Enhanced Cas12a multi-gene regulation using a CRISPR array separator

  1. Jens P Magnusson
  2. Antonio Ray Rios
  3. Lingling Wu
  4. Lei S Qi  Is a corresponding author
  1. Department of Bioengineering, Stanford University, United States
  2. Department of Chemical and Systems Biology, Stanford University, United States
  3. Stanford ChEM-H Institute, Stanford University, United States


The type V-A Cas12a protein can process its CRISPR array, a feature useful for multiplexed gene editing and regulation. However, CRISPR arrays often exhibit unpredictable performance due to interference between multiple guide RNA (gRNAs). Here, we report that Cas12a array performance is hypersensitive to the GC content of gRNA spacers, as high-GC spacers can impair activity of the downstream gRNA. We analyze naturally occurring CRISPR arrays and observe that natural repeats always contain an AT-rich fragment that separates gRNAs, which we term a CRISPR separator. Inspired by this observation, we design short, AT-rich synthetic separators (synSeparators) that successfully remove the disruptive effects between gRNAs. We further demonstrate enhanced simultaneous activation of seven endogenous genes in human cells using an array containing the synSeparator. These results elucidate a previously underexplored feature of natural CRISPR arrays and demonstrate how nature-inspired engineering solutions can improve multi-gene control in mammalian cells.


Precise control of cell identity and behavior will require the ability to regulate the expression of many genes simultaneously. Genes can be experimentally turned on or off using transcriptional activators or repressors attached to nuclease-deactivated Cas proteins (dCas) in technologies named CRISPRa and CRISPRi (Lo and Qi, 2017). When this Cas fusion protein is recruited to a target gene, guided by a CRISPR-associated guide RNA (gRNA for type V CRISPR Cas12, also known as CRISPR-RNAs [crRNAs] when expressed from their native loci) or a chimeric single-guide RNA (sgRNA for type II CRISPR Cas9), the target gene can be activated or repressed. While this technology works relatively well for controlling single genes, a central goal is to efficiently control more than a handful of genes at a time for applications in cell engineering.

In their native prokaryotic context, multiple crRNAs are encoded on a CRISPR array transcribed as a single, long transcript (Brouns et al., 2008; Zetsche et al., 2015; Figure 1A). Unlike the widely used Cas9, which requires a trans-activating crRNA (tracrRNA) and RNase III for maturation of its gRNA, Cas12a (also known as Cpf1) can process its own CRISPR array (Fonfara et al., 2016; Zetsche et al., 2015). Therefore, multi-gene control can be achieved experimentally with Cas12a (McCarty et al., 2020). This strategy has recently been used to edit or control the expression of multiple genes in human cells (Breinig et al., 2019; Campa et al., 2019; Kleinstiver et al., 2019; Tak et al., 2017; Zetsche et al., 2017). However, CRISPR arrays encoding multiple crRNAs often exhibit unpredictable performance for multi-gene regulation. Small-RNA-seq experiments suggest that array processing by Cas12a is uneven, such that the constituent processed gRNAs may differ 10- to 100-fold in abundance (Campa et al., 2019; Liao et al., 2019b). To reliably regulate many genes experimentally using this system, it will be crucial to optimize the performance of CRISPR arrays in mammalian cells and understand the principles governing CRISPR array processing.

Figure 1 with 1 supplement see all
gRNA performance is affected by the GC content of the upstream spacer.

(A) The CRISPR-Cas12a operon consists of Cas genes and a CRISPR array. (B) Each gRNA consists of a repeat and a spacer. Pre-processing repeats contain a ~16–18 nt fragment, here denoted CRISPR separator, which gets excised by Cas12a and an unknown enzyme. (C) The separator has previously been omitted when expressing Cas12a arrays in mammalian cells. We asked if the separator serves to insulate gRNAs from the negative influence of secondary structure in spacers. (D) We designed CRISPR arrays consisting of two gRNAs, the first with a non-targeting dummy spacer, and the second targeting the promoter of GFP, genomically integrated in HEK293T cells. (E) Experimental setup; Lb-dCas12a-miniVPR was used to activate GFP, and GFP fluorescence was analyzed as a measure of array performance. (F) CRISPR arrays can display hypersensitivity to the composition of the dummy spacer. In extreme cases, replacing the last nucleotide from T to G can lead to almost complete abrogation of GFP activation. (G) A library of 51 CRISPR arrays, each with a dummy spacer of different GC content. A strong negative correlation is seen between the GC content of the dummy spacer and GFP fluorescence. Each dot represents one of the 51 CRISPR arrays (average of three replicates). Arrays were divided into three groups based on the level of GFP fluorescence they enabled. Boxes indicate two groups that were analyzed in (I and J). (H–J) For each group, the average GC content of a sliding 5-nt window was calculated. The best-performing arrays were the ones where the dummy spacer happened to have low GC content at its 3’ end (H). Some arrays showed unexpectedly high or low GFP activity for the GC content of their dummy spacers (G). These arrays contain low (I) or high (J) GC content at the very 3’ end of their dummy spacers, suggesting that the GC content of the last few bases is an important predictor of array performance. Shaded regions in (H–J) represent standard error. (K) The predictive power of knowing the GC content of 3-nt regions in the dummy gRNA (Materials and methods). Merely knowing the GC content of the las three bases is more predictive than knowing the overall GC content. (L) A plot showing the relationship between GC content of the 51 dummy spacers and the secondary structures they are predicted to form with the GFP-targeting gRNA (the larger the value on the y-axis, the more stable the predicted secondary structure). (M) This predicted secondary structure formation is anticorrelated with performance of the GFP-targeting spacer, suggesting that strong secondary structures is what impedes array performance.

A gRNA consists of a repeat region, which is often identical for all gRNAs in the array, and a spacer (here used synonymously with ‘guide region’), which serves to guide the Cas12a protein to complementary double-stranded DNA (Figure 1B). In their natural bacterial setting, the full-length repeat sequence includes a short (~16–18 nt) fragment that gets excised and discarded during gRNA processing and maturation, leaving the final, processed gRNA to consist of a post-processing repeat and a spacer (Figure 1B). The excised repeat fragment, which we here denote a CRISPR separator, undergoes cleavage at its 3’ end by Cas12a itself, and at its 5’ end by an unknown bacterial enzyme (Swarts, 2019; Figure 1B). The separator is not strictly needed for array function and has no known role, as far as we are aware. Cas12a cannot excise the separator on its own, which means that it remains attached to the 3’ end of the upstream spacer in mammalian cells (Zetsche et al., 2017). For this reason, and because the separator has been seen as dispensable, the separator has been omitted when Cas12a arrays have been experimentally expressed in eukaryotic cells (Figure 1C; Campa et al., 2019; Kleinstiver et al., 2019; Tak et al., 2017; Zetsche et al., 2017). Yet, despite being under intense evolutionary pressure, the fact that Cas12a arrays from all known bacterial species retain the CRISPR separator suggests that it might have a biological function.

Here, we hypothesized that the separator plays a role in facilitating CRISPR array processing and that array performance is impaired in its absence. We find that gRNAs lacking the separator are highly sensitive to the content of guanine and cytosine (GC) nucleotides in the upstream spacer. Specifically, the higher the GC content of a spacer, the worse the downstream gRNA performs. We notice that the natural separator sequence is rich in adenine and thymine/uracil (AT/U) nucleotides, and we therefore surmised that the separator insulates neighboring gRNAs from one another. We design and insert a synthetic separator (synSeparator) consisting of four A/T nucleotides between each gRNA in a Cas12a CRISPR array; this allows more effective CRISPR activation of multiple endogenous genes in human cells. Based on these results, we conclude that the CRISPR separator found in natural Cas12a arrays acts as an insulator that reduces interference between adjacent gRNAs. These results show how natural systems can guide optimization of CRISPR-mediated synthetic multi-gene regulation.


gRNA performance is affected by the GC content of the upstream spacer

In bacteria-harboring CRISPR-Cas systems, new spacers are acquired from viral genomes and integrated into the CRISPR array. It is possible that some spacer sequences form RNA secondary structures that interfere with Cas12a processing of the array. RNA secondary structure is in fact known to impede Cas protein binding and processing in similar contexts. For example, Cas12a function is sensitive to hairpin formation downstream of the CRISPR array (Liao et al., 2019a), and gRNA processing is impaired by base-pairing of the repeat with regions outside the gRNA (Creutzburg et al., 2020). Global RNA structure of the CRISPR array may negatively affect both gRNA processing and performance (Liao et al., 2019b). Similarly, the RNA-guided, RNA-cleaving protein Cas13 can also be negatively affected by gRNA secondary structure (Abudayyeh et al., 2016; Yan et al., 2018). It is therefore theoretically plausible that local secondary structure within the transcribed CRISPR array could interfere with array processing (Figure 1C). One feature that promotes RNA secondary structure formation is high GC content (Chan et al., 2009) because G-C base pairs contain three hydrogen bonds, compared to A-U’s two hydrogen bonds. We first tested whether the GC content of a spacer could affect performance of a downstream gRNA.

To do this, we first developed a method for assembling CRISPR arrays using oligonucleotide hybridization and ligation, with which we could assemble CRISPR arrays containing up to 30 gRNAs (Materials and methods). We used this method to assemble a simple Cas12a array consisting of two consecutive gRNAs whose repeat regions did not contain the separator sequence (Figure 1D). In this array, the second gRNA’s spacer was complementary to the promoter of GFP, which had been genomically integrated into HEK293T cells (Figure 1E). The first gRNA’s spacer instead consisted of a non-targeting sequence, which we could alter to study its effect on GFP activation. We refer to this sequence as a dummy spacer.

To study the consequences of varying the dummy spacer, we transfected the HEK293T cells with constructs encoding the CRISPR array and nuclease-deactivated Cas12a (from Lachnospiraceae bacterium) fused to the miniaturized VP64-p65-Rta (mini-VPR) tripartite activator and mCherry (subsequently denoted dCas12a-miniVPR) (Vora et al., 2018). If the dummy spacer did not influence the performance of the downstream gRNA, we should see equal GFP activation in all experiments. If, on the other hand, the dummy spacer affected the performance of the downstream spacer, we would measure differences in GFP fluorescence. Surprisingly, we found that the CRISPR array sometimes displayed hypersensitivity to the composition of the dummy spacer: In extreme cases, a single nucleotide change from T to G led to almost complete abrogation of GFP activation in transfected cells (Figure 1F, Materials and methods).

We asked how such hypersensitivity could come about. We generated a library of 51 CRISPR arrays containing one dummy spacer with varying GC content (10–90%), and one GFP-targeting spacer that was identical in all arrays. Forty-eight hours after transfection, we analyzed cells by flow cytometry and quantified GFP fluorescence as a measure of array performance. Intriguingly, we observed a strong negative correlation between the GC content of the dummy spacer and GFP activation (Figure 1G, Figure 1—figure supplement 1A; the percentage of GFP+ cells was a more sensitive measure of array performance than median GFP fluorescence, Figure 1—figure supplement 1B). This indicated that spacers can exert a strong influence on the performance of the downstream gRNA.

Since these dummy spacers were random sequences, we asked whether the distribution of GC content within these spacers mattered for their effect on the downstream gRNA. We first divided all the dummy spacers into three groups based on whether they enabled high, medium, or low GFP activation (Figure 1G). For each dummy spacer, we calculated the GC content of a sliding 5-nt window (Figure 1H; Materials and methods). Interestingly, this analysis showed that ‘permissive’ dummy spacers had relatively low GC content at the 3’ end, close to the Cas12a cleavage site. In contrast, non-permissive dummy spacers had slightly higher GC content at the 3’ end. Dummy spacers that enabled medium-level GFP activation had quite high overall GC content but lower GC content close to the 3’ end. This suggested that the GC content of the spacer’s last few bases, close to the Cas12a cleavage site, might be a more important determinant than the overall GC content of a spacer.

