food (GF) and (C) *orco¹/orco¹* rescue in succinate supplemented food (SF). (D) Total lamellocyte count in lymph gland from control, (*w¹¹¹⁸,* n = 8), *orco¹/orco¹* mutant in RF (n = 10, ***p<0.0001), GF (n = 7, *p=0.022) and SF (n = 13, **p=0.006). (E) Total lamellocyte count in circulation from control (*w¹¹¹⁸*, n = 14), *orco¹/orco¹* mutant in RF (n = 41, ***p<0.0001), GF (n = 18, ***p<0.0001) and SF (n = 14, ***p<0.0001). (**F–G**) In response to wasp-infection, lamellocytes in lymph gland, *Kurs6-Gal4, UAS-Gad1^RNAi* in (F) GABA supplemented food (GF) and (G) succinate supplemented food (SF), compared to (A) control (*Kurs6-Gal4/+*) in regular food (RF). (H) Total lamellocytes counts in lymph gland from control (*Kurs6-Gal4/+*, n = 18), *Kurs6-Gal4, UAS-Gad1^RNAi* in RF (n = 22, ***p<0.0001), GF (n = 11, ***p<0.0001) and SF (n = 6, **p=0.007). (I) Total lamellocyte count in circulation in *Kurs6-Gal4/+,* (n = 25), *Kurs6-Gal4, UAS-Gad1^RNAi* on RF (n = 25, ***p<0.0001), GF (n = 12, ***p<0.0001) and SF (n = 26, ***p<0.0001). (**J–N**) Compared to Sima protein levels detected at 12HPI in lymph glands from (J) control (*w¹¹¹⁸*) animals on RF, (K) *orco¹/orco¹* on RF and (M) *Kurs6-Gal4, UAS-Gad1^RNAi* on RF show reduced Sima expression, which is restored with succinate supplementation, (L) *orco¹/orco¹* on SF and (N) *Kurs6-Gal4, UAS-Gad1^RNAi* on SF.

Figure 4—source data 1 Contains numerical data plotted in Figure 4D,E,H and I.: https://cdn.elifesciences.org/articles/60376/elife-60376-fig4-data1-v2.xlsx
Download elife-60376-fig4-data1-v2.xlsx

Taken together, the data thus far reveal a critical dependence of the larval hematopoietic system on olfactory stimulation for GABA production, which controls blood-progenitor Sima levels. During hematopoiesis, systemic GABA-uptake and catabolism in lymph gland blood-progenitor cells inhibits Hph activity. This likley facilitates stabilization of Sima protein in progenitor cells and controls their lamellocyte potential. In response to wasp-infection, immune-progenitor cells increase their Gat expression, thereby increasing GABA uptake. This further increases progenitor Sima levels necessary for lamellocyte differentiation. Olfactory dysfunction or Gat and Ssadh mutants fail to achieve the threshold levels of Sima in blood-progenitor cells. Hence in these conditions, the animals fail to induce lamellocytes.

Pathogenic odors induce immune priming

The establishment of lamellocyte potential by a long-range metabolic cross-talk set up by odor detection was puzzling. We therefore asked if the olfactory axis was involved in sensing wasps and if prior pathogenic odor experience during development influenced any aspect of the immune response. This was addressed by experiments mimicking Drosophila larvae rearing in wasp-infested scenarios as in the wild, where the chances of infection are higher. We reared Drosophila larvae from early embryonic stages in a food medium that was infused with wasp odors (a condition referred to as wasp-odor food [WOF] and see Materials and methods for experimental details). These preconditioned animals were subjected to wasp immune challenge with L. boulardi followed by analysis of their cellular immune response. Immune response in larvae reared on regular food medium were used as experimental controls. WOF animals demonstrated a significant increase in lamellocyte numbers in response to L. boulardi infection (Figure 5A,B and Figure 5—figure supplement 1A). A twofold increase at 24HPI in lymph gland lamellocyte numbers (Figure 5A,D and E) was evident in wasp-odor-enriched condition. Any increase in overall size of the lymph gland in WOF-infected animals was not evident (Figure 5D,E). An increase in circulating lamellocyte numbers at 48HPI was also evident (Figure 5B, Figure 5—figure supplement 1A), without significant difference in cell densities (Figure 5—figure supplement 1B). This implied that WOF condition led to more lamellocyte formation in response to wasp-infection. We also analyzed lymph glands and circulating immune cells for lamellocyte formation in homeostatic conditions. We observed that these preconditioned animals even in the absence of infection could ectopically generate lamellocytes, both in the lymph gland and circulation (Supplementary file 1 and 2). This recapitulated phenotypes seen with GF or SF supplemented food and also with Gat-overexpressing animals. Hence, we investigated GABA levels in animals in the homeostatic uninfected condition. Surprisingly, a twofold increase in hemolymph GABA levels was detected (Figure 5C). Correspondingly, lymph gland blood-cell iGABA (Figure 5F,G) and Sima protein (Figure 5H,I) levels were increased as well. This showed that WOF preconditioned animals had developmentally elevated systemic GABA availability, which consequently raised progenitor Sima expression and led to improved lamellocyte potential. The immune-benefit thus seemed unlikely of any dramatic increase in lymph gland progenitor population. Moreover, differentiation into plasmatocytes (Supplementary file 3) or crystal cells (Supplementary file 5) was comparable to controls. This implied specificity of wasp-odors in priming lamellocyte potential as opposed to controlling general blood-cell differentiation.

Figure 5 with 2 supplements see all

Download asset Open asset

Physiological role for odors in blood cell immunity.

DNA is marked with DAPI (blue), iGABA (green), Sima protein (red), and Myospheroid (Mys) staining (red) is employed to mark the lamellocytes in lymph gland Scale bars in panels D-O = 20 µm. RF is regular food, WOF is wasp-odor food and HPI indicates hours post wasp-infection. In lymph gland, lamellocytes analyzed at 24HPI and in circulation at 48HPI. In **A, B, R** and S median is shown as box plots and vertical bars represent the upper and lowest cell-counts. In panels **C, P**, Q, and T mean with standard deviation is shown. Statistical analysis, in panels **A, B, R, and S** is Mann-Whitney test, two-tailed and in panels **C, P, Q, and T** is unpaired t-test, two-tailed. ‘n’ represents total number of larvae analyzed, and for lymph gland ‘n’ represents lymph gland lobes analyzed. ns is nonsignificant. White dotted lines demarcate lymph glands. For better representation of the lymph gland primary lobes, the images shown, have been edited for removal of adjacent tissues (like dorsal vessel and ring gland). (A) Quantifications of lymph gland lamellocyte numbers. Compared to controls (*Or49a-Gal4/+*) raised on RF (n = 23), animal raised on WOF show increase in lamellocytes number (n = 17, ***p<0.0001). However, such increase not observed in *Or49a-Gal4, UAS-Hid* larvae when raised on WOF (n = 13, **p=0.0015) compared to *Or49a-Gal4, UAS-Hid* raised on RF (n = 20). (B) Quantifications of total circulating lamellocyte numbers per larvae. Compared to control (*Or49a-Gal4/+*) raised on RF (n = 38), animal raised on WOF show increase in lamellocytes number (n = 35, **p=0.0085); however, such increase was not observed in *Or49a-Gal4, UAS-Hid* larvae when raised on WOF (n = 29, ***p=0.0003) compared to *Or49a-Gal4, UAS-Hid* raised on RF (n = 29). (C) Quantifications of hemolymph GABA from uninfected 3rd instar larvae on RF (*Or49a-Gal4/+*, n = 27), WOF (*Or49a-Gal4/+,* n = 30 ***p=0.0008), *Or49a-Gal4, UAS-Hid, rpr* on WOF (n = 30 *p=0.011) and *Or49a-Gal4, UAS-Hid, rpr* on RF (n = 27). Refer Supplementary file 4 for absolute amounts. (**D–E**) Compared to (D) control (*Or49a-Gal4/+*) lymph gland lamellocyte response, (E) WOF (*Or49a-Gal4/+*) animals show increased number of lamellocytes. (**F–G**) Compared to (F) control (*Or49a-Gal4/+*) lymph gland iGABA levels, (G) WOF (*Or49a-Gal4/+*) animals show elevated levels of iGABA. (**H–I**) Compared to (H) control (*Or49a-Gal4/+*) lymph gland Sima protein expression, (I) WOF (*Or49a-Gal4/+*) animals show increased Sima expression. (**J–K**) WOF condition failed to increase the lamellocyte numbers in (J) WOF (*Or49a-Gal4; UAS-Hid*), when compared to (K) RF (*Or49a-Gal4; UAS-Hid*) animals. (**L–O**) iGABA levels and Sima expression are also comparable in (**L, N**) WOF (*Or49a-Gal4; UAS-Hid*), when compared to (**M, O**) RF (*Or49a-Gal4; UAS-Hid*) animals. See corresponding quantifications in (P and Q). (P) Relative fold change in iGABA intensity of uninfected *Or49a>/+* on WOF (n = 14, **p=0.008), and *Or49a>Hid* on WOF (n = 9, ns) in comparison to RF (*Or49a>/+*, n = 11), and RF (*Or49a>Hid*, n = 5), respectively. (Q) Relative fold change in Sima protein intensity of uninfected *Or49a>/+* on WOF (n = 14, *p=0.011), and *Or49a>Hid* on WOF (n = 9, ns) in comparison to RF (*Or49a>/+,* n = 11) and RF (*Or49a>Hid*, n = 5), respectively. (R) Quantifications of lymph gland lamellocyte numbers. Compared to control (*Or49a-Gal4/+,* n = 41), forced activation of odorant receptor neuron (ORN), *Or49a* (*Or49a-Gal4; UAS-TrpA1* n = 41, ***p<0.0001) show increase in lamellocytes numbers in the lymph gland. (S) Quantifications of total circulating lamellocytes. Compared to control (*Or49a-Gal4*/+, n = 19), increase in lamellocytes number is seen upon forced activation of *Or49a-Gal4; UAS-TrpA1* (n = 17, **p=0.001). (T) Quantification of encapsulation response. Compared to control on RF (*Hml>/+,* n = 20), increased encapsulation response (%) is seen in WOF animals (*Hml>/+,* n = 19, *p=0.0256), a similar increase is also seen upon forced activation of ORN, *Or49a* (*Or49a-Gal4; UAS-TrpA1*, n = 47, **p=0.0068), as compared to control (*Or49a-Gal4>/+*, n = 20).

Figure 5—source data 1 Contains numerical data plotted in Figure 5A,B,C,P,Q,R,S and T.: https://cdn.elifesciences.org/articles/60376/elife-60376-fig5-data1-v2.xlsx
Download elife-60376-fig5-data1-v2.xlsx

The increased in lamellocyte response and elevated GABA levels seen in WOF condition was detected in animals with different genetic backgrounds (Figure 5—figure supplement 1A,C and Supplementary file 4). Secondly, in orco mutant animals the WOF immune benefit was abrogated (Figure 5—figure supplement 1A). These data showed that the WOF-induced immune priming was not restricted to specific genetic backgrounds and secondly, it was medidated by olfactory stimulation and not mediated by feeding or ingestion of wasp-odor components. Drosophila larvae exposed to other odorants (like acetic acid, 1-octen-3-ol and acetophenone [see Materials and methods for details and concentrations tested]) did not expand lamellocyte numbers or showed any increase in peripheral GABA levels in the hemolymph or in the lymph gland (Figure 5—figure supplement 1D–J and Supplementary file 4). Rather, immune cell response and GABA levels were varying in different odor conditions. This implied specificty in wasp-odors of L. boulardi on priming lamellocyte benefit. The data also highlighted differential control of odors on systemic GABA levels and the immune-response.

The detection of wasp odors in larvae is facilitated by activation of Or49a (Ebrahim et al., 2015). The ablation of Or49a (Or49a>Hid), diminished the immune benefits imposed by WOF condition. Or49a>Hid animals raised in WOF condition failed to increase their lamellocyte numbers (Figure 5A,B and J), hemolymph GABA level (Figure 5C and Supplementary file 4), lymph gland iGABA (Figure 5L,P), and Sima levels (Figure 5N,Q). The phenotypes detected in Or49a>Hid WOF animals were comparable to levels seen in Or49a>Hid larvae reared on regular conditions (Figure 5A–C,K,M and O). Importantly, loss of Or49a in regular conditions (Or49a>Hid, RF) did not impede the infection-induced lamellocyte response (Figure 5A,B and K). Neither did its loss affect hemolymph and lymph gland GABA levels in the homeostatic uninfected condition (Figure 5C,M and Figure 5—figure supplement 1K). Loss of Or49 in regular condition also did not reduce Sima protein expression in lymph glands blood cells (Figure 5O compared to H and Figure 5—figure supplement 1K). Altogether, these data showed that Or49a function was not necessary for basal lamellocyte induction or controlling developmental levels of systemic GABA levels or progenitor iGABA and Sima expression. Or49a function was however necessary for mediating the immune benefits seen in WOF condition. Genetic approaches, which force activate Or49a, recapitulated an increase in lamellocytes as seen in WOF condition even in regular food conditions (Figure 5R and S). Interestingly, a similar increase was not evident with activation of Or42a (Figure 5—figure supplement 1L), which is unexpected as its loss abrogated lamellocyte induction. These results showed the importance of Or42a function in the establishment of basal lamellocyte potential but insufficiency in expanding their numbers. Or49a on the other hand was capable of enhancing lamellocyte potential but was dispensible for basal lamellocyte induction.

Finally, we investigated the functional implications of the increased lamellocyte phenotype on the success of the immune response. In a normal immune response, the deposited wasp-eggs are encapsulated by lamellocytes leading to the formation of a melanotic capsule and killing of the parasitoid egg. We monitored parasitoid wasp-egg encapsulation response and percent melanization response. Encapsulation response was measured by counting the number of encapsulated and un-encapsulated wasp-eggs per larvae (Vanha-Aho et al., 2015) and for percentage melanization, infected larvae carrying melanotic wasp-egg capsules (Yang et al., 2015), see Materials and methods for details) post wasp-infection were estimated and represented as the percentage of larvae with black capsule to the total number of infected larvae.

In our hands, control larvae showed around 30% encapsulation response, while in WOF and Or49a>TrpA1, this was increased to 50% (Figure 5T). Furthermore, 50% control larvae showed melanization response while in WOF and Or49a>TrpA1 condition this was also increased to 75% (Figure 5—figure supplement 2A). Blocking the pathway on the other hand, led to a reduction in wasp-egg encapsulation and melanization response (Figure 5—figure supplement 2B–D). These results highlight the physiological significance of the increased lamellocyte phenotype on effective wasp-egg clearance. Encapsulation response also requires concerted action of activated immune cells including plasmatocytes and crystal cells apart from lamellocytes (Dudzic et al., 2015; Anderl et al., 2016, Sorrentino et al., 2002). Therefore, an overall improved repertoire of immune cells in WOF and Or49a >TrpA1 condition can be hypothesized. Taken together, these findings reveal the importance of environmental odor perception on cellular immune priming and function.

Discussion

Olfaction-immune axis in development and stress response

The olfactory-immune connect is a well-established phenomenon across systems (Strous and Shoenfeld, 2006). Animals with olfactory dysfunction have heightened inflammatory signatures but fail to mount immune response when challenged (Connor et al., 2000). The mechanistic and physiological underpinnings of olfaction and immune cross-talk in development and infection however remain poorly characterized.

In this study, we explore the importance of olfaction in cellular immune responses during Drosophila larval hematopoiesis. We show that as Drosophila larvae dwell into their food medium, sensing of food-related odors, which are the predominant odors present in their environment, leads to activation of a neuronal circuit (ORN-PN-Kurs6⁺GABA⁺ neuronal route). This stimulates Kurs6⁺GABA⁺ neurosecretory cells to release GABA whose sensing and uptake via GABA transporter, Gat, in blood-progenitor cells of the lymph gland and intracellular breakdown establishes a non-autonomous axis that controls intracellular levels of Sima protein expression. Within 6 hr of infection with parasitic wasps, immune progenitor cells upregulate Gat protein expression. This enables cells to internalize more GABA and its metabolism further raises progenitor Sima protein expression and transcriptional activation that leads to progenitor differentiation into lamellocytes. Our data suggest a transcriptional role for Sima in promoting a metabolic shift in blood-progenitor cells which are in agreement with existing literature (Bajgar et al., 2015; Dolezal et al., 2019; Krejčová et al., 2019) via activation of its target gene, Ldh whose function is also necessary for lamellocyte formation. In the absence of food odors, or in anosmic animals, the lack of olfactory input blocks neuronal GABA production and release. This subsequently affects progenitor GABA-metabolism and Sima protein expression leading to loss of immune potential necessary for lamellocyte formation. The basal activation of the olfactory circuit through food odors is central for specifying lamellocyte cell fate. We posit that in animals dwelling in conditions where chances of infection are high, this systemic route can be co-opted to raise their immune output. The prior sensing of wasps, by Drosophila larvae early in development via Or49a raises downstream PN-activity leading to enhanced GABA production and elevation of blood-progenitor cell Sima protein levels. This leads to superior immune-priming of progenitor cells and when infected these animals generate lamellocytes more rapidly and effectively (Figure 6).

Figure 6

Download asset Open asset

Developmental control of immune-competency by environmental odors.

*Drosophila* larvae spend most of their time dwelling in food. The odors derived from this eco-system defines an integral immune-component during hematopoiesis. Sensing food odors via Or42a stimulates projection neurons (PN) leading to downstream activation of Kurs6⁺GABA⁺ neurosecretory cells, which mediate release of GABA (eGABA) into the hemolymph. eGABA is internalized by lymph gland blood-progenitor cells via GABA-transporter (Gat) and its subsequent intracellular catabolism leads to stabilization of Sima protein in them. This establishes their immune-competency to differentiate into lamellocytes. Physiologically, this sensory odor axis is co-opted to detect environmental pathogenic wasp-odors. Upon detection of wasp odors via Or49a in the preconditioned media (WOF), a combinatorial stimulation of both Or42a and Or49a, elevates neuronal GABA release, leading to increase blood cell iGABA and Sima expression. This developmentally establishes superior immune-competency to withstand the immune-challenge by parasitic wasps.

