Matriptase activation of Gq drives epithelial disruption and inflammation via RSK and DUOX

  1. Jiajia Ma
  2. Claire A Scott
  3. Ying Na Ho
  4. Harsha Mahabaleshwar
  5. Katherine S Marsay
  6. Changqing Zhang
  7. Christopher KJ Teow
  8. Ser Sue Ng
  9. Weibin Zhang
  10. Vinay Tergaonkar
  11. Lynda J Partridge
  12. Sudipto Roy
  13. Enrique Amaya
  14. Tom J Carney  Is a corresponding author
  1. Lee Kong Chian School of Medicine, Experimental Medicine Building, Yunnan Garden Campus, 59 Nanyang Drive, Nanyang Technological University, Singapore
  2. Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore
  3. Division of Cell Matrix Biology and Regenerative Medicine, School of Biological Sciences, Faculty of Biology, Medicine and Health, University of Manchester, United Kingdom
  4. Department of Molecular Biology and Biotechnology, University of Sheffield, United Kingdom
  5. Department of Biological Sciences, National University of Singapore, Singapore
  6. Department of Pediatrics, Yong Loo Ling School of Medicine, National University of Singapore, Singapore


Epithelial tissues are primed to respond to insults by activating epithelial cell motility and rapid inflammation. Such responses are also elicited upon overexpression of the membrane-bound protease, Matriptase, or mutation of its inhibitor, Hai1. Unrestricted Matriptase activity also predisposes to carcinoma. How Matriptase leads to these cellular outcomes is unknown. We demonstrate that zebrafish hai1a mutants show increased H2O2, NfκB signalling, and IP3R -mediated calcium flashes, and that these promote inflammation, but do not generate epithelial cell motility. In contrast, inhibition of the Gq subunit in hai1a mutants rescues both the inflammation and epithelial phenotypes, with the latter recapitulated by the DAG analogue, PMA. We demonstrate that hai1a has elevated MAPK pathway activity, inhibition of which rescues the epidermal defects. Finally, we identify RSK kinases as MAPK targets disrupting adherens junctions in hai1a mutants. Our work maps novel signalling cascades mediating the potent effects of Matriptase on epithelia, with implications for tissue damage response and carcinoma progression.

eLife digest

Cancer occurs when normal processes in the cell become corrupted or unregulated. Many proteins can contribute, including one enzyme called Matriptase that cuts other proteins at specific sites. Matriptase activity is tightly controlled by a protein called Hai1. In mice and zebrafish, when Hai1 cannot adequately control Matriptase activity, invasive cancers with severe inflammation develop. However, it is unclear how unregulated Matriptase leads to both inflammation and cancer invasion.

One outcome of Matriptase activity is removal of proteins called Cadherins from the cell surface. These proteins have a role in cell adhesion: they act like glue to stick cells together. Without them, cells can dissociate from a tissue and move away, a critical step in cancer cells invading other organs. However, it is unknown exactly how Matriptase triggers the removal of Cadherins from the cell surface to promote invasion.

Previous work has shown that Matriptase switches on a receptor called Proteinase-activated receptor 2, or Par2 for short, which is known to activate many enzymes, including one called phospholipase C. When activated, this enzyme releases two signals into the cell: a sugar called inositol triphosphate, IP3; and a lipid or fat called diacylglycerol, DAG. It is possible that these two signals have a role to play in how Matriptase removes Cadherins from the cell surface.

To find out, Ma et al. mapped the effects of Matriptase in zebrafish lacking the Hai1 protein. This revealed that Matriptase increases IP3 and DAG levels, which initiate both inflammation and invasion. IP3 promotes inflammation by switching on pro-inflammatory signals inside the cell such as the chemical hydrogen peroxide. At the same time, DAG promotes cell invasion by activating a well-known cancer signalling pathway called MAPK. This pathway activates a protein called RSK. Ma et al. show that this protein is required to remove Cadherins from the surface of cells, thus connecting Matriptase’s activation of phospholipase C with its role in disrupting cell adhesion.

An increase in the ratio of Matriptase to HAI-1 (the human equivalent of Hai1) is present in many cancers. For this reason, the signal cascades described by Ma et al. may be of interest in developing treatments for these cancers. Understanding how these signals work together could lead to more direct targeted anti-cancer approaches in the future.


The transmembrane serine protease, Matriptase, encoded by the ST14 gene, has potent oncogenic properties and is consistently dysregulated in human carcinomas. Overexpression of Matriptase in the mouse epidermis leads to epidermal papillomas, ulcerative and invasive carcinomas, and inflammation (List et al., 2005; Martin and List, 2019). These effects of Matriptase are mitigated by a cognate serine protease inhibitor, HAI-1. Clinically, an increase in the Matriptase:HAI-1 ratio has been found in a range of tumours and is predictive of poor outcome (Martin and List, 2019). Loss of mouse Hai1 leads to epidermal and intestinal barrier defects, epithelial inflammation, and failure of placental labyrinth formation, which are all due to unrestricted Matriptase activity (Kawaguchi et al., 2011; Nagaike et al., 2008; Szabo et al., 2007). The response of epithelia to unregulated Matriptase activity appears conserved across vertebrates. Mutation of the zebrafish orthologue, Hai1a, also results in epidermal defects, including loss of membrane E-cadherin, aberrant mesenchymal behaviour of keratinocytes, which form cell aggregations over the body and loss of fin fold integrity. The epidermis also displays sterile inflammation and is invaded by highly active neutrophils. Genetic ablation of the myeloid lineage demonstrated that the keratinocyte phenotypes are not a consequence of the inflammation (Carney et al., 2007). The strong hai1afr26 allele is embryonic lethal, dying within the first week, whilst the more mild allele, hai1ahi2217, is semi-viable, with epithelial defects resolved through sphingosine-1-phosphate-mediated entosis and cell extrusion (Armistead et al., 2020). All hai1a mutant phenotypes can be ameliorated by reduction of Matriptase levels (Carney et al., 2007; Mathias et al., 2007).

Due to the clinical implications of its dysregulation, the signalling pathways activated pathologically by Matriptase are of interest. The G-protein-coupled receptor, proteinase-activated receptor-2 (Par2), is essential for the oncogenic and inflammatory effects of uninhibited Matriptase in zebrafish and mouse (Sales et al., 2015; Schepis et al., 2018). Par2 is directly activated by Matriptase proteolysis and signals through a number of heterotrimeric Gα protein subunits. Early studies in keratinocytes linked Par2 activation with intracellular Ca++ mobilisation via phospholipase C, thus implicating Gq subunit as the canonical target (Schechter et al., 1998). Alternate Gα subunits, including Gi, Gs, and G12/13, are now known to also be activated by Par2 (Zhao et al., 2014). Par2 displays biased agonism, and the logic of the pathway utilised depends on cell context and the activating protease. In vitro experiments using HEK293 cells implicated both Par2 and Gi in Matriptase-mediated Nfκb pathway activation (Sales et al., 2015). Whilst this explains the inflammatory phenotype of uninhibited Matriptase, it does not address whether Par2 promotes carcinoma phenotypes directly in keratinocytes in vivo. In zebrafish, as the keratinocyte defects are not dependent on inflammation, but are dependent on Par2, it is likely that there is a direct effect of Par2 on promoting keratinocyte motility. Par2 can also transactivate EGFR through an unknown mechanism, and inhibition of EGFR alleviates certain basal keratinocyte phenotypes of zebrafish hai1a mutants (Schepis et al., 2018). Thus, the identity, contribution, and interactions of the pathways downstream of Matriptase and Par2 remain unclear. Here through use of the zebrafish hai1a mutant, we comprehensively map the essential pathways downstream of zebrafish Matriptase and Par2, leading to inflammation and epithelial disruption.


Increased hydrogen peroxide and calcium flashes contribute to inflammation in hai1a mutants

Neutrophils in hai1a embryos invade the epidermis, are highly motile, but move randomly (Carney et al., 2007; Mathias et al., 2007Figure 1A–E, Video 1). To establish the nature of their stimulus, we tested if neutrophils in hai1a altered their behaviour in the presence of a large fin wound. In wild-type larvae, neutrophils were recruited from a great distance and tracked to the wound with high directionality. However, neutrophils in the hai1a mutant appeared largely apathetic to the wound and remained migrating randomly. There was a mild increase in neutrophil speed in hai1a larvae following wounding, indicating that they retain capacity to respond to additive stimuli (Figure 1—figure supplement 1A–D, Video 2). Co-labelling of basal keratinocyte nuclei (using TP63 immunostaining), neutrophils (Tg(fli1:EGFP)y1 transgenic), and TUNEL labelling of apoptotic cells highlighted that whilst the epidermis of hai1a mutants, unlike WT, had regions of apoptosis at 24hpf (arrowhead, Figure 1—figure supplement 1E, F), neutrophils were not associated, but rather found at nascent TUNEL-negative aggregates of basal keratinocytes (arrow). We conclude that epidermal cell death does not directly contribute to inflammation and that the effector stimulating neutrophils in hai1a mutants is as, or more, potent as that of wounds.

Figure 1 with 1 supplement see all
The epidermis of hai1a mutants displays elevated hydrogen peroxide.

(A, B) Projected confocal images showing neutrophils populate the tail of hai1ahi2217 mutants (B) but just the vasculature of WT (A) at 4dpf labelled by the Tg(mpx:EGFP)i114 line. Fin extremity outlined in white. (C) Neutrophils move significantly faster in hai1ahi2217 than WT. n = 15; t-test; ***p<0.001. (D, E) Tracks of neutrophil migration taken from Video 1 in WT (D) and hai1ahi2217 (E). (F) Schematic of the Hai1a protein with protein domains given, signal peptide as purple line and transmembrane domain as grey line. Location and nature of the fr26 and two dandruff alleles, ti251 and t419 given. (G) Selected region of 2D gel of protein extracted from 24hpf embryos for hai1at419 (left) or hai1ati251 (right) in red, superimposed over WT protein samples (green in both). The shift in pI of peroxiredoxin4 in both alleles is indicated with an arrow. (H, I) Projected lateral confocal views of pentafluorobenzenesulfonyl fluorescein (PFBSF) staining of WT (H) and hai1ati251/hi2217 (I) tail fins at 48hpf. (J) Box and whiskers plot of PFBSF fluorescent staining intensity of WT and hai1afr26 mutants at 48hpf in trunk and tail. n = 9; t-test ***p<0.001. (K, L) Projected lateral confocal views of PFBSF staining of WT (K) and hai1ahi2217 (L) at 16hpf. Scale bars: (B, I, L) = 100 µm.