Surprisingly, dummy spacers in the 50–90% GC range exhibited a wide range of GFP activation, some enabling unexpectedly high GFP activation and others unexpectedly low (Figure 1G). We analyzed the sliding GC content specifically of these spacers and found that unexpectedly permissive dummy spacers showed an even stronger trend toward low GC content at the 3’ end (Figure 1I). In contrast, unexpectedly non-permissive dummy spacers had high GC content at the 3’ end (Figure 1J). Thus, even if a dummy spacer had high GC content, it could still allow efficient performance of the GFP-targeting gRNA if GC content in the last 3–5 bases was low, and vice versa.

GC content of the entire dummy spacer was moderately predictive of GFP activation (R2 = 0.45; Figure 1K; Materials and methods). However, we found that simply knowing the average GC content of the last three nucleotides in the dummy spacer allowed slightly better predictive power than knowing the GC content of the whole dummy spacer (R2 = 0.52; Figure 1K). The GC content of these last three bases was more predictive of array performance than that of any other three bases in the dummy spacer (Figure 1K). These results indicated that high GC content at the 3’ end of a spacer impairs performance of the subsequent gRNA.

GC content is a determinant of secondary structure formation. Such secondary structures might interfere with proper folding of the GFP-targeting gRNA. We used the online tool RNAfold (Lorenz et al., 2011) to calculate secondary structure formation for the library of 51 dummy spacers with the GFP-targeting gRNA. To quantify the propensity to form secondary structures, we used the calculated free energy of the thermodynamic ensemble, a measure of the stability of the set of structures adopted by an RNA molecule. We indeed found a strong positive correlation between GC content and predicted secondary structure formation (R2 = 0.66; Figure 1L). Accordingly, there was a corresponding anticorrelation between predicted RNA structure and array performance. This anticorrelation was strongest when both the dummy spacer and the subsequent GFP-targeting gRNA were used as input to RNAfold (R2 = 0.57; Figure 1M) rather than only the dummy spacer (R2 = 0.27; Figure 1—figure supplement 1C). This suggested that high-GC spacers may form secondary structures that are particularly disruptive if they directly involve the downstream gRNA. Taken together, these results suggest that high GC content in spacers can lead to secondary structure formation, which may interfere with proper folding and processing of the CRISPR array transcript.

Natural CRISPR arrays contain separator sequences with low GC content

We next asked whether bacteria have evolved mechanisms to preferentially incorporate low-GC spacers into their CRISPR arrays to overcome the hypersensitivity to spacer GC content. After all, it could be detrimental to a bacterium if it accidentally incorporated a high-GC spacer that lowered the performance of a pre-existing gRNA. To address this question, we analyzed 727 naturally occurring Cas12a spacer sequences from 30 bacterial species containing the Type V-A CRISPR (Supplementary file 2; Materials and methods). However, we did not find any conspicuous absence of GC-rich spacers: Spacer GC content was distributed around an average of 39%, with a range of 10–70% (Figure 2A), though spacer GC content did vary between species and was weakly correlated with the overall genomic GC content (R2 = 0.16; Figure 2—figure supplement 1A). These results were true also for L. bacterium, the species from which our Cas12a variant is derived, and for the commonly used Acidaminococcus sp. and Francisella tularensis subsp. novicida (Figure 2A). Neither did we find that GC content was lower at the 3’ end of these spacers (Figure 2B; Materials and methods). We therefore wondered how natural CRISPR arrays cope with high-GC spacers.

Figure 2 with 1 supplement see all
Natural CRISPR arrays contain separator sequences with low GC content.

(A) The GC content of naturally occurring CRISPR-Cas12a spacers display no obvious depletion of high-GC spacers (though spacer GC content is weakly correlated with overall genomic GC content, Figure 2—figure supplement 1A). Spacers from commonly used Cas12a variants (Lb, As, Fn) are highlighted in color. (B) Neither do these spacers show low GC content at their 3’ ends. But the separator sequences of these gRNAs have low GC content. (C) This is seen also in a multiple-sequence alignment of 79 natural separator sequences, which suggests that one purpose of the CRISPR separator is to act as an insulator between adjacent gRNAs in a Cas12a CRISPR array.

In naturally occurring CRISPR arrays, the separator sequence gets excised through the action of Cas12a and an unknown enzyme (Figure 1B; Zetsche et al., 2015). We asked whether the separator might act as an insulator that protects every gRNA from disturbances caused by the secondary structure in upstream spacers. We analyzed 79 unique separator sequences from 30 bacterial species (Supplementary file 2; Materials and methods). Overall, these separators showed little sequence conservation (Figure 2C, Figure 2—figure supplement 1B), except for a moderately conserved region at the very 5’ end (GTYTA). This conserved region possibly acts as a recognition motif for the unknown enzyme responsible for cleaving the separator at the 5’ end. However, we did detect a strong bias for low GC content in the 79 separator sequences (Figure 2B–C). This opened the possibility that in natural CRISPR arrays, the separator aids CRISPR array processing by providing an AT-rich sequence that maximizes Cas12a accessibility to its cleavage site.

Like Cas12a, the type VI CRISPR RNA-cleaving enzyme Cas13d can also process its own gRNA (Konermann et al., 2018; Yan et al., 2018; Zhang et al., 2018; Zhang et al., 2019), an ability that makes Cas13d attractive for multi-gene regulation on the RNA level (Figure 2—figure supplement 1C). We similarly analyzed the 6-nt CRISPR separator from 12 bacterial species containing Cas13d arrays (Supplementary file 2; Materials and methods). We found a strong bias for low GC content here as well, particularly at the 3’ end of the separator, close to the Cas13d cleavage site (Figure 2—figure supplement 1C). This suggests that sensitivity to spacer GC content is a factor that has shaped the evolution of multiple CRISPR-Cas systems.

A synthetic separator improves CRISPR array performance in human cells

We asked whether Cas12a CRISPR arrays would show improved performance in human cells if they included the natural CRISPR separator between each gRNA. To test this, we designed CRISPR arrays where the first gRNA contained a dummy spacer (30% GC content) and the second a GFP-targeting spacer, with and without the natural, 16-nt separator from L. bacterium preceding each repeat (Figure 3A; Materials and methods). Including this separator, however, almost completely abolished the array’s function, as almost no GFP activation was seen in the transfected cells (Figure 3B). This is consistent with a previous study that reported poor performance of gRNAs containing the pre-processed Cas12a repeat downstream of the gRNA of interest, which contains the separator (Liu et al., 2019), and is why previous designs have completely excluded any separator sequence. One possible reason is that the long separator remains attached at the 3’ end of each spacer because Cas12a cannot fully excise it (Zetsche et al., 2015; Zetsche et al., 2017), which might interfere with Cas12a function, as has been shown previously (Nguyen et al., 2020).

Figure 3 with 1 supplement see all
A synthetic separator improves CRISPR array performance in human cells.

(A) A diagram showing how we introduced either the full, 16-nt separator sequence from L. bacterium or a short 1–4 nt synthetic separator (synSeparator) between each gRNA in the CRISPR array. (B) The full, 16-nt separator sequence almost completely eliminates GFP activation. (C) Diagram showing inclusion of synSeparator sequences from the 3’ end of the L. bacterium in the CRISPR array. Each array contained a synthetic separator (G, T, AT, AAT, or AAAT) upstream of every repeat. The GC content of the dummy spacer was 30%, 50%, or 70%. The most non-permissive 50%- and 70%-GC spacers from Figure 1G were used. (D) AT-rich synSeparators improve GFP activation compared with a single G nucleotide. (E, F) This effect is caused by the separator upstream of the GFP-targeting gRNA: Adding the synSeparator only downstream of the GFP-targeting gRNA leads to no improvement. This suggests that the separator acts by improving gRNA processing rather than by generating a 3’ AAAT overhang on the GFP-targeting spacer itself. (G) RNA secondary structure prediction of two of the most disruptive dummy spacers (50% and 70% GC) together with the subsequent GFP-targeting gRNA. (H) This suggests that these spacers form secondary structures that involve the GFP-targeting spacer. Both the natural L. bacterium separator and the AAAT synSeparator are predicted to break up these structures or form protrusions that may facilitate Cas12a access to its cleavage site. (I) SynSeparators derived from other bacterial species (see Figure 2C) can rescue poor GFP activation caused by a non-permissive dummy spacer (70% GC) in a CRISPR array (array design as in A). (J) The enhanced Cas12a protein from A. species (Kleinstiver et al., 2019) is also sensitive to GC content of a dummy spacer (array design as in A) and its performance can be rescued using a TTTT synSeparator derived from its natural separator.

We instead asked if we could incorporate only a portion of the separator and still retain its insulating function. We generated CRISPR arrays in which all gRNAs were preceded either by 1–4 A/T nucleotides from the natural L. bacterium separator or by a single G as a control (Figure 3A,C). We generated three versions of each array, where the GC content of the dummy spacer was 3%, 50%, or 70%. (We used the 50% and 70% spacers that had resulted in the lowest level of GFP activation in Figure 1G; Supplementary file 3.) Interestingly, addition of an AT-rich synthetic separator improved the performance of the CRISPR array in all cases (Figure 3D), suggesting that a very short, AT-rich synthetic separator was sufficient to counteract the interference between gRNAs. We denoted this new sequence a synSeparator for synthetic separator.

Guide-RNA performance can be increased by adding RNA extensions to the 3’ end of the gRNA’s spacer (Creutzburg et al., 2020; Kocak et al., 2019; Nguyen et al., 2020). We asked whether the increased GFP activation we observed with the AAAT synSeparator was attributable to the AAAT extension added to the 3’ end of the GFP-targeting spacer, rather than by the AAAT separating the two gRNAs in this array. We made four variants of this array where we changed the position of the G or AAAT separators (Figure 3E). We observed activated GFP expression with variant 2 but not with variant 3 (Figure 3F), supporting the hypothesis that the synSeparator exerts its main effect by facilitating gRNA insulation and processing. We did observe a small additional increase in effectiveness using variant 4 compared to variant 2. This can either be attributed to improved insulation and processing at the 3’ end of the GFP spacer itself (which has 45% GC content) or to increased performance of the GFP-targeting spacer due to the 3’ AAAT extension on this spacer.

We surmised that computational prediction of RNA structure might yield insights into the mechanism by which the CRISPR separator facilitates gRNA processing. We used RNAfold to analyze two of the worst-performing dummy spacers from Figure 1G (50% and 70% GC) (Figure 3G). This analysis suggested that these spacers form secondary structures that involve the GFP-targeting gRNA and additionally restrict Cas12a’s access to its cleavage site (Figure 3H). Interestingly, addition of the AT-rich natural separator, or the synSeparator, appeared to loosen up these structures or create an accessible bulge at the Cas12a cleavage site (Figure 3H). This suggested that, for spacers prone to forming obstructive secondary structures, AT-rich separators give Cas12a improved access to its cleavage site.

We asked whether the GFP-targeting gRNA would be most sensitive to secondary structures that form exclusively within the dummy spacer or to structures that also involve the repeat region of the GFP-targeting gRNA. To address this question, we generated several variants of a short CRISPR array guided by RNAfold secondary structure prediction, where we gradually mutated the dummy spacer to form secondary structures that were either limited to the dummy spacer or that competed with the natural pseudoknot structure in the GFP-gRNA’s repeat region (Figure 3—figure supplement 1A, Supplementary file 1). Results showed that, as the predicted extent of base-pairing increased, CRISPRa performance gradually worsened (Figure 3—figure supplement 1B). Interestingly, this happened both when the secondary structure was limited to the dummy spacer and when it involved the GFP-targeting gRNA’s repeat region. This indicated that CRISPR array performance is sensitive to both kinds of disruption. We then included the AAAT synSeparator to these worst-performing arrays and found that this rescued CRISPRa performance in both cases (Figure 3—figure supplement 1B), suggesting that the separator acts both by physically insulating gRNAs from each other and by breaking up secondary structures that involve two consecutive gRNAs.