The study reveals an unconventional developmental and stress-sensing role for the olfactory system in the sustenance of a competitive repertoire of immune progenitor cells. The utilization of Or42a, the most predominant OR activated in response to food-related odors, establishes a route that systemically connects the olfactory modality to the development of the immune system (ORN-PN-Kurs6-GABA-hematopoietic cells). The systemic connection sensitizes immune cells to environmental stressors such as the presence of wasps and promotes an innate immune training component when growing in conditions with higher chances of infection. However, it is not the overall strength of the olfactory input that controls immune-efficiency, but more specific to certain odors or activation of specific ORNs that can ultimately increase neuronal GABA production. The genetic data on forced activation of Or42a and Or49a support this notion, where activation of Or49a reciprocated with an enhancement of immune response as seen in wasp-odor enriched conditions, while activation of Or42a (Or42a>TrpA1) did not. This suggests that the stimulation of Or49a in the wasp-odor condtion is able to further raise downstream neuronal activity that can enhance GABA production. This raises the question of the impact of other pathogenic odors on immune-priming. Exposure of larvae to odors of varying natures (both attractive and aversive) provides some insight. Specifically, exposure to 1-octen-3-ol, did not elevate GABA levels or increase lamellocyte differentiation. 1-octen-3-ol, is a fungal aversive odorant that has been shown to affect larval plasmatocyte responses by controlling nitric oxide signaling (Inamdar and Bennett, 2014). This reflects the specificity of wasp-odors, its sensing and downstream signaling route employed to elevate GABA and mount lamellocyte priming.

An understanding of the complexities of cross-talk between individual ORN and their respective glomeruli and how they control PN activity is beginning to emerge and especially for specialized ORNs like Or49a, their modality of signaling is very unique (Berck et al., 2016). The early activation of Or49a in larval development is perceived as a stress response and is a bonus for the animal in priming immune potential. Larval Or49a is tuned to detect iridomyrmecin, which is an odor produced specifically by Leptopilina wasps (Ebrahim et al., 2015). Hence, a similar consequence on immune-priming with iridoid-producing Leptopilina can be predicted, but still remains to be tested.

Dual-use of GABA in the development of a competent hematopoietic system

Within the lymph gland, the blood-progenitor cells express both GABA_BR and Gat. While extracellular ligand-dependent GABA/GABA_BR signaling promotes progenitor maintenance, the intracellular GABA metabolic pathway controls immune-differentiation potential. Ligand functions of GABA via binding to GABA_BR in progenitor cells elevates intracellular Ca²⁺ which is necessary for their maintenance in their undifferentiated state (Shim et al., 2013). GABA uptake by Gat and its intracellular catabolism to promote Sima levels in blood cells on the other hand sustains a metabolic state necessary for their competency to differentiate into lamellocytes. Thus, immune cells therefore employ dual-use of GABA both as a developmental cue and as an inflammatory cue during hematopoietic development to maintain a demand-adapted immune-response. The two pathways run parallel to each other and loss of either does not impede the functioning of the other. When blood cell GABA metabolism is abrogated, blood-progenitor differentiation into lamellocyte is affected, but overall lymph gland development is unaffected and is unlike GABA_BR1^RNAi expressing blood-progenitor cells. On the other hand, when blood cell GABA_BR signaling is aborogated, blood-progenitor cell maintenance is affected but lamellocyte differentiation is unperturbed. Rather GABA_BR1^RNAi expressing blood progenitor cells show a mild increase in Sima protein levels (Figure 3—figure supplement 1P,P’ and Q) alongside formation of more lamellocytes. Thus blood-progenitor cells switch from a maintenance role for GABA (GABA/ GABA_BR/Ca²⁺ signaling) to its inflammatory function (GABA metabolism) in response to wasp-infection, which we hypothesize is at the level of Gat expression. This notion is supported by upregulation of Gat expression in response to wasp-infection, preceding the initiation of the inflammatory cellular response. Secondly, progenitor-cells over-expressing Gat even in homeostasis generate lamellocytes independent of infection. Thus limiting levels of Gat expression in progenitor-cells emerges as a potential regulator of GABA’s role as an inflammatory molecule.

The role of GABA as a general immune modulator is beginning to emerge from studies in vertebrates as well. Both GABA_BR and Gat are detected in immune cells of myeloid (Stuckey et al., 2005) and lymphoid origin (Jin et al., 2013). Macrophages shift to GABA as a metabolic resource to mediate inflammatory responses (Tannahill et al., 2013). GABA function in human hematopoietic stem cells (HSCs) or progenitor cells remains unclear and to our knowledge, any direct metabolic involvement of secreted neuronally derived GABA in hematopoietic progenitor cells has not been demonstrated. The findings from our work project commonalities between the mammalian immune system and the Drosophila hematopoietic system. To what extent GABA function, as we have described herein Drosophila through sensory routes is relevant in human HSCs or common myeloid progenitor cells remains to be investigated.

Conclusions

Being a key pro-survival sensory modality, this study expands our current understanding of olfaction beyond modulation of animal behavior, implying more diverse physiological contexts (Riera et al., 2017) than previously known. Most often, animals in the wild dwell in surroundings with pathogenic threats in their environment. Such is also the case with Drosophila larvae in the wild where almost 80% are infected with wasps of Leptopilina species (Fleury et al., 2004). Larvae being more vulnerable to infection with their limited abilities to avoid predators in their environment, an adaptive mechanism that enhances immunity, poses a viable option to withstand such challenges. The control of inflammatory response by olfactory cues may therefore have arisen as a means to deal with unfavorable conditions. The use of general broad-odors to establish basic immune-potency that can be further modulated depending on environmental conditions, exemplifies a rheostat-like control by the olfactory axis. To our knowledge, such impact of odor-experience as a direct handle to fine-tune immune metabolism to enable an immune advantage is the first in vivo description of its kind. It will be interesting to determine if elements of the olfaction/immune axis described here are relevant for general myeloid development and adaptation. Studies such as these will lead to an understanding of how immunity is controlled by smell, as well as provide insights in the deployment of olfactory routes to train immunity in development and disease.

Materials and methods

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Genetic reagent (D. melanogaster)	dome-MESO-Gal4, UAS-EYFP	U. Banerjee
Genetic reagent (D. melanogaster)	Tep4-Gal4, UAS-mCherry	U. Banerjee
Genetic reagent (D. melanogaster)	Hml^△-Gal4, UAS-2xEGFP	S.Sinenko
Genetic reagent (D. melanogaster)	UAS-Gat	M. Freeman (Muthukumar et al., 2014), (Mazaud et al., 2019)
Genetic reagent (D. melanogaster)	UAS-Hph	C.Frei
Genetic reagent (D. melanogaster)	Kurs6-Gal4	G. Korge
Genetic reagent (D. melanogaster)	Kurs6-Gal4; mCD8GFP	Banerjee Lab
Genetic reagent (D. melanogaster)	Orco-gal4	Bloomington Drosophila Stock Center	BL 26818 RRID:BDSC_26818
Genetic reagent (D. melanogaster)	Or49a-Gal4	Bloomington Drosophila Stock Center	BL 9985 RRID:BDSC_9985
Genetic reagent (D. melanogaster)	Or42a-Gal4	Bloomington Drosophila Stock Center	BL 9969 RRID:BDSC_9969
Genetic reagent (D. melanogaster)	GH146-Gal4	Shim et al., 2013
Genetic reagent (D. melanogaster)	UAS-2xEGFP	Bloomington Drosophila Stock Center	BL 6658 RRID:BDSC_6658
Genetic reagent (D. melanogaster)	orco¹	Bloomington Drosophila Stock Center (Shim et al., 2013)	BL 23129 RRID:BDSC_23129
Genetic reagent (D. melanogaster)	UAS-Hid, rpr	Nambu J.R. (Wing et al., 1998)
Genetic reagent (D. melanogaster)	UAS-Hid	Bloomington Drosophila Stock Center	BL65403 RRID:BDSC_65403
Genetic reagent (D. melanogaster)	UAS-TrpA1	Bloomington Drosophila Stock Center	BL 26263 RRID:BDSC_26263
Genetic reagent (D. melanogaster)	TRIC	Bloomington Drosophila Stock Center (Gao et al., 2015)	BL61680 RRID:BDSC_61680
Genetic reagent (D. melanogaster)	: Gad1^RNAi	Bloomington Drosophila Stock Center (Shim et al., 2013)	BL 28079 RRID:BDSC_28079
Genetic reagent (D. melanogaster)	ChAT^RNAi	Bloomington Drosophila Stock Center (Shim et al., 2013)	BL25856 RRID:BDSC_25856
Genetic reagent (D. melanogaster)	GABA_BR1^RNAi	Bloomington Drosophila Stock Center (Shim et al., 2013)	BL 28353 RRID:BDSC_28353
Genetic reagent (D. melanogaster)	Gat^RNAi	Bloomington Drosophila Stock Center (Stork et al., 2014)	BL 29422 RRID:BDSC_29422
Genetic reagent (D. melanogaster)	Gat^RNAi	Vienna Drosophila RNAi Center (Stork et al., 2014)	VDRC:v13359/GD FlyBase ID:FBgn0039915
Genetic reagent (D. melanogaster)	Ssadh^RNAi	Vienna Drosophila RNAi Center	VDRC:v106637/KK FlyBase ID:FBgn0039349
Genetic reagent (D. melanogaster)	Ssadh^RNAi	Bloomington Drosophila Stock Center	BL55683 RRID:BDSC_55683
Genetic reagent (D. melanogaster)	Ssadh^RNAi	Vienna Drosophila RNAi Center	VDRC: v14751/GD FlyBase ID:FBgn0039349
Genetic reagent (D. melanogaster)	CG3379^RNAi ^(aKDH)	Bloomington Drosophila Stock Center	BL 34101 RRID:BDSC_34101
Genetic reagent (D. melanogaster)	skap^RNAi	Bloomington Drosophila Stock Center	BL 55168 RRID:BDSC_55168
Genetic reagent (D. melanogaster)	SdhA^RNAi	Vienna Drosophila RNAi Center	VDRC:v330053 FlyBase ID:FBgn0261439
Genetic reagent (D. melanogaster)	sima^RNAi	Bloomington Drosophila Stock Center (Wang et al., 2016)	BL33894 RRID:BDSC_33894 HMS00832
Genetic reagent (D. melanogaster)	Hph^RNAi	Vienna Drosophila RNAi Center (Mukherjee et al., 2011)	VDRC:v103382/KK FlyBaseID:FBgn0264785
Genetic reagent (D. melanogaster)	Ldh^RNAi	Bloomington Drosophila Stock Center (Li et al., 2017)	BL33640 RRID:BDSC_33640
Antibody	Anti-P1 (Mouse)	I. Ando		IF(1:100)
Antibody	Anti-Pxn (Rabbit)	J. Shim		IF(1:2000)
Antibody	Anti-PPO (Rabbit)	H. Müller		IF(1:1000)
Antibody	Anti-Hnt (Mouse)	Developmen tal Studies Hybridoma Bank	DSHB Cat# 1g9, RRID:AB_528278	IF(1:100)
Antibody	Anti-Mys (Mouse)	CF.6G11; Developmen tal Studies Hybridoma Bank	Cat#CF6G11 RRID:AB_528310	IF(1:100)
Antibody	Anti-GABA (Rabbit)	Sigma-Aldrich	Cat# A2052	IF(1:100)
Antibody	Anti-Sima (Guinea pig)	U. Banerjee		IF(1:100)
Antibody	Anti-Gat (Rabbit)	M. Freeman (Muthukumar et al., 2014)		IF(1:5000)
Antibody	Anti-pCaMKII (Rabbit)	Cell Signaling (Shim et al., 2013)	Cat# 3361	IF(1:100)
Antibody	Anti-wingless (Mouse)	Developmen tal Studies Hybridoma Bank	Cat#4D4 RRID:AB_528512	IF(1:10)
Antibody	Anti-Ci (Rat)	Developmen tal Studies Hybridoma Bank	Cat#2A1 RRID:AB_2109711	IF(1:5)
Antibody	Anti-Antp	Developmen tal Studies Hybridoma Bank	Cat#8C11 RRID:AB_528083	IF(1:100)
	Phalloidin	Sigma-Aldrich	Cat# 94072	1:100

Drosophila husbandry, stocks, and genetics

Request a detailed protocol

The following Drosophila stocks were used in this study: w¹¹¹⁸ (wild type, control) dome-MESO-Gal4, UAS-EYFP and Tep4-Gal4, UAS-mCherry (U. Banerjee), Hml^△-Gal4, UAS-2xEGFP (S.Sinenko), UAS-Gat (M. Freeman) (Muthukumar et al., 2014), (Mazaud et al., 2019), UAS-Hph (C.Frei), Kurs6-Gal4 (G. Korge), Kurs6-Gal4; mCD8GFP (Banerjee Lab), Orco-gal4 (BL 26818), Or49a-Gal4 (BL 9985), Or42a-Gal4 (BL 9969), GH146-Gal4 (Shim et al., 2013), UAS-2xEGFP (BL 6658), orco¹ (BL 23129 Shim et al., 2013), UAS-Hid, rpr (Nambu J.R. Wing et al., 1998), UAS-Hid (BL65403), UAS-TrpA1 (BL 26263), TRIC (BL61680) (Gao et al., 2015). The RNAi stocks were obtained either from Vienna (VDRC) or Bloomington (BDSC) stock centres. The lines used for the study are: Gad1^RNAi (BL 28079 Shim et al., 2013), ChAT^RNAi (BL25856 Shim et al., 2013), GABA_BR1^RNAi (BL 28353 Shim et al., 2013), Gat^RNAi (BL 29422 Stork et al., 2014), Gat^RNAi (VDRC 13359/GD, Stork et al., 2014), Ssadh^RNAi (VDRC 106637/KK), Ssadh^RNAi (BL55683) and Ssadh^RNAi (14751/GD), CG3379^RNAi (αKDH, BL 34101), skap^RNAi (BL 55168), SdhA^RNAi (VDRC 330053), sima^RNAi (HMS00832, BL33894 Wang et al., 2016), Hph^RNAi (VDRC 103382 Mukherjee et al., 2011), Ldh^RNAi (BL33640 Li et al., 2017), Tgo^RNAi (BL 26740, VDRC 10735 Mukherjee et al., 2011). All fly stocks were reared on corn meal agar food medium with yeast supplementation at 25°C incubator unless specified. The crosses involving RNAi lines were maintained at 29°C to maximize the efficacy of the Gal4/UAS-RNAi system. Controls correspond to either w¹¹¹⁸ (wild type) or Gal4 drivers crossed with w¹¹¹⁸.

All the RNAi stocks were tested for their knockdown efficiencies by using a ubiquitous driver to express these lines followed by isolation of total mRNA from whole animals subjecting them to qRT-PCR analysis with respective primers. RNAi knockdown efficiencies of the respective lines are: Gat^RNAi (97.7%), CG3379^RNAi (αKDH, 95%), Ssadh^RNAi (45%), and skap^RNAi (40%).

All stocks were tested for their background effects for lamellocyte response to L. boulardi infection. This was done by crossing the respective Gal4 lines, RNAi lines and genetic rescue combinations to w¹¹¹⁸ followed by wasp-infection and assessment of lamellocyte numbers (Figure 5—figure supplement 2G).

Wasp infections

Request a detailed protocol

Leptopilina boulardi were maintained as previously described (Schlenke et al., 2007). Wasp infection protocol was followed as described in published literature (Bajgar et al., 2015; categorized as strong infections). Briefly, 40 Drosophila larvae (aged 60 ± 2 hr after egg laying) were exposed to 10 females and five male wasps for a duration of 6 hr at 25°. After removing wasps, the infected Drosophila larvae were put back to 29° (for RNAi crosses).

Wasp-infection resistance assays

Request a detailed protocol

For encapsulation response, individual Drosophila larvae (60+12HPI) were sorted under stereomicroscope according to the presence or absence of black capsules. The numbers of encapsulated and un-encapsulated wasp-eggs per larvae were counted. The egg was scored as encapsulated when traces of melanin were found on it (as described in Vanha-Aho et al., 2015). For percent melanization, individual infected Drosophila larvae (60+12HPI) were sorted under stereomicroscope according to the presence or absence of black capsules. Larvae without obvious black capsules were dissected to confirm whether they were infected. The number of larvae in the cohort that showed this melanization response was obtained as represented as the percentage of larvae with black capsule to the total number of infected larvae, as described in Yang et al., 2015.

Immunostaining and immunohistochemistry

Request a detailed protocol

For staining circulating cells, 3rd instar larvae were collected and washed in 1X PBS and transferred to Teflon coated slides (Immuno-Cell #2015 C 30) followed by staining protocol previously described (Jung et al., 2005). Lymph glands isolated from larvae were also stained following similar staining protocol. Immunohistochemistry on lymph gland and circulating blood cells was performed with the following primary antibodies: mouse αP1 (1:100, I. Ando), rabbit αPxn (1:2000, J. Shim),), rabbit αPPO (1:1000, H. Müller), mouse αHnt (1:100, DSHB), mouse αMys (1:100, CF.6G11; DSHB), rabbit αGABA (1:100, Sigma, A2052), guinea pig αSima (1:100, U. Banerjee), rabbit αGat (1:5000, M. Freeman (Muthukumar et al., 2014), rabbit αpCaMKII (1:100, Cell Signaling, 3361 Shim et al., 2013), αwingless(1:10, DSHB), rat αCi (1:5, DSHB), mouse αAntp (1:100, DSHB). The following secondary antibodies were used at 1:500 dilutions: FITC, Cy3 and Cy5 (Jackson Immuno Research Laboratories and Invitrogen). Phalloidin (Sigma-Aldrich # 94072) was used at 1:100 dilutions to stain cell morphologies and nuclei were visualized using DAPI. Samples were mounted with Vectashield (Vector Laboratories). A minimum of five independent biological replicates were analyzed from which one representative image is shown.