Figure 1—source data 1

2D proteomics protein ID report list of the spot identities with significant ratio changes.
Figure 1—source data 2

2D proteomics protein ratio changes for each of the protein spots identified as significantly changed.
Figure 1—source data 3

2D proteomics top 50 proteins significantly changed in hai1a mutants.
Video 1
Neutrophils in WT and hai1ahi2217 4dpf larva.

Projected confocal timelapses of eGFP-positive neutrophils in the tail region of 4dpf Tg(mpx:eGFP)i114 (left) and hai1ahi2217; Tg(mpx:eGFP)i114 (right) larvae taken every 45 s for 45 min. Scale bar: 50 µm.

Video 2
Neutrophils in WT and hai1ahi2217 4dpf larva before and after fin wound.

Projected confocal timelapses of eGFP-positive neutrophils in the tail region of 4dpf Tg(mpx:eGFP)i114 (left) and hai1ahi2217; Tg(mpx:eGFP)i114 (right) larvae taken every 50 s for 250 min with the tail fin cut at 50 min. GFP is overlaid on DIC (Differential Interference Contrast) channel. Scale bar: 50 µm.

To identify the neutrophil activator in hai1a, we employed an unbiased approach using 2D gel proteomics to compare the wild-type proteome with that of strong hai1a alleles. The dandruff (ddf) mutant has many phenotypic similarities to the strong hai1afr26 allele (van Eeden et al., 1996). Crosses between ddfti251 or ddft419 and hai1ahi2217 failed to complement, and sequencing of hai1a cDNA from both ddf alleles identified a nonsense mutation in the ddft419 allele (c.771T>G; p.Tyr257Ter) and a missense mutation of a highly conserved amino acid in the ddfti251 allele (c.749G>A; p.Gly250Asp) (Figure 1F, Figure 1—figure supplement 1G–I). We used both alleles for comparative 2D protein gel analysis at 24hpf and 48hpf. Rather than finding proteins with altered molecular weight, Peroxiredoxin4 (Prdx4) was identified as having a higher pI in both hai1at419 and hai1ati251 mutants at 24hpf and 48hpf, indicative of a change in oxidation state (Figure 1G, Figure 1—figure supplement 1J, K). Peroxiredoxins are hydrogen peroxide scavengers, and its altered oxidation state suggested that hai1a has higher H2O2 levels, a known activator of inflammation in larval zebrafish (Niethammer et al., 2009). Pentafluorobenzenesulfonyl fluorescein (PFBSF) staining Maeda et al., 2004 demonstrated significantly higher levels of H2O2 in the trunk and tails of hai1a mutants at 24hpf and 48hpf (Figure 1H–J, Figure 1—figure supplement 1L, M). This increase in H2O2 in hai1a was observed as early as 16hpf, and thus preceded presentation of hai1a phenotypes (Figure 1K, L).

To demonstrate that, as with other phenotypes, the H2O2 increase in hai1a was due to unrestrained activity of Matriptase1a, we used a matriptase1a mutant allele, st14asq10, which prematurely terminates the protein at 156 amino acids (Figure 2A, Figure 2—figure supplement 1A–CLin et al., 2019). Zygotic st14a mutants showed no overt phenotype; however, maternal zygotic mutants lacked ear otoliths (Figure 2B, C). As expected, when crossed into the hai1a background, embryos lacking otoliths (st14asq10; hai1ahi2217 double mutants) never displayed the hai1a epidermal and neutrophil phenotypes (Figure 2D–F; Table 1). Double mutants also had significantly reduced H2O2 levels (Figure 2F, Figure 2—figure supplement 1D). To determine if reduced H2O2 could account for the rescue of hai1a phenotypes by st14a mutation, we used genetic and pharmacological inhibition of the main enzyme responsible for generating H2O2 in zebrafish, Duox. A morpholino directed against duox successfully reduced H2O2 levels (Figure 2, Figure 2—figure supplement 1D) and neutrophil inflammation in hai1a mutants but did not rescue the epithelial defects (Figure 2F, G). Treatment with a known Duox inhibitor, diphenyleneiodonium (DPI), also resulted in amelioration of neutrophil inflammation, but not epithelial aggregates, in hai1a mutants (Figure 2G, Figure 2—figure supplement 1E). We conclude that Matriptase1 activity leads to excess H2O2 in hai1a mutants, which partially accounts for the neutrophil inflammation, but not epidermal defects.

Figure 2 with 1 supplement see all
Loss of Matriptase1a or Duox1 reduces H2O2 and neutrophils in hai1a mutants.

(A) Schematic of the Matriptase1a protein with domains given and transmembrane domain as grey line. Location and nature of the sq10 allele given by red arrow. (B, C) Lateral DIC (Differential Interference Contrast) images of st14a+/sq10 (B) and MZ st14asq10 (C) otic vesicles at 24hpf showing absence of otoliths (arrowheads in B) in the maternal zygotic st14a mutants. (D, E) Lateral DIC images of hai1ahi2217 single mutant (D) and st14asq10; hai1ah12217 double mutant (E) at 48hpf highlighting rescue of epidermal aggregates and fin morphology (arrowheads) in the double mutants. (F) Projected confocal images of pentafluorobenzenesulfonyl fluorescein (PFBSF) staining at 24hpf (left column), TP63 (magenta), and eGFP (green) antibody staining at 48hpf (middle column) with DIC imaging (right column) for hai1ahi2217 single mutants (top row), st14asq10; hai1ahi2217 double mutants (middle row), and hai1ahi2217 mutants injected with 0.4 mM, duox MO + 0.2 mM tp53 morpholino (bottom row). Individuals for middle and right columns were hemizygous for the Tg(mpx:eGFP)i114 transgene. (G) Counts of eGFP-positive neutrophils on the fins of hai1ahi2217; Tg(mpx:eGFP)i114 or Tg(mpx:eGFP)i114, and either uninjected, injected with morpholino against duox (left side of graph), treated with 0.5% DMSO (Dimethyl sulfoxide) or 40 µM diphenyleneiodonium (DPI) (right side of graph). n = 10; t-test; ***p<0.001; *p<0.05. Scale bars: (C) = 20 µm; (E, F) = 100 µm.

Table 1
Prevalence of otolith and epithelial phenotypes in hai1a and st14a double mutants: p<0.0001 (Chi-squared test).
hai1a+/hi2217; st14a+/sq10 ♂ × hai1ahi2217/hi2217; st14asq10/sq10
Observed (expected)WT epidermishai1a epidermisTotal
Wild-type otoliths72 (65)60 (65)132 (130)
No otoliths128 (65)0 (65)128 (130)
Total200 (130)60 (130)260

Duox is regulated by calcium through its EF-Hand domains, and calcium flashes are known to generate H2O2 in epidermal wounds in Drosophila (Razzell et al., 2013). We injected hai1afr26 with RNA encoding the calcium reporter GCaMP6s. Timelapse imaging at 24hpf indicated that hai1a mutants had significantly more calcium flashes in both the trunk and tail (Figure 3A, B, E, Figure 3—figure supplement 1A, B, Video 3). Increased intracellular calcium dynamics was observable as early as 16hpf, concomitant with increased H2O2, but prior to onset of hai1a phenotypes (Figure 3G, H, Video 4). Release of calcium from intracellular stores is regulated by IP3 receptors located on the endoplasmic reticulum. The frequency and number of calcium flashes in the trunk and tail of hai1a mutants are reduced by treatment with the IP3R inhibitor, 2-APB compared to control (Figure 3C, D, F, Figure 3—figure supplement 1C, D, Video 5). Reducing calcium flashes in hai1a mutant embryos with 2-APB also significantly reduced H2O2 levels (Figure 3I, J, Figure 3—figure supplement 1E) and partially reduced inflammation; however, the epidermal defects were not noticeably rescued (imaged by DIC (Differential Interference Contrast) or labelled with the TP63 antibody) (Figure 3I–K). We observed similar reduction in neutrophil inflammation, but not rescue of epidermal defects, in hai1a mutants treated with thapsigargin, which inhibits the replenishment of ER calcium stores by SERCA (Figure 3K, Figure 3—figure supplement 1F, G). This suggests, in hai1a mutants, that IP3R-dependent calcium flashes activate Duox, flooding the epidermis with H2O2 and leading to inflammation.

Figure 3 with 1 supplement see all
Calcium dynamics in hai1a mutants regulate H2O2 and inflammation.

(A–D) Projected confocal images of eGFP in the tail of WT (A) or hai1afr26; (B–D) injected with GCaMP6s RNA, imaged at 24hpf, indicating calcium dynamics. Embryos are either untreated (A, B), treated with DMSO (C), or with 2.5 µM 2-APB (D). Images are temporal projections of timelapse movies taken at maximum speed intervals (2 min) and projected by time. (E, F) Graphs comparing eGFP intensities from GCaMP6s RNA timelapses in trunk and tail between 24hpf WT and hai1afr26 (E) and between hai1afr26 treated with DMSO and 2.5 µM 2-APB (F). n = 10; t-test; *p<0.05, ***p<0.001. (G, H) Projected light-sheet images of Tg(actb2:GCaMP6s, myl7:mCherry)lkc2 embryos indicating calcium dynamics at 16hpf of sibling (G) or hai1ahi2217 (H). Images are temporal projections of timelapse movies taken at 45 s intervals and projected by time. (I, J) Pentafluorobenzenesulfonyl fluorescein (PFBSF) staining at 24hpf (left column), TP63 (magenta), and eGFP (green) antibody staining at 48hpf (middle column) with DIC imaging (right column) for hai1ahi2217/ti251 mutants (J), or hai1ahi2217/ti247 mutants treated with 2.5 µM 2-APB (I). Individuals for middle and right columns were hemizygous for the Tg(mpx:eGFP)i114 transgene. (K) Counts of eGFP-positive neutrophils in the fins at 48hpf of Tg(mpx:eGFP)i114, or hai1ahi2217; Tg(mpx:eGFP)i114 treated with 0.5% DMSO, 2.5 µM 2-APB, or 6.5 µM thapsigargin. n = 20; t-test; ***p<0.001. Scale bars (AD) = 50 µm; (G, IJ) = 100 µm.