Although natural CRISPR-separators are all AT-rich, they show little sequence conservation. We asked whether synSeparators derived from other species than L. bacterium would be equally effective at rescuing poor-performing arrays. We generated short CRISPR arrays containing one of the worst-performing dummy spacers (70% GC; Figure 3A) and included 4-nt synSeparators derived from the 3’ ends of other natural separators (Figure 3I; compare Figure 2C). Indeed, all these synSeparators improved performance of the GFP-targeting gRNA (Figure 3I), indicating that the effect was not sequence specific to the AAAT synSeparator.

Next, we asked whether Cas12a variants from other species than L. bacterium are also sensitive to spacer GC content. We used the previously engineered nuclease-deactivated, enhanced Cas12a from A. species (denAsCas12a) (Kleinstiver et al., 2019) and designed short CRISPR arrays (Figure 3A) containing two of the worst-performing dummy spacers (50% and 70% GC), the natural, post-processing repeat region of A. species, and a synSeparator derived from the natural A. species separator (TTTT) (Supplementary file 2). Indeed, denAsCas12a was also sensitive to spacer GC content, and its performance was improved by the TTTT synSeparator (Figure 3J), indicating that sensitivity to spacer GC content is not limited to LbCas12a.

It is conceivable that a CRISPR array transcript can assume global secondary structures, in which case a gRNA’s position within the array might affect its performance depending on the structure of surrounding regions. Indeed, such a positional effect has been observed in E. coli (Liao et al., 2019b). To test whether we would observe such a positional effect, we designed four CRISPR arrays consisting of one GFP-targeting spacer and three dummy spacers (30–33% GC; Supplementary file 4), where the GFP-targeting spacer was in a different position in each array (Figure 3—figure supplement 1C). We made sure that the GFP-targeting gRNA would be preceded by the same dummy gRNA in as many arrays as possible, as different dummy gRNAs may have different propensities to generate secondary structures immediately upstream of the GFP-targeting gRNA. The synSeparator was not included for this experiment. We observed no difference in GFP activation between any of the four arrays (Figure 3—figure supplement 1D). This indicates that position within a CRISPR array is not necessarily an important determinant of gRNA performance but may become important when the CRISPR array assumes tight secondary structures within a specific region as observed in Liao et al.

The synSeparator improves CRISPR array processing

We hypothesized that the synSeparator improves array performance by facilitating Cas12a processing and performed an in vitro cleavage assay to test this hypothesis. Using in vitro transcription, we generated RNA transcripts of one of the worst-performing two-gRNA arrays containing a 70% GC dummy spacer (see Figure 3A,D), either with or without the AAAT synSeparator upstream of each Cas12a cleavage site (Figure 4A, Supplementary file 4). We incubated this array with Lb-Cas12a protein for different amounts of time (2, 5, 10, 30, and 60 min) and analyzed the cleavage products on a Bioanalyzer (Materials and methods). The resulting electropherograms (Figure 4B–D) were normalized based on RNA amount to make the results quantitatively comparable across biological replicates. The results showed that array processing occurred both in the presence and absence of the synSeparator but that it was more efficient with the synSeparator. As Cas12a incubation proceeded for longer times, more single gRNAs were excised (41/42 nt and 45/46 nt in length without and with the AAAT synSeparator, respectively; Figure 4B,C; see Figure 4—figure supplement 1 for each point plotted separately), but at all time points more single gRNAs had been processed from the array containing the synSeparator (Figure 4E; see Materials and methods for calculations). Though the exact numbers may not correspond to what would be seen inside living cells, these results indicate that the synSeparator improves Cas12a processing efficiency of CRISPR arrays.

Figure 4 with 1 supplement see all
The synSeparator improves CRISPR array processing.

(A) In vitro-transcribed CRISPR arrays containing one of the worst-performing dummy spacers (70% GC), either with or without the AAAT synSeparator upstream of each Cas12a cleavage site. (B, C) Representative Bioanalyzer electropherograms show how both CRISPR arrays become more fully processed with longer Cas12a incubation times (Asterisks highlight specific cleavage products. Note the 25-nt RNA marker, which is not part of the CRISPR array, and how its peak height varies due to sample normalization. See Figure 4—figure supplement 1 for separate plots). However, the synSeparator-containing array is processed more efficiently, seen clearly after a 10 min incubation (D; note that the synSeparator remains attached to the gRNA and slightly increases its length). Bioanalyzer peak data were used to calculate how much of the maximum possible processing had occurred at different time points (E; calculations presented in Materials and methods; n = 3 replicates for each time point). For reference, a gray dotted line shows how much processing had occurred in a CRISPR array containing a 30%-GC dummy spacer and no synSeparator after a 60 min incubation (n = 5 replicates). AU, arbitrary units. Error bars and the gray area in (E) indicate standard deviation.

The synthetic separator improves multiplexed gene activation in human cells

We next tested if the addition of the synSeparator would improve CRISPR activation of endogenous genes when gRNAs were expressed in a CRISPR array. We transfected HEK293T cells (Figure 1E) with one of two CRISPR arrays containing seven gRNAs (Figure 5A), one array with and one array without the AAAT synSeparator between each gRNA. Each gRNA targeted the promoter of a different gene for activation. We co-transfected a dCas12a activator containing full-length VPR (Chavez et al., 2015). Target genes included both protein-coding genes (CD9, IFNG, EGFR, TMEM107, GFP) and long non-coding RNAs (IMPACT, DANCR) (Supplementary file 3; Materials and methods). The seven target genes differed in their baseline expression levels in HEK293T cells (Figure 5B). We analyzed target gene levels using RT-qPCR on bulk-RNA isolates and did not sort transfected cells based on uptake of the Cas12a or CRISPR array plasmids.

The synthetic separator improves multiplexed gene activation in human cells.

(A) We designed a 7-gRNA array to activate seven endogenous/reporter genes in HEK293T cells with and without the AAAT synSeparator between each gRNA. (B) For all target genes, the synSeparator improves target gene activation level, as measured by RT-qPCR. Arrows indicate the expression fold-change achieved with the synSeparator compared to mock transfection (black values) or the CRISPR array not containing the synSeparator (green values). (C) Plot showing that the improvement of CRISPR activation is consistent across genes. (D) This improvement is also seen on the protein level for the target gene GFP, as measured by GFP fluorescence and percent GFP-positive cells.

Including the synSeparator increased activation levels of all target genes compared to the array without the synSeparator (Figure 5B). The improvement effect varied, ranging from 1.1-fold to 8.0-fold, but was consistent across all target genes (Figure 5C). The increase was also seen on the protein level, which we could analyze for GFP via flow cytometry (Figure 5D). These results indicate that addition of a short, AT-rich sequence between gRNAs in a Cas12a CRISPR array can improve multi-gene activation in HEK293T cells.


In this study, we found that Cas12a CRISPR arrays are sensitive to spacer GC content (Figure 1G). Specifically, high GC content at the 3’ end of a spacer leads to poor performance of the downstream gRNA (Figure 1H–K). This is likely caused by secondary structures (Figure 1M) that are either restricted to a single gRNA or involve two consecutive gRNAs (Figure 3—figure supplement 1A,B). CRISPR arrays containing such disruptive gRNAs are processed inefficiently by Cas12a (Figure 4B–E), which likely explains their poor performance. However, AT-rich separator sequences, even short, 4-nt sequences, can break up such secondary structures and give Cas12a access to its cleavage site (Figure 3H), improving CRISPR array performance (Figure 3D–J). Consequently, including short synSeparators between the gRNAs in a Cas12a array is a simple way to improve CRISPRa performance in human cells (Figure 5).

Considerations for activation of endogenous genes

We note that the improvement afforded by the synSeparator was not as large for the endogenous genes as for our experimental system with the worst-performing dummy spacers. We speculate that this may be for either of two reasons. First, for the CRISPR arrays in Figure 5, we used spacers that were either derived from previously published studies or had been pre-tested in our lab. All these spacers likely represent the best of several tested spacers and had thus already been shown to work even in the absence of a synSeparator. We did not necessarily select them for being GC-rich or prone to secondary structure formation. Therefore, researchers may experience the greatest benefit from the synSeparator with spacers that have not already proved functional without the synSeparator. Second, our clonal HEK293T cell line likely carries several copies of the GFP gene in its genome, each of which has seven protospacers in its TRE3G promoter. This multitude of Cas12a binding sites may serve to amplify the CRISPRa effect compared to endogenous genes, which only have two Cas12a binding sites, one in each copy of the gene (though the aneuploid HEK293T cells may have more).

One limitation of our study was that we only investigated the performance of the synSeparator in HEK293T cells and not other cell types. HEK293T cells are easy to transfect and readily express a large protein like dCas12a-VPR-mCherry (>6 kb). We nevertheless hypothesize that the negative influence of high-GC spacers and the insulating effect of synSeparators are generalizable across cell types. That is because we could observe these effects even in the cell-free context of an in vitro expression system (Figure 4). This suggests that the sensitivity to spacer GC content is determined only by the interaction between Cas12a and the array, rather than being dependent on a particular cellular context. We surmise that the synSeparator will be most beneficial in cells that can readily express a dCas12a activator and preferentially for high-GC spacers that have not already been shown to work even without a synSeparator.

GFP as readout of CRISPR array performance

We used an experimental system where GFP fluorescence served as a readout of CRISPR array performance. In this system, the percentage of GFP+ cells was a more sensitive measure of array performance than median GFP fluorescence (Figure 1G, Figure 1—figure supplement 1). Even low levels of GFP transcription leads to bright GFP fluorescence. We used a relatively weak Cas12a activator (Lb-dCas12a driven by the PGK promoter, with mini-VPR rather than full-length VPR), where the percentage of GFP+ cells rarely exceeded 20. This was deliberate; the combination of a weak Cas activator and a GFP-percentage readout was ideal for measuring small differences in CRISPR array performance. We speculate that in cases where a very strong Cas activator is used (where most cells activate GFP), median GFP fluorescence may be a better measure.

Suggested mechanism of action for the synSeparator

In our experiments, including the full 16-nt separator from L. bacterium in a CRISPR array led to an almost complete failure to activate the target gene (Figure 3B). At face value, this would seem to contrast with previous studies that reported efficacious CRISPR editing even when including the separator (Liu et al., 2019; Zetsche et al., 2017). But we think these data actually support our findings. First, in Liu et al., the pre-processed repeat (including the separator) shows improved performance if it is positioned upstream of the gRNA. If one such repeat was additionally placed downstream of the gRNA, this construct performed the worst of all tested constructs. This is consistent with our conclusion that the full-length separator reduces performance of gRNAs when present in CRISPR arrays in mammalian cells. Second, our array in Figure 3B is not entirely non-functional. Re-running the same experiment with a stronger Cas12a-activator (Cas12a-VPR; also used in Figure 5) shows some GFP activation even with the full separator (1.4% vs 20.8% GFP+ cells). But for consistency, we have used the same, slightly less effective, Cas12a activator (dCas12a-miniVPR) for all GFP-targeting experiments. Third, both the Liu et al. and Zetsche et al. studies used CRISPR editing rather than CRISPRa. We speculate that this might explain the relatively high indel frequency: Only a single cleavage event needs to take place for an indel to occur, whereas gene activation presumably requires the Cas12a activator to be present on the promoter for extended periods of time.