Lamellocyte quantification in lymph gland and circulation

Request a detailed protocol

Lamellocytes were identified primarily based on their large flattened morphology using cytoskeletal marker phalloidin (Small et al., 2014) and myospheroid/L4 (Anderl et al., 2016). Their quantifications were undertaken both in the lymph gland and in circulation. In uninfected conditions, both lymph gland and circulatory lamellocyte counts were done in wandering 3rd instar larvae. In wasp-infected condition, lymph gland lamellocyte response was assessed at 24 HPI prior to their disintegration and release into the hemolymph (Lanot et al., 2001). Circulating lamellocyte counts were done at 48 HPI, when the lamellocytes in circulation are derived from both the lymph gland pool of differentiating blood cells and circulating blood cells. For total circulating lamellocyte counts, individual larvae were bled per well and all the lamellocytes were manually counted. For lymph gland lamellocyte count, the tissues were counter-stained with phalloidin or Myospheroid and imaged to obtain Z-stacks. Large flattened lamellocytes detected by phalloidin and Myospheroid-positive cells (as lamellocytes) were manually counted per lobe of the lymph gland.

Blood cell density analysis

Request a detailed protocol

To calculate circulating blood cell count/mm² and the proportion of lamellocytes in blood cells, individual larvae were bled per well, counter-stained with DAPI and phalloidin and imaged to obtain five images per well under constant magnification of 20X. All hemocytes (DAPI-positive cells) in these images were counted using the ImageJ software plugin Analyze particles tool and the numbers of cells from the five images were summed and a cell density per mm² was obtained. The respective number of lamellocytes per image was counted and plotted as proportions in blood cell count/mm². The circulating cellular response to infection was quantified at 48HPI and in uninfected conditions was undertaken in wandering 3rd instar larvae. In all experiments, control genotypes were analyzed in parallel to the experimental tests. For each experiment, a minimum of five biological replicates were analyzed and the quantifications represent the mean of all the biological replicates.

Imaging

Request a detailed protocol

Immuno-stained images were acquired using Olympus FV1000 and FV3000 confocal microscopy or Nikon C2 Si-plus system under a ×20 air or ×40 oil-immersion objective. Bright field images were obtained on OlympusSZ10 or Zeiss Axiocam.

Quantification of lymph gland phenotypes

Request a detailed protocol

All images were quantified using ImageJ software. Lymph gland area analysis was done as described (Shim et al., 2012). Roughly, middle three confocal Z-stacks were merged and threshold, selected and area was measured. This was done for respective zones and the area is represented in percent values. Controls were analyzed in parallel to the tests every time. A minimum of five animals were analyzed each time and the experiment was repeated at least three times. The quantifications represent the mean of the three independent experimental sets. For crystal cell quantification, total number of Hnt-positive cells per lymph gland lobe was counted and represented as crystal cells per lobe. A minimum of five animals were analyzed each time and this was repeated atleast twice. For quantifying mean intensities in lymph gland tissues it was calculated as described in literature (Louradour et al., 2017; Morin-Poulard et al., 2016). Briefly, the relevant stacks of the lymph gland images were selected; the area to be measured per lobe was defined using the select tool, mean intensities were calculated in the respective selected area. Background subtractions were done by subtracting fixed squared boxes outside the lymph gland image and calculating final mean intensity. The relative fold change in intensities per lobe was calculated using mean intensity values. For intensity quantifications, the imaging settings were kept constant for each individual experimental setup. Controls were analyzed in parallel to the tests every time. A minimum of five animals were analyzed each time and the experiment was repeated at least three times.

GABA measurements

Request a detailed protocol

GABA measures in circulation were conducted by bleeding five wandering 3rd instar larvae to extract their hemolymph as previously published (Shim et al., 2013) and analyzed using LC-MS/SRM method (Agilent 1290 Infinity UHPLC). This was done for minimum of 15 larvae per genotype and repeated three times. The quantifications shown represent the mean of all the repeats.

In situ hybridization

Request a detailed protocol

Digoxigenin (DIG)-labeled probes for in situ hybridization was synthesized by PCR using DIG RNA labeling kit (Roche #11175025910). The probes for Ssadh and CG33791 (αKDH) genes were generated using primers mentioned previously that were fused to a T7 promoter sequence. Finally the probes were applied to dissected lymph gland tissues prepared for hybridization following the previously published protocol (Shim et al., 2012).

Quantitative real-time PCR analysis

Request a detailed protocol

Total RNA was extracted using Trizol reagent (Invitrogen, USA). For lymph gland analysis, RNA was obtained from 3rd instar larvae (#150 for each genotype). The total RNA extracted was reverse transcribed with Super Mix kit (Invitrogen) and followed by quantitative real-time PCR (qPCR) with SYBR Green PCR master mix kit (Applied Biosystems). The relative expression was normalized against rp49 gene. The respective primers used are the following:

rp49 Forward: CGGATCGATATGCTAAGCTGT
rp49 Reverse: GCGCTTGTTCGATCCGTA
rps20 Forward: CTGCTGCACCCAAGGATA
rps20 Reverse: AGTCTTACGGGTGGTGAT
Gat Forward: TGCCTTGTTTCCCTACGTTC
Gat Reverse: GTACCAAGTCCAAGCCCGTA
Ssadh Forward: TTAGGAATTGCGGACAGACC
Ssadh Reverse: CTGTCCGCCCAGAATAATGT
Idh Forward: AAGCGCGTAGAGGAGTTCAA
Idh Reverse: AAGACGGTTCCTCCCAAGAT
Gdh Forward: ACGAGATGATCACCGGCTAC
Gdh Reverse: GACAGGGCTTTGACCTCATC
αKDH Forward: CGCGAATTCTCTCTCCACGCCCGCAAATC
αKDH Reverse: CGCTCTAGAGTCTCACCTGTTCCACCCTCACCA
skap Forward: CGCGAATTCGGAACCTCAATGTCCAGGAACACG
skap Reverse: GCGTCTAGAGAACTCACGGCGGGGGAACT
Sdh Forward: GTCCCACGACATTAG
Sdh Reverse: GCCAAGATAGCGGATAGC
sima Forward: AACTATCGCGAGGAGTCGAA
sima Reverse: CGTTAGCAGGGGCATATCAT
Ldh Forward: ACGGCTCCAACTTTCTGAAG
Ldh Reverse: GCAAAATGGTATCGGGACTG

Minimal odor and odor-infused food preparation

Request a detailed protocol

The minimal odor food was prepared as described previously (Shim et al., 2013). WOF was prepared by placing sealed dialysis tubing with low molecular weight cut-off (Spectra/Por Dialysis tubing MWCO 500–1000 D) containing L. boulardi wasps in the proportion of 15 females and 5–8 males into regular food medium. This setup allows odorant cues to pass through without diffusion of any macromolecular substance. The food was freshly prepared each time. For exposure to others odorant (acetic acid, 1-octen-3-ol and acetophenone), larvae were treated with respective odorants of the highest available purity (>99% from Sigma). Acetic acid (Sigma 2722), 1-octen-3-ol (Sigma O5284) and acetophenone (Sigma 00790) at concentrations as described previously (Kreher et al., 2005). Briefly, the respective odorants were constituted in Mineral oil (Sigma M5904) to obtain 10⁻² dilution. Of diluted odorant, 40 μl was placed on Whatman filter paper, which was then placed inside the vial containing regular fly-food media, not in direct contact with the food. Every 18–24 hr, 40 μl of odorant was again infused into the same Whatman paper to provide constant exposure of odors into the vial.

Drosophila larvae from 1st instar stage were reared in the different odorant infused food media until wandering 3rd instar stage. To quantify the influence of odors in immune response, each experimental set was undertaken with a minimum of 10 larvae analyzed in each set and this was repeated a minimum of three times for every odor condition.

Succinate and GABA supplementation

Request a detailed protocol

Succinate (Sodium succinate dibasic hexahydrate, Sigma S2378) and GABA (Sigma, A2129) enriched diets were prepared by supplementing regular fly food with respective amounts by weight/volume measures of succinate or GABA to achieve 3% or 5% concentrations. Eggs/first instar larvae were transferred in these supplemented diets and reared until analysis of respective tissues.

Statistical analyses

Request a detailed protocol

All statistical analyses were performed using GraphPad Prism six software and Microsoft Excel 2010. The medians were analyzed using Mann-Whitney test, two-tailed and means were analyzed with unpaired t-test, two-tailed. Images were processed utilizing ImageJ (NIH) and Adobe Photoshop CS5.

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files. Source data files have been provided for Figures 1–5, the corresponding Figure supplements and Supplementary files 1–5.

References

1. Anderl I
2. Vesala L
3. Ihalainen TO
4. Vanha-Aho LM
5. Andó I
6. Rämet M
7. Hultmark D
(2016) Transdifferentiation and proliferation in two distinct hemocyte lineages in Drosophila melanogaster Larvae after Wasp Infection
PLOS Pathogens 12:e1005746.
https://doi.org/10.1371/journal.ppat.1005746
- PubMed
- Google Scholar
(2015) Extracellular Adenosine mediates a systemic metabolic switch during immune response
PLOS Biology 13:e1002135.
https://doi.org/10.1371/journal.pbio.1002135
- PubMed
- Google Scholar
(2019) Drosophila as a genetic model for hematopoiesis
Genetics 211:367–417.
https://doi.org/10.1534/genetics.118.300223
- PubMed
- Google Scholar
(2012) Dual role for insulin/TOR signaling in the control of hematopoietic progenitor maintenance in Drosophila
Development 139:1713–1717.
https://doi.org/10.1242/dev.080259
- PubMed
- Google Scholar
1. Berck ME
2. Khandelwal A
3. Claus L
4. Hernandez-Nunez L
5. Si G
6. Tabone CJ
7. Li F
8. Truman JW
9. Fetter RD
10. Louis M
11. Samuel ADT
12. Cardona A
(2016) The wiring diagram of a glomerular olfactory system
eLife 5:e14854.
https://doi.org/10.7554/eLife.14859
- Google Scholar
1. Bouché N
2. Fromm H
(2004) GABA in plants: just a metabolite?
Trends in Plant Science 9:110–115.
https://doi.org/10.1016/j.tplants.2004.01.006
- PubMed
- Google Scholar
(2005) Mitochondrial succinate is instrumental for HIF1alpha nuclear translocation in SDHA-mutant fibroblasts under normoxic conditions
Human Molecular Genetics 14:3263–3269.
https://doi.org/10.1093/hmg/ddi359
- PubMed
- Google Scholar
(2000) Olfactory bulbectomy provokes a suppression of interleukin-1beta and tumour necrosis factor-alpha production in response to an in vivo challenge with lipopolysaccharide: effect of chronic desipramine treatment
Neuroimmunomodulation 7:27–35.
https://doi.org/10.1159/000026417
- PubMed
- Google Scholar
(2004) Cellular immune response to parasitization in Drosophila requires the EBF orthologue collier
PLOS Biology 2:e196.
https://doi.org/10.1371/journal.pbio.0020196
- PubMed
- Google Scholar
(2019) Molecular regulations of metabolism during immune response in insects
Insect Biochemistry and Molecular Biology 109:31–42.
https://doi.org/10.1016/j.ibmb.2019.04.005
- PubMed
- Google Scholar
1. Dragojlovic-Munther M
2. Martinez-Agosto JA
(2012) Multifaceted roles of PTEN and TSC orchestrate growth and differentiation of Drosophila blood progenitors
Development 139:3752–3763.
https://doi.org/10.1242/dev.074203
- PubMed
- Google Scholar
1. Dudzic JP
2. Kondo S
3. Ueda R
4. Bergman CM
5. Lemaitre B
(2015) Drosophila innate immunity: regional and functional specialization of prophenoloxidases
BMC Biology 13:13–81.
https://doi.org/10.1186/s12915-015-0193-6
- PubMed
- Google Scholar
1. Ebrahim SA
2. Dweck HK
3. Stökl J
4. Hofferberth JE
5. Trona F
6. Weniger K
7. Rybak J
8. Seki Y
9. Stensmyr MC
10. Sachse S
11. Hansson BS
12. Knaden M
(2015) Drosophila avoids parasitoids by sensing their semiochemicals via a dedicated olfactory circuit
PLOS Biology 13:e1002318.
https://doi.org/10.1371/journal.pbio.1002318
- PubMed
- Google Scholar
1. Fleury F
2. Ris N
3. Allemand R
4. Fouillet P
5. Carton Y
6. Boulétreau M
(2004) Ecological and genetic interactions in Drosophila-parasitoids communities: a case study with D. melanogaster, D. simulans and their common Leptopilina parasitoids in south-eastern france
Genetica 120:181–194.
https://doi.org/10.1023/B:GENE.0000017640.78087.9e
- PubMed
- Google Scholar
1. Gao L
2. Fei H
3. Connors NC
4. Zhang J
5. Levitan IB
(2008) Drosophila ortholog of succinyl-CoA synthetase {beta} subunit: a novel modulator of Drosophila KCNQ channels
Journal of Neurophysiology 99:2736–2740.
https://doi.org/10.1152/jn.01314.2007
- PubMed
- Google Scholar
1. Gao XJ
2. Riabinina O
3. Li J
4. Potter CJ
5. Clandinin TR
6. Luo L
(2015) A transcriptional reporter of intracellular ca(2+) in Drosophila
Nature Neuroscience 18:917–925.
https://doi.org/10.1038/nn.4016
- PubMed
- Google Scholar
1. Honti V
2. Csordás G
3. Márkus R
4. Kurucz E
5. Jankovics F
6. Andó I
(2010) Cell lineage tracing reveals the plasticity of the hemocyte lineages and of the hematopoietic compartments in Drosophila melanogaster
Molecular Immunology 47:1997–2004.
https://doi.org/10.1016/j.molimm.2010.04.017
- PubMed
- Google Scholar
1. Inamdar AA
2. Bennett JW
(2014) A common fungal volatile organic compound induces a nitric oxide mediated inflammatory response in Drosophila melanogaster
Scientific Reports 4:3833.
https://doi.org/10.1038/srep03833
- PubMed
- Google Scholar
1. Jin Z
2. Mendu SK
3. Birnir B
(2013) GABA is an effective immunomodulatory molecule
Amino Acids 45:87–94.
https://doi.org/10.1007/s00726-011-1193-7
- PubMed
- Google Scholar
1. Jung SH
2. Evans CJ
3. Uemura C
4. Banerjee U
(2005) The Drosophila lymph gland as a developmental model of hematopoiesis
Development 132:2521–2533.
https://doi.org/10.1242/dev.01837
- PubMed
- Google Scholar
(2005) The molecular basis of odor coding in the Drosophila larva
Neuron 46:445–456.
https://doi.org/10.1016/j.neuron.2005.04.007
- PubMed
- Google Scholar
1. Krejčová G
2. Danielová A
3. Nedbalová P
4. Kazek M
5. Strych L
6. Chawla G
7. Tennessen JM
8. Lieskovská J
9. Jindra M
10. Doležal T
11. Bajgar A
(2019) Drosophila macrophages switch to aerobic glycolysis to mount effective antibacterial defense
eLife 8:e50414.
https://doi.org/10.7554/eLife.50414
- PubMed
- Google Scholar
1. Krzemień J
2. Dubois L
3. Makki R
4. Meister M
5. Vincent A
6. Crozatier M
(2007) Control of blood cell homeostasis in Drosophila larvae by the posterior signalling centre
Nature 446:325–328.
https://doi.org/10.1038/nature05650
- PubMed
- Google Scholar
1. Lanot R
2. Zachary D
3. Holder F
4. Meister M
(2001) Postembryonic hematopoiesis in Drosophila
Developmental Biology 230:243–257.
https://doi.org/10.1006/dbio.2000.0123
- PubMed
- Google Scholar
(2004) Or83b encodes a broadly expressed odorant receptor essential for Drosophila olfaction
Neuron 43:703–714.
https://doi.org/10.1016/j.neuron.2004.08.019
- PubMed
- Google Scholar
(2002) Control of the hypoxic response in Drosophila melanogaster by the Basic Helix-Loop-Helix PAS Protein Similar
Molecular and Cellular Biology 22:6842–6853.
https://doi.org/10.1128/mcb.22.19.6842-6853.2002
- PubMed
- Google Scholar
1. Li H
2. Chawla G
3. Hurlburt AJ
4. Sterrett MC
5. Zaslaver O
6. Cox J
7. Karty JA
8. Rosebrock AP
9. Caudy AA
10. Tennessen JM
(2017) Drosophila larvae synthesize the putative oncometabolite L-2-hydroxyglutarate during normal developmental growth
PNAS 114:1353–1358.
https://doi.org/10.1073/pnas.1614102114
- PubMed
- Google Scholar
(2017) Reactive oxygen species-dependent toll/NF-κB activation in the Drosophila hematopoietic niche confers resistance to wasp parasitism
eLife 6:e25496.
https://doi.org/10.7554/eLife.25496
- PubMed
- Google Scholar
1. Maguire SE
2. Rhoades S
3. Chen W-F
4. Sengupta A
5. Yue Z
6. Lim JC
7. Mitchell CH
8. Weljie AM
9. Sehgal A
(2015) Independent effects of γ-Aminobutyric acid transaminase (GABAT) on metabolic and sleep homeostasis
Journal of Biological Chemistry 290:20407–20416.
https://doi.org/10.1074/jbc.M114.602276
- Google Scholar
1. Makki R
2. Meister M
3. Pennetier D
4. Ubeda JM
5. Braun A
6. Daburon V
7. Krzemień J
8. Bourbon HM
9. Zhou R
10. Vincent A
11. Crozatier M
(2010) A short receptor downregulates JAK/STAT signalling to control the Drosophila cellular immune response
PLOS Biology 8:e1000441.
https://doi.org/10.1371/journal.pbio.1000441
- PubMed
- Google Scholar
1. Márkus R
2. Laurinyecz B
3. Kurucz E
4. Honti V
5. Bajusz I
6. Sipos B
7. Somogyi K
8. Kronhamn J
9. Hultmark D
10. Andó I
(2009) Sessile hemocytes as a hematopoietic compartment in Drosophila melanogaster
PNAS 106:4805–4809.
https://doi.org/10.1073/pnas.0801766106
- PubMed
- Google Scholar
1. Mazaud D
2. Kottler B
3. Gonçalves-Pimentel C
4. Proelss S
5. Tüchler N
6. Deneubourg C
7. Yuasa Y
8. Diebold C
9. Jungbluth H
10. Lai EC
11. Hirth F
12. Giangrande A
13. Fanto M
(2019) Transcriptional regulation of the glutamate/GABA/Glutamine cycle in adult Glia controls motor activity and seizures in Drosophila
The Journal of Neuroscience 39:5269–5283.
https://doi.org/10.1523/JNEUROSCI.1833-18.2019
- PubMed
- Google Scholar
1. Mills E
2. O'Neill LA
(2014) Succinate: a metabolic signal in inflammation
Trends in Cell Biology 24:313–320.
https://doi.org/10.1016/j.tcb.2013.11.008
- PubMed
- Google Scholar
(2016) Vascular control of the Drosophila haematopoietic microenvironment by slit/Robo signalling
Nature Communications 7:11634.
https://doi.org/10.1038/ncomms11634
- PubMed
- Google Scholar
(2011) Interaction between notch and Hif-alpha in development and survival of Drosophila blood cells
Science 332:1210–1213.
https://doi.org/10.1126/science.1199643
- PubMed
- Google Scholar
(2014) Activity-dependent regulation of astrocyte GAT levels during synaptogenesis
Nature Neuroscience 17:1340–1350.
https://doi.org/10.1038/nn.3791
- PubMed
- Google Scholar
1. Neuhaus EM
2. Gisselmann G
3. Zhang W
4. Dooley R
5. Störtkuhl K
6. Hatt H
(2005) Odorant receptor heterodimerization in the olfactory system of Drosophila melanogaster
Nature Neuroscience 8:15–17.
https://doi.org/10.1038/nn1371
- PubMed
- Google Scholar
(1992)
Comparison of the several methods of investigation in the diagnosis of alkaline esophagitis. considerations on 92 cases]