Video 3
Calcium dynamics in WT and hai1afr26 embryos at 24hpf.

Projected confocal timelapses of eGFP in the trunks (left side) and tails (right side) of a 24hpf WT (top row) and hai1afr26 (bottom row) embryos injected with GCaMP6s RNA, indicating calcium dynamics. Scale bar: 50 µm.

Video 4
Calcium dynamics in WT and hai1ahi2217 embryos at 16hpf.

Projected light-sheet timelapses of eGFP in WT (left side) and hai1ahi2217 (right side) embryos at 16hpf. Both embryos carried the Tg(actb2:GCaMP6s, myl7:mCherry)lkc2 transgene reporting calcium dynamics, which were higher in the hai1a mutant, particularly over the yolk. Images were taken every 45 s for 19 min. Scale bar: 50 µm.

Video 5
Calcium dynamics in DMSO and 2-APB-treated hai1afr26 embryos at 24hpf.

Projected confocal timelapses of eGFP signal in the trunks (left side) and tails (right side) of 24hpf hai1afr26 embryos injected with GCaMP6s RNA and treated with 0.03% DMSO (top row) and 2.5 µM 2-APB (bottom row), indicating reduced calcium dynamics following 2-APB treatment. Scale bar: 50 µm.

Hydrogen peroxide elevates NfkB signalling in hai1a mutants

Increased Matriptase, Par2 activity, or hydrogen peroxide levels are known to activate NfkB signalling (Kanke et al., 2001; Sales et al., 2015; Schreck et al., 1991). We crossed the hai1afr26 allele to the NfkB sensor transgenic line Tg(6xHsa.NFKB:EGFP)nc1. In WT embryos, NfkB signalling was mostly restricted to neuromasts at 48hpf, whilst in hai1a mutants we observed an increase in fluorescence at 24hpf and a strong increase at 48hpf. Fluorescence at both timepoints was noted in epidermal aggregates and fin folds, locations of strong inflammation (Figure 4A, B, Figure 4—figure supplement 1A, B). This increase in signalling in 48hpf hai1a mutant embryos was confirmed by qRT-PCR of the NfkB target gene, nfkbiaa (Figure 4C). Unlike calcium and H2O2, NfkB signalling is not present at early stages prior to phenotype (Figure 4—figure supplement 1C, D). To determine the extent that NfkB signalling accounts for the hai1a phenotypes, we generated a mutant in the ikbkg (=ikkg or nemo) gene, which encodes a scaffold protein required for activating the NfkB pathway (Rothwarf et al., 1998) (ikbkgsq304 Gly80ValfsTer11; Figure 4—figure supplement 1E). Crossing this mutant to hai1ahi2217 on the Tg(mpx:eGFP)i114 background realised a very strong rescue of neutrophil inflammation at 48hpf, but no improvement of hai1a epidermal defects (Figure 4D–I). To demonstrate that this increase in NfkB signalling was dependent on H2O2, we injected hai1ahi2217; Tg(6xHsa.NFKB:EGFP)nc1 embryos with duox MO. We noted a strong reduction in NfkB pathway activation compared to uninjected hai1ahi2217 mutant controls (Figure 4J, K). Conversely, genetic ablation of NfkB signalling, through use of the ikbkg mutant, did not reduce H2O2 levels in hai1a mutants (Figure 4—figure supplement 1F, G). Similarly, we tested if reduction of calcium flashes could also reduce NfkB signalling in hai1a mutants using 2-APB but noticed only a slight reduction (Figure 4—figure supplement 1H, I). We propose that upon loss of Hai1a, IP3R-mediated release of calcium activates Duox to increase H2O2. This acts upstream of NfkB pathway activation, which occurs at later stages, and is necessary for the inflammation phenotype.

Figure 4 with 1 supplement see all
NfkB signalling is elevated in hai1a mutants and is necessary for neutrophil inflammation.

(A, B) Lateral confocal projections of Tg(6xHsa.NFKB:EGFP)nc1 embryos reporting NfkB signalling levels at 48hpf for WT (A) and hai1afr26 (B). (C) qPCR of cDNA levels of NfkB target gene nfkbiaa in hai1afr26 vs. sibs at 48hpf. n = 3, 200 embryos pooled in each, t-test *p<0.05. (D–E′) Projected confocal images of the tail fins of 48hpf Tg(mpx:eGFP)i114; hai1ahi2217 embryos, immunostained for TP63 (magenta) and eGFP (green) (D, E) with corresponding DIC image (D′, E′). Embryos were either mutant for ikbkg (ikbkgsq304, E–E′) or heterozygous (ikbkg+/sq304; D–D′). (F) Counts of eGFP-positive neutrophils in the fins at 48hpf of hai1ahi2217; ikbkg+/sq304 and hai1ahi2217; ikbkgsq304. Embryos were hemizygous for Tg(mpx:eGFP)i114. n = 9; t-test; ***p<0.001. (G–I) Lateral DIC images of the trunk of hai1a+/hi2217; ikbkg+/sq304 (G), hai1ahi2217; ikbkg+/sq304 (H), and hai1ahi2217; ikbkgsq304 (I). Loss of IKBKG does not rescue epidermal defects of hai1a mutants (arrowheads). (J, K) Lateral confocal projections of Tg(6xHsa.NFKB:EGFP)nc1 embryos reporting NfkB signalling levels at 32hpf of hai1ahi2217 uninjected (J) or injected with duox MO (K). Loss of H2O2 reduces NfkB signalling levels in hai1a mutants. Scale bars: (A, K) = 200 µm; (D′, I) = 50 µm.

Both inflammation and epidermal aggregates of hai1a mutants are resolved by Gq inhibition

IP3 is generated from cleavage of PIP2 by Phospholipase C. The sensitivity of the hai1a mutants to 2-APB implies that IP3 levels are increased and therefore there may be an increase in Phospholipase C activity. Numerous attempts to inhibit PLC in hai1a mutants failed, and we were unable to find a dosage window that rescued without gross embryo deformity. Hence, we tested rescue of hai1a mutants with YM-254890, an inhibitor of the heterotrimeric G protein alpha subunit, Gq, which directly activates PLC isoforms. We found that not only did this significantly reduce neutrophil inflammation (Figure 5D, F), but surprisingly, it also significantly rescued the epidermal defects in hai1a mutants, with a significant reduction in TP63-positive epidermal aggregates in the trunk and improved tail fin fold integrity at 48hpf (Figure 5A–E).

Gq inhibition rescues both epidermal and inflammation phenotypes of hai1a mutants.

(A–D) Lateral images of ventral trunk and tail at 48hpf for WT (left panels), hai1ahi2217 treated with 0.5% DMSO (middle panels), and hai1ahi2217 treated with 32 µM YM-254890 (right panels). DIC micrographs are shown in (AB), whilst projected confocal images are shown in (CD), where embryos are immunostained for TP63 (C, D; magenta) and eGFP (D; green). Embryos in (D) are hemizygous for Tg(mpx:eGFP)i114. Arrowheads indicate region of aggregate formation lost upon treatment with Gq inhibitor YM-254890. (E) Pie charts showing proportion of embryos with no (WT; white), mild (grey) or severe (black) hai1a mutant epidermal phenotypes. Embryos were derived from hai1ahi2217/hi2217 × hai1a+/hi2217 crosses and assayed at 48hpf. Clutches treated with 0.5% DMSO (upper pie chart) were compared to those treated with 32 µM YM-254890 (lower pie chart) by Chi-squared analysis. ***p<0.001; n = 72. (F) Graph of counts of eGFP-positive neutrophils in the fins at 48hpf of Tg(mpx:eGFP)i114, or hai1ahi2217; Tg(mpx:eGFP)i114 treated with 0.5% DMSO, or 32 µM YM-254890. n = 6; Mann–Whitney test; **p<0.01. Scale bars: (AD) = 100 µm.

PMA treatment phenocopies the hai1a mutant

As IP3R inhibition only blocks inflammation in hai1a mutants, but an inhibitor of a PLC activator (Gq) additionally reduces the epidermal defects, we considered that diacyl glycerol (DAG) might contribute to the epidermal defects as the second product of PIP2 cleavage (along with IP3). Indeed, treating WT embryos from 15hpf to 24hpf with 125 ng/ml phorbol 12-myristate 13-acetate (PMA), a DAG analogue, resulted in embryos with striking similarities to strong hai1a mutants, including a thin or absent yolk sac extension, lack of head straightening, lack of lifting the head off the yolk, and multiple epidermal aggregates on the skin (Figure 6A–C). These aggregates were due, at least partially, to displacement of basal keratinocytes as shown by TP63 staining where the basal keratinocyte nuclei lost their uniform distribution (Figure 6D, E). Treatment from 24hpf to 48hpf with 125 ng/ml PMA led to a fin defect similar to the dysmorphic hai1a mutant fin (Figure 6F, G). It has been shown that the basal keratinocytes in hai1a lose their epithelial nature and adopt a partially migratory phenotype (Carney et al., 2007Video 6). We treated Tg(krtt1c19e:lyn-tdtomato)sq16 larvae (Lee et al., 2014) with 37.5 ng/ml PMA for 12 hr and imaged the basal epidermis at 3dpf by light-sheet timelapse. Whilst the DMSO-treated transgenic larvae had very stable keratinocyte membranes and shape, PMA treatment led to a less stable cell membrane topology and dynamic cell shape, similar to hai1a mutants (Figure 6H, Videos 7 and 8). Kymographs taken from Video 7 highlighted both the more labile and weaker cell membrane staining following PMA treatment (Figure 6I). The potency of PMA was dependant on region and reduced with age.

Phorbol 12-myristate 13-acetate (PMA) induces epidermal aggregates, motility, H2O2, NfkB, and inflammation.