We found that the AAAT synSeparator improves the ability of Cas12a to process a poor-performing CRISPR array containing a 70%-GC dummy spacer (Figure 4). This result supports our observations that spacer GC content is correlated with predicted secondary structure formation (Figure 1L) and that GC content close to the Cas12a cleavage site is particularly predictive of the performance of the downstream gRNA (Figure 1K). Furthermore, previous data show that Cas12a processing is sensitive to RNA secondary structure (Creutzburg et al., 2020). Thus, it is likely that the synSeparator improves performance of CRISPR arrays in vivo by increasing Cas12a processing efficiency. In our Cas12a cleavage assay, we observed that array processing still occurred even without the synSeparator, though it was less efficient than with the synSeparator. These experimental conditions do not necessarily reflect the situation inside living cells. For example, we used an excess of Cas12a protein (16:1 Cas12a:array ratio), which may not be the case inside cells. Furthermore, our in vitro conditions in principle allow the reaction to proceed to completion (even though the reaction appears to slow down after 30 min, possibly due to the lower concentration of available Cas12a molecules as more and more Cas12a molecules become sequestered by their RNA cleavage products and unavailable to participate in further processing events). This may not be true in a living eukaryotic cell, where RNA turnover may constantly remove partially processed CRISPR arrays. Under these conditions, slow processing kinetics may serve to prevent the complete processing of gRNAs.

One additional possible mechanism for how the synSeparator improves CRISPR array performance could be that the synSeparator improves the GFP-targeting spacer itself rather than facilitating gRNA processing. In other words, that it is the synSeparator downstream of the GFP-targeting spacer, rather than the one upstream, that improves performance by remaining attached to the post-processed GFP-targeting spacer. This would be in line with studies showing that gRNA performance can be improved by RNA 3’ spacer extensions (Creutzburg et al., 2020; Kocak et al., 2019; Nguyen et al., 2020). However, our results demonstrate that the synSeparator exerts its beneficial effect before or during gRNA processing, rather than by modifying the 3’ end of the post-processed GFP-targeting spacer itself (Figure 3F; version 2 vs. version 3; Figure 4). In addition, RNA secondary structure prediction (RNAfold) did not indicate that the GFP-targeting spacer would fold back on itself when an AAAT extension is added to the 3’ end, which would have been the case for the mechanism demonstrated by Creutzburg et al. (data not shown). Although we cannot exclude that a 3’ extension to the GFP-targeting gRNA itself contributes to gRNA efficacy (Figure 3F, version 3 vs. version 4), such an effect would be marginal.

A competing explanation for the synSeparator’s function could be that the natural and synthetic separators provide a specific sequence motif that aids Cas12a binding and/or processing rather than counteracting secondary structure formation. However, natural separators contain no conserved sequence close to Cas12a’s binding site that could act as such a binding motif (Figure 2C). And we found that different synSeparators can rescue poor array performance (Figure 3I). Thus, this possibility is unlikely.

It is conceivable that our introduction of AAAT synSeparators could introduce polyadenylation sites (e.g., AATAAA, ATTAAA, AGTAAA, etc.) (Beaudoing et al., 2000), which could prematurely terminate the transcript and reduce CRISPRa activity. However, we analyzed all sequences and found that this was not the case. In any case, polyadenylation sites are AT-rich, so if this was an issue, AT-rich dummy spacers would be expected to perform worse than GC-rich ones, which is the opposite of what was observed (Figure 1G).

Generalizability and outlook

We found that the beneficial effect of adding an AT-rich synSeparator was not limited to the AAAT sequence derived from the natural separator of L. bacterium; three other AT-rich synSeparators also rescued the detrimental effects of a high-GC upstream spacer, though with various efficacy (Figure 3I). We speculate that the quantitative difference between the synSeparators could either be due to intrinsic insulation capacity of these sequences or the way they interact with Lb-Cas12a, or sequence-specific interactions with this particular CRISPR array.

It is informative to compare the separator of Cas12a with that of Cas13d. Cas13d’s pre-processed repeat also contains an AT-rich separator sequence. Like Cas12a, Cas13d itself can only cleave the 3’ end of its separator (Yan et al., 2018). But Cas13d gRNAs nonetheless perform well in mammalian cells despite the separator remaining attached to the spacer. Perhaps this is because the Cas13d separator is only six nt long, in contrast to Cas12a’s 16–18 nt. A recent study found that the performance of Cas12a gRNAs starts to drop if RNA sequences > 13 nt long are attached to the 3’ end of the spacer (Nguyen et al., 2020), consistent with this hypothesis.

As a biotechnology, improvement of simultaneous gene targeting is beneficial to several applications. In this work, we demonstrated improvement of endogenous gene activation using the redesigned CRISPR array containing the synthetic separator, but it is possible that the same design can be used for multiplexed gene editing and base editing using the Cas12a system. Furthermore, because CRISPR-mediated multi-gene activation has been increasingly used for stem cell reprogramming and large-scale genetic screening (Replogle et al., 2020; Weltner et al., 2018), our method will further enhance these emerging applications. Taken together, the results from our study suggest that the CRISPR separator has evolved as an integral part of the repeat region and that one of its functions is to insulate gRNAs from the disrupting effects of varying GC content in upstream spacers. This insulating effect of AT-rich CRISPR separators may be important enough to have helped shape the evolution of Cas12a CRISPR arrays. Furthermore, our study demonstrates how design inspired by the natural CRISPR system can improve the efficacy of tools for CRISPR gene editing and regulation.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HEK Lenti-X 293T (modified)Takara Bio632,180Genomically integrated TRE3G-GFP
Commercial assay or kitiScript cDNA Synthesis KitBio-Rad1708890
Commercial assay or kitRNeasey Plus Mini KitQiagen74,134
Commercial assay or kitiTaq Universal SYBR Green SupermixBio-Rad1725120
Peptide, recombinant proteinT7 DNA LigaseNEBM0318S
Peptide, recombinant proteinT4 Polynucleotide KinaseNEBM0201L
Commercial assay or kitNucleoSpin Gel and PCR Clean-upTakara32–740609.50
Commercial assay or kitIn-Fusion HD Cloning PlusTakara638,920
Commercial assay or kitKAPA HiFi Hot-start PCR kitRoche07958897001
Commercial assay or kitHiScribe T7 Quick High Yield RNA Synthesis KitNEBE2040S
Commercial assay or kitMEGAclear Transcription Clean-Up KitThermo FisherAM1908
Peptide, recombinant proteinEnGen Lba Cas12a (Cpf1) - 2000 pmolNEBM0653T
Peptide, recombinant proteinRecombinant RNase inhibitorTakara Bio2313 A
Commercial assay or kitRNA Nano 6,000 chipsAgilent5067–1511
Sequence-based reagentLow Range ssRNA LadderNEBN0364S
Commercial assay or kitTransIT-LT1 transfection reagentMirus BioMIR2304-70

Cell lines

Request a detailed protocol

We used HEK293T cells (Takara Bio, Japan). The identity and negative mycoplasma status of these cells have been confirmed by the vendors. Upon receiving the cell line, we engineered the cells to carry a genomically integrated dscGFP gene driven by the TRE3G promoter (consisting of seven repeats of the Tet response element) (Kempton et al., 2020). This cell line was clonally sorted and expanded and showed no background GFP fluorescence. We expanded and kept multiple aliquots in the liquid nitrogen freezer. The cells were taken out of the liquid nitrogen freezer for experiments and discarded after maximum 3 months of use.

Cell culture

Request a detailed protocol

Cells were cultured in DMEM+ GlutaMAX (Thermo Fisher, Waltham, MA) containing 100 U/ml of penicillin and streptomycin (Thermo Fisher) and 10% fetal bovine serum (Clontech). Cells were grown at 37°C with 5% CO2 and passaged using 0.05% Trypsin-EDTA solution (Thermo Fisher) or TryplE Express Enzyme (Thermo Fisher).


Request a detailed protocol

Cells were transfected with constructs carrying (1) the nuclease-deactivated (D832A) dCas12a (from L. bacterium, human codon-optimized) (Zetsche et al., 2015) fused either to the VP64-p65-Rta (VPR) activator (Chavez et al., 2015) and mCherry (Figure 5), or to mini-VPR (Vora et al., 2018) and mCherry (remaining experiments); (2) a CRISPR array-expressing plasmid. For Figures 1 and 3a, CRISPR array construct consisting of firefly luciferase immediately followed by a CRISPR array and an SV40 pA terminator, expressed under the CAG promoter element, was used (Supplementary file 1). For the activation of seven endogenous genes (Figure 5), firefly luciferase was replaced with BFP and a Malat1 Triplex sequence Campa et al., 2019 followed by the L. bacterium Cas12a leader sequence (Supplementary file 1).

Cells were seeded 1 day before transfection at a density of 5 × 104 cells per well in a 24-well plate. Cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio, Madison, WI) according to the manufacturer’s recommendation (250 ng dCas12a-VPR-mCherry plasmid; 250 ng CRISPR array plasmid; 1.5 µl transfection reagent per well).

Flow cytometry

Request a detailed protocol

Two days after transfection, cells were dissociated using 0.05% Trypsin-EDTA or TrypLE (Thermo Fisher), passed through a 40 µm filter-capped test tube (Corning, Corning, NY), and analyzed using either a CytoFLEX S flow cytometer (Beckman Coulter, Brea, CA) or a BD Influx FACS machine (BD Biosciences, Franklin Lakes, NJ) or a BD FACSMelody (BD Biosciences). For each experiment, 10,000 events were recorded. During flow cytometry analysis, we gated for cells expressing the Cas12a construct (mCherry+), but not the CRISPR array construct. That is because array processing by Cas12a severs the upstream reporter gene from the poly-A tail, thus potentially disturbing reporter gene expression and thereby the analysis. For Figures 1 and 3, three replicates were performed for each sample.

RT-qPCR to quantify endogenous gene activation (Figure 5)

Request a detailed protocol

Cells were transfected as described above. For cell harvesting, all cells in each well were dissociated and included in the analysis and were thus not sorted based on uptake of Cas12a or CRISPR array plasmids. Two biological replicates were performed. Total RNA was extracted with the RNeasy Plus Mini Kit (Qiagen, Germany), according to manufacturer’s instructions. Reverse transcription was performed using iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA). Quantitative PCR reactions were run on a LightCycler thermal cycler (Bio-Rad) with iTaq Universal SYBR Green Supermix (Bio-Rad). ΔΔCt values for the target genes were divided by those of RPL13A to obtain relative expression. gRNA spacers and RT-qPCR primers are listed in Supplementary file 3.

Assembly of CRISPR arrays

CRISPR arrays were assembled using an oligonucleotide duplexing and ligation method that we developed. First, arrays were designed computationally using SnapGene software (v. 5.1–5.2; Insightful Science, San Diego, CA). The arrays were designed to include two flanking sequences containing a 20 bp overlap with the opened backbone plasmid, as required for a subsequent In-Fusion reaction. This double-stranded CRISPR array sequence was then computationally divided into ≤60 nt DNA sequences with unique 4-nt 5’ overhangs, which were ordered from Integrated DNA Technologies (IDT, Coralville, IA) in LabReady formulation (100 µM in IDTE buffer, pH 8.0) and standard desalting purification. For each ligation vial, an oligonucleotide mix was first made containing 1 µl of each oligonucleotide. Up to 16 single-stranded oligonucleotides (i.e. corresponding to eight oligo duplexes) were ligated per reaction vial. For CRISPR arrays longer than that, the reaction was divided into multiple vials, each vial containing ≤8 oligonucleotide duplexes (e.g. if the array consists of 12 oligonucleotide duplexes, the reaction was performed in two vials with six duplexes in each).

Phosphorylation and duplexing

Request a detailed protocol
Oligonucleotide mix1.0 µl
2× T7 ligation buffer (NEB)2.5 µl
H2O1.25 µl
T4 PNK (NEB)0.25 µl
Total5 µl

Then run a phosphorylation-duplexing reaction on a thermocycler:

37°C30 min
95°C5 min
25°CStep down 0.1°C/s

Then, add 1 reaction volume (5 µl) of 1× T7 buffer (2.5 µl 2x T7 buffer + 2.5 µl water). Add 1 µl T7 DNA ligase (New England Biolabs, MA) (Important: Use T7 ligase rather than T4 ligase, as T7 ligase lacks the ability to ligate blunt ends). Incubate at 25°C for 3 hr. Then, dilute the sample 1/5 by adding 40 µl water. Run the sample on a 2% agarose gel. A ladder pattern should be visible. Excise the band corresponding to the ligated product. Depending on whether the entire CRISPR array was assembled in a single vial or divided into several vials, do either of the following:

If the entire array was assembled in a single vial

Request a detailed protocol

Gel-purify the excised band using the Macherey-Nagel NucleoSpin Gel & PCR Clean-up kit (Takara Bio, Japan). Insert the purified array into the opened plasmid backbone using In-Fusion cloning (Takara Bio).