Minerva Chirurgica 47:95–100.
- PubMed
- Google Scholar
1. Riera CE
2. Tsaousidou E
3. Halloran J
4. Follett P
5. Hahn O
6. Pereira MMA
7. Ruud LE
8. Alber J
9. Tharp K
10. Anderson CM
11. Brönneke H
12. Hampel B
13. Filho CDM
14. Stahl A
15. Brüning JC
16. Dillin A
(2017) The sense of smell impacts metabolic health and obesity
Cell Metabolism 26:198–211.
https://doi.org/10.1016/j.cmet.2017.06.015
- PubMed
- Google Scholar
1. Rizki TM
2. Rizki RM
(1992) Lamellocyte differentiation in Drosophila larvae parasitized by Leptopilina
Developmental & Comparative Immunology 16:103–110.
https://doi.org/10.1016/0145-305X(92)90011-Z
- PubMed
- Google Scholar
(2007) Cellular and developmental adaptations to hypoxia: a Drosophila perspective
Methods in Enzymology 435:123–144.
https://doi.org/10.1016/S0076-6879(07)35007-6
- PubMed
- Google Scholar
(2010) Succinate dehydrogenase - Assembly, regulation and role in human disease
Mitochondrion 10:393–401.
https://doi.org/10.1016/j.mito.2010.03.001
- PubMed
- Google Scholar
(2007) Contrasting infection strategies in generalist and specialist wasp parasitoids of Drosophila melanogaster
PLOS Pathogens 3:e158.
https://doi.org/10.1371/journal.ppat.0030158
- Google Scholar
1. Schofield CJ
2. Ratcliffe PJ
(2005) Signalling hypoxia by HIF hydroxylases
Biochemical and Biophysical Research Communications 338:617–626.
https://doi.org/10.1016/j.bbrc.2005.08.111
- PubMed
- Google Scholar
1. Selak MA
2. Armour SM
3. MacKenzie ED
4. Boulahbel H
5. Watson DG
6. Mansfield KD
7. Pan Y
8. Simon MC
9. Thompson CB
10. Gottlieb E
(2005) Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase
Cancer Cell 7:77–85.
https://doi.org/10.1016/j.ccr.2004.11.022
- PubMed
- Google Scholar
1. Semenza GL
2. Wang GL
(1992) A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation
Molecular and Cellular Biology 12:5447–5454.
https://doi.org/10.1128/MCB.12.12.5447
- PubMed
- Google Scholar
(1999) Metabolism and functions of gamma-aminobutyric acid
Trends in Plant Science 4:446–452.
https://doi.org/10.1016/S1360-1385(99)01486-7
- PubMed
- Google Scholar
(2012) Direct sensing of systemic and nutritional signals by haematopoietic progenitors in Drosophila
Nature Cell Biology 14:394–400.
https://doi.org/10.1038/ncb2453
- PubMed
- Google Scholar
1. Shim J
2. Mukherjee T
3. Mondal BC
4. Liu T
5. Young GC
6. Wijewarnasuriya DP
7. Banerjee U
(2013) Olfactory Control of Blood Progenitor Maintenance
Cell 155:1141–1153.
https://doi.org/10.1016/j.cell.2013.10.032
- Google Scholar
(2011) Oxidative stress in the haematopoietic niche regulates the cellular immune response in Drosophila
EMBO Reports 13:83–89.
https://doi.org/10.1038/embor.2011.223
- PubMed
- Google Scholar
1. Small C
2. Ramroop J
3. Otazo M
4. Huang LH
5. Saleque S
6. Govind S
(2014) An unexpected link between notch signaling and ROS in restricting the differentiation of hematopoietic progenitors in Drosophila
Genetics 197:471–483.
https://doi.org/10.1534/genetics.113.159210
- PubMed
- Google Scholar
(2002) Cellular immune response to parasite infection in the Drosophila lymph gland is developmentally regulated
Developmental Biology 243:65–80.
https://doi.org/10.1006/dbio.2001.0542
- PubMed
- Google Scholar
(2010) Lineage tracing of lamellocytes demonstrates Drosophila macrophage plasticity
PLOS ONE 5:e14051.
https://doi.org/10.1371/journal.pone.0014051
- PubMed
- Google Scholar
(2014) Neuron-glia interactions through the heartless FGF receptor signaling pathway mediate morphogenesis of Drosophila astrocytes
Neuron 83:388–403.
https://doi.org/10.1016/j.neuron.2014.06.026
- PubMed
- Google Scholar
1. Strous RD
2. Shoenfeld Y
(2006) To smell the immune system: olfaction, autoimmunity and brain involvement
Autoimmunity Reviews 6:54–60.
https://doi.org/10.1016/j.autrev.2006.07.002
- PubMed
- Google Scholar
1. Stuckey DJ
2. Anthony DC
3. Lowe JP
4. Miller J
5. Palm WM
6. Styles P
7. Perry VH
8. Blamire AM
9. Sibson NR
(2005) Detection of the inhibitory neurotransmitter GABA in macrophages by magnetic resonance spectroscopy
Journal of Leukocyte Biology 78:393–400.
https://doi.org/10.1189/jlb.1203604
- PubMed
- Google Scholar
1. Tannahill GM
2. Curtis AM
3. Adamik J
4. Palsson-McDermott EM
5. McGettrick AF
6. Goel G
7. Frezza C
8. Bernard NJ
9. Kelly B
10. Foley NH
11. Zheng L
12. Gardet A
13. Tong Z
14. Jany SS
15. Corr SC
16. Haneklaus M
17. Caffrey BE
18. Pierce K
19. Walmsley S
20. Beasley FC
21. Cummins E
22. Nizet V
23. Whyte M
24. Taylor CT
25. Lin H
26. Masters SL
27. Gottlieb E
28. Kelly VP
29. Clish C
30. Auron PE
31. Xavier RJ
32. O'Neill LA
(2013) Succinate is an inflammatory signal that induces IL-1β through HIF-1α
Nature 496:238–242.
https://doi.org/10.1038/nature11986
- PubMed
- Google Scholar
(2006) Comparative sequence analysis and tissue localization of members of the SLC6 family of transporters in adult Drosophila melanogaster
Journal of Experimental Biology 209:3383–3404.
https://doi.org/10.1242/jeb.02328
- PubMed
- Google Scholar
1. Vanha-Aho LM
2. Anderl I
3. Vesala L
4. Hultmark D
5. Valanne S
6. Rämet M
(2015) Edin expression in the fat body is required in the defense against parasitic wasps in Drosophila melanogaster
PLOS Pathogens 11:e1004895.
https://doi.org/10.1371/journal.ppat.1004895
- PubMed
- Google Scholar
(2016) In vivo genetic dissection of tumor growth and the warburg effect
eLife 5:e18126.
https://doi.org/10.7554/eLife.18126
- PubMed
- Google Scholar
1. Wing JP
2. Zhou L
3. Schwartz LM
4. Nambu JR
(1998) Distinct cell killing properties of the Drosophila reaper, head involution defective, and grim genes
Cell Death & Differentiation 5:930–939.
https://doi.org/10.1038/sj.cdd.4400423
- PubMed
- Google Scholar
1. Yang H
2. Kronhamn H
3. Ekström H
4. Korkut H
5. Hultmark H
(2015) JAK/STAT signaling in Drosophila muscles controls the cellular immune response against parasitoid infection
EMBO Rep 16:64–72.
https://doi.org/10.15252/embr.201540277
- Google Scholar
1. Zhou D
2. Xue J
3. Lai JC
4. Schork NJ
5. White KP
6. Haddad GG
(2008) Mechanisms underlying hypoxia tolerance in Drosophila melanogaster: hairy as a metabolic switch
PLOS Genetics 4:e1000221.
https://doi.org/10.1371/journal.pgen.1000221
- PubMed
- Google Scholar

Decision letter

Bruno Lemaitre

Reviewing Editor; École Polytechnique Fédérale de Lausanne, Switzerland
Anna Akhmanova

Senior Editor; Utrecht University, Netherlands
Tomas Dolezal

Reviewer
Balint Z Kacsoh

Reviewer; Geisel School of Medicine at Dartmouth, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

The authors investigate the role of the GABA-shunt pathway that generates succinate, in the lymph gland (LG) hematopoietic progenitors in response to wasp parasitism. The authors propose that wasp odor boosts the Drosophila immune response by regulating iGABA and Sima levels in lymph glands. This reveals an interesting cross-talk between olfaction and the immune system.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting your work entitled "Control of cellular immune-competency by odors in Drosophila" for consideration by eLife. Your article has been reviewed by a Senior Editor, a Reviewing Editor, and three reviewers. The following individuals involved in review of your submission have agreed to reveal their identity: Balint Z Kacsoh (Reviewer #2); Dan Hultmark (Reviewer #3).

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work has been rejected but you are allowed to submitted to eLife a revised version of this article that will be considered as a new submission. This allows you to have more time to address reviewers' comments. If you find that this is too risky, you have also the possibility to transfer this article to another journal.

At this stage, too many controls are lacking and the paper does not stand by itself in the absence of the other joint article. The idea would be to reinforce the conclusion by (1) centering the paper on the lymph gland, (2) by clearly demonstrating the effect of wasp odors on hematopoiesis, (3) by characterizing the pathway (GABA-Succinate-SIMU) et, (4) by revealing the consequence of resistance on wasp infection.

Reviewer #1:

In this study, the authors established that odors participate in the control of lamellocyte differentiation, a specific immune cell type which appears in Drosophila in response to wasp parasitism and is required for wasp egg encapsulation. They propose that odor sensing leads to the release of GABA into the hemolymph, which is taken up by lymph gland progenitors. Raising Drosophila larvae on food enriched in GABA (GF) or succinate (SF) rescues defects observed in those that are unable to sense odors. They further observed an increase in Sima levels in lymph gland cells in response to wasp parasitism. Finally, they propose that wasp odor contributes to an efficient Drosophila immune response by regulating GABA and Sima levels in lymph glands.

This analysis is interesting but must be significantly improved to support the conclusions proposed by the authors. The statements drawn in the summary, as well as in the first paragraph of the discussion, are not in agreement with the data presented. Furthermore, many conclusions rely on data that are neither published nor provided in the manuscript; this is not acceptable. Several key controls are missing (see below for details). Concerning the organization of the manuscript: in the Results section only data should be given, information relative to Materials and methods/tools or comments/discussion should be shifted to the corresponding sections. The key results of the study (including controls) must be provided in the main figures and the reader should be able to understand the conclusions by analyzing them. A strong reorganization of figures (including the addition of controls) is requested to improve data presentation for clarity and to prevent the reader from getting confused among main and supporting data.

Measuring larval melanisation is not an accurate way to evaluate the success of wasp encapsulation. Indeed, melanised larvae can give rise to living wasp larvae. A more reliable criterion will be the % of wasp egg hatching (%of wasp eggs that give rise to living wasp larvae).

Furthermore, in most experiments, the authors measured the absolute numbers of lamellocytes in circulation and rely on this criterion to estimate the efficiency of the Drosophila immune response. First, the % of circulating lamellocytes relative to the total amount of circulating blood cells (that can differ depending on genetic contexts) should be more accurate/meaningful than giving an absolute number. Second, since the correlation between circulating lamellocyte numbers and the efficiency of larval wasp encapsulation is under debate (see the recent paper by Leitao et al., 2019 and also data given in this study), it is very important to systematically analyse both lamellocyte numbers (in lymph gland and in circulation) and to measure the % of wasp egg encapsulation in every genetic context.

The data relative to Sima expression and function (by lof and gof in lymph gland progenitors) has to be given in the present manuscript. The functional links between GABA levels, Hph and Sima in lymph gland progenitors have to be established. The expression of these genes in different mutant contexts has to be performed and epistasis experiments must be done to establish their hierarchy.

To establish a functional link between Orco1 and Hph the authors performed rescue experiments of orco1 mutants by expressing hph RNAi under the control of the hml-Gal4 driver which is NOT expressed in lymph gland progenitors but in circulating differentiating blood cells (Figure 3G-J). These data do not support the proposed model where the function of Hph on Sima is supposed to occur in lymph gland progenitors! Rescue experiments must be done with hph RNAi under the control of lymph gland progenitor drivers.

Concerning the contribution of wasp odor to the Drosophila immune response: data provided are not convincing (see comments below for Figure 4) The injection of oil droplets to Drosophila larvae is known to induce the immune response and leads to droplet encapsulation. This represents a very interesting alternative to address the contribution of the wasp odor to the Drosophila immune response that should be tested here.

The model presented in Figure 5 does not summarize the data presented in this study. Those that link the cascade comprising iGABA, succinate, hph, sima and Ldh to lamellocyte differentiation are not provided here. The proposed role for wasp odor is not convincing. The cooperative effects of food and wasp odors were not analyzed.

Figure 1

What about the specificity of the Gal4 drivers that are used (Or42a, Kurs6)? Are similar results obtained in Or42A>hid and Or42A>or42RNAi (that would preserve neurons) larvae? What about lymph gland GABA levels in Kurs6>GatRNAi?

Figure 1—figure supplement 1

In Orco>Hid, rp and Or42b>hid: what about lymph gland lamellocyte numbers?

In RF, MOF and MOF+ food odor: what about lamellocyte differentiation in the lymph gland?

In Figure 1—figure supplement 1E in GH146>ChatRNAi there are only few lamellocytes in circulation but the % of melanised larvae does not seem statistically different from controls (statistics are missing). Thus, these results contradict the correlation between circulating lamelllocyte numbers and larval melanisation (see comments above), they also contradict the role of acetylcholine in the response to the wasp parasitism via its control of GABA levels. What about GABA and Sima levels in lymph glands in these experiments?

Are there any defects in lamellocyte numbers (in the lymph gland and in circulation), in wasp egg encapsulation, in lymph gland GABA and Sima levels when acetylcholine is constitutively released?

Figure 2

It must be established here that GABA receptor is not required, and that the role of GABA is mediated by the metabolic pathway to generate succinate. This must be added and presented in the main figures.

A-D controls are missing: phenotypes (lamellocyte differentiation in lymph glands and in circulation, GABA and Sima levels in lymph glands) should be analysed in the absence of wasp parasitism and when larvae are raised on GF and SF medium. 2E-H’ controls without parasitism should be provided. Is there any difference in larval development or size when they are raised on GF or SF compared to RF?

It is essential to illustrate in this Figure (i)the internalisation of GABA in lymph gland progenitors; (ii) the requirement of GABA internalisation for lamellocyte differentiation.

2A and 2C: what about wasp egg encapsulation?

In circulation (Figure 2E’,G’,F’,H’) since the red cells are considered as lamellocytes although they do not display their specific elongated shape, a marker for mature lamellocytes (L1, β−intergrin,.…) should be used.

Figure 3

A control lymph gland picture (without parasitism) must be presented, pictures B and D should be replaced since the focus seems to be different from the other pictures shown?

All the data relative to Sima expression and function in the lymph gland should be introduced here. What about Sima expression when larvae are raised on SF in the absence of parasitism? What about lamellocyte numbers (in the lymph gland and in circulation) and wasp egg encapsulation when Sima is overexpressed (gof) or in sima loss-of-function (lof) in lymph gland progenitors? Epistasis experiments between GABA and Sima in lymph gland progenitors must be performed.

Hph expression and function in lymph gland progenitors must be analysed. Recue and epistasis experiments between GABA, Hph and Sima must be performed in lymph gland progenitors to establish whether there are functional links between them. In hml>hphRNAi in Orco 1 mutants there is a strong increase in circulating lamellocyte numbers: is the total number of circulating blood cells affected?