(A, B) Lateral micrographs of embryos treated with DMSO (A) or 125 ng/ml PMA (B, C) showing generation of epidermal aggregates (arrowheads). (D, E) Projected confocal images of the trunk of 24hpf WT embryos treated with 0.1% DMSO (D) or 125 ng/ml PMA (E) and immunostained for TP63 (magenta), showing aggregation of TP63-positive cells. (F, G) Projected confocal images superimposed on DIC image of the tail of 48hpf Tg(mpx:eGFP)i114 embryos treated with 0.1% DMSO (F) or 125 ng/ml PMA (G) showing fin defect and activation of eGFP-positive neutrophils (green, G). (H, I) Single timepoint images at t = 0 (top panels, H) and t = 1800 s (lower panels, H) and kymographs (I) derived from light-sheet movies (Video 7) of the epidermis of 3dpf Tg(krtt1c19e:lyn-tdtomato)sq16 larvae treated with 0.1% DMSO (left panels) or 37.5 ng/ml PMA (right panels) showing the lack of membrane stability following PMA treatment. (J–K′) Single frames (J, K) and tracks of eGFP- positive neutrophils (J′, K′) from light-sheet (Video 8) showing neutrophils labelled by eGFP and basal keratinocyte cell membranes labelled by lyn-tdTomato in the trunk of a 3dpf Tg(krtt1c19e:lyn-tdtomato)sq16 larva treated with 0.1% DMSO (J, J′) or 37.5 ng/ml PMA (K, K′) for 18 hr, and imaged every 20 s for 30 min. Track colour in (J′, K′) denotes mean velocity (dark blue 0.0 – red 0.2). (L–O) Projected lateral confocal views of pentafluorobenzenesulfonyl fluorescein (PFBSF) staining of 24hpf WT embryos treated with 0.1% DMSO (L, N) or 125 ng/ml PMA (M, O) showing elevation of H2O2 in the trunk (L, M) and tail (N, O). (P, Q) Projected confocal images of eGFP in the tail at 24hpf of WT injected with GCaMP6s RNA, treated with DMSO (P), or with 125 ng/ml PMA (Q). Images are temporal projections of timelapse movies taken at maximum speed intervals (2 min) and projected by time. (R) Plot of PFBSF fluorescent staining intensity of WT embryos treated with 0.1% DMSO or 125 ng/ml PMA in the trunk and tail. n = 6; ANOVA with Bonferroni post-test **p<0.01. (S) Graph comparing eGFP intensities from 24hpf GCaMP6s RNA timelapses in tail following treatment with DMSO and 125 ng/ml PMA. n = 10; t-test. (T–U) Lateral confocal projections of Tg(6xHsa.NFKB:EGFP)nc1 embryos reporting NfkB signalling levels at 48hpf in WT treated with DMSO (T) and WT treated with 125 ng/ml PMA (U). Scale bars: (A, B, C, F) = 100 µm; (D, J, Q) = 50 µm; (H, I) = 20 µm; (U) = 200 µm.

Video 6
Basal keratinocyte membrane and neutrophil dynamics in 3dpf wild-type and hai1ahi2217 larvae carrying the Tg(krtt1c19e:lyn-tdtomato)sq16 and Tg(mpx:eGFP)i114 transgenes.

Projected light-sheet timelapses of the trunk of 3dpf WT (left) and hai1ahi2217 (right) larvae with neutrophils and basal keratinocyte membranes labelled by eGFP and lyn-tdTomato, respectively. Both larvae carried the Tg(krtt1c19e:lyn-tdtomato)sq16; Tg(mpx:eGFP)i114 transgenes. The hai1a mutants have highly dynamic neutrophils and keratinocyte membrane dynamics. Scale bar: 20 µm.

Video 7
Basal keratinocyte membranes in DMSO and phorbol 12-myristate 13-acetate (PMA)-treated 3dpf Tg(krtt1c19e:lyn-tdtomato)sq16 larvae.

Zoomed projected light-sheet timelapses of basal keratinocyte membranes labelled by lyn-tdTomato in the trunk of 3dpf Tg(krtt1c19e:lyn-tdtomato)sq16 larvae treated with 0.1% DMSO (left) and 37.5 ng/ml PMA (middle and right) for 18 hr. Membranes are stable in DMSO-treated larvae but were dynamic in PMA-treated larvae. Images were captured every 20 s. Scale bar: 10 µm.

Video 8
Neutrophils and basal keratinocyte membranes in DMSO and phorbol 12-myristate 13-acetate (PMA)-treated 3dpf Tg(krtt1c19e:lyn-tdtomato)sq16; Tg(mpx:eGFP)i114 larvae.

Lateral projection of light-sheet timelapse of neutrophils labelled by eGFP and basal keratinocyte cell membranes labelled by lyn-tdTomato in the trunks of 3dpf Tg(krtt1c19e:lyn-tdtomato)sq16 larva treated with 0.1% DMSO (left) and 37.5 ng/ml PMA (right) for 18 hr. PMA treatment leads to slightly dynamic cell membranes and motile neutrophils. Images were captured every 20 s for 30 min. Scale bar: 50 µm.

Most PMA-treated Tg(mpx.eGFP)i114 larvae at 48hpf also had more neutrophils in the epidermis than untreated controls, which were highly migratory (Figure 6F–G, J–K′, Video 8). We determined H2O2 levels in PMA-treated embryos using PFBSF staining and found that it was significantly increased in both trunk and tail at 24hpf (Figure 6L–O, R). In contrast, when we treated GCaMP6s RNA-injected embryos with PMA, we failed to see an increase in calcium flashes, as seen in hai1a (Figure 6P, Q, S). To see if the heightened H2O2 and inflammation was also correlated with increased NfkB signalling, we treated Tg(6xHsa.NFKB:EGFP)nc1 embryos with 125 ng/ml PMA. There was a robust increase in fluorescence, indicating that PMA activates the NfkB pathway (Figure 6T, U).

The phenocopy and the rescue of hai1a by PMA and Gq inhibition respectively imply that DAG is elevated in hai1a mutants. Elevated cellular DAG leads to relocalisation of Protein Kinase C isoforms to the plasma and nuclear lipid membranes where they bind DAG and become activated. Using a GFP-tagged PKCδ fusion protein (Sivak et al., 2005), we showed that in the WT embryo there was largely diffuse cytoplasmic PKCδ-GFP signal, however, it translocated to plasma and nuclear membranes in hai1a mutants, indicating increased levels of DAG (Figure 7A, B, Figure 7—figure supplement 1A, B). This is indeed relevant to the epidermal defects, as treatment of hai1ahi2217 embryos with the PKC inhibitor, GFX109203, reduced the epidermal aggregates and disruption of fin morphology as imaged by DIC or immunostaining for TP63 (Figure 7C–H). Neutrophil inflammation in the epidermis was somewhat reduced, but not to a significant degree (Figure 7E–I). Thus, these experiments strongly suggest that epithelial defects of hai1a are due to DAG generation and PKC activation.

Figure 7 with 1 supplement see all
Inhibition of PKC rescues epidermal defects of hai1a.

(A, B) Confocal images of the ventral fin of 22hpf sibling (A) or hai1ahi2217 (B) embryos injected with RNA encoding PKCδ-GFP. Mostly cytoplasmic distribution in sibling was relocated to cell and nuclear membranes in hai1a mutants. (C, D) Lateral brightfield images of 48hpf hai1ahi2217 larvae treated with 0.5% DMSO (C) or 85 µM GFX109203 (D). Epidermal aggregates and fin deterioration are rescued by the PKC inhibitor (arrowheads). (E–H) DIC (E, G) and projected confocal images (E′, G′, F, H) of hai1ahi2217; Tg(mpx:eGFP)i114 trunk at 24hpf (E–E′, G–G′) and tail at 48hpf (F, H), either treated with 0.5% DMSO (E–F) or 85 µM GFX109203 (G–H). Embryos are immunostained for TP63 (magenta) and eGFP (green), highlighting rescue of epidermal phenotype and partial rescue of neutrophils by GFX109203. (I) Counts of eGFP-positive neutrophils in the fins at 48hpf of Tg(mpx:eGFP)i114, or hai1ahi2217; Tg(mpx:eGFP)i114 treated with 0.5% DMSO or 85 µM GFX109203. n = 8; ANOVA, Dunn’s multiple comparisons; **p<0.01. Scale bars: (A) = 10 µm; (D) = 200 µm; (H) = 100 µm.

Elevated MAPK signalling generates epithelial defects in hai1a

We next sought to determine which pathways downstream of PKC are responsible for the epidermal defects. The MAPK pathway is a major target pathway of multiple PKC isoforms, and activation of this pathway in zebrafish epidermis has previously been shown to induce papilloma formation which have very similar attributes to hai1a mutant aggregates (Chou et al., 2015). Although whole embryo western analysis of hai1a mutants failed to show an overall increase in pERK (Armistead et al., 2020), we performed wholemount immunofluorescent analysis in case there was only a localised effect. Indeed, we observed a significant and localised increase in cytoplasmic pERK immunoreactivity (phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204)) in the regions of epidermal aggregate formation in hai1a mutants and in PMA-treated embryos, including under the yolk at 24hpf and in the fins at 24hpf and 48hpf (Figure 8A–K, Figure 8—figure supplement 1A–F). There was no increase in total ERK levels in the mutant (Figure 8—figure supplement 1M, N). Increased pERK was seen in both the cytoplasm and nucleus of TP63-positive cells but was only increased in the nucleus of periderm cells (Figure 8E–E′, Figure 8—figure supplement 1D). To establish that this is an early marker of aggregate formation, and not a sequela, we stained hai1a mutant embryos at earlier timepoints. We found that at 16hpf regions of the epidermis have pERK staining before overt aggregation formation (Figure 8G–H), whilst nascent aggregates also contain pERK staining which increases in number over time (Figure 8—figure supplement 1G–L).

Figure 8 with 1 supplement see all
Elevation of pERK levels in phorbol 12-myristate 13-acetate (PMA)-treated and hai1a mutant epidermis.

(A–L) Lateral projected confocal images of trunks (A, A′, B, E, E′, F), yolk surface (G, G′, H) and tails (C, C′, D, I, I′, J) of embryos immunostained for TP63 (A′, B, C′, D, E′, F, G′, H, I′, J; magenta) and pERK (AJ; green) at 24hpf (A–F), 16hpf (G–H), and 48hpf (I–J). Both hai1afr26 (A, A′, C, C′, E, E′, G, G′) and 125 ng/ml PMA-treated (I, I′) embryos show increased epidermal pERK levels compared to untreated WT (B, D, F, H, J). Elevation of epidermal pERK in hai1afr26 mutants and PMA- treated embryos is seen in the trunk (A, E) and tail (C, I) as well as in epidermis over the yolk prior to overt phenotype manifestation (G). (K) Quantification of pERK immunofluorescent intensity in the tail of 24hpf hai1afr26 larvae compared to siblings. n = 5; Mann–Whitney test; **p<0.01. Scale bars: (B) = 100 µm; (D, H, J) = 50 µm; (F) = 20 µm.