If the array was divided into >1 vial

Request a detailed protocol

For all excised bands belonging to the same array, pool the excised bands into a single vial. Gel-purify the pooled bands using the Macherey-Nagel NucleoSpin Gel & PCR cleanup kit. Elute in 15 µl water. Then, add 1 volume (15 µl) of 2× T7 buffer and 1 µl T7 DNA ligase. Incubate at 25°C for 3 hr. Then, run the ligated product on a 2% agarose gel. A faint band should be seen corresponding to the full-length CRISPR array. Excise and gel-purify this band. Insert into backbone vector using In-Fusion.

Design of short CRISPR arrays (two gRNAs) for testing effect of GC content of dummy spacer (Figure 1)

Request a detailed protocol

The 51 dummy spacer sequences (Figure 1) were adapted from a negative-control sgRNA library generated by Gilbert et al., 2014. These sequences correspond to scrambled Cas9 spacer sequences, and we adjusted them slightly for length (20 nt) and GC content. We designed five dummy spacers for each 10%-GC increment (10–90%) because we hypothesized that this amount would sufficiently capture the variability of array performance. We additionally included six dummy spacers from a previous pilot experiment (30%–80% GC). All dummy spacers are listed in Figure 1—source data 1.xlsx.

Computation of GC content in sliding window (Figure 1H,J and Figure 2B)

Request a detailed protocol

For each of the dummy spacer sequences, we computed the GC content in a sliding 5-nt window (first nucleotides 1–5, then nucleotides 2–6, etc.). For each such window, we then calculated the average and standard error of all 51 spacers. As the sliding window approached the 3’ end of the spacers, we reduced the size of the sliding window to 4, then 3, then two nucleotides, in order to increase resolution at the very 3’ end. This was performed also for naturally occurring spacers (Figure 2B) and CRISPR separators (Figure 2B). The spacers we analyzed varied in length from 25 to 36 nt. For this analysis, we truncated the 5’ ends of spacers longer than 25 nt. This way, we could align and analyze the 25 nucleotides at the most 3’ end of every spacer, even though it meant that we would lose information at the 5’ end of longer spacers. For the separator sequences, we first aligned them using the T-Coffee alignment tool (see below), which did not truncate any of the separator sequences.

Calculation of the predictive power of spacer GC content

Request a detailed protocol

For calculating the predictive power of knowing the GC content of three bases in the dummy spacer (Figure 1K), we divided each 20-nt spacer into eighteen 3-nt windows and calculated the GC content for each window. For each such window (e.g. nucleotides 1–3), we plotted GC content versus percent GFP+ cells for all 51 arrays. We then performed a linear regression (GraphPad Prism v. 9.0; GraphPad Software, San Diego, CA) and used the resulting R2 value for Figure 1J.

Multiple-sequence alignment of naturally occurring CRISPR sequences (Figure 2, Figure 2—figure supplement 1)

Request a detailed protocol

To find bacterial CRISPR-Cas12a operons, we used CRISPR-Cas++ (Couvin et al., 2018) using two search strategies: (1) Using the CRISPRCasdb-Blast tool with default settings (accessed September 2020), we input the Cas12a repeat sequences from Zetsche et al., 2015 and extracted all spacers and repeats, making sure that the spacer sequences were all directed in the 5’-to-3’ direction. (2) Using the CRISPRCasdb function, we searched for Cas12a loci in all organisms using default settings. Alignment of separator sequences and post-processed repeats was performed using the multiple-sequence alignment tools of SnapGene (v. 5.1–5.2). The separator sequences were aligned using the T-Coffee algorithm. The sequences used can be found in Supplementary file 2.

Cas12a cleavage assay (Figure 4)

Request a detailed protocol

We first PCR-amplified the CRISPR array from our expression plasmids using the KAPA HiFi HotStart polymerase and the KAPA HiFi Fidelity Buffer (KAPA Biosystems, MA) (25 PCR cycles), using primers spanning the array. The forward primer contained the T7 promoter sequence, followed by two Gs for increased expression (TAATACGACTCACTATAGGG) immediately upstream of the primer’s target-binding region. The PCR product was purified using the Macherey-Nagel NucleoSpin Gel & PCR Clean-up kit (Takara Bio), and 500 ng DNA was used for the subsequent in vitro transcription reaction. For this, we used the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol and incubated the reaction at 37°C overnight. RNA was purified using the MEGAclear Transcription Clean-up Kit (Thermo Fisher) using the manufacturer’s protocol. For the Cas12a cleavage reaction, we used EnGen Lba Cas12a protein (New England Biolabs) but used our own cleavage buffer rather than NEBuffer 2.1, as we found that this buffer gave better results. This cleavage buffer consisted of Tris-HCl (final concentration 20 mM, pH 7.5, ThermoFisher), KCl (final concentration 50 mM, ThermoFisher), Recombinant RNase inhibitor (final concentration 1 U/µl, Takara Bio), and MgCl2 (final concentration 2 mM). Mg2+ is important for the proper folding of the gRNA pseudoknot (Dong et al., 2016; Fonfara et al., 2016). The concentration of free Mg2+ inside living cells is on the order of 1 mM (Maeshima et al., 2018). We found that a MgCl2 concentration of 2 mM gave slightly crisper cleavage products than 1, 5, or 10 mM, and we used 2 mM for all experiments.

Cleavage buffer4.3 µl
RNA (1 µg/µl)0.25 µl
Cas12a (100 µM)0.45 µl
Total5 µl

First, we added 0.25 µl RNA (1 µg/µl stock) to 4.3 µl cleavage buffer, heat-denatured this solution at 70°C for 2 min and transferred the vials to room temperature. Then we added 0.45 µl Cas12a (100 µM stock solution) and immediately transferred the tubes to a pre-heated thermocycler set at 37°C. Because each CRISPR array contains three cleavage sites and Cas12a remains bound to its gRNA after processing, we used an excess of Cas12a protein (16:1 Cas12a:array). To stop the reaction, we added 0.3 µl proteinase K (New England Biolabs, 800 U/ml stock solution, which had been pre-diluted 1:1 in cleavage buffer) and transferred vials to a thermocycler pre-set to 50°C, where they were incubated for 1 hr and then transferred to ice. Samples were analyzed on a 2,100 Bionalyzer (Agilent, CA) using RNA Nano 6000 chips. Samples and Low Range ssRNA Ladder (New England Biolabs) were heat-denatured at 70°C for 2 min and transferred to ice immediately before loading on the chip in order to minimize secondary structure formation. Bioanalyzer results were normalized based on the sample with the lowest RNA concentration to enable quantitative comparisons between replicates. To calculate how many percent of gRNAs had been fully processed (Figure 4E), we used the Bioanalyzer’s output of the area of the RNA peak corresponding to fully processed, single gRNA and divided this by the total area of all peaks to estimate the fraction of the total RNA that was contained in the peak corresponding to fully excised, single gRNAs. If processing of these CRISPR arrays proceeds to completion, 28% and 29% of the total RNA mass should be composed of single gRNAs for the two arrays, respectively (e.g., (41 + 42)/(57 + 41 + 42 + 158) = 0.28 for the array without the synSeparator; see Figure 4A), whereas the remaining RNA mass should consist of the upstream and downstream sequences. We divided the observed fraction of single gRNAs with 0.28 and 0.29, respectively, to find the percentage of maximum processing that had occurred.

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files. Source data have been provided for all figures.


Decision letter

  1. Joseph T Wade
    Reviewing Editor; Wadsworth Center, New York State Department of Health, United States
  2. Detlef Weigel
    Senior Editor; Max Planck Institute for Developmental Biology, Germany
  3. Chase Beisel
    Reviewer; Helmholtz Institute for RNA-based Infection Research, Germany
  4. Joseph T Wade
    Reviewer; Wadsworth Center, New York State Department of Health, United States

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Acceptance summary:

The Cas12a protein from type V CRISPR-Cas systems can be used for genome editing or modulating gene expression in mammalian cells. One of the advantages of Cas12a over other CRISPR-based systems is the ability to multiplex guide RNAs in a single array. Here, the authors show that processing of RNAs from these arrays can be inhibited by RNA secondary structure, which can be reversed by introducing an artificial sequence, coined the "synSeparator", between guide RNAs. The use of synSeparators increases the activity of Cas12a in mammalian cells, and thus represents an important advance in the development of Cas12a for biotechnology applications.

Decision letter after peer review:

Thank you for submitting your article "Enhanced Cas12a multi-gene regulation using a CRISPR array separator" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Joseph T Wade as the Reviewing Editor and Reviewer #2, and the evaluation has been overseen by Detlef Weigel as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Chase Beisel (Reviewer #1).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1. The authors should test more specific models for how the A/T-rich synSeparators promote crRNA activity, either by analyzing existing data with different separator variants, or experimentally testing more separator/spacer combinations to address specific models. The reviewers recommend focusing on secondary structure in the repeat sequences as a likely source of synSeparator activity.

2. To show that synSeparators are broadly useful for multiplexed Cas12a applications, the authors should test additional targeting crRNA guides, ideally with the design informed by mechanistic insight from Essential Revision #1. The authors should also test crRNAs with synSeparators in another cell line and/or with a different Cas12a protein to further show generalizability.

Reviewer #1 (Recommendations for the authors):

Some additional literature should be integrated into manuscript. Fonfara Nature 2016 showed that Cpf1 encodes a distinct domain responsible for processing the transcribed CRISPR array into individual crRNAs. Liao Nat Commun 2019 showed that the order of the spacer in a CRISPR-Cas12a array can immensely impact multiplexed targeting, where targeting by one crRNA was strongly inhibited due to its repeat pairing with the upstream spacer. McCarty Nat Commun 2020 provided a comprehensive review of multiplexing approaches with CRISPR, including the use of CRISPR arrays.

To support general claims, the authors would need to show that the same trends persist when testing different guide sequences. This would include the selected synthetic separators as well as the natural separator.

The authors also need to integrate the folding of the repeat hairpin, as improper folding likely explains the authors' results more-so than general folding of the upstream guide sequence.

References on line 40 should be replaced with the original demonstration of crRNA processing (Brouns Science 2008) and possibly include the original paper characterizing Cas12a (Zetsche Cell 2015).

Descriptions around processing should consider the fact that the spacer is also trimmed to the 20 – 24 nt guide naturally observed with Cas12a crRNAs (Zetsche Cell 2015).

L. 63 – 64: A more reasonable reason for removal of the separator in the original work was that it was seen as dispensable rather than interfering with targeting activity.

Specify somewhere early in the Results which Cas12a was used (e.g. As, Lb, Fn).

L. 301: The claim of a significant increase needs to be supported statistically. Given the smaller fold-changes and the duplicate measurements, many of these increases may not be statistically significant.

Reviewer #2 (Recommendations for the authors):

1. The data in Figure 1 correlate predicted secondary structure with crRNA activity. However, this relationship can be tested more directly. I would like to see targeted substitutions in the separator that are predicted to lead to specific changes in secondary structure at key positions around the Cas12a cleavage site.

2. The authors speculate that the separator sequences affect Cas12a processing of the crRNAs, but they rely on indirect readouts of crRNA processing. It would be informative to measure processed crRNA levels directly, especially for the experiment shown in Figure 4. crRNA processing could also be assayed in vitro using purified Cas12a.