3G-H: in hml>hph RNAI without wasp parasitism, what about lamellocyte numbers (in the lymph gland and in circulation) and lymph gland GABA and Sima expression? In the corresponding text the authors use the term "blood cells" for both lymph gland progenitors and circulating blood cells (as identified by the hml>Gal4 driver). This is very confusing since they are very distinct cell types. The adequate terms must be used for clarity.

Figure 2—figure supplement 2K: high numbers of circulating lamellocytes in Orco>Hid,rp larvae raised on GF and SF. What about the number of total circulating blood cells in these conditions, about lamellocyte numbers in lymph glands and wasp egg encapsulation in these contexts? What about lamellocyte numbers (in circulation and lymph gland), in the absence of parasitism?

Figure 4

Non-infected controls are missing: experiments without wasp infection must be run in parallel with those performed under wasp parasitism conditions. This is crucial to conclude that the phenotypes observed are due only to wasp infection. 4A: there is a huge dispersion of the values, the number of larvae analysed should be extended to reduce dispersion. Lamellocyte numbers in Or49a> hid-rp (RF) are similar (even superior) to Or49a>+ (RF) larvae, indicating that wasp odor is not required for lamellocyte production under regular wasp infection as it is performed in the lab. These data rather suggest that raising larvae in WOF and in the absence of infection, prime the lymph gland progenitors that are now more competent to rapidly differentiate into lamellocytes upon wasp parasitism. Longer exposure of larvae to WOF or to odor concentration might have a side effect on lymph gland progenitors in control larvae. This can be seen in Figure sup 2J where at the L3 stage, a significant alteration of dome+ cells indicates that the lymph gland progenitors differ between larvae raised on WOF compared to those raised on RF. What about GABA and Sima levels in L2/L3 lymph glands from control larvae raised on WOF medium? Analyzing the immune response triggered by oil injection in larvae might help to distinguish the contribution or not of wasp odor to this response.

Since the % of wasp egg encapsulation has not been examined the authors cannot conclude that wasp odor acts on the "efficiency of the immune response" as stated in the text.

4G is different from Figure 3A: Why?

4J is not in agreement with the quantification given in Figure 4L, similar remark holds for 4K and 4M.

4F: higher GABA levels are observed in the cardiac tube compared to the control 4E. Unfortunately, this raises doubts about the rigor with which the experiments were performed. To prevent this interrogation, pictures should not be a tight crop around one lymph gland lobe but a larger view including surrounding tissues (cardiac tube, pericardial cells) that would allow the reader to compare backgrounds between controls and experiments.

What is the control genotype in Figure 4C-H?

Sup Figure 3O-P: what about lamellocyte numbers in the lymph gland, wasp egg encapsulation, and lymph gland GABA and Sima levels?

Sup Figure 4

What about wasp egg encapsulation, lymph gland lamellocytes, lymph gland Sima levels when the different odors are provided to Drosophila larvae?

H-L': not convincing since the quality of pictures is not good enough. Why do we see such extensive green staining in J-L'? These data are not necessary.

Reviewer #2:

Madhwal et al., present their work, entitled, "Control of cellular immune-competency by odors in Drosophila." In this study, the authors investigate and identify a role for Drosophila larval environmental odor experience on priming cellular immune potential. Excitingly, the authors show that odor sensing is critical to production of lamellocytes in the circulating hemolymph of a Drosophila larva. This odor detection mediates the release of GABA from neurosecretory cells and is subsequently internalized by blood progenitor-cells. This internalization is followed by catabolization to generate succinate which stabilizes Sima (HIFα) protein, key for lamellocyte production. Remarkably, Drosophila larvae in odor environments mimicking parasitoid-threatened conditions raises systemic GABA and blood-progenitor Sima levels. Thus, these larvae have a primed immune response in anticipation of infection. Also, thank you to the authors for a wonderful summary Figure (Figure 5).

Collectively, this body of work represents novel and important insight into influence of environmental odor-experience on immune phenotypes. The genetic controls and experimental lines are elegantly chosen and the manuscript is written in a very clear and logical order. The rescue experiment with GABA or succinate supplementation is especially compelling. Odorants influence myeloid- metabolism and the priming of the innate-immune system, a truly remarkable finding building on the emerging field of environmental modulation of physiology.

It is my recommendation that this important manuscript be accepted pending revisions outlined below:

The authors provide an extremely important body of work. However, I have a few concerns on the genetic dissection of the phenotype that are important to be addressed:

– The role of Leptopilina boulardi venom may be a confounding variable. As described in Markus et al., 2005, a sterile needle wound is sufficient to trigger lamellocyte production and differentiation. While the data in Figure 1 is quite compelling, I believe it important to test via sterile needle wound the wild-type and Or42a>Hid line. Alternatively, sterile needle wound alone may not be sufficient to trigger the heightened response, but only in combination with odorant. This may be the case as the authors examine a general injury response. However, the methods do not outline what a general injury response is from, so I cannot conclude the finding. Either way, this would be important to address.

– Crystal cells self-melanize when larvae are incubated at 60°C for 10 minutes.

– Williams, Ando and Hultmark, (2005).

– This point is furthered by text in the manuscript: "GABA metabolism does not control differentiation of blood cells to plasmatocytes or crystal cell lineages, implying specificity of GABA in priming lamellocyte potential."

– The odorant clearly primes the immune response of the Drosophila larvae. I am left wondering what is the odorant that does the priming. The Materials and methods read:

"L. boulardi wasps in the proportion of 15 females and 8 males into regular food medium".

– I believe it is important to the impact of the paper to ask whether the odorant detected is male wasp specific or female wasp specific (OR perhaps it is not specific?). Either way, this is an important outstanding question that should be addressed. Regardless of the answer, this will further catapult this exciting finding into becoming a seminal work in the field of environmental modulation of physiology. This will also provide a baseline to identify what exactly Or49a is detecting (male, female, or general wasp odor?). Pure male populations can be acquired by using virgin female wasps to infect larvae. All F1 wasps will be male, thus providing a pure odorant. I am excited to read future studies that will hopefully identify the molecule that is being detected.

Reviewer #3:This is a very interesting paper, throwing more light on the mysterious connection between olfaction and immunity, previously described by some of the authors of this manuscript. The data presented here show that olfactory detection of parasites, via one or two specific odorant receptors, is required to prime the immune system for an enhanced response to later parasite attacks. They also confirm that the signal from the central nervous system to the hematopoietic tissue is mediated by GABA. GABA is taken up by the blood cell precursors, affecting their cellular metabolism and stabilizing Sima, a homolog of hypoxia-inducible factor α (HIFalpha). There, Sima is required for the generation of immune response effector cells (lamellocytes). When the authors blocked olfactory signaling, for instance by mutating a key olfactory co-receptor, the animals were unable to make lamellocytes. This capacity could be rescued, for instance by directly providing GABA, or by genetically blocking Sima turnover, thereby increasing its concentration. The results are convincing, and the links described here between olfaction, HIF signaling and immunity should be of considerable general interest. However, the paper is not very well written and some important information is missing:

1) A very recent article by Krejčová et al., (2019) describes the role of HIF signaling in the activation of Drosophila blood cells during bacterial infection. That paper very nicely complements the results described here. It was perhaps published after this manuscript was submitted, but appropriate references to that article must be added.

2) References are made to a "manuscript in submission" by Madhwal et al. Depending on how close that manuscript has come to publication, it may be wise to depend less on data presented there, since these data are still hidden from the reader. The authors could probably make their points by referring to other sources (e.g the above-mentioned paper by Krejčová et al.,), or to the experiments shown in the present manuscript.

3) Specifically, it is claimed that "Sima is both necessary and sufficient for lamellocyte induction". The data presented here suggest that Sima is necessary, and data elsewhere point in the same direction, but I am not aware of any published data showing that it is sufficient for lamellocyte induction. If that claim is only supported by the other submitted manuscript, it is better to delete it. The presented model does not depend on it.

4) The experimental system is not fully described, leaving it to the reader to fill the gaps. For instance, it is not clearly stated which parasite is studied. The Introduction makes a general statement about "Leptopilina wasps", and in the later sections, the reader has to infer that "wasps" or "L. boulardi wasps" refers to wasps of the species Leptopilina boulardi. That may seem self-evident for people in the field, but to help others it should be stated explicitly.

5) Many figures show the effects of genetic constructs, food etc. on lamellocyte production. From the context it can be inferred that these effects were often (maybe always?) studied in wasp-infected larvae. That must be clearly stated.

6) The second sentence in the Results section introduces "a subset of neurosecretory cells (Kurs6+)", implying that Kurs6+ is a term for a specific set of neurons. Later, "Kurs6" comes up as part of a genotype. That confused me at first. It took me some time to figure out that Kurs6-Gal4 is in fact a driver construct, and that "Kurs6+" simply refers to cells that express this driver. It would have been helpful to properly introduce this driver to the reader.

7) The term "iGABA" turned up rather unexpectedly in the text, and it confused me a lot. I don't think it is understood by the general reader. Does it simply refer to intracellular GABA? If so, I strongly suggest to spell it out, rather than introducing yet another multiple-letter combination. That would not make the text significantly longer.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Metabolic control of cellular immune-competency by odors in Drosophila" for consideration by eLife. Your article has been reviewed by Anna Akhmanova as the Senior Editor, a Reviewing Editor, and three reviewers. The following individuals involved in review of your submission have agreed to reveal their identity: Tomas Dolezal (Reviewer #1); Balint Z Kacsoh (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)

Summary:

The reviewers agree that the paper has been improved and is now easier to read. The findings were judged fascinating but there are still issues. The authors delineate a linear story (one pathway) but some elements could affect the system independently. The reviewers agree on a set of recommendations that should be addressed during the revision of the manuscript.

Essential revisions:

1) Resistance to parasitoid wasp

The authors provide an extremely important body of work. However, but the reviewers have a concern about the physiological significance of the phenotype. It is appropriate to hypothesize that an increase in lamellocyte production will yield a more potent immune response against parasitoids, as seen in other Drosophila species (i.e. D. suzukii). However, genetic perturbation that increase lamellocyte numbers, or perturbs the immune system in any manner, does not necessarily mean that the immune response mounted will be successful. The authors should provide experiments monitoring resistance to parasitoid wasps when the pathway they discovered is perturbated. There should monitor the impact of feeding larvae on WOF on resistance and how disturbing Or49A, Gat and Ssadh affect resistance to parasitoid wasp.

2) RNAi effectivity and using one line

The reviewers questioned the validity of the study as some results are based only one RNAi and their knockdown efficiencies were tested by using a ubiquitous and not in the actual tissues. They however recognize that the model is supported by the fact that they are testing different players affect the pathway. The reviewers however ask to repeat the experiments with Gat and Ssadh using another RNAi line to reinforce their conclusion.

3) Sima staining

Figure 3: There are discrepancies in the Sima staining which put question into the specificity of this staining/back ground. For example, some LGs showed a punctate expression of Sima in the posterior part of the LG (Figure 3F,G and H which is not seem in the other LGs). Pictures in Figure 3B, K and m are not in agreement with quantifications in 3O. The same comment holds for Figure 3F-L and quantifications in J. Expression of Sima in lamellocyte is also not convincing. The specificity of the Sima antibody has to be checked. Figure 3—figure supplement 1I is the difference in sima mRNA levels significant? The reviewers recommend to address this point or at least to prepare a supplementary figure showing replicated of the picture they use of their graph.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Metabolic control of cellular immune-competency by odors in Drosophila" for consideration by eLife. Your article has been reviewed by Anna Akhmanova as the Senior Editor, a Reviewing Editor, and one reviewer. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

There is an interest from the reviewers to publish this manuscript in eLife but some issues remained. At this stage, we encourage you to address either experimentally or by changes in the text the comments listed below (a possibility is to tune down the statements). The hope is that you can rapidly submit a revised version that addresses the few points left.

Essential revisions:

1) The regulatory cascade that goes from iGAbA to Ldh (Figure 6, left part) is not fully established, since several epistasis experiments are still lacking. For example, functional links in the lymph gland are not established between: (i) hph and sima, and more importantly between (ii) sima and Ldh and (iii) sima and iGABA. Epistasis experiments are lacking which precludes drawing in the model Figure 6 plain arrows representing functional connections. Some experiments given in the manuscript for establishing functional links are irrelevant: this is the case of the epistasis experiment between oroc1 and Sima (via hph RNAi with the hml driver; sup Figure 4L-O). The hml-gal4 driver is not expressed at all in lymph gland progenitors where hph function is supposed to be required!

One key point concerns Sima functions. In the model, Sima is acting downstream of iGABA and is required for lamellocyte differentiation in response to wasp parasitism (Figure 6, left part). Unfortunately, these regulations are not yet definitively established in the manuscript.

Why have authors not performed rescue experiments of DomeMESO>Gat RNAi or (Dome-MESO>Ssadh RNAi) of the mutant lymph gland phenotype by overexpressing Sima with the Dome-MESO gal4 driver? This is a key experiment that would establish whether Sima is the key payer downstream of iGaba.

Concerning the functional link between Sima and lamellocyte differentiation: Does the overexpression of Sima with the dome-MESO gal4 driver lead to a cellular immune response similar to the one observed in response to wasp infection? These are key questions that have to be addressed to sustain the model proposed in Figure 6.

2) Figure 6 (right panel) this representation is misleading and is not in agreement with the presented data. The proposed role for wasp odor for the immune response is not correct. Indeed, killing the Or49a neurons (wasp odor sensing neurons) has no impact on the immune response on larvae raised on RF (Figure 5). Thus, there is no need at all for these neurons to mount an immune response. Raising larvae on WOF leads only to an increase in the immune response that is dependent on Or49A neurons. Any conditions that lead to increased GABA levels (such as SF, GF,WOF ) and even in the absence of wasp parasitism (since lamellocytes are detected in these conditions in the absence of parasitism) have the same consequence; i. e. a boost of the immune response. This data indicates that increasing GABA levels (by activating GABAnergic neurons) by different ways leads in all conditions to boosting the immune response.

3) Ca²⁺ levels in the lymph gland and their potential contribution to the immune response is unclear. What about Ca 2+ levels and requirement: (i) in response to wasp infection and (ii) in dome-MESO>gat RNAi conditions?

4) Figure 2—figure supplement 4 and Figure 4D-E, H-I controls are missing. This concerns Figure 4D and E; Figure 4H and I and Figure 2—figure supplement 4L. In response to wasp parasitism, do wild type larvae raised in SF or GF have increased lamellocyte differentiation compared to wt parasited larvae raised on RF?

5) Figure 2—figure supplement 3: why are the authors looking at pCamKII? What does this marker indicate?

6) Figure 2—figure supplement 3P: DomeMESO>gatRNAi , a decrease in iGABA is observed (Figure 2H) whereas no difference for pxn is measured. This is different from data given in Shim et al., 2013 where a decrease in GABA leads to increase Pxn? How can one reconcile these data?

7) Dome-MESO>sima RNAi: Subsection “Progenitor Sima protein stability via GABA-catabolism establishes lamellocyte Potential”: one cannot write that "plasmatocyte number is not affected" since quantifications are missing.

8) Propositions for deleting some parts:

– Figure 3—figure supplement 1M-T' are redundant with Figure 3.

– Data relative to tango: They are based on only one RNAi treatment and they are not essential. Thus, they could be removed.

– Figure 4A', B', C', F' and G' are not informative. Cells shown have a round shape and do not correspond to lamellocytes that have a characteristic elongated morphology.

– Figure 5—figure supplement 2G there is no reference of this Figure in the manuscript!

9) I have still comments on the writing as the article, which is difficult to follow even to quite close experts.

– The Abstract is difficult to understand:

Here is a possible (suggested) Abstract based on your texts:

“Studies in different animal model systems have revealed the impact of odors on immune cells, However, any understanding on why and how odors control cellular immunity remained unclear. We find that Drosophila employ an olfactory/immune cross-talk to tune a specific cell type, the lamellocytes, from hematopoietic-progenitor cells. We show that neuronally released GABA derived upon olfactory stimulation, is utilized by blood-progenitor cells as a metabolite and through its catabolism, these cells stabilize Sima/HIFα protein in them. In blood-progenitor cells, Sima capacitates these cells with the ability to drive a metabolic state that is necessary for initiating lamellocyte differentiation. This systemic axis becomes relevant for larvae dwelling in wasp-infested environments where chances of infection are higher. By co-opting the olfactory route, the preconditioned animals elevate their systemic GABA levels leading to the up-regulation of blood-progenitor cell Sima expression. This elevates their immune-potential and primes them to respond rapidly when infected with parasitic wasps. The present work highlights the importance of the olfaction in immunity and shows how odor detection during animal development is utilized to establish a long-range axis in the control of immune-progenitor competency and priming.”

Introduction “innate competitiveness” consider rewriting this term.

Introduction: The third paragraph does not fit well the flow of the text. Include this text after mentioning the link between odor and immunity.

Introduction: consider shortened this part or move some part in the Abstract.

Introduction

Indicates that you are using Orco and provide background information or replace by an introductory sentence if the result is described below.

Indicate that it is in the “lymph gland”.

Replace mutational analysis by “the use of mutations” or “the use of loss of function mutations”.

Subsection “Olfaction controls cellular immune response necessary to combat parasitic wasp Infections”: explain what is PSC and why you look at PSC.

Subsection “Progenitor Sima protein stability via GABA-catabolism establishes lamellocyte Potential”: Avoid to use a passive sentence form. It will be simpler to say. We next explored…. (this applies to many other parts of the text).

Consider to add additional sub-sectioning in the results to facilitate the reading.

Subsection “Pathogenic odors induce immune priming”, second paragraph: I could not understand the statements. Could you make it clearer?

The Discussion is far too long and should be divided by two.

https://doi.org/10.7554/eLife.60376.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Reviewer #1:

In this study, the authors established that odors participate in the control of lamellocyte differentiation, a specific immune cell type which appears in Drosophila in response to wasp parasitism and is required for wasp egg encapsulation. They propose that odor sensing leads to the release of GABA into the hemolymph, which is taken up by lymph gland progenitors. Raising Drosophila larvae on food enriched in GABA (GF) or succinate (SF) rescues defects observed in those that are unable to sense odors. They further observed an increase in Sima levels in lymph gland cells in response to wasp parasitism. Finally, they propose that wasp odor contributes to an efficient Drosophila immune response by regulating GABA and Sima levels in lymph glands.