To determine if elevated pERK is causative of epidermal defects, we attempted to rescue using pERK inhibitors. Initially we used PD0325901; however, this appeared to give fin fold deformities, even in WT embryos (Anastasaki et al., 2012), precluding ability to assess rescue in hai1a, although there was a noticeable reduction in epidermal aggregates forming under the yolk-sac extension (data not shown). Instead, we tried U0126 and CI-1040, other well-known pERK inhibitors (Allen et al., 2003; Favata et al., 1998). Both inhibitors showed a significant reduction in hai1a mutant epidermal aggregates under the yolk, and restoration of the overall and tail epithelial morphology, with embryos showing a hai1a phenotype class significantly reduced (Figure 9A–G, Figure 9—figure supplement 1A–F). Similarly, the epidermal defects of the trunk, yolk, and tail following PMA treatment were also ameliorated by concomitant U0126 treatment (Figure 9H, I, Figure 9—figure supplement 1G, H). Rescue of aggregates and tail morphology following PMA treatment or in hai1a mutants could be visualised by immunolabelling TP63 in basal keratinocyte nuclei (Figure 9J–O, Figure 9—figure supplement 1I, J). Initiating U0126 treatment later at 26hpf led to only a partial rescue, indicating that the epidermal phenotypes were likely due to sustained pERK activation (Figure 9—figure supplement 1K–M′).

Figure 9 with 2 supplements see all
Rescue of the hai1a epidermal phenotype by pERK inhibitors.

(A–F) Lateral DIC images of 24hpf (A, B) or 48hpf (C–F) hai1ahi2217 embryos treated with either DMSO (A, C, E), 1.3 µM CI-1040 (B), or 100 µM U0126 (D, F) showing rescue of general morphology (B), trunk (D), and tail (F) epidermal phenotypes compared to DMSO-treated hai1ahi2217. Epidermal aggregates under the yolk are reduced in the treated mutants (AD; arrowheads). (G) Proportion of 48hpf larvae derived from hai1a+/hi2217 incross showing mild or severe hai1a epidermal phenotype following DMSO (upper) or U0126 (lower) treatment (Chi-squared test). (H, I) Lateral DIC images of 24hpf embryo treated with 125 ng/ml phorbol 12-myristate 13-acetate (PMA) (H) or PMA and U0126 (I). Yolk-associated epidermal aggregates are reduced. (J–M) Lateral projected confocal images of hai1ahi2217; Tg(mpx:eGFP)i114 trunk at 24hpf (J, K) and tail at 48hpf (L, M), either treated with 0.5% DMSO (J, L) or U0126 (K, M). Embryos are immunostained for TP63 (magenta) and eGFP (green), highlighting rescue of epidermal phenotype but no reduction of neutrophils. (N, O) Lateral projected confocal images of Tg(mpx:eGFP)i114 treated with PMA alone (N) or PMA with U0126 (O) and immunostained for TP63 (magenta) and eGFP (green). Fin morphology is restored but neutrophils are still present. (P) Quantification of neutrophils in the fins showing U0126 does not reduce inflammation induced by loss of hai1a or PMA treatment. n = 8; ANOVA with Bonferroni post-test; ***p<0.001. (Q–X) Projected confocal images of 48hpf larval tails immunostained for β-catenin (green) and TP63 (magenta; R, T, V, X) of WT (Q, R, U, V) and hai1ahi2217 (S, T, W, X), either untreated (Q–T), treated with PMA (U, V) or U0126 (W, X). (YAA) Profile plots of fluorescence distribution across cells of WT (Y), hai1ahi2217 (Z), and hai1ahi2217 treated with U0126 (AA). X-axis represents width of the cell. β-catenin immunofluorescence intensity (Y-axis) shows majority at cell edge (demarcated in light purple) in WT and rescued hai11a mutants, but is distributed in cytoplasm in mutant. Two cells per 3–5 larvae were analysed. Scale bars: (B) = 200 µm, (F, I, K, O) = 100 µm, (V) = 20 µm.

Treatment with U0126 did not significantly reduce neutrophil inflammation of hai1a mutants or PMA treatment (Figure 9L–P). This suggests that the inflammation phenotype is not simply a consequence of the epidermal defects. Furthermore, dye penetration assays showed that the epithelial barrier was not globally and overtly compromised in hai1a, underscoring that inflammation is not simply a consequence of epithelial defects (Figure 9—figure supplement 2A–H). It has been shown that the epidermal defects in hai1a are associated with loss of E-cadherin from adherens junctions (Carney et al., 2007). As there was a rescue of the epithelial phenotype following pERK inhibition, we looked at the status of the adherens junction marker β-catenin. Whilst the WT basal epidermal cells of the 48hpf tail showed strong staining at the membrane, hai1a mutants and PMA-treated embryos showed a significant loss of β-catenin at the membrane and increase in the cytoplasm (Figure 9Q–V, Y, Z). Treatment of hai1a mutants with U0126 restored the membrane localisation of β-catenin (Figure 9W, X, AA).

Phosphorylation of cytoplasmic RSK by pERK leads to loss of E-cadherin at the hai1a keratinocyte membrane

As increased pERK appeared to contribute strongly to loss of adherens junctions and removal of E-cadherin/β-catenin from the membrane, we sought to determine how pERK signalling might affect adherens junctions. We predicted that this would occur through a cytoplasmic target of pERK as we have previously shown that there is no transcriptional downregulation of E-cadherin levels in hai1a, making a nuclear transcription factor target less likely to be relevant (Carney et al., 2007). The p90RSK family of kinases represents direct cytoplasmic targets of Erk1/2 phosphorylation which regulate cell motility, and thus were good candidates for mediators disrupting cell-cell adhesion (Čáslavský et al., 2013; Tanimura and Takeda, 2017). We determined that at least RSK2a (=p90RSK2a, encoded by rps6ka3a) is expressed in basal keratinocytes at 24hpf (Figure 10A, B). To gauge if there was an alteration in phosphorylation of RSK family members in the epidermis of hai1a mutants, we used an antibody which detects a phosphorylated site of mouse p90RSK (Phospho-Thr348). This site is phosphorylated in an ERK1/2-dependent manner (Romeo et al., 2012). We noticed a substantial increase in cytoplasmic signal in both hai1a mutants and PMA-treated embryos. Where p90RSK-pT348 signal was largely nuclear in both basal and periderm cells in WT, it was more broadly observed in hai1a mutant fins, with an increase in the cytoplasm leading to a more uniform staining (Figure 10C–D′). This increase in cytoplasmic levels of p90RSK-pT348 was observable at 17hpf prior to epithelial defects (Figure 10—figure supplement 1A–C). p90RSK cytoplasmic signal was lost upon U0126 and GFX109203 treatments, showing that it was pERK and PKC dependant (Figure 10E, E′, Figure 10—figure supplement 1D, E). Similarly, increased cytoplasmic p90RSK-pT348 was observed following PMA treatment which was reduced by co-treatment with U0126 (Figure 10F–H′). The increase in cytoplasmic p90RSK-pT348 signal, and its reduction by U0126, was significant in both hai1a mutants and PMA-treated embryos (Figure 10I, J).

Figure 10 with 1 supplement see all
Altered RSK status in hai1ahi2217 accounts for epidermal defects.

(A, B) In situ hybridisation of rps6ka3a at 24hpf under low- (A) and high-power (B) magnification showing expression in basal keratinocytes. Open arrowheads in (B) indicate borders of EVL cells bisecting nuclei of underlying rps6ka3a-positive cells. (C–H′) Lateral projected confocal images of the tails of embryos immunostained for p90RSK (Phospho-Thr348) (C–H′) and TP63 (C′–H′). In both the hai1ahi2217 (D, D′) and 125 ng/ml phorbol 12-myristate 13-acetate (PMA)-treated (G, G) embryos, there is an increase in cytoplasmic levels of p90RSK (Phospho-Thr348) signal above the nuclear only signal seen in WT (C, C′) or DMSO (F, F′). Treatment with the pERK inhibitor U0126 reduced cytoplasmic levels but did not affect nuclear signal (E, E′; H, H′), (I, J) Quantification of immunofluorescent intensity of cytoplasmic levels of p90RSK (Phospho-Thr348) in basal keratinocytes of tails of 48hpf WT and hai1ahi2217, treated with DMSO or U0126 (I), and PMA or PMA plus U0126 (J). Nucleus signal was excluded by masking from the DAPI channel. n = 5; t-test; ***p<0.001, **p<0.01, *p<0.05. (K–N) Lateral DIC images of hai1ahi2217 embryos at 24hpf (K, L) and 48hpf (M, N) untreated (K, M) or treated with 1.2 µM BI-D1870 (L) or 9 µM dimethyl fumarate (DMF). Locations of epidermal aggregates and loss of tail fin morphology in hai1a mutants, and their rescue by RSK inhibitor treatment are indicated by arrowheads. (O–Q) Lateral projected confocal images of the tails of embryos immunostained with antibodies against E-cadherin and TP63in WT (O, P) and hai1ahi2217 treated with DMF (Q). (O′–Q′) Profile plots of fluorescence distribution across cells of WT (O), hai1ahi2217 (P′), and hai1ahi2217 treated with DMF (Q′). X-axis represents width of the cell. β-Catenin immunofluorescence intensity (Y-axis) shows majority at cell edge (E-cadherin domain demarcated in light purple) and centre of cell (nucleus demarcated in light green) in WT and rescued hai11a mutants, but there is no clear membrane signal in the untreated hai1a mutants. Two cells per five larvae were analysed. Scale bars: (A, K, N) = 100 µM; (B, H) p=20 µM.

If phosphorylation of an RSK protein is required for mediating the pERK epidermal defects in hai1a mutants, then inhibition of RSK should rescue the epidermal defects. As morpholino-targeted inhibition of rps6ka3a was unsuccessful, we employed established pan-RSK inhibitors BI-D1870 and dimethyl fumarate (Andersen et al., 2018; Sapkota et al., 2007). Dimethyl fumarate treatment reduced the extent of cytoplasmic p90RSK-pT348 in hai1a (Figure 10—figure supplement 1F, G). We noted that both inhibitors were able to reduce epidermal aggregates in hai1a mutants and restore fin morphology when visualised by DIC or TP63 immunofluorescence (Figure 10K–N, Figure 10—figure supplement 1H, I, K, L). Reduction of mutant phenotype classes was significant at both 24hpf and 48hpf (Figure 10—figure supplement 1J). We then assayed if RSK inhibition can reduce the aberrant cytoplasmic E-cadherin staining in hai1a mutant basal keratinocytes and observed that dimethyl fumarate treatment restored membrane localisation of E-cadherin in the mutants (Figure 10O–Q′). Thus, phosphorylation of RSK proteins is altered in hai1a mutants, and their inhibition appears to restore E-cadherin to the membrane and reduce epidermal aggregate formation.