3. The data in Figure 4 show a modest effect of introducing a short, A/T-rich separator in the CRISPR array. I think even a small improvement in crRNA activity would be an important advance, so the magnitude of the effect is not a concern. However, I would like to see more than one CRISPR array tested, and it would be informative to individually replace A/T-rich separators with G/C-rich separators. Also, does the spacer order matter? Spacer order could also affect RNA secondary structure.

Reviewer #3 (Recommendations for the authors):

1. This is not needed for the current manuscript, but in future experimentation the authors could consider performing comparative small RNA-seq to validate crRNA array processing in presence/absence of the synSeparator.

2. In Figure 4B, the black arrows could be confusing to readers. Consider showing only the green values or more explicitly stating what the black arrows denote.

3. In line 33-36, The word "coding sequence" is not appropriate. The word should be replaced with regulatory element or something similar.

4."permissive" (line 153) should be changed to "permissive".

5. Although authors have mentioned both VPR and mini-VPR (line 530), none of Results section/figures have included VPR. Was full-length VPR used?

6. In Line 202 – legend of Figure 2 there are some extra brackets around "Figure S2A".

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Enhanced Cas12a multi-gene regulation using a CRISPR array separator" for further consideration by eLife. Your revised article has been evaluated by Detlef Weigel (Senior Editor) and a Reviewing Editor.

The Reviewing Editor has read through your revised manuscript and response letter. We appreciate the impressive effort you have made to respond to the comments from the previous round of review. In principle, the paper is now suitable for publication in eLife, pending a response to a few small comments ; these comments should all be addressable with changes to the text. The most important issue relates to Figure 4. The new in vitro assay is a nice addition since it suggests the effects of RNA secondary structure are directly on Cas12a. However, I am a little confused by the data presentation in Figure 4, and I think you may be overstating the magnitude of the difference in cleavage between RNAs with/without a SynSeparator. There is clearly an improvement from adding the SynSeparator, which alone is sufficient reason to include these new data. However, you should either more clearly explain/present the data, or soften your conclusions. See comment #3 below for more details.

Specific comments:

1. Lines 578-585 (Discussion). This paragraph doesn't relate to anything in the current study, so I recommend removing it.

2. The Discussion covers a lot of ground. I recommend adding section titles to improve the readability.

3. Figure 4E summarizes the data for the in vitro cleavage assay. However, to my eye at least, the data in panels B and C, and the data in the associated supplementary figure, don't match panel E. Specifically, without the SynSeparator, the largest increase in cleavage (shown in Figure 4E) occurs between 30 and 60 minutes. However, in panel B, there is almost no difference in the abundance of the 41/42 nt products between 30 and 60 minutes. Moreover, the kinetics of cleavage for the RNA without a SynSeparator are clearly delayed relative to the RNA with a SynSeparator, but cleavage appears to saturate after ~30 minutes (see also panels E and F of the supplementary figure, which to my eye are almost identical). Figure 4E suggests that only 20% of possible cleavage has occurred after 60 minutes for the RNA without a SynSeparator. If that is the case, why is it that cleavage appears to have saturated after 30 minutes? The authors need to present and describe these data more clearly, and potentially soften their conclusions.

4. The authors should use more precise language when describing changes in predicted secondary structure, making clear that these are predictions. For example, rather than saying "as these secondary structures grew tighter, CRISPRa performance gradually worsened", I suggest "as the predicted extent of base-pairing increased, CRISPRa performance gradually worsened".

5. Line 42. This is the one place where I would stick with "crRNA" rather than "gRNA". Perhaps you could mention in parentheses that the RNAs are commonly called crRNAs when expressed from their native loci.

6. Line 42. I suggest "prokaryotic" rather than "bacterial".


Author response

Essential revisions:

1. The authors should test more specific models for how the A/T-rich synSeparators promote crRNA activity, either by analyzing existing data with different separator variants, or experimentally testing more separator/spacer combinations to address specific models. The reviewers recommend focusing on secondary structure in the repeat sequences as a likely source of synSeparator activity.

We have now performed several new experiments and computational analyses to explore the mechanism by which synSeparators enhance CRISPR array performance (These experiments are also described in response to specific reviewers’ comments). After performing these experiments, we are confident that appending A/T-rich synSeparators does enhance the efficiency of crRNA array cleavage, which explains the better multiple gene activation we observed in cells. These efforts include:

First, we performed an in vitro Cas12a cleavage assay where we investigated Cas12a’s ability to process CRISPR arrays containing spacers with high or low GC content, and with or without the synSeparator. We now present these data in a new main figure (Figure 4) and an associated supplemental figure (Figure S4). We found that array processing is less efficient when the upstream dummy spacer has high GC content (70%) than when it has low GC content (30%) (Figure 4E). Inserting an AT-rich 4-nt synSeparator between each gRNA rescues this processing defect and makes processing of the array with the 70%-GC spacer nearly as efficient as that with the 30%-GC spacer

(Figure 4E). We present a time-course measurement of cleavage where we subjected CRISPR arrays to Cas12a processing for different amounts of time. Under these experimental conditions, fully processed, single gRNAs are detectable after 10 minutes, at which time the synSeparator-containing array already shows increased processing efficiency compared to the array without the synSeparator (Figure 4B-E). These results are consistent with the functional performance of these very same arrays in cells (Figure 3D). The results demonstrate that high-GC spacers can impair array processing and that an AT-rich synSeparator can rescue poor processing of these arrays. Perhaps surprising is the observation that some processing did occur of the array with the 70%-GC dummy spacer, even without the synSeparator. This is surprising because this same array allowed virtually no GFP activation in cells (Figure 3D). We have added a paragraph in the Discussion where we speculate that the experimental conditions in the cleavage assay may not perfectly mimic those in a living cell. For example, the cleavage assay is in principle allowed to proceed to completion, whereas RNA degradation in a cell might render CRISPR arrays non-functional if they are not processed fast enough.

Second, we have performed a new experiment where we introduced a series of targeted point mutations in the dummy gRNA that were designed to provoke secondary structure formation. The purpose of this experiment was to gain a better mechanistic understanding of where the most disruptive secondary structures are located. Specifically, we asked whether a GFP-targeting gRNA would be most sensitive to secondary structures that form exclusively within the upstream (dummy) spacer, or to structures that also involve the repeat region of the GFP-targeting gRNA itself. We present these results in a new supplemental figure (Figure S3) and an accompanying paragraph in the main text. To address this question, we generated several variants of a short CRISPR array where we gradually mutated the dummy spacer to form secondary structures that were either localized to the dummy spacer or that competed with the natural pseudoknot structure in the GFP-gRNA’s repeat region (Figure S3A, Table S1). These designs were guided by a secondary structure prediction tool, RNAfold. Results showed that, as these secondary structures grew tighter and tighter, CRISPRa performance gradually worsened (Figure S3B). Interestingly, this happened both when the secondary structure was localized to the dummy spacer and when it also involved the GFP-targeting gRNA’s repeat region. This indicated that CRISPR array performance is sensitive to both kinds of disruption. We then included the AAAT synSeparator to these worst-performing arrays and found that this significantly rescued CRISPRa performance in both cases (Figure S3B), suggesting that the separator acts both by insulating gRNAs from each other and by breaking up secondary structures that involve two consecutive gRNAs.

Third, we have performed an experiment to explore the possibility that there is a positional effect in a CRISPR array, such that a gRNA may perform differently depending on where in an array it is located. This experiment could indicate the extent to which global RNA structure affects gRNA function. We present these data in Figure S3C-D and an accompanying paragraph in the main text. We generated four CRISPR arrays, each containing one GFP-targeting gRNA and three non-targeting dummy gRNAs, and placed the GFP-targeting gRNA in each of the four positions. We made sure that the GFP-targeting gRNA would be preceded by the same dummy gRNA in as many arrays as possible, because different dummy gRNAs may have different propensities to generate secondary structures immediately upstream of the GFP-targeting gRNA, which would add variability. We found no positional effect in the performance of the GFP-targeting gRNA. This suggests that local RNA structure may be a more important determinant of gRNA performance than global RNA structure, at least in this experimental setting.

Fourth, we have performed a new computational analysis of spacer secondary structure using RNAfold, which contributes to a mechanistic understanding of CRISPR array processing in the context of high-GC spacers: We have assessed predicted secondary structure formation of the dummy spacers from Figure 1G (presented in the new Figure 1M). These results show that the performance of a GFP-targeting gRNA is anticorrelated with the predicted secondary structure of the upstream dummy spacer (Figure 1M). Interestingly, this anticorrelation was strongest when the structural prediction included both the non-targeting dummy spacer and the subsequent GFP gRNA (R2 = 0.57; Figure 1M) rather than only the dummy spacer (R2 = 0.27; Figure S1C), suggesting that secondary structures that directly involve the GFP-targeting gRNA may be particularly disruptive. Together with the experimental results described above (with the targeted mutations introduced into the dummy spacer), these results suggest that, even though secondary structures may be disruptive if they are confined to the upstream spacer, they may often be even more disruptive if they also involve the targeting gRNA itself.

Fifth, we present predicted secondary structures (RNAfold) from the two worst-performing CRISPR arrays from Figure 1G in new panels in Figure 3G-H. These structures suggest that the poor performance of these arrays may be caused by tight secondary structures that form between the dummy spacer and the GFP-targeting gRNA, which is likely to impair Cas12a processing (Figure 3H). Interestingly, both the natural L. bacterium separator and the AAAT synSeparator are predicted to break up these structures or form protrusions that may facilitate Cas12a access to its cleavage site. For example, structural ensemble diversity increases from 1.78 to 12.51 for this 50%-GC spacer, and from 7.07 to 12.43 for this 70%-GC spacer, when the full-length natural separator is included.

Taken together, all these new results indicate that the disruptive effect of high-GC spacers is likely caused by secondary structures (Figure 1M) that are either restricted to a single gRNA or involve two consecutive gRNAs (Figures 1M, S1C, S3A-B). CRISPR arrays containing such disruptive gRNAs are processed inefficiently by Cas12a (Figure 4B-E), which likely explains their poor performance. However, AT-rich separator sequences, even short, 4-nt sequences, can break up such secondary structures and give Cas12a access to its cleavage site (Figure 3H), improving CRISPR array processing (Figure 4) and performance (Figure 3D-J).

2. To show that synSeparators are broadly useful for multiplexed Cas12a applications, the authors should test additional targeting crRNA guides, ideally with the design informed by mechanistic insight from Essential Revision #1. The authors should also test crRNAs with synSeparators in another cell line and/or with a different Cas12a protein to further show generalizability.

We have addressed the generalizability of our findings with several new experiments:

First, we now include data demonstrating that a different nuclease-deactivated, enhanced-Cas12a from Acidaminococcus species (denAsCas12a; Kleinstiver et al., 2019) is also sensitive to the effects of high-GC spacers (Figure 3J). This poor performance was largely rescued by including a TTTT synSeparator derived from the natural AsCas12a separator (see Figure 2C). This experiment demonstrates that sensitivity to high-GC spacers is not specific to our particular Lb-dCas12a activator but is a general property of different Cas12a variants, consistent with the observation that all observed Cas12a arrays contain AT-rich separator sequences.

Second, we now include data demonstrating that the beneficial effect of adding a synSeparator is not limited to the AAAT sequence derived from the Lachnospiraceae b. separator. We now include three other 4-nt, AT-rich synSeparators derived from Acidaminococcus s. (TTTT), Moraxella b. (TTTA) and Prevotella d. (ATTT) (Figure 3I). All these synSeparators rescued the poor GFP activation caused by an upstream spacer with high GC content, demonstrating that the capacity to insulate neighboring gRNAs from each other is a general feature of AT-rich sequences. That said, these four synSeparators differed somewhat in the magnitude of GFP rescue they enabled (Figure 3I). This quantitative difference might be due to an intrinsic “insulation capacity” that differs between these sequences, or to the way they interact with the specific Lb-Cas12a protein used in this experiment, or to sequence-specific secondary structures within this particular CRISPR array. We discuss these possibilities in the Discussion.