This analysis is interesting but must be significantly improved to support the conclusions proposed by the authors. The statements drawn in the summary, as well as in the first paragraph of the discussion, are not in agreement with the data presented. Furthermore, many conclusions rely on data that are neither published nor provided in the manuscript; this is not acceptable. Several key controls are missing (see below for details). Concerning the organization of the manuscript: in the Results section only data should be given, information relative to Materials and methods/tools or comments/discussion should be shifted to the corresponding sections. The key results of the study (including controls) must be provided in the main figures and the reader should be able to understand the conclusions by analyzing them. A strong reorganization of figures (including the addition of controls) is requested to improve data presentation for clarity and to prevent the reader from getting confused among main and supporting data.

Measuring larval melanisation is not an accurate way to evaluate the success of wasp encapsulation. Indeed, melanised larvae can give rise to living wasp larvae. A more reliable criterion will be the % of wasp egg hatching (%of wasp eggs that give rise to living wasp larvae). Furthermore, in most experiments, the authors measured the absolute numbers of lamellocytes in circulation and rely on this criterion to estimate the efficiency of the Drosophila immune response.

The main finding of the manuscript is the importance of sensory stimulation to generate a cell type that is necessary to respond to infections by parasitic wasps. The melanization data in the previous version was added to support the functional aspect of these immune cells and that in conditions when these cells were not detected the melanization of wasp-eggs was also undetectable. The aspect of melanization itself is far more complex and we agree with the reviewer that our assays do not evaluate it and also is not the central point of our investigation. We feel if any systemic control of melanization exists, will be better understood by undertaking a more thorough analysis and best done as an independent study. Hence, the current manuscript focuses on mechanisms controlling the development of immune-competent blood-progenitor cells that are capacitated to differentiate into lamellocytes. These are are impressive cells as they are only seen in conditions of infection/inflammation and not seen in homeostasis, unlike plasmatocytes and crystal cells. The processes that define such capability to the immune system forms the central focus of this manuscript.

First, the % of circulating lamellocytes relative to the total amount of circulating blood cells (that can differ depending on genetic contexts) should be more accurate/meaningful than giving an absolute number.

This is done. In addition to total lamellocytes numbers/larva, their respective proportions to total circulating blood cells is also provided for every genetic context in infected and uninfected conditions. The data in infected conditions are shown in: Figure 1—figure supplement 1E, Figure 2—figure supplement 1M, Figure 2—figure supplement 2C, Figure 2—figure supplement 5C, Figure 3—figure supplement 1L, Figure 5—figure supplement 1B and uninfected states is provided in Supplementary file 2.

Second, since the correlation between circulating lamellocyte numbers and the efficiency of larval wasp encapsulation is under debate (see the recent paper by Leitao et al., 2019 and also data given in this study), it is very important to systematically analyse both lamellocyte numbers (in lymph gland and in circulation) and to measure the % of wasp egg encapsulation in every genetic context.

Lymph gland lamellocyte counts are now provided for all genetic conditions. They are shown in Figure 1C, 1F, 1I, Figure 2P, Figure 3T, Figure 4D, 4H, Figure 5A and Extended 7N, 8N Figure 1—figure supplement 1A, Figure 1—figure supplement 1C, Figure 2—figure supplement 1K, Figure 2—figure supplement 1N, Figure 2—figure supplement 1D, Figure 2—figure supplement 1I, Figure 2—figure supplement 4I, Figure 2—figure supplement 5A, Figure 3—figure supplement 1J, Figure 4—figure supplement 1F.

The data relative to Sima expression and function (by lof and gof in lymph gland progenitors) has to be given in the present manuscript. The functional links between GABA levels, Hph and Sima in lymph gland progenitors have to be established. The expression of these genes in different mutant contexts has to be performed and epistasis experiments must be done to establish their hierarchy.

The functional link between GABA levels, Hph and Sima in lymph gland progenitors is provided. Figure 2, Figure 3 and Figure 1—figure supplement 1, Figure 2—figure supplement 2, Figure 2—figure supplement 3, Figure 2—figure supplement 4, Figure 2—figure supplement 5, Figure 3—figure supplement 1 and Figure 3—figure supplement 2 are completely dedicated towards describing this process.

To establish a functional link between Orco1 and Hph the authors performed rescue experiments of orco1 mutants by expressing hph RNAi under the control of the hml-Gal4 driver which is NOT expressed in lymph gland progenitors but in circulating differentiating blood cells (Figure 3G-J). These data do not support the proposed model where the function of Hph on Sima is supposed to occur in lymph gland progenitors! Rescue experiments must be done with hph RNAi under the control of lymph gland progenitor drivers.

We have attempted to do the rescue experiment as suggested by the reviewer of orco1 mutants by expressing hph RNAi under the control of a progenitor driver. However, the genetic complexity of this experiment has limited its success as the combinations were often unhealthy and failed to propagate. As a result, we have been unable to get enough larvae of the correct genotype for addressing the infection response. As we continue to attempt this question by other approaches, we utilized HmlΔGal4 to address this issue. HmlΔGal4 is a well-established lymph gland driver line. It marks differentiating blood cells of the lymph gland as early as 60h AEL ((Jung et al., 2005), (Goto et al., 2003, Mondal et al., 2011) (Charroux and Royet, 2009)). Using this driver, we find recovery of lamellocyte formation in the lymph glands of orco1 mutants. The data provides epistatic relationship of the systemic pathway in blood cells of the lymph gland and indicates that loss of Hph in Hml⁺ is also sufficient to restore their lamellocyte formation.

Concerning the contribution of wasp odor to the Drosophila immune response: data provided are not convincing (see comments below for Figure 4) The injection of oil droplets to Drosophila larvae is known to induce the immune response and leads to droplet encapsulation. This represents a very interesting alternative to address the contribution of the wasp odor to the Drosophila immune response that should be tested here.

We thank reviewer for this suggestion, and we will employ this assay to investigate the melanization/encapsulation response of lamellocytes in our forthcoming investigations.

The model presented in Figure 5 does not summarize the data presented in this study. Those that link the cascade comprising iGABA, succinate, hph, sima and Ldh to lamellocyte differentiation are not provided here. The proposed role for wasp odor is not convincing. The cooperative effects of food and wasp odors were not analyzed.

This is corrected. The current draft incorporates all the missing data on GABA metabolism linking it to progenitor Ldh function in lamellocyte formation to strengthen the model presented.

Figure 1

What about the specificity of the Gal4 drivers that are used (Or42a, Kurs6)?

The specificity of these drivers is previously shown in Shim et al., and show limited expression within the neuronal tissue without any non-specific expression in immune cells.

Are similar results obtained in Or42A>hid and Or42A>or42RNAi (that would preserve neurons) larvae?

We tested RNAi line Or42a (BL#65152) and failed to detect any difference due to its poor knock-down efficiency. There are 2 other RNAi lines available at VDRC which we were unable to procure due to difficulties with general procurement of lines from VDRC (problems with importing these lines and custom clearances that continue to exist). Unfortunately, we also tried to obtain Or42a mutant lines from Carlson lab and Dennis Mathew, but failed to obtain them for the same import reasons. We feel unfortunate, but nevertheless, I also understand the point raised by the reviewer. In response to this, I would like to mention the physiological experiment done with media lacking food odors (Figure 1—figure supplement 1C and 1D) where olfactory neurons are preserved showed defective lamellocyte formation both in the lymph gland and circulation (Figure 1—figure supplement 1C and 1D) which was corrected by restoration of food odors back into the medium. Additionally, orco1 mutant larvae also showed lamellocyte defect. Subsequently, downstream of olfactory signaling we have blocked projection neurons and Kurs6 neurons which phenocopy the lamellocyte defect. Taken together, all the data show the defect in lamellocyte formation is not a consequence of loss of Or42a, rather lack of olfactory signalling.

What about lymph gland GABA levels in Kurs6>GatRNAi?

We do not understand the concern being raised by Kurs6>GatRNAi, which would block

GABA transporter in Kurs6 neurons. However, blocking GABA-synthesis (Kurs6>Gad1RNAi) in Kurs6 neurons leads to reduction in systemic GABA levels and lymph gland GABA levels. This is previously reported in (Shim, Mukherjee et al., 2013) and we have now made this clearer in the text.

Figure 1—figure supplement 1

In Orco>Hid, rp and Or42b>hid: what about lymph gland lamellocyte numbers?

In RF, MOF and MOF+ food odor: what about lamellocyte differentiation in the lymph gland?

This is provided in Figure 1—figure supplement 1A-C and 1F.

Figure 2

It must be established here that GABA receptor is not required, and that the role of GABA is mediated by the metabolic pathway to generate succinate. This must be added and presented in the main figures.

We provide the entire data on GABA receptor and its lack in lamellocyte formaion as an Figure 2—figure supplement 1K. To maintain the focus and narrative of the study on olfaction and GABA’s role as a metabolite and the increasing number of panels that describe this, we have kept the entire data on GABA receptor as an independent Figure 2—figure supplement 1, but will be happy to make it into a main figure if necessary.

Is there any difference in larval development or size when they are raised on GF or SF compared to RF?

Larval development or size on these diets at concentrations tested is not altered. Our data on lymph gland blood development in SF condition in Figure 2—figure supplement 4A-C, showing no change in their hematopoietic aspects reflects this and implies, that this dietary state does not induce any stress response, given the highly sensitive nature of the lymph gland immune to stresses (Shim et al., 2012) (Owusu-Ansah and Banerjee, 2009) (Kim et al., 2011).

It is essential to illustrate in this Figure (i)the internalisation of GABA in lymph gland progenitors; (ii) the requirement of GABA internalisation for lamellocyte differentiation.

Figure 2 describes GABA uptake and its internalization by lymph gland progenitors necessary for lamellocyte formation. Figure 2A-2K show dependency of Gat function in moderating intracellular GABA levels in blood progenitor cells and Figure 2L-Q describe its intracellular metabolic role in lamellocyte response. The experiments have been conducted using 2 independent blood-progenitor cell driver and these data are shown in Figure 2—figure supplement 2.

2A and 2C: what about wasp egg encapsulation?

In circulation (Figure 2E’,G’,F’,H’) since the red cells are considered as lamellocytes although they do not display their specific elongated shape, a marker for mature lamellocytes (L1, β−intergrin,.…) should be used.

Lamellocytes have a characteristic large flattened morphology which is the primary phenotype that is utilized to detect and count these cells. The stainings with phalloidin or with Myospheroid (β−intergrin) have been undertaken to identify the cells of this characteristic shape. We have used protocols to detect these cells that are routinely used and published (Anderl et al., 2016), (Small et al., 2014). Panels with Myospheroid (β−intergrin) staining are now shown in Figure 2L-O, Figure 3C, 3D, 3P-S, Figure 4A-C, 4F, 4G, Figure 5D, 5E, 5J, 5K, Figure 2—figure supplement 4D-H, Figure 3—figure supplement 3B-C.

Figure 3

A control lymph gland picture (without parasitism) must be presented, pictures B and D should be replaced since the focus seems to be different from the other pictures shown?

All the data relative to Sima expression and function in the lymph gland should be introduced here. What about Sima expression when larvae are raised on SF in the absence of parasitism? What about lamellocyte numbers (in the lymph gland and in circulation) and wasp egg encapsulation when Sima is overexpressed (gof) or in sima loss-of-function (lof) in lymph gland progenitors? Epistasis experiments between GABA and Sima in lymph gland progenitors must be performed.

Hph expression and function in lymph gland progenitors must be analysed. Recue and epistasis experiments between GABA, Hph and Sima must be performed in lymph gland progenitors to establish whether there are functional links between them. In hml>hphRNAi in Orco 1 mutants there is a strong increase in circulating lamellocyte numbers: is the total number of circulating blood cells affected?

3G-H: in hml>hph RNAI without wasp parasitism, what about lamellocyte numbers (in the lymph gland and in circulation) and lymph gland GABA and Sima expression? In the corresponding text the authors use the term "blood cells" for both lymph gland progenitors and circulating blood cells (as identified by the hml>Gal4 driver). This is very confusing since they are very distinct cell types. The adequate terms must be used for clarity.

The draft is restructured significantly. Most experiments have been redone and the current version provides the epistatic relationship between GABA and Sima in lymph gland blood progenitor cells. As mentioned, these data are presented in Figure 2, Figure 3 and Figure 1—figure supplement 1, Figure 2—figure supplement 2, Figure 2—figure supplement 3, Figure 2—figure supplement 4, Figure 2—figure supplement 5, Figure 3—figure supplement 1 and Figure 3—figure supplement 2.

With regards to hml>hphRNAi in Orco 1 mutants, our attempts to conduct the rescue experiment as suggested by the reviewer of orco1 mutants by expressing hph RNAi under the control of a progenitor driver have not been successful. The genetic complexity of this experiment has limited its success and the combinations were often unhealthy and failed to propagate. As we continue to attempt this question by other approaches, we utilized HmlΔGal4 which is also a well-established lymph gland driver line. It marks differentiating blood cells of the lymph gland as early as 60h AEL. Using this driver, we find recovery of lamellocyte formation in the lymph glands of orco1 mutants. These data provide epistatic relationship of the systemic pathway in blood cells of the lymph gland and indicates that loss of Hph in Hml⁺ is also sufficient to restore their lamellocyte formation and is provided as supplemental data. This data is also supportive of our previous findings on the GABA-pathway using HmlΔGal4, and is suggestive of a lamellocyte lineage trajectory that is: dome⁺ to dome⁺Hml⁺ to Hml⁺ to Mys⁺, in the lymph glands. This is currently under investigation.

Figure 2—figure supplement 2K: high numbers of circulating lamellocytes in Orco>Hid,rp larvae raised on GF and SF. What about the number of total circulating blood cells in these conditions, about lamellocyte numbers in lymph glands and wasp egg encapsulation in these contexts? What about lamellocyte numbers (in circulation and lymph gland), in the absence of parasitism?

Lamellocyte numbers in circulation and lymph gland, in the absence of parasitism of Orco>Hid,rp larvae is provided in Supplementary file 1 and Supplementary file 2. Post-infection the total circulating blood cell numbers are provided in Figure 1—figure supplement 1E.

Figure 4

Non-infected controls are missing: experiments without wasp infection must be run in parallel with those performed under wasp parasitism conditions. This is crucial to conclude that the phenotypes observed are due only to wasp infection.

The data on un-infected WOF conditions are clearly provided in Supplementary file 1 and Supplementary file 2. We detect the formation of lamellocyte even in the absence of infection while their numbers are much reduced than detected in infections, the data indicate improved competency of blood-progenitor cells to make lamellocytes in WOF condition.

Figure 4A: There is a huge dispersion of the values, the number of larvae analysed should be extended to reduce dispersion. Lamellocyte numbers in Or49a> hid-rp (RF) are similar (even superior) to Or49a>+ (RF) larvae, indicating that wasp odor is not required for lamellocyte production under regular wasp infection as it is performed in the lab. These data rather suggest that raising larvae in WOF and in the absence of infection, prime the lymph gland progenitors that are now more competent to rapidly differentiate into lamellocytes upon wasp parasitism. Longer exposure of larvae to WOF or to odor concentration might have a side effect on lymph gland progenitors in control larvae. This can be seen in Figure Sup 2J where at the L3 stage, a significant alteration of dome+ cells indicates that the lymph gland progenitors differ between larvae raised on WOF compared to those raised on RF. What about GABA and Sima levels in L2/L3 lymph glands from control larvae raised on WOF medium? Analyzing the immune response triggered by oil injection in larvae might help to distinguish the contribution or not of wasp odor to this response.

We have attempted to clarify these points. We have added more number of samples to increase “n” values for WOF condition. But the nature of the data is the same and the dispersion is still huge. We predict this is a consequence of the nature of the experiment which shown dynamic physiology of animals and how they perceive odors and respond. However, the trend to make more lamellocytes in response to wasp-odors is significantly evident. We show upregulation of GABA and Sima levels in developing L3 lymph glands from control uninfected larvae raised on WOF medium. This is shown in Figure 5G on WOF compared to 5F on RF (GABA) and 5I on WOF compared to 5H on RF (Sima). Blocking sensing of wasp-odors by abrogating Or49a (Or49>Hid) shows a failure of these animals to increase the levels of GABA and Sima as seen in WOF. The levels in Or49>Hid animals raised on WOF, remain comparable to levels seen in controls on regular food. Figure 5L compared to 5G and 5F (GABA) and 5N compared to 5I and 5H (Sima). We have also undertaken sterile wounding of WOF animals to analyze immune response to general injury (this was shown in the previous version, but now omitted). While cellular immune response to injury is comparable to controls, these animals make more lamellocytes here as well. We feel the data on un-infected WOF conditions provided in Supplementary file 1 and Supplementary file 2 where lamellocyte formation is detected even in the absence of infection proves the point on wasp-odors and their contribution in improved competency of blood progenitor cells in making lamellocytes. Hence, for the sake of simplicity and linearity in the current version of the manuscript the data on injury in WOF animals is not provided, but we will be happy to add it back.

Since the % of wasp egg encapsulation has not been examined the authors cannot conclude that wasp odor acts on the "efficiency of the immune response" as stated in the text:

Figure 4G is different from Figure 3A: Why?

Figure 4J is not in agreement with the quantification given in Figure 4L, similar remark holds for 4K and 4M.

Figure 4F: higher GABA levels are observed in the cardiac tube compared to the control 4E. Unfortunately, this raises doubts about the rigor with which the experiments were performed. To prevent this interrogation, pictures should not be a tight crop around one lymph gland lobe but a larger view including surrounding tissues (cardiac tube, pericardial cells) that would allow the reader to compare backgrounds between controls and experiments.