There are a number of similarities between loss of Hai1a in zebrafish and overexpression of Matriptase in the mouse epidermis, including inflammation, hyperproliferation, and enhanced keratinocyte motility, suggesting conservation of downstream pathways. What the conserved ancestral role of the Matriptase-Hai1 might have been is unclear. Matriptase dysregulation in the mouse is associated with cancer progression (Martin and List, 2019). Tumours have long been considered to represent non-healing wounds, and the cellular- and tissue-level phenotypes of hai1a have similarities to tumours. Epidermal cells in zebrafish transformed by MAPK activation both promote and respond to inflammation through similar mechanisms to wound responses (Feng et al., 2010; Schäfer and Werner, 2008). Further, tissue damage of the zebrafish epidermis perturbs osmolarity and releases nucleotides, leading to inflammation and epithelial cell motility, with the resulting phenotypes strikingly similar to hai1a mutants (de Oliveira et al., 2014; Enyedi and Niethammer, 2015; Gault et al., 2014; Hatzold et al., 2016). Indeed, the tissue responses initiated by loss of zebrafish Hai1a have been previously suggested to represent an early injury response (Schepis et al., 2018), whilst PAR2 synergises with P2Y purinergic and EGF receptors to promote cell migration in scratch assays (Shi et al., 2013). Thus our analysis supports the previous hypothesis of the Hai1-Matriptase system as a component of tissue injury responses (Schepis et al., 2018), which, if inappropriately activated, promotes carcinoma.

The various molecular pathways known to be activated by Matriptase have not been fully delineated or integrated. Par2 has previously been shown to be required for the hai1a phenotype in zebrafish and contributes to the phenotypes of Matriptase overexpression in the mouse. Exactly which heterotrimeric G-protein Par2 is activating in vivo and how this links to phenotypes has not been identified. Our analyses allow us to propose a pathway downstream of Par2 which accounts for both the inflammatory and the epidermal phenotypes (Figure 11). Firstly, inhibition of Gq rescued both the inflammation and epithelial defects. PAR2 activation of Gq has been documented to occur in many cell types including keratinocytes, where inhibition of Gq and PKC reduces PAR2-mediated Nfκb signalling (Böhm et al., 1996; Goon Goh et al., 2008; Macfarlane et al., 2005). Although we were unable to rescue hai1a phenotypes with a PLC inhibitor due to toxicity, genetic sensors demonstrated increased levels of Ca++ and DAG in hai1a epidermis. Our analysis demonstrated that the different products of PIP2 hydrolysis appear to invoke the two main hai1a phenotypes to different extents. IP3R-dependent calcium release in hai1a epidermis was required for Duox activity, high hydrogen peroxide levels, and, later, increased NfkB signalling. Reduction of these attenuated the inflammatory, but not epithelial, defects. Conversely, inhibiting the DAG receptor, PKC, rescued the epithelial phenotypes, and the inflammation slightly. The DAG analogue, PMA, phenocopied the epidermal defects of hai1a mutants but also increased H2O2, NfkB, and neutrophil inflammation, indicating that PKC activation may be sufficient, but not necessary, for inflammation. This is in line with known activation of Duox and IKK by PKC (Rigutto et al., 2009; Turvey et al., 2014). In addition, expression of activated Ras in zebrafish keratinocytes has been shown to lead to H2O2 release and neutrophil attraction (Feng et al., 2010). Thus, there is likely to be dual contribution to the inflammatory phenotype from IP3 and DAG. It is important to stress however that the inflammation is not simply a result of epithelial defects or an overt loss of barrier. Firstly, we see increase in Ca++ and H2O2 very early in the epidermis prior to skin defects. Secondly, barrier assays failed to conclusively show a broad increase in permeability. Finally, rescue of epithelial defects by PKC and pERK inhibition did not fully rescue the inflammation. We conclude in our model that DAG contributes to both aspects of the phenotype, but IP3 promotes only the inflammation.

Model of pathway-activated downstream of Hai1 and Matriptase.

Proposed model of pathways downstream of Hai1 which drives chronic and acute sterile inflammation (red) and epithelial motility (blue). A previously defined transactivation of EGFR is also integrated. Other pathways known to act downstream of Matriptase, involving cMet, PI3K, AKT, and mTOR, are not shown.

Seminal experiments in transgenic mice overexpressing Matriptase in the epidermis and treated with a DMBA/PMA regime concluded that Matriptase and PMA activate functionally similar carcinoma promoting pathways (List et al., 2005). Our subsequent analysis suggests that this would include the MAPK pathway as we see increased phosphorylated-ERK in the epidermis of both hai1a mutants and also PMA-treated embryos. That we can rescue the epithelial defects using a MEK inhibitor indicated that this increase in epidermal pERK is likely critical to the phenotype. The MAPK pathway is known to regulate cell motility (Tanimura and Takeda, 2017). In the zebrafish epidermis, misexpression of activated MEK2 generated papillomas with remarkable resemblance to the epidermal aggregates in hai1a mutants (Chou et al., 2015), and which are not overtly proliferative. In astrocytes and oesophageal or breast tumour cell lines, PAR2 stimulates migration and invasiveness through MAPK/ERK, activation of which required Gq and PIP2 hydrolysis (Jiang et al., 2004; McCoy et al., 2010; Morris et al., 2006; Sheng et al., 2019).

One of the main molecular defects defined for zebrafish hai1a is the removal of adherens junction proteins from the membrane (Carney et al., 2007). MAPK signalling has been shown to reduce E-cadherin expression at adherens junctions and promote cytoplasmic accumulation through phosphorylation of the effector, RSK (Čáslavský et al., 2013). Like Matriptase, activation of RSK2 is associated with tumour progression, promoting invasiveness and metastasis of glioblastomas and head and neck squamous cell carcinomas (Kang et al., 2010; Sulzmaier et al., 2016). Promotion of invasiveness has also been noted for activated RSK1, which promotes invasion of melanoma clinically as well as in vitro and zebrafish melanoma models (Salhi et al., 2015). Intriguingly, proximity protein labelling has identified p120-catenin as a target of RSK phosphorylation. This catenin promotes cell-cell adhesion by stabilising cadherins at junctions, a function inhibited by RSK phosphorylation (Méant et al., 2020). More broadly, RSK2 activity promotes cell motility through other mechanisms, including inactivation of Integrins and activation of the RhoGEF, LARG (Gawecka et al., 2012; Shi et al., 2018). Thus, we propose that pERK signalling, through RSK members, significantly contributes to dissolution of adherens junctions and the hai1a epidermal phenotype. We observed increased pERK in the cytoplasm and also the nucleus of keratinocytes, with comparatively more nuclear levels in periderm cells. Thus, whilst RSKs are phosphorylated by pERK, it is also likely that other cytoplasmic and also nuclear targets, such as cFos and Ets transcription factors, may also be activated, and that there are underlying transcriptional changes in hai1a mutants. It is not clear why pERK shows slightly different subcellular localisation patterns between the two different epidermal layers, but the two layers do respond differently to ErbB2 inhibition (Schepis et al., 2018), whilst calcium is recently described to alter nuclear shuttling of pERK (Chuderland et al., 2020).