Third, we attempted to investigate the effect of the synSeparator in different cell types. However, many cell types are difficult to transfect and dCas12a-VPR-mCherry is a big construct (>6 kb). Either due to poor transfection efficiency or poor expression of the Cas12a activator construct, CRISPRa activity was consistently poor in these cell types, both with and without the synSeparator (e.g., we cannot observe fluorescence from the mCherry gene fused to the dCas12a activator, which we always see in HEK293T cells). Because of the low delivery efficiency of CRISPRa, it was not possible to evaluate the performance of the synSeparator. To our knowledge, there have not been many reports using dCas12a-VPR in cell types other than HEK293T. While we think that it will be important to optimize CRISPRa in many cell types (e.g., by optimizing transfection conditions, Cas12a variants, promoters, expression vectors, etc.), the focus of our study has been to show the separator’s mechanism and general function; we believe that optimizing general CRISPRa for different cell types is beyond the scope of this paper. We acknowledge that this is a limitation of our study and we have added a paragraph about this in the Discussion (line 355. All line numbers refer to the document with no markup visible). We nevertheless hypothesize that the negative influence of high-GC spacers and the insulating effect of synSeparators are generalizable across cell types. That is because we could observe improved array processing with the synSeparator even in the cell-free context of an in vitro expression system, as described above (Figure 4). This suggests that the sensitivity to spacer GC content is determined only by the interaction between Cas12a and the array, rather than being dependent on a particular cellular context.

Reviewer #1 (Recommendations for the authors):

Some additional literature should be integrated into manuscript. Fonfara Nature 2016 showed that Cpf1 encodes a distinct domain responsible for processing the transcribed CRISPR array into individual crRNAs. Liao Nat Commun 2019 showed that the order of the spacer in a CRISPR-Cas12a array can immensely impact multiplexed targeting, where targeting by one crRNA was strongly inhibited due to its repeat pairing with the upstream spacer. McCarty Nat Commun 2020 provided a comprehensive review of multiplexing approaches with CRISPR, including the use of CRISPR arrays.

We thank the reviewer for these suggestions. We have now included references to Fonfara et al. and McCarty et al. in the text (lines 43, 44). Regarding the Liao et al. reference, we have now performed an experiment exploring the positional effect of gRNAs in an array (Figure S3C-D). We observed no difference in GFP activation when a GFP-targeting gRNA was moved to each position in a 4-gRNA array, indicating that position is not necessarily an important determinant of gRNA performance. This finding is interesting considering the positional effect observed in Liao et al. We speculate that positional effects might be observed in cases where local secondary structures exist in some regions of an array but not in others. In such cases, positioning a gRNA in such a region may lead to decreased performance. We have included this discussion in the Results section (line 288).

To support general claims, the authors would need to show that the same trends persist when testing different guide sequences. This would include the selected synthetic separators as well as the natural separator.

We performed an experiment intended to investigate the effect of the synSeparator in different cell types. However, either due to poor transfection efficiency or poor expression of the Cas12a activator construct, CRISPRa activity was consistently poor in these cell types, both with and without the synSeparator (e.g., we did not visually observe fluorescence from the mCherry gene fused to the dCas12a activator, which we always see in HEK293T cells). Because of the low general delivery efficiency of CRISPRa, it was not possible to evaluate the performance of the synSeparator. Many cell types are difficult to transfect and dCas12a-VPR-mCherry is a big construct (>6 kb). To our knowledge, there have not been many reports using dCas12a-VPR in cell types other than HEK293T. While we think that it will be important to optimize CRISPRa in many cell types (e.g., by optimizing transfection conditions, Cas12a variants, promoters, expression vectors, etc.), the focus of our study has been to show the separator’s mechanism and general function; we believe that optimizing general CRISPRa for different cell types is beyond the scope of this paper. We acknowledge that this is a limitation of our study and we have added a paragraph about this in the Discussion (line 355). We nevertheless hypothesize that the negative influence of high-GC spacers and the insulating effect of synSeparators are generalizable across cell types. That is because we could observe improved array processing with the synSeparator even in the cell-free context of an in vitro expression system, as described above (Figure 4). This suggests that the sensitivity to spacer GC content is determined only by the interaction between Cas12a and the array, rather than being dependent on a particular cellular context.

The authors also need to integrate the folding of the repeat hairpin, as improper folding likely explains the authors' results more-so than general folding of the upstream guide sequence.

We have now performed a computational analysis using RNAfold where we correlated the performance of all dummy spacers with their predicted secondary structure (Figure 1M). As the reviewer suspected, correlation between predicted RNA structure and array performance was indeed higher when the structural prediction included both the dummy spacer and the entire GFP-targeting gRNA (R2 = 0.57; Figure 1M) than when it included only the dummy spacer (R2 = 0.27; Figure S1C). This higher correlation suggests that secondary structures that involve the GFP-targeting gRNA play a more important role in our experiment than secondary structures that only involve the dummy spacer. These results are described in the Results section and in the Figure 1 legend.

References on line 40 should be replaced with the original demonstration of crRNA processing (Brouns Science 2008) and possibly include the original paper characterizing Cas12a (Zetsche Cell 2015).

This has now been done.

Descriptions around processing should consider the fact that the spacer is also trimmed to the 20 – 24 nt guide naturally observed with Cas12a crRNAs (Zetsche Cell 2015).

Please see our response to comments (2) and (3) above. We are not sure we fully understood these comments; please let us know if we did not address them fully.

L. 63 – 64: A more reasonable reason for removal of the separator in the original work was that it was seen as dispensable rather than interfering with targeting activity.

Thanks for the insight. This has been adjusted: ”For this reason, and because the separator has been seen as dispensable, the separator has been omitted when Cas12a arrays have been experimentally expressed in eukaryotic cells.”

Specify somewhere early in the Results which Cas12a was used (e.g. As, Lb, Fn).

This has now been done, both in the legend of Figure 1 and in the Results section.

L. 301: The claim of a significant increase needs to be supported statistically. Given the smaller fold-changes and the duplicate measurements, many of these increases may not be statistically significant.

Our plan was to address the significance by instead using a different CRISPR array in a different cell line. Please see point (10) for a description of our efforts.

Reviewer #2 (Recommendations for the authors):

1. The data in Figure 1 correlate predicted secondary structure with crRNA activity. However, this relationship can be tested more directly. I would like to see targeted substitutions in the separator that are predicted to lead to specific changes in secondary structure at key positions around the Cas12a cleavage site.

We thank the reviewer for this suggestion. We have now performed the suggested experiment. We used our design of a 2-gRNA CRISPR array (Figure 1D) where the second gRNA targets the GFP promoter and the first gRNA contains a dummy spacer. We generated several versions of this array where we iteratively mutated the dummy spacer to either form a hairpin restricted to the dummy spacer, or a hairpin that would compete with the pseudoknot in the GFP-gRNA’s repeat region (Figure S3A-B). We found that each of these hairpins significantly reduced performance of the GFP-targeting gRNA. These results suggest that interfering with the pseudoknot indeed disrupts gRNA performance, but that also hairpins that presumably don’t interfere with the pseudoknot are detrimental – perhaps by sterically hindering Cas12a from accessing its cleavage site. Interestingly, the AAAT synSeparator partly rescues performance of the worst-performing of these constructs. These results are displayed in the new Figure S3 and discussed in the related part of the Results section.

2. The authors speculate that the separator sequences affect Cas12a processing of the crRNAs, but they rely on indirect readouts of crRNA processing. It would be informative to measure processed crRNA levels directly, especially for the experiment shown in Figure 4. crRNA processing could also be assayed in vitro using purified Cas12a.

We have now performed an in vitro cleavage assay to address this important point. Using in vitro transcription, we generated RNA transcripts of one of the worst-performing two-gRNA arrays containing a 70% GC dummy spacer (see Figure 3A, D), either with or without the AAAT synSeparator upstream of each Cas12a cleavage site. We incubated this array with purified Lb-Cas12a protein for different amounts of time (2, 5, 10, 30, 60 minutes) and analyzed the cleavage products on a Bioanalyzer. The results showed that array processing occurred both in the presence and absence of the synSeparator but that it was more efficient with the synSeparator. As Cas12a incubation proceeded for longer times, more and more single gRNAs were excised, but for all processing times more single gRNAs had been processed in the array containing the synSeparator. Though the exact numbers may not correspond to what would be seen inside living cells, these results indicate that the synSeparator improves Cas12a processing efficiency and kinetics of CRISPR arrays. We now present these results in a new Figure (Figure 4) and a supplemental figure S4. We describe these results in the Results section, describe the methodology in the Methods section and discuss the results in the Discussion.

3. The data in Figure 4 show a modest effect of introducing a short, A/T-rich separator in the CRISPR array. I think even a small improvement in crRNA activity would be an important advance, so the magnitude of the effect is not a concern. However, I would like to see more than one CRISPR array tested,

We attempted to investigate the effect of the synSeparator in different cell types. However, either due to poor transfection efficiency or poor expression of the Cas12a activator construct, CRISPRa activity was consistently poor in these cell types, both with and without the synSeparator (e.g., we did not visually observe fluorescence from the mCherry gene fused to the dCas12a activator, which we always see in HEK293T cells). Because of the low general efficiency of CRISPRa, it was not possible to evaluate the performance of the synSeparator. Many cell types are difficult to transfect and dCas12a-VPR-mCherry is a big construct (>6 kb). To our knowledge, there have not been many reports using dCas12a-VPR in cell types other than HEK293T. While we think that it will be important to optimize CRISPRa in many cell types (e.g., by optimizing transfection conditions, Cas12a variants, promoters, expression vectors, etc.), the focus of our study has been to show the separator’s mechanism and general function; we believe that optimizing general CRISPRa for different cell types is beyond the scope of this paper. We acknowledge that this is a limitation of our study and we have added a paragraph about this in the Discussion (line 355). We nevertheless hypothesize that the negative influence of high-GC spacers and the insulating effect of synSeparators are generalizable across cell types. That is because we could observe improved array processing with the synSeparator even in the cell-free context of an in vitro expression system, as described above (Figure 4). This suggests that the sensitivity to spacer GC content is determined only by the interaction between Cas12a and the array, rather than being dependent on a particular cellular context.

and it would be informative to individually replace A/T-rich separators with G/C-rich separators.

This is an interesting suggestion. We think that our data already provide an answer to this question: First, our data using a 2-gRNA array (Figure 1) show that if the last ~4 bases in the first spacer are GC-rich, they negatively influence performance of the downstream gRNA (Figure 1H-K). These GC-rich bases in effect act like GC-rich separators for the purpose of this question. Furthermore, replacing the AT-rich synSeparator with a single G can, in extreme cases, lead to severe malfunction of the subsequent gRNA (Figure 3D). We believe these data demonstrate that Gs and Cs can be detrimental when located just upstream of the Cas12a cleavage site.

Also, does the spacer order matter? Spacer order could also affect RNA secondary structure.

We thank the reviewer for this suggestion. Indeed, a previous study (Liao et al., Nat Comm, 2019) showed that the order of the gRNAs in a CRISPR-Cas12a array can impact gRNA performance. We have now performed an experiment exploring the positional effect of gRNAs in an array (Figure S3C-D). We observed no difference in GFP activation when a GFP-targeting gRNA was moved to each position in a 4-gRNA array, indicating that position is not necessarily an important determinant of gRNA performance. This finding is interesting considering the positional effect observed in Liao et al. We speculate that positional effects might be observed in cases where local secondary structures exist in some regions of an array but not in others. In such cases, positioning a gRNA in such a region may lead to decreased performance. We have included this discussion in the Results section (line 288).

Reviewer #3 (Recommendations for the authors):

1. This is not needed for the current manuscript, but in future experimentation the authors could consider performing comparative small RNA-seq to validate crRNA array processing in presence/absence of the synSeparator.