What is the control genotype in Figure 4C-H?

Majority of the stainings have been re-done and the images have been quantified to strengthen the point on wasp-odor sensing and its ability to raise systemic GABA levels and lamellocyte response. The detection of wasp-odors leading to increase in systemic GABA levels raises blood-progenitor GABA and Sima expression. The point raised by the reviewer on higher GABA levels being observed in the cardiac tube on WOF conditions reflects the point that in these conditions the systemic levels of GABA is up-regulated (Figure 5G compared to 5F for lymph gland data and also see 5C for hemolymph GABA data). We have also made sure that all genotypes are mentioned.

Sup Figure 3O-P: what about lamellocyte numbers in the lymph gland, wasp egg encapsulation, and lymph gland GABA and Sima levels?

Figure 5—figure supplement 1

What about wasp egg encapsulation, lymph gland lamellocytes, lymph gland Sima levels when the different odors are provided to Drosophila larvae?

H-L': not convincing since the quality of pictures is not good enough. Why do we see such extensive green staining in J-L'? These data are not necessary.

The data on different odors is mainly provided to show the specificity of wasp-odors in lamellocyte formation and modulating systemic GABA levels. Hence, we show circulating lamellocyte counts and GABA levels. We have data on Sima levels as well and will be happy to provide it. We have removed the panels H-L'.

Reviewer #2:

Madhwal et al., present their work, entitled, "Control of cellular immune-competency by odors in Drosophila." In this study, the authors investigate and identify a role for Drosophila larval environmental odor experience on priming cellular immune potential. Excitingly, the authors show that odor sensing is critical to production of lamellocytes in the circulating hemolymph of a Drosophila larva. This odor detection mediates the release of GABA from neurosecretory cells and is subsequently internalized by blood progenitor-cells. This internalization is followed by catabolization to generate succinate which stabilizes Sima (HIFα) protein, key for lamellocyte production. Remarkably, Drosophila larvae in odor environments mimicking parasitoid-threatened conditions raises systemic GABA and blood-progenitor Sima levels. Thus, these larvae have a primed immune response in anticipation of infection. Also, thank you to the authors for a wonderful summary Figure (Figure 5)!

Collectively, this body of work represents novel and important insight into influence of environmental odor-experience on immune phenotypes. The genetic controls and experimental lines are elegantly chosen, and the manuscript is written in a very clear and logical order. The rescue experiment with GABA or succinate supplementation is especially compelling. Odorants influence myeloid- metabolism and the priming of the innate-immune system, a truly remarkable finding building on the emerging field of environmental modulation of physiology.

It is my recommendation that this important manuscript be accepted pending revisions outlined below:

We thank reviewer#2 for the positive response on our work. The suggestions made have been incorporated into the revised version of the draft and critique made have been very useful in re-writing of the manuscript. Please find our response to comments and concerns raised herewith.

The authors provide an extremely important body of work. However, I have a few concerns on the genetic dissection of the phenotype that are important to be addressed:

– The role of Leptopilina boulardi venom may be a confounding variable. As described in Markus et al., 2005, a sterile needle wound is sufficient to trigger lamellocyte production and differentiation. While the data in Figure 1 is quite compelling, I believe it important to test via sterile needle wound the wild-type and Or42a>Hid line. Alternatively, sterile needle wound alone may not be sufficient to trigger the heightened response, but only in combination with odorant. This may be the case as the authors examine a general injury response. However, the methods do not outline what a general injury response is from, so I cannot conclude the finding. Either way, this would be important to address.

As we understand here, the point being raised by the reviewer is about dampened lamellocyte formation in olfactory mutants is perhaps a consequence of the boulardi venom. The data we provide in the current manuscript throughout, clearly shows that cellular response to waspinfection in olfactory and GABA-metabolic mutants are specifically affected for lamellocyte formation while the overall blood cell numbers seen following infection are comparable to controls. This is reflected in comparable cell densities post wasp-infection between control w1118 vs orco1/orco1, Orco> vs Orco>Hid, rpr, Or42a> vs Or42a>Hid, Kurs6> vs Kurs6>Gad1RNAi (Figure 1—figure supplement 1E). In all these conditions while the control makes a substantial percentage of lamellocytes, the mutants even though have similar cell densities they are incapacitated to generate lamellocytes. Implying that these animals respond to infections. The strength of wasp-infection induces heightened immune response as opposed to sterile injury as rightly mentioned byt the reviewer and clearly olfactory mutants and blocking progenitor GABA metabolic conditions are able to respond to infection but unable to mount lamellocyte differentiation. This is reflected in their lymph gland numbers and circulating lamellocyte numtbers. This defect is restored by GABA or succinate supplementation. Hence based on all the mutants described in the study, we feel it is very unlikely that all of them are more susceptible to the parasitoid venom leading to the lamellocyte defect.

– The defects in melanization yield a second important question: Are crystal cells also negatively affected by the inability to detect odorants? Are crystal cell populations affected by wasp odor? This question should be investigated and can be easily by heating Drosophila larvae as described in the citation below and counting the melanin spots. If this cell type is also affected, it would provide a stronger mechanistic link between lack of melanotic activity and odor detection of either both cell types OR only lamellocytes.– Crystal cells self-melanize when larvae are incubated at 60°C for 10 minutes– Williams, Ando and Hultmark, (2005).– This point is furthered by text in the manuscript: "GABA metabolism does not control differentiation of blood cells to plasmatocytes or crystal cell lineages, implying specificity of GABA in priming lamellocyte potential."

The current manuscript has been restructured as per the overall suggestions from the reviewers and the editor to center focus on lymph gland blood-progenitor cells and their contribution to lamellocyte formation. For this reason, we have omitted all the melanization data as we feel a clear understanding of this process requires much more experimental work and is better suited as an independent piece of work. As rightly pointed here in this comment as well, addressing crystal cells and their functions in response to wasp-odors in melanization response warrants further analysis, which is currently being undertaken.

– The odorant clearly primes the immune response of the Drosophila larvae. I am left wondering what is the odorant that does the priming. The Materials and methods read:

"L. boulardi wasps in the proportion of 15 females and 8 males into regular food medium".

We agree with the reviewer that it will be very exciting to identify the molecule that drives immue-priming. Based on data presented by (Ebrahim, Dweck et al., 2015) behavior of Drosophila larvae to wasps, it is mediated by Or49a. In this study the authors describe the specificity of Or49a towards detection of iridomyrmecin which is an odor produced specifically by Leptopilina wasps from both males and females. This study clearly shows the behavioral avoidance response to iridomyrmecin in the larvae is mediated by activation Or49a. Based on our genetic data with blocking Or49a function in WOF condition, we speculate iridomyrmecin as the molecule that functions in immune-priming capacity, however the commercial unavailability of this compound has limited us from asking this question and still remains to be tested.

Reviewer #3:

This is a very interesting paper, throwing more light on the mysterious connection between olfaction and immunity, previously described by some of the authors of this manuscript. The data presented here show that olfactory detection of parasites, via one or two specific odorant receptors, is required to prime the immune system for an enhanced response to later parasite attacks. They also confirm that the signal from the central nervous system to the hematopoietic tissue is mediated by GABA. GABA is taken up by the blood cell precursors, affecting their cellular metabolism and stabilizing Sima, a homolog of hypoxia-inducible factor α (HIFalpha). There, Sima is required for the generation of immune response effector cells (lamellocytes). When the authors blocked olfactory signaling, for instance by mutating a key olfactory co-receptor, the animals were unable to make lamellocytes. This capacity could be rescued, for instance by directly providing GABA, or by genetically blocking Sima turnover, thereby increasing its concentration. The results are convincing, and the links described here between olfaction, HIF signaling and immunity should be of considerable general interest. However, the paper is not very well written and some important information is missing:

We sincerely thank reviewer#3 for the positive response of our work. We have made all attempts to improve the quality of the work both in terms of rigor and analysis by doing new experiments and in terms of re-structuring of the draft to provide important data that were missing in the previous version. Please find our response to every comment here with.

1) A very recent article by Krejčová et al., (2019) describes the role of HIF signaling in the activation of Drosophila blood cells during bacterial infection. That paper very nicely complements the results described here. It was perhaps published after this manuscript was submitted, but appropriate references to that article must be added.

We thank the reviewer for pointing this out. Yes, it was missed as our paper was submitted much before Krejčová et al., 2019 became online. This reference is now cited.

2) References are made to a "manuscript in submission" by Madhwal et al. Depending on how close that manuscript has come to publication, it may be wise to depend less on data presented there, since these data are still hidden from the reader. The authors could probably make their points by referring to other sources (e.g the above-mentioned paper by Krejčová et al.,), or to the experiments shown in the present manuscript.

We provide all the data on GABA and its metabolism in blood-progenitor cells in the revised version. The data is shown in Figure 2, Figure 3 and Figure 2—figure supplement 1, Figure 2—figure supplement 2, Figure 2—figure supplement 3, Figure 2—figure supplement 4, Figure 2—figure supplement 5, Figure 3—figure supplement 1, Figure 3—figure supplement, Figure 3—figure supplement 2.

3) Specifically, it is claimed that "Sima is both necessary and sufficient for lamellocyte induction". The data presented here suggest that Sima is necessary, and data elsewhere point in the same direction, but I am not aware of any published data showing that it is sufficient for lamellocyte induction. If that claim is only supported by the other submitted manuscript, it is better to delete it. The presented model does not depend on it.

We agree with the reviewer that Sima sufficiency is not supported by the current data we have. This is now corrected.

4) The experimental system is not fully described, leaving it to the reader to fill the gaps. For instance, it is not clearly stated which parasite is studied. The Introduction makes a general statement about "Leptopilina wasps", and in the later sections, the reader has to infer that "wasps" or "L. boulardi wasps" refers to wasps of the species Leptopilina boulardi. That may seem self-evident for people in the field, but to help others it should be stated explicitly.

We have made this clear in the text and describe the use of L. boulardi explicitly. The methods section incoporates a segment on wasp-infection to describe the experimental details with more clarity.

5) Many figures show the effects of genetic constructs, food etc. on lamellocyte production. From the context it can be inferred that these effects were often (maybe always?) studied in wasp-infected larvae. That must be clearly stated.

This is now stated clearly. For all data acquired upon infection, hours post infection is mentioned both in the figures and in legends and also this is carefully presented in the main text. Data acquired in uninfected conditions is also categorically described and we hope the current version will be clearer in this regard.

6) The second sentence in the Results section introduces "a subset of neurosecretory cells (Kurs6+)", implying that Kurs6+ is a term for a specific set of neurons. Later, "Kurs6" comes up as part of a genotype. That confused me at first. It took me some time to figure out that Kurs6-Gal4 is in fact a driver construct, and that "Kurs6+" simply refers to cells that express this driver. It would have been helpful to properly introduce this driver to the reader.

We have made this distinction on Kurs6 clearer in the text. We thank the reviewer for raising this point.

7) The term "iGABA" turned up rather unexpectedly in the text, and it confused me a lot. I don't think it is understood by the general reader. Does it simply refer to intracellular GABA? If so, I strongly suggest to spell it out, rather than introducing yet another multiple-letter combination. That would not make the text significantly longer.

This is also clearly stated in the current version.

[Editors’ note: what follows is the authors’ response to the second round of review.]

Essential revisions:

1) Resistance to parasitoid wasp

The authors provide an extremely important body of work. However, but the reviewers have a concern about the physiological significance of the phenotype. It is appropriate to hypothesize that an increase in lamellocyte production will yield a more potent immune response against parasitoids, as seen in other Drosophila species (i.e. D. suzukii). However, genetic perturbation that increase lamellocyte numbers, or perturbs the immune system in any manner, does not necessarily mean that the immune response mounted will be successful. The authors should provide experiments monitoring resistance to parasitoid wasps when the pathway they discovered is perturbated. There should monitor the impact of feeding larvae on WOF on resistance and how disturbing Or49A, Gat and Ssadh affect resistance to parasitoid wasp.

We thank the reviewers for their positive feedback on our manuscript.

The physiological significance of the increased lamellocyte phenotype on immune response mounted and whether it is successful or not has now been addressed by measuring the impact on wasp-egg encapsulation. This has been undertaken by assaying for: (1) encapsulation response (Vanha-aho Leena-Maija et al., 2015) and by measuring (2) percent melanization (Yang et al., 2015).

For percent melanization, individual infected Drosophila larvae (60+12HPI) were sorted under stereomicroscope according to the presence or absence of black capsules. Larvae without obvious black capsules were dissected to confirm whether they were infected. The number of larvae in the cohort that showed this melanization response was obtained as represented as the percetage larvae with melanization response to the total number of infected larvae (as described in Yang et al., 2015). The details of these assays have now been provided in the Materials and methods section.

Our results show that rearing Drosophila larvae on WOF (Figure 5A, B) or forced activation of Or49a (Or49a>TrpA1), (Figure 5R, S) that cause an increase in lamellocyte production, also show a significant increase in both encapsulation response (Figure 5T) and percent melanization (Figure 5—figure supplement 2A). Blocking the pathway, on the other hand in Dome>Gat^RNAi BL29422 and Dome>Ssadh^RNAi VDRC 106637KK (Figure 2P and Q), where a reduction in lamellocyte numbers was noticed, a dramatic reduction in encapsulation response and percent melanization is observed (Figure 5—figure supplement 2A-D). These results provide the physiological significance of the increased lamellocyte phenotype on effective wasp-egg clearance. Since encapsulation response of wasp-eggs requires concerted action of activated immune cells including plasmatocytes, crystal cells and lamellocytes (Dudzic et al., 2015, Anderl et al., 2016, Sorrentino et al., 2001), the implications of the overall improved encapsulation and melanization detected in WOF and Or49a >TrpA1 could also imply an improved repertoire of activated immune cells in addition to increasing lamellocyte numbers.

With the addition of this new data, the importance of olfaction in immune priming is further strengthened. We sincerely thank the reviewers for bringing this point and these data are discussed in Results section.

2) RNAi effectivity and using one line

The reviewers questioned the validity of the study as some results are based only one RNAi and their knockdown efficiencies were tested by using a ubiquitous and not in the actual tissues. They however recognize that the model is supported by the fact that they are testing different players affect the pathway. The reviewers however ask to repeat the experiments with Gat and Ssadh using another RNAi line to reinforce their conclusion.

We have now tested all RNAi lines available for both Gat and Ssadh in VDRC and Bloomington stock collection.

For Gat loss of function, we find that UAS-Gat^RNAi GD (VDRC), showed a significant reduction in lamellocyte formation. This is evident at 48HPI in circulating population. At 24HPI any change in the lymph gland is however not detected. For Ssadh, we find driving Ssadh^RNAi BL55683 and Ssadh ^RNAi 14751/GD both led to mild reduction in lamellocyte formation. In the lymph gland the changes are significant as opposed to in the circulation. The new lines gave weaker responses but the data show trends that are comparable to the lines previously used in the study UAS-Gat^RNAi BL29422 and UAS-Ssadh^RNAⁱ KK. These data are provided in the Figure 2—figure supplement 2A and B.

3) Sima staining

Figure 3: There are discrepancies in the Sima staining which put question into the specificity of this staining/back ground. For example, some LGs showed a punctate expression of Sima in the posterior part of the LG (Figure 3F,G and H which is not seem in the other LGs).

The posterior expression of Sima protein pointed out by the reviewer in lymph gland tissues refers to Sima expression seen in the cells of the PSC (negative for Domeless expression and positively marked with antennapedia, a bonafied PSC marker). This data is now shown in Figure 3—figure supplement 1A, B.

In conditions Figure 3F, G, and H pointed out by the reviewer, a reduction in Sima protein expression in the Dome+ cells of MZ is seen. Hence, the expression in PSC cells (lacking Dome expression) in these lymph glands becomes readily evident. We provide supporting images in Figure 3—figure supplement 1M-T’, showing Domeless expression in these lymph glands to make this distinction clear.

Pictures in Figure 3B, K and m are not in agreement with quantifications in 3O. The same comment holds for Figure 3F-L and quantifications in J.

We provide multiple images that have been utilized for these quantifications as supporting data for the quantifications. These figures are appended along with this response (Author response image 1A and Author response image 1B). We will be happy to add them as supplementary figures in the manuscript if need be. We have replaced the images in Figure 3G, I, L and M with better representative ones as well.

Author response image 1

Download asset Open asset

Expression of Sima in lamellocyte is also not convincing.

We now provide better representative images of lamellocytes at 12HPI and 24HPI to support Sima expression in lamellocytes. Data shown in Figure 3—figure supplement 1E-H. Compared to Sima protein levels seen in most cells of the lymph gland, its expression post-infection in Myospheroid positive cells is elevated albeit at different levels (Figure 3—figure supplement 1E-H). Some show very high expression, and some show moderately elevated Sima levels. This is seen both at 12HPI and 24HPI.

The specificity of the Sima antibody has to be checked.

The Sima antibody utilized in this study has been obtained from Prof. Utpal Banerjee’s lab where they have generated this antibody and confirmed its specificity in their own independent study (Wang et al., 2016). We also provide evidence to support its specificity in the lymph gland.

1) As reported earlier in Mukherjee et al., 2011, the Sima antibody used in this study shows comparable expression pattern in the lymph gland. We find basal Sima protein expression in all cells of the lymph gland with elevated expression detected in crystal cells (Figure 3A and Figure 3—figure supplement 1C-D’).

2) We have further confirmed the specificity of this antibody by staining for Sima protein in lymph glands expressing sima^RNAi (dome-MESO>UAS-sima^RNAi). We observe a significant reduction in Sima protein levels in this genetic condition. We provide this data in Figure 3—figure supplement 1V,V’ and Z.

Figure 3—figure supplement 1I is the difference in sima mRNA levels significant?

Yes, this is significant (***p<0.0001). P value added in Figure legend.