Our model for how Matriptase invokes cellular responses is highly likely to be incomplete. Indeed, others have indicated MMPs, HB-EGF, EGFR, and AKT and are downstream of Matriptase and PAR2 function (List et al., 2005; Schepis et al., 2018Darmoul et al., 2004Chung et al., 2013; Rattenholl et al., 2007). Furthermore, Matriptase promotes HGF–cMet signalling in mouse (Szabo et al., 2011). We do not think that these conflict with our model but will interface with it. A number of reports have demonstrated that PI3K/AKT and MEK/ERK function in parallel downstream of PAR2 (Sheng et al., 2019; Tanaka et al., 2008; van der Merwe et al., 2009). Furthermore, there is evidence that PKC activates both MEK/ERK and EGFR independently following PAR2 stimulation, and that PI3K is activated by PAR2 via Gq (Wang and DeFea, 2006Al-Ani et al., 2010). Cell identity, subcellular localisation, β-arrestin scaffolding, and biased agonism/antagonism are known to generate alternative downstream outputs from PAR2 (Zhao et al., 2014). To understand fully the roles of Matriptase and PAR2 in epithelial homeostasis and carcinoma, it will be critical to map how, when, and where they activate different downstream pathways.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Gene (Danio rerio)hai1aGenBankNM_213152=spint1a
Gene (Danio rerio)matriptase1aGenBankNM_001040351=st14 a
Gene (Danio rerio)duoxGenBankXM_017354273=dual oxidase
Gene (Danio rerio)ikbkgGenBankNM_001014344=ikky
Gene (Danio rerio)nfkbiaaGenBankNM_213184=ikbaa
Gene (Danio rerio)rps6ka3aGenBankNM_212786=RSK2a
Gene (Danio rerio)tp63GenBankNM_152986=delta Np63
Strain, strain background (Escherichia coli)Top10InvitrogenC404010Chemical competent cells
Strain, strain background (Danio rerio)ABZIRCWild-type strain
Strain, strain background (Danio rerio)TLZIRCWild-type strain
Genetic reagent (Danio rerio)Tg(mpx:EGFP)i114Uni of Sheffield
Genetic reagent (Danio rerio)Tg(fli1:EGFP)y1ZIRC
Genetic reagent (Danio rerio)hai1afr26Hammerschmidt lab; Max Planck Freiburg
Genetic reagent (Danio rerio)hai1ahi2217Nancy Hopkins lab; Massachusetts Institute of Technology
Genetic reagent (Danio rerio)ddfti251Nuesslein-Volhard lab; Max Planck Tuebingen PMID:9007245ZFIN ID:
=dandruff spint1ati251
Genetic reagent (Danio rerio)ddft419Nuesslein-Volhard lab; Max Planck Tuebingen
=dandruff spint1at419
Genetic reagent (Danio rerio)st14asq10Our lab
Genetic reagent (Danio rerio)Tg(6xNFkB:EGFP)nc1Rawls lab
Genetic reagent (Danio rerio)Tg(krtt1c19e:LY-Tomato)sq16Our lab. Lee et al:
Genetic reagent (Danio rerio)Tg(actb2:GCaMP6s, myl7:mCherry)lkc2This paperPlasmid from Solnica-Krezel Lab. Injected with Tol2 RNA to make line
AntibodyChicken anti-eGFP antibodyAbcamab13970,
AntibodyRabbit anti-eGFPTorrey Pines BiolabsTp401
AntibodyRabbit anti-FITCThermo Fisher Scientific71-1900
AntibodyRabbit anti-p90RSK (Phospho-Thr348)GenScriptA004871:100
AntibodyRabbit anti-beta cateninAbcamab6302
AntibodyMouse anti-E-cadherinBD Biosciences610181
AntibodyMouse anti-Tp63Biocare MedicalCM163
AntibodyRabbit anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204)Cell Signaling TechnologyCat# 4370, RRID:AB_23151121:100
AntibodyRabbit anti-p44/42 MAPK (Erk1/2)Cell Signaling TechnologyCat# 9102, RRID:AB_3307441:100
AntibodyAlexa Fluor-488 Donkey anti-rabbitLife TechnologiesA21206
AntibodyAlexa Fluor-647 Donkey anti-rabbitLife TechnologiesA31573
AntibodyAlexa Fluor-546 Donkey anti-mouseLife TechnologiesA10036
AntibodyAlexa Fluor-488 Goat anti-chickenLife TechnologiesA11039
Recombinant DNA reagentpCS2+-PKCδ-GFPAmaya Lab, Uni of Manchester
For making PKCd-GFP RNA
Recombinant DNA reagentpT3Ts-Tol2Ekker Lab, Mayo Clinic
Addgene Plasmid #31831
Recombinant DNA reagentpCS2+-GCaMP6sSolnica-Krezel Lab, Washington University School of Medicine, St. Louis, MOFor making GCaMP6s RNA
Recombinant DNA reagentp(actb2:GCaMP6s, myl7:mCherry)Solnica-Krezel Lab, Washington University School of Medicine, St. Louis, MO.
For making stable transgenic line
Sequence-based reagentduox morpholinoGeneToolsPMID:194948115′ AGTGAATTAGAGAAATGCACCTTTT 3′ (0.4 mM)
Sequence-based reagentp53 morpholinoGeneToolsPMID:194948115′
Sequence-based reagentOligo(dT)12–18 PrimerInvitrogenPMID:18418012
Sequence-based reagentnfkbiaaThis paperPCR primersF-5′ AGACGCAAAGGAGCAGTGTAG 3′
Sequence-based reagenteef1a1l1This paperPCR primersF′-5′ CTGGAGGCCAGCTCAAACAT 3′
Sequence-based reagentrps6ka3a in situ probeThis paperPCR primers for cloning probeF′-5′ ATACTCCAGTCCCACCGGA 3′
Peptide, recombinant proteinProteinase KThermo ScientificEO04910.5 μg/μl
Commercial assay or kitSuperScript III Reverse TranscriptaseInvitrogen18080093
Commercial assay or kitTRIzol ReagentInvitrogen15596026
Commercial assay or kitGoTaq G2 Green Master MixPromegaM7823Functions used:
Average Intensity
Commercial assay or kitiTaq Universal SYBR Green SupermixBio-Rad1725121Functions used:
Commercial assay or kitmMESSAGE mMACHINE SP6 Transcription KitInvitrogenAM1340Tests:
Student’s t-test,
Chi-squared test,
Mann–Whitney test,
ANOVA with Bonferroni or Dunn’s post-tests
Commercial assay or kitmMESSAGE mMACHINE T3 Transcription KitInvitrogenAM1348
Commercial assay or kitMEGAshortscript T7 Transcription KitInvitrogenAM1350
Commercial assay or kitpGEM-T EasyPromegaA137A
Commercial assay or kitpCR 2.1-TOPO TA vectorInvitrogenK450040
Commercial assay or kitQIAquick PCR Purification KitQiagen28104
Commercial assay or kitDIG RNA Labeling KitRoche11175025910
Commercial assay or kitSP6 RNA PolymeraseRoche10 810 274 001
Commercial assay or kitNBT/BCIP Stock SolutionRoche11681451001
Chemical compound, drugDiphenyleneiodonium chlorideSigma-AldrichD292640 μM
Chemical compound, drugThapsigarginSigma-AldrichT90336.25 μM
Chemical compound, drugBisindolylmaleimide I (GF109203X)SelleckchemS720885 μM
Chemical compound, drugYM-254890FocusBiomolecules10-1590-010032 μM
Chemical compound, drug2-Aminoethyl diphenylborinateSigma-AldrichD97542.5 μM
Chemical compound, drugBI-D1870Axon MedchemAxon-15281.2 μM
Chemical compound, drugDimethyl fumarateSigma-Aldrich2429269 μM
Chemical compound, drugPhorbol 12-myristate 13-acetateSigma-AldrichP813937.5 or 125 ng/ml
Chemical compound, drugU0126Cell Signaling Technology9903100 μM
Chemical compound, drugPD184352 (CI-1040)SelleckchemS10201.3 μM
Chemical compound, drugDAPI (4′,6-diamidino-2-phenylindole, dihydrochloride)InvitrogenD13065 µg/ml
Chemical compound, drugPenta-fluorobenzenesulfonyl fluoresceinCayman Chemicals1000598312.5 μM
Chemical compound, drugFluorescein isothiocyanate–dextranSigma-AldrichFD42.5 mg/ml
Software, algorithmFiji (ImageJ 1.52p)NIH used:
Average Intensity
Software, algorithmImaris 9.6.0Oxford InstrumentsFunctions used:
Software, algorithmPrism 9.1.1GraphPadTests:
Student’s t-test,
Chi-squared test,
Mann–Whitney test,
ANOVA with Bonferroni or Dunn’s post-tests
Software, algorithmPhotoshop 22.1.1 releaseAdobe

Zebrafish husbandry and lines

Request a detailed protocol

Fish were housed at the IMCB and the NTU zebrafish facilities under IACUC numbers #140924 and #A18002, respectively, and according to the guidelines of the National Advisory Committee for Laboratory Animal Research. Embryos were derived by natural crosses and staged as per Kimmel et al., 1995 and raised in 0.5× E2 medium (7.5 mM NaCl, 0.25 mM KCl, 0.5 mM MgSO4, 75 μM KH2PO4, 25 μM Na2HPO4, 0.5 M CaCl2, 0.35 mM NaHCO3). Anaesthesia was administered in E2 medium (embryos) or fish tank water (adults) using 0.02% pH 7.0 buffered Tricaine MS-222 (Sigma). The hai1a/ddf alleles used were hai1ahi2217, hai1afr26, ddfti251, and ddft419. The st14asq10 allele was generated previously (Lin et al., 2019). For imaging neutrophils and keratinocytes, the transgenic lines Tg(mpx:EGFP)i114 (Renshaw et al., 2006) and Tg(krtt1c19e:lyn-tdtomato)sq16 (Lee et al., 2014) were used, whilst early leukocytes were imaged with Tg(fli1:EGFP)y1 (Redd et al., 2006). To image NfkB pathway activity, the Tg(6xHsa.NFKB:EGFP)nc1 sensor line was used (Kanther et al., 2011). Calcium imaging was performed by injection of GCaMP6s RNA (see below) or using a Tg(actb2:GCaMP6s, myl7:mCherry)lkc2 stable transgenic line, generated via plasmid (Chen et al., 2017) and Tol2 RNA co-injection.

Genomic DNA and RNA extraction, reverse transcription, and PCR

Request a detailed protocol

Adult fin clips or embryos were isolated following anaesthesia, and genomic DNA extracted by incubation at 55°C for 4 hr in Lysis buffer (10 mM Tris pH 8.3, 50 mM KCl, 0.3% Tween20, 0.3% Nonidet P-40, 0.5 µg/µl Proteinase K). PCRs were performed using GoTaq (Promega) on a Veriti thermal cycler (Applied Biosystems) and purified with a PCR purification kit (Qiagen). TRIzol (Invitrogen) was used for RNA extraction following provided protocol, and cDNA generated from 1 µg total RNA using SuperScript III Reverse Transcriptase (Invitrogen) with Oligo(dT)12-18 primer. For qPCR, iTaq SYBR green (Bio-Rad) was used to amplify, with reaction dynamics measured on a Bio-Rad CFX96 Real-Time PCR Detection System. For measuring nfkbiaa mRNA by qPCR, the following primers (5′ to 3′) were used to amplify a region encoded on exons 4 and 5: F-AGACGCAAAGGAGCAGTGTAG, R-TGTGTGTCTGCCGAAGGTC. Reference gene was eef1a1l1 and the primers used amplified between exon 3 to 4: F-CTGGAGGCCAGCTCAAACAT, R- ATCAAGAAGAGTAGTACCGCTAGCATTAC.

RNA synthesis

Request a detailed protocol

RNAs for GCaMP6s and PKCδ-GFP were synthesised from pCS2-based plasmids containing the respective coding sequences (Sivak et al., 2005Chen et al., 2017). These were linearised with NotI (NEB), and RNA in vitro transcribed with mMESSAGE mMACHINE SP6 Transcription Kit (Ambion). RNA for Tol2 was generated from the pT3Ts-Tol2 plasmid, linearised with SmaI (NEB), and transcribed with the mMESSAGE mMACHINE T3 Transcription Kit (Ambion). RNA for injection was purified by lithium chloride precipitation.

Embryo injection and morpholino

Request a detailed protocol

Embryos were aligned on an agarose plate and injected at the one-cell stage with RNA or morpholino diluted in Phenol Red and Danieau’s buffer using a PLI-100 microinjector (Harvard Apparatus). Injection needles were pulled from borosilicate glass capillaries (0.5 mm inner diameter, Sutter) on a Sutter P-97 micropipette puller. The Duox morpholino (AGTGAATTAGAGAAATGCACCTTTT) was purchased from GeneTools and injected at 0.4 mM with 0.2 mM of the tp53 morpholino (GCGCCATTGCTTTGCAAGAATTG).

TALEN mutagenesis

Request a detailed protocol

To generate the ikbkg mutant, TALEN vectors targeting the sequence ATGGAGGGCTGG in second exon were designed and constructed by ToolGen ( TALEN vectors were linearised with PvuII (NEB) and purified using a PCR purification kit (Qiagen), and then used for in vitro transcription with the MEGAshortscript T7 kit (Ambion). About 170–300 pg of supplied ZFN RNAs or purified TALEN RNAs were then injected into one-cell stage WT zebrafish embryos, which were raised to 24 hr, then genomic DNA extracted.

For detection of fish with edited loci, PCR was performed on genomic DNA of injected fish with primers flanking the target site, cloned by TA cloning into pGEMT-Easy (Promega) or pCR2.1-TOPO-TA (Invitrogen) and individual clones sequenced to establish efficiency. Other embryos were raised to adulthood and their offspring were similarly genotyped to identify founder mutants.

Small-molecule treatment

Request a detailed protocol

All compounds for treating embryos were dissolved in DMSO, diluted in 0.5× E2 Embryo Medium and embryos treated by immersion. The compounds, and concentrations used, with catalogue numbers were diphenyleneiodonium chloride (DPI), 40 µM (D2926, Sigma); thapsigargin, 6.25 µM (T9033, Sigma); bisindolylmaleimide I (GF109203X), 85 µM (S7208, Selleckchem); YM-254890, 32 µM (10-1590-0100, Focus Biomolecules); 2-aminoethyl diphenylborinate (2-APB), 2.5 µM (D9754, Sigma), BI-D1870, 1.2 µM (Axon-1528, Axon Medchem); dimethyl fumarate, 9 µM (242926, Sigma); phorbol 12-myristate 13-acetate (PMA), 37.5 or 125 ng/ml (P8139, Sigma); U0126, 100 µM (9903, Cell Signaling Technology); PD184352 (CI-1040), 1.3 µM (S1020, Selleckchem). Unless otherwise stated, controls for all experiments were exposed to 0.5% DMSO carrier in 0.5× E2 Embryo Medium.

Proteomic analysis

Request a detailed protocol

Batches of 100 WT, ddft419, and ddfti251 embryos were collected at 24 hr and 48 hr, dechorionated, deyolked, and protein extracted as per Alli Shaik et al., 2014. Protein was precipitated in 100% methanol at 4°C, then resuspended in 2-D cell lysis buffer (30 mM Tris-HCl, pH 8.8, containing 7 M urea, 2 M thiourea, and 4% CHAPS). 2-D DIGE and mass spectrometry protein identification was performed by Applied Biomics (Hayward, CA). Protein samples were labelled with either Cy2, Cy3, or Cy5, mixed, and then subjected to 2-D DIGE to separate individual proteins. Gels were scanned using Typhoon TRIO (Amersham BioSciences) and analysed by Image QuantTL and DeCyder (ver. 6.5) software (GE-Healthcare). Spots with more than 1.5-fold change were picked, in-gel trypsin digested, and protein identification performed by MALDI-TOF mass spectrometry and MASCOT search engine in the GPS Explorer software (Matrix Science).

In situ hybridisation

Request a detailed protocol

A probe corresponding to the final 1078 bp of rps6ka3a (RSK2a; NM_212786.1) was generated by cloning a PCR-derived cDNA fragment into in pGEMT-Easy (Promega), linearising with ApaI (NEB) and transcribing a DIG probe with SP6 RNA polymerase (Roche). Whole-mount in situ hybridisation developed with NBT/BCIP (Roche) was performed as described (Thisse and Thisse, 2008).

Immunofluorescent, dye staining, and TUNEL

Request a detailed protocol

For antibody staining, embryos were fixed in 4% paraformaldehyde overnight at 4°C and then washed in PBT (0.1% Triton in PBS), permeabilised in −20°C acetone for 7 min, washed in PBT, blocked for 3 hr in Block solution (PBT supplemented with 4% BSA and 1% DMSO), then incubated overnight at 4°C with primary antibody diluted in Block solution, washed extensively in PBT, re-blocked in Block solution, then incubated overnight at 4°C with fluorescent secondary antibody diluted in Block solution. Following extensive PBT washing, embryos were cleared in 80% glycerol/PBS before imaging. Primary antibodies used and their dilutions are as follows: Chicken anti-eGFP antibody, 1:500 (ab13970, Abcam), Rabbit anti-eGFP, 1:500 (Tp401, Torrey Pines Biolabs), Rabbit anti-FITC, 1:200 (#71-1900, Thermo Fisher), Rabbit anti-beta catenin, 1:200 (ab6302, Abcam), Mouse anti-E-cadherin, 1:200 (#610181, BD Biosciences), Mouse anti-Tp63, 1:200 (CM163, Biocare Medical), Rabbit anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204), 1:100 (#4370, Cell Signaling Technology), Rabbit anti-p44/42 MAPK (Erk1/2), 1:100 (#9102, Cell Signaling Technology), and Rabbit anti-p90RSK (Phospho-Thr348), 1:100 (A00487, GenScript). All secondary antibodies were purchased from Invitrogen and used at 1:700 and were Alexa Fluor-488 Donkey anti-rabbit (A21206), Alexa Fluor-647 Donkey anti-rabbit (A31573), Alexa Fluor-546 Donkey anti-mouse (A10036), and Alexa Fluor-488 Goat anti-chicken (A-11039). Nuclei were counterstained using 5 µg/ml of DAPI (4',6-diamidino-2-phenylindole, dihydrochloride; D1306, Invitrogen) added during secondary antibody incubation.

To stain hydrogen peroxide, embryos were incubated for 60 min at room temperature with 12.5 µM PFBSF (#10005983, Cayman Chemicals), then rinsed in Embryo Medium, anaesthetised, and imaged.

Fluorescent TUNEL staining was performed using the Fluorescein In Situ Cell Death Detection Kit (11684795910, Roche), with the fluorescein detected by antibody staining using rabbit anti-FITC, and co-immunostained for TP63 and eGFP. Epidermal permeability assays were conducted by immersing 36hpf embryos in 2.5 mg/ml fluorescein isothiocyanate-dextran 3–5 kDa (Sigma) or 0.075% methylene blue for 30 min and then destained in E2 medium.

Microscopy and statistical analysis

Request a detailed protocol

Still and timelapse imaging was performed on upright Zeiss AxioImager M2, Zeiss Light-sheet Z.1, upright Zeiss LSM800 Confocal Microscope or Zeiss AxioZoom V16 microscopes. Embryos were mounted in 1.2% Low Melting Point Agarose (Mo Bio Laboratories) in 0.5× E2 medium in 35 mm glass-bottom imaging dishes (MatTek) or in a 1 mm inner diameter capillary for light-sheet timelapse. When imaging was performed on live embryos, the embryo media were supplemented with buffered 0.02% Tricaine and imaging conducted at 25°C. Image processing was done using Zen 3.1 software (Zeiss), Fiji (ImageJ, ver. 1.52p), or Imaris (Bitplane) and compiled using Photoshop 2020 (Adobe). Neutrophils were tracked with TrackMate in Fiji or using the Spot function in Imaris. Kymographs were generated using the Reslice function in Fiji following generation of a line of interest across image. Fluorescence intensities were calculated using the Average Intensity function in Fiji following generation of a Region of Interest and masking of the DAPI channel to exclude the nucleus when required. In statistical analyses, n = number of embryos or cells measured, and as defined in the figure legend. GraphPad Prism was used for statistical analyses and graph generation. In all statistical tests, *p<0.05, **p<0.01, ***p<0.001. Tests used are indicated in the associated figure legend and were Student’s t-test, Chi-squared test, Mann–Whitney test, or ANOVA with Bonferroni or Dunn’s post-tests.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.


    1. Chuderland D
    2. Marmor G
    3. Shainskaya A
    4. Seger R
    (2020) Calcium-Mediated interactions regulate the subcellular localization of extracellular Signal-Regulated kinases (ERKs)
    Cellular Physiology and Biochemistry : International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology 54:474–492.
    1. Sheng J
    2. Deng X
    3. Zhang Q
    4. Liu H
    5. Wang N
    6. Liu Z
    7. Dai E
    8. Deng Q
    PAR-2 promotes invasion and migration of esophageal Cancer cells by activating MEK/ERK and PI3K/Akt signaling pathway
    International Journal of Clinical and Experimental Pathology 12:787–797.

Decision letter

  1. Jonathan A Cooper
    Senior and Reviewing Editor; Fred Hutchinson Cancer Research Center, United States
  2. Jody Rosenblatt
    Reviewer; King's College London, United Kingdom

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Acceptance summary:

This manuscript unravels a detailed bipartite signaling mechanism, activation of which results in epithelial inflammation and cell motility. The paper is potentially of broad interest to cancer biologists and epithelial cell biologists. The data generated using the combination of genetic analyses, chemical inhibitors, and state-of-the-art confocal microscopy is of exceptionally high quality and supports the majority of the claims made in this paper.

Decision letter after peer review:

Thank you for submitting your article "Matriptase generates a tissue damage response via promoting Gq signalling, leading to RSK and DUOX activation" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Jody Rosenblatt as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Jonathan Cooper as the Senior Editor.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential Revisions:

Having conferred, we all agree that the paper is of interest and very thoroughly done regarding most aspects of the paper. The main things we would like you to address are the following:

1. Test whether the inflammatory response is a downstream consequence of poor epithelial barrier function, due to the primary epidermal phenotype. This seems to bear out in your experiments but could be addressed with dextran permeability or other approaches.

2. Address if the cell motility phenotype really lies downstream of DAG or is in a parallel pathway.

3. The paper is generally well-written but quite long. Please consider editing for conciseness and brevity.

Reviewer #1 (Recommendations for the authors):

1. Are the epithelial cells really more motile or is the primary cause that they no longer act collectively together like an epithelium, and migrate because of this?

2. You mention a comprehensive proteomic screen yet there is no real reference to this in how you went about it in your experiments. Were the proteomics results, in fact, used? The rationale seems to go without it. If not, do you need to include it?

3. Your analysis frequently depends on inhibitors. While you explain that sometimes morphants didn't work, I think you need to at least change the language in your results to suggest, as you could be having some off-target effects with drugs like U0126 and others.

4. Throughout, I found that the paper was logically ordered, and the results were very clear. However, I did find that the introduction and the discussion of the pathway could be more concise and clearer. It may be useful here to use a schematic to show the pathway implied before and then how your findings changed that, which could go at the beginning of