Thanks for the suggestion. We have now performed the suggested experiment using an in vitro cleavage assay to address this important point. Using in vitro transcription, we generated RNA transcripts of one of the worst-performing two-gRNA arrays containing a 70% GC dummy spacer (see Figure 3A, D), either with or without the AAAT synSeparator upstream of each Cas12a cleavage site. We incubated this array with Lb-Cas12a protein for different amounts of time (2, 5, 10, 30, 60 minutes) and analyzed the cleavage products on a Bioanalyzer. The results showed that array processing occurred both in the presence and absence of the synSeparator but that it was more efficient with the synSeparator. As Cas12a incubation proceeded for longer times, more and more single gRNAs were excised, but for all processing times more single gRNAs had been processed in the array containing the synSeparator. Though the exact numbers may not correspond to what would be seen inside living cells, these results indicate that the synSeparator improves Cas12a processing efficiency of CRISPR arrays. We now present these results in a new Figure (Figure 4) and a supplemental figure S4. We describe these results in the Results section, describe the methodology in the Methods section and discuss the results in the Discussion.

2. In Figure 4B, the black arrows could be confusing to readers. Consider showing only the green values or more explicitly stating what the black arrows denote.

We now added a more explicit explanation for the green and black values in the legend of Figure 5.

3. In line 33-36, The word "coding sequence" is not appropriate. The word should be replaced with regulatory element or something similar.

We realize that this sentence was confusing. We meant that recruitment to the coding sequence (gene body) can mediate repression. But because it was written in a confusing way, we now simply state “When this fusion protein is recruited to a target gene […] the target gene can be activated or repressed.”

4."permissive" (line 153) should be changed to "permissive".

Could the reviewer please clarify this point? (now on line 131).

5. Although authors have mentioned both VPR and mini-VPR (line 530), none of Results section/figures have included VPR. Was full-length VPR used?

Full-length VPR was used for activation of endogenous genes (Figure 5). We acknowledge that this was not stated clearly enough so we have now clarified this in the Results section (Line 318) and Methods (Line 632).

6. In Line 202 – legend of Figure 2 there are some extra brackets around "Figure S2A".

We have now removed these extra brackets.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Specific comments:

1. Lines 578-585 (Discussion). This paragraph doesn't relate to anything in the current study, so I recommend removing it.

Are you referring to the paragraph about the endogenous enzyme responsible for processing the 3’ end of each gRNA? (I think line numbers in Word shift depending on whether the original or edited version is displayed). We have now removed this paragraph.

2. The Discussion covers a lot of ground. I recommend adding section titles to improve the readability.

We have now added subheadings in italics (“Considerations for activation of endogenous genes”, “GFP as readout of CRISPR array performance”, “Suggested mechanism of action for the synSeparator”, “Generalizability and outlook”). Please feel free to edit these subheadings if you think others would be more suitable.

3. Figure 4E summarizes the data for the in vitro cleavage assay. However, to my eye at least, the data in panels B and C, and the data in the associated supplementary figure, don't match panel E. Specifically, without the SynSeparator, the largest increase in cleavage (shown in Figure 4E) occurs between 30 and 60 minutes. However, in panel B, there is almost no difference in the abundance of the 41/42 nt products between 30 and 60 minutes. Moreover, the kinetics of cleavage for the RNA without a SynSeparator are clearly delayed relative to the RNA with a SynSeparator, but cleavage appears to saturate after ~30 minutes (see also panels E and F of the supplementary figure, which to my eye are almost identical). Figure 4E suggests that only 20% of possible cleavage has occurred after 60 minutes for the RNA without a SynSeparator. If that is the case, why is it that cleavage appears to have saturated after 30 minutes? The authors need to present and describe these data more clearly, and potentially soften their conclusions.

Thank you for this insightful and important observation. We think there are two main questions in your comment.

The first is, why does there appear to be a discrepancy between Figures 4B and 4E, such that 4B suggests a saturation after 30 minutes while 4E suggests that the reaction has not saturated after 30 minutes. We think this apparent discrepancy has two explanations. First, the triplicate experiments that make up Figure 4E at each time point show variability. We have now updated Figure 4 (and uploaded it using the submission system) to include each data point in 4E, which highlights this variability better. For the array without the synSeparator, one can now see that the 60-minute time point consists of two data points that show reduced cleavage (only slightly higher than the 30-minute time point) and one data point that shows slightly higher cleavage. While the average value for the 60-minute time point is thus shifted slightly upward, the two lower data points may be more representative. In Figure 4B, each curve represents only one representative sample rather than the average of all three samples, as noted in the Figure 4B legend. Second, cleavage efficiency was calculated as the percentage of RNA contained in the 41/42-nt peak divided by total RNA in all cleavage peaks, as described in the Methods section. This means that the calculation is not only sensitive to an increase in the 41/42-nt peak but also to a decrease in larger cleavage products. It appears to be the case that the samples shown in Figure 4B (which are the same as shown in supplementary Figure 4E and F) show a slight decrease in the ~100-nt cleavage product at the 60-minute time point. This would make the 41/42-nt peak make up a larger fraction of the total RNA, even though the 41/42-nt peak appears not to be greater in size.

The second question is, why does the cleavage reaction appear to slow down or saturate already at 30 minutes, despite the excess of Cas12a molecules relative to RNA molecules? We don’t have an answer to this question but speculate that this could be due to a decrease in available Cas12a molecules with time. Because Cas12a remains bound to its gRNA after processing, the amount of freely available Cas12a molecules decreases as the processing reaction proceeds. Perhaps processing of the recalcitrant high-GC gRNAs requires is so unfavorable that it requires a high excess of Cas12a protein to take place. In this scenario, cleavage would become less and less efficient as the amount of freely available Cas12a molecules decreases. We have added this speculation in the Discussion: “… the reaction appears to slow down after 30 minutes, possibly due to the lower concentration of available Cas12a molecules as more and more Cas12a molecules become sequestered by their RNA cleavage products and unavailable to participate in further processing events.”

We hope that these changes facilitate a clearer interpretation of our data.

4. The authors should use more precise language when describing changes in predicted secondary structure, making clear that these are predictions. For example, rather than saying "as these secondary structures grew tighter, CRISPRa performance gradually worsened", I suggest "as the predicted extent of base-pairing increased, CRISPRa performance gradually worsened".

We have performed the suggested change.

5. Line 42. This is the one place where I would stick with "crRNA" rather than "gRNA". Perhaps you could mention in parentheses that the RNAs are commonly called crRNAs when expressed from their native loci.

This change has been performed and the suggested clarification added. (…also known as CRISPR-RNAs [crRNAs] when expressed from their native loci”).

6. Line 42. I suggest "prokaryotic" rather than "bacterial".

This has now been changed.


Article and author information

Author details

  1. Jens P Magnusson

    Department of Bioengineering, Stanford University, Stanford, United States
    Conceptualization, Formal analysis, Investigation, Methodology, Project administration, Software, Supervision, Visualization, Writing – original draft, Writing – review and editing
    Competing interests
    The authors have filed a US provisional patent application related to this work (application no. 63/139,095).
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3928-8959
  2. Antonio Ray Rios

    Department of Bioengineering, Stanford University, Stanford, United States
    Investigation, Writing – review and editing
    Competing interests
    The authors have filed a US provisional patent application related to this work (application no. 63/139,095).
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6717-2267
  3. Lingling Wu

    Department of Bioengineering, Stanford University, Stanford, United States
    Competing interests
    The authors have filed a US provisional patent application related to this work (application no. 63/139,095).
  4. Lei S Qi

    1. Department of Bioengineering, Stanford University, Stanford, United States
    2. Department of Chemical and Systems Biology, Stanford University, Stanford, United States
    3. Stanford ChEM-H Institute, Stanford University, Stanford, United States
    Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing – review and editing
    For correspondence
    Competing interests
    The authors have filed a US provisional patent application related to this work (application no. 63/139,095).
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3965-3223


Li Ka Shing Foundation

  • Lei S Qi

NIH Common Fund 4D Nucleome Program (U01 DK127405)

  • Lei S Qi

Human Frontier Science Program (Long-term Fellowship)

  • Jens P Magnusson

Sweden-America Foundation

  • Jens P Magnusson

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Hannah Kempton for vectors encoding Cas12a protein. JPM is supported by the Human Frontier Science Program Long-term Fellowship and the Sweden-America Foundation. LSQ is supported by Li Ka Shing Foundation and the National Institutes of Health Common Fund 4D Nucleome Program (U01 DK127405).

Senior Editor

  1. Detlef Weigel, Max Planck Institute for Developmental Biology, Germany

Reviewing Editor

  1. Joseph T Wade, Wadsworth Center, New York State Department of Health, United States


  1. Chase Beisel, Helmholtz Institute for RNA-based Infection Research, Germany
  2. Joseph T Wade, Wadsworth Center, New York State Department of Health, United States

Publication history

  1. Received: January 9, 2021
  2. Preprint posted: January 27, 2021 (view preprint)
  3. Accepted: September 8, 2021
  4. Accepted Manuscript published: September 9, 2021 (version 1)
  5. Accepted Manuscript updated: September 13, 2021 (version 2)
  6. Version of Record published: September 28, 2021 (version 3)


© 2021, Magnusson et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 2,780
    Page views
  • 465
  • 6

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jens P Magnusson
  2. Antonio Ray Rios
  3. Lingling Wu
  4. Lei S Qi
Enhanced Cas12a multi-gene regulation using a CRISPR array separator
eLife 10:e66406.

Further reading

    1. Cell Biology
    2. Chromosomes and Gene Expression
    Hirotaka Araki, Shinjiro Hino ... Mitsuyoshi Nakao
    Research Article

    Skeletal muscle exhibits remarkable plasticity in response to environmental cues, with stress-dependent effects on the fast-twitch and slow-twitch fibers. Although stress-induced gene expression underlies environmental adaptation, it is unclear how transcriptional and epigenetic factors regulate fiber type-specific responses in the muscle. Here, we show that flavin-dependent lysine-specific demethylase-1 (LSD1) differentially controls responses to glucocorticoid and exercise in postnatal skeletal muscle. Using skeletal muscle-specific LSD1-knockout mice and in vitro approaches, we found that LSD1 loss exacerbated glucocorticoid-induced atrophy in the fast fiber-dominant muscles, with reduced nuclear retention of Foxk1, an anti-autophagic transcription factor. Furthermore, LSD1 depletion enhanced endurance exercise-induced hypertrophy in the slow fiber-dominant muscles, by induced expression of ERRγ, a transcription factor that promotes oxidative metabolism genes. Thus, LSD1 serves as an ‘epigenetic barrier’ that optimizes fiber type-specific responses and muscle mass under the stress conditions. Our results uncover that LSD1 modulators provide emerging therapeutic and preventive strategies against stress-induced myopathies such as sarcopenia, cachexia, and disuse atrophy.

    1. Chromosomes and Gene Expression
    2. Developmental Biology
    Nan Wang, Jing He ... Kehkooi Kee
    Research Article Updated

    Non-coding RNAs exert diverse functions in many cell types. In addition to transcription factors from coding genes, non-coding RNAs may also play essential roles in shaping and directing the fate of germ cells. The presence of many long non-coding RNAs (lncRNAs) which are specifically expressed in the germ cells during human gonadal development were reported and one divergent lncRNA, LNC1845, was functionally characterized. Comprehensive bioinformatic analysis of these lncRNAs indicates that divergent lncRNAs occupied the majority of female and male germ cells. Integrating lncRNA expression into the bioinformatic analysis also enhances the cell-type classification of female germ cells. Functional dissection using in vitro differentiation of human pluripotent stem cells to germ cells revealed the regulatory role of LNC1845 on a transcription factor essential for ovarian follicle development, LHX8, by modulating the levels of histone modifications, H3K4me3 and H3K27Ac. Hence, bioinformatical analysis and experimental verification provide a comprehensive analysis of lncRNAs in developing germ cells and elucidate how an lncRNA function as a cis regulator during human germ cell development.