Overall, we have addressed all the above points raised regarding Sima protein expression pattern in the lymph gland, the specificity of Sima antibody and provide better representative images used for graphical representation of the data in Figure 3. More supporting images that comply with the Sima quantifications are provided along with this response to satisfy the concern with Sima quantifications (See Author response image and Author response image 2). If required, we will be happy to provide them as Figure supplements accompanying the main manuscript as well.

Author response image 2

Download asset Open asset

[Editors’ note: what follows is the authors’ response to the second round of review.]

Essential revisions:

1) The regulatory cascade that goes from iGAbA to Ldh (Figure 6, left part) is not fully established, since several epistasis experiments are still lacking.

For example, functional links in the lymph gland are not established between: (i) hph and sima, and more importantly between (ii) sima and Ldh and (iii) sima and iGABA. Epistasis experiments are lacking which precludes drawing in the model Figure 6 plain arrows representing functional connections.

One key point concerns Sima functions. In the model, Sima is acting downstream of iGABA and is required for lamellocyte differentiation in response to wasp parasitism (Figure 6, left part). Unfortunately, these regulations are not yet definitively established in the ms.

Why have authors not performed rescue experiments of DomeMESO>Gat RNAi or (Dome-MESO>Ssadh RNAi) of the mutant lymph gland phenotype by overexpressing Sima with the Dome-MESO gal4 driver? This is a key experiment that would establish whether Sima is the key payer downstream of iGaba.

Concerning the functional link between Sima and lamellocyte differentiation: Does the overexpression of Sima with the dome-MESO gal4 driver lead to a cellular immune response similar to the one observed in response to wasp infection? These are key questions that have to be addressed to sustain the model proposed in Figure 6.

We understand the concern raised by the reviewer regarding the epistatic relationship between iGABA, sima and Ldh. We have made attempts to conduct these epistasis experiments but have not been successful. This is mainly due to technical limitation posed by over-expression of sima or Ldh using progenitor drivers dome-MESO> or Tep4> drivers which lead to larval lethality. As an alternative approach we undertook GABA and succinate supplementation experiments in control animals and evaluated Sima function. These supplemented animals showed elevated Sima protein expression in progenitor cells and when infected made more lamellocytes. Expressing Sima^RNAi in progenitor cells, led to abrogation of the lamellocyte response seen with GABA or succinate supplementation. These data showed that GABA and Succinate mediated lamellocyte response is dependent on Sima function in progenitor cells. The data are shown in (Figure 4—figure supplement 1E). Although not conclusive the data are in agreement with our conclusions and we have now redone the model keeping in line with these concerns raised. We have used dotted lines to present the possibility of Sima and its metabolic function in lamellocyte differentiation as opposed to plain arrows representing functional connections.

Some experiments given in the manuscript for establishing functional links are irrelevant: this is the case of the epistasis experiment between oroc1 and Sima (via hph RNAi with the hml driver; sup Figure 4L-O). The hml-gal4 driver is not expressed at all in lymph gland progenitors where hph function is supposed to be required!

We have removed this figure. Our attempts to conduct the rescue of orco¹ mutants by expressing hph RNAi under the control of Hml^ΔGal4 were mainly undertaken to provide an epistatic relationship between olfaction and lamellocyte formation in blood cells of the lymph gland. Doing the same experiment with progenitor specific drivers was not successful, mainly due to the genetic combinations of fly strains that had limited success surviving and were often unhealthy and failed to propagate. Hence, we utilized Hml^ΔGal4 which is also a well-established lymph gland driver line, but yes as the reviewer points out it marks differentiating blood cells of the lymph gland. But using this driver as well we could recover lamellocyte formation in the lymph glands of orco¹ mutants. These data provided epistatic relationship of the systemic pathway in blood cells of the lymph gland and indicated that loss of Hph in Hml⁺ is also sufficient to restore their lamellocyte formation. But to minimize complexity, as suggested Figure 4—figure supplement 1L-O data are now eliminated.

2) Figure 6 (right panel) this representation is misleading and is not in agreement with the presented data. The proposed role for wasp odor for the immune response is not correct. Indeed, killing the Or49a neurons (wasp odor sensing neurons) has no impact on the immune response on larvae raised on RF (Figure 5). Thus, there is no need at all for these neurons to mount an immune response. Raising larvae on WOF leads only to an increase in the immune response that is dependent on Or49A neurons. Any conditions that lead to increased GABA levels (such as SF, GF,WOF) and even in the absence of wasp parasitism (since lamellocytes are detected in these conditions in the absence of parasitism) have the same consequence; i. e. a boost of the immune response. This data indicates that increasing GABA levels (by activating GABAnergic neurons) by different ways leads in all conditions to boosting the immune response.

We understand the point mentioned here and have now edited the model to mention “Boosting immune response”. We thank the reviewer for bringing this point to our attention.

3) Ca²⁺ levels in the lymph gland and their potential contribution to the immune response is unclear. What about Ca 2+ levels and requirement: (i) in response to wasp infection and (ii) in dome-MESO>gat RNAi conditions?

Ca²⁺ levels have been addressed and presented in the manuscript Figure 2—figure supplement 1P-R and Figure 2—figure supplement 3G, H.

pCamKII is calcium-calmodulin-dependent protein kinase II whose phosphorylation at Threonine286 is dependent on intracellular Ca²⁺ signaling (Miller et al., 1986). pCaMKII expression in the lymph gland progenitor cells has been shown to be responsive to GABA/GABA_BR mediated signaling whose function downstream of GABA_BR is necessary for progenitor maintenance (Shim et al., 2013). Hence, as readout of any change in progenitor Ca²⁺ signaling and GABA/GABA_BR signaling, pCamKII expression analysis in lymph gland progenitor cells was conducted.

In control animals in response to wasp infection (6HPI) we did not observe any change in pCamKII levels, and the levels remained comparable to un-infected controls. This data is shown in Figure 2—figure supplement 1P-R.

In dome-MESO>Gat^RNAi animals no change in pCamkII expression was detected and remained comparable to controls (Figure 2—figure supplement 3G, H). Based on this we concluded that the loss of lamellocyte differentiation in Gat^RNAi animals is most likely independent of progenitor Ca²⁺ signaling. Also consistent with this result, expression of GABA_BR^RNAi in progenitor cells, which has been shown to down-regulate progenitor intracellular Ca²⁺ levels (Shim et al., 2013) made lamellocyte formation. Hence, we understand that loss of Ca²⁺ may not impede lamellocyte formation but any definitive role for calcium signaling in infection response and lamellocyte development needs to be investigated more thoroughly and is best done as an independent study.

4) Figure 2—figure supplement 4 and Figure 4D-E, H-I controls are missing. This concerns Figure 4D and E; Figure 4H and I and Figure 2—figure supplement 4L.

The controls are provided in the figures. The graphs show rescue of lamellocyte phenotypes in Gat or Ssadh mutants, which lack succinate and orco¹ or Kurs6>Gad1RNAi conditions, which lack GABA and consequently succinate. When raised on succinate or GABA supplemented food, these mutants show rescue of lamellocytes formation comparable to controls raised on regular diet (Controls are indicated with red arrows in Author response image 3).

Author response image 3

Download asset Open asset

In response to wasp parasitism, do wild type larvae raised in SF or GF have increased lamellocyte differentiation compared to wt parasited larvae raised on RF?

This data is provided in the manuscript Figure 4—figure supplement 1E. Controls reared on SF or GF show increased lamellocyte differentiation.

5) Figure 2—figure supplement 3: Why are the authors looking at pCamKII ? What does this marker indicate?

As mentioned in the previous comment, pCaMKII expression in the lymph gland progenitor cells has been shown to be responsive to GABA/GABA_BR mediated signaling whose function downstream of GABA_BR is necessary for progenitor maintenance (Shim et al., 2013). Hence, as readout of any changes in progenitor Ca²⁺ signaling and GABA/GABA_BR signaling, pCamKII expression analysis in lymph gland progenitor cells was conducted.

6) Figure 2—figure supplement 3P: DomeMESO>gatRNAi , a decrease in iGABA is observed (Figure 2H) whereas no difference for pxn is measured. This is different from data given in Shim et al., 2013 where a decrease in GABA leads to increase Pxn? How can one reconcile these data?

Shim et al., 2013 established a role for extracellular GABA (eGABA) function as a ligand, which activates GABA_BR signaling in blood progenitors to sustain their intra-cellular calcium homeostasis necessary for their maintenance. Consequently, loss of GABA from the brain or GABA_BR signaling in blood progenitors led to increased differentiation (both Pxn and P1) with a subsequent loss of MZ (medullary zone) maintenance markers.

The current study delineates an intracellular function for GABA (iGABA), whose internalization via GABA transporter (Gat) and breakdown via Ssadh is necessary for priming blood progenitor cells to differentiate into lamellocytes. GABA uptake by progenitor cells via Gat and its catabolism drives lamellocyte differentiation, which is independent of GABA’s function as an extracellular ligand driving GABA_BR signaling. This is supported by Gat and Ssadh loss-of-function data that did not impede Ca²⁺ signaling in progenitor cells (supported by no change in pCamKII data shown in Figure 2—figure supplement 3G, H). Thus, progenitor GABA_BR signaling is intact and hence their maintenance is unperturbed.

We conclude that neuronally derived extracellular GABA has dual function during blood progenitor development. (A) As a ligand, binding and activation of eGABA to progenitor GABA_BR drives progenitor maintenance (Shim et al., 2013) and (B) eGABA internalization via Gat in progenitor cells and its breakdown establishes Sima protein expression essential for lamellocyte induction. We propose that the two pathways run parallel to each other and do not impede the functioning of each other. This is supported by data where Gat or Ssadh progenitor loss did not alter their GABA_BR signaling and similarly, loss of GABA_BR signaling in progenitor cells did not impede lamellocyte differentiation (Figure 2—figure supplement 1K and L) or Sima expression in progenitor cells (Figure 3—figure supplement 1P, P’ and Q) rather made more (Figure 2—figure supplement 1K).

7) Dome-MESO>sima RNAi: Subsection “Progenitor Sima protein stability via GABA-catabolism establishes lamellocyte Potential”: One cannot write that "plasmatocyte number is not affected" since quantifications are missing.

Now corrected.

8) Propositions for deleting some parts

– Figure 3—figure supplement 1M-T' are redundant with Figure 3.

These figures have now been removed.

– Data relative to tango: they are based on only one RNAi treatment and they are not essential. Thus, they could be removed.

We have removed the data.

– Figure 4A, B, C, F and G are not informative. Cells shown have a round shape and do not correspond to lamellocytes that have a characteristic elongated morphology.

These have now been removed.

– Figure 5—figure supplement 2G there is no reference of this Figure in the manuscript!

We have called this in Materials and method sections .

9) I have still comments on the writing as the article, which is difficult to follow even to quite close experts.

– The Abstract is difficult to understand:Here is a possible (suggested) Abstract based on your texts:

“Studies in different animal model systems have revealed the impact of odors on immune cells, However, any understanding on why and how odors control cellular immunity remained unclear. We find that Drosophila employ an olfactory/immune cross-talk to tune a specific cell type, the lamellocytes, from hematopoietic-progenitor cells. We show that neuronally released GABA derived upon olfactory stimulation, is utilized by blood-progenitor cells as a metabolite and through its catabolism, these cells stabilize Sima/HIFα protein in them. In blood-progenitor cells, Sima capacitates these cells with the ability to drive a metabolic state that is necessary for initiating lamellocyte differentiation. This systemic axis becomes relevant for larvae dwelling in wasp-infested environments where chances of infection are higher. By co-opting the olfactory route, the pre-conditioned animals elevate their systemic GABA levels leading to the up-regulation of blood-progenitor cell Sima expression. This elevates their immune-potential and primes them to respond rapidly when infected with parasitic wasps. The present work highlights the importance of the olfaction in immunity and shows how odor detection during animal development is utilized to establish a long-range axis in the control of immune-progenitor competency and priming.”

Introduction “innate competitiveness” consider rewriting this term.

We have incorporated this suggested abstract and edited the Introduction accordingly.

Introduction: The third paragraph does not fit well the flow of the text. Include this text after mentioning the link between odor and immunity.

This is done.

Introduction: consider shortened this part or move some part in the Abstract.

This is now done.

Introduction

Indicates that you are using Orco and provide background information or replace by an introductory sentence if the result is described below.

This is now edited.

Indicate that it is in the “lymph gland”.

Done.

Replace mutational analysis by “the use of mutations” or “the use of loss of function mutations”.

Done.

Subsection “Olfaction controls cellular immune response necessary to combat parasitic wasp Infections”: Explain what is PSC and why you look at PSC.

We have added it in Subsection “Olfaction controls cellular immune response necessary to combat parasitic wasp Infections”:.

Subsection “Progenitor Sima protein stability via GABA-catabolism establishes lamellocyte Potential”: Avoid to use a passive sentence form. It will be simpler to say. We next explored…. (this applies to many other parts of the text).

This is corrected.

Consider to add additional sub-sectioning in the results to facilitate the reading.

We have added subheadings.

Subsection “Pathogenic odors induce immune priming”, second paragraph: I could not understand the statements. Could you make it clearer?

This is now re-written as “in orco mutant animals the WOF immune benefit was completely diminished (Figure 5—figure supplement 1A). These data showed that the WOF induced immune priming was not restricted to specific genetic backgrounds and secondly, it was mediated by olfactory stimulation and not mediated by feeding or ingestion of wasp-odor components.”

The Discussion is far too long and should be divided by two.

We have shortened it.

https://doi.org/10.7554/eLife.60376.sa2

Article and author information

Author details

Sukanya Madhwal
1. Institute for Stem Cell Science and Regenerative Medicine (inStem), Bangalore, India
2. Manipal Academy of Higher Education, Manipal, India
Contribution
Conceptualization, Resources, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-9818-7576
Mingyu Shin

Department of Life Science, College of Natural Science, Hanyang University, Seoul, Republic of Korea

Contribution
Resources, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology

Competing interests
No competing interests declared
Ankita Kapoor
1. Institute for Stem Cell Science and Regenerative Medicine (inStem), Bangalore, India
2. Manipal Academy of Higher Education, Manipal, India
Contribution
Resources, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology

Competing interests
No competing interests declared
Manisha Goyal
1. Institute for Stem Cell Science and Regenerative Medicine (inStem), Bangalore, India
2. The University of Trans-Disciplinary Health Sciences & Technology (TDU), Bengaluru, India
Contribution
Resources, Data curation, Validation, Investigation, Visualization, Methodology, Writing - review and editing

Competing interests
No competing interests declared
Manish K Joshi

Institute for Stem Cell Science and Regenerative Medicine (inStem), Bangalore, India

Present address
Aix Marseille Université, CNRS, Institut de Biologie du Développement de Marseille (IBDM), Marseille, France

Contribution
Resources, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology

Competing interests
No competing interests declared
Pirzada Mujeeb Ur Rehman

Institute for Stem Cell Science and Regenerative Medicine (inStem), Bangalore, India

Present address
University of Cologne, CECAD-Cluster of Excellence, Köln, Germany

Contribution
Resources, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology

Competing interests
No competing interests declared
Kavan Gor

Institute for Stem Cell Science and Regenerative Medicine (inStem), Bangalore, India

Contribution
Data curation

Competing interests
No competing interests declared
Jiwon Shim
1. Department of Life Science, College of Natural Science, Hanyang University, Seoul, Republic of Korea
2. Research Institute for Natural Science, Hanyang University, Seoul, Republic of Korea
Contribution
Supervision, Funding acquisition, Investigation, Project administration

For correspondence
jshim@hanyang.ac.kr

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-2409-1130
Tina Mukherjee

Institute for Stem Cell Science and Regenerative Medicine (inStem), Bangalore, India

Contribution
Conceptualization, Resources, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing

For correspondence
tinam@instem.res.in

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-3776-5536

Funding

Department of Biotechnology , Ministry of Science and Technology (DBT/PR13446/COE/34/30/2015)

Tina Mukherjee

Department of Science and Technology, Ministry of Science and Technology (DST/ECR/2015/000390)

Tina Mukherjee

Department of Biotechnology , Ministry of Science and Technology (Ramalingaswami Fellowship)

Tina Mukherjee

DBT-The Innovative Young Biotechnologist Award (IYBA)2017 (000390DBT-IYBA 2017)

Tina Mukherjee

Centre Franco-Indien pour la Promotion de la Recherche Avancée (CEFIPRA)

Tina Mukherjee

National Research Foundation (NRF2014S1A2A2028388)

Jiwon Shim

National Research Foundation (NRF-2017R1C1B2007343)

Jiwon Shim

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank U Banerjee for Sima antibody, M Freeman for Gat antibody, Shannon Olsson for odor experiments, N Mortimer and T Schlenke for L.boulardi stock and FlyBase, VDRC (Austria), and BDSC for fly stocks, NCBS, CCAMP for their Fly facility, imaging, and metabolomics facilities. We thank Apurva Sarin and inStem colleagues for helpful discussion and comments on the manuscript. We specially acknowledge Varadharajan Sundaramurthy and Neeraja Subhash for imaging support in times with campus restrictions due to Covid-19 crisis. Due to space limitations, we apologize to our colleagues whose work is not cited. This study was supported by the DBT-Center of Excellence grant BT/PR13446/COE/34/30/2015, DST-ECR ECR/2015/000390, 000390DBT-IYBA 2017, CEFIPRA and DBT Ramalingaswami Re-entry Fellowship to TM and Basic Science Research Program through National Research Foundation (NRF-2014S1A2A2028388 and NRF-2017R1C1B2007343) to JS. SM is a Graduate Student at inStem, in the Tina Mukherjee lab.

Senior Editor

Anna Akhmanova, Utrecht University, Netherlands

Reviewing Editor

Bruno Lemaitre, École Polytechnique Fédérale de Lausanne, Switzerland

Reviewers

Tomas Dolezal
Balint Z Kacsoh, Geisel School of Medicine at Dartmouth, United States

Publication history

Received: June 26, 2020
Accepted: December 28, 2020
Accepted Manuscript published: December 29, 2020 (version 1)
Version of Record published: January 14, 2021 (version 2)

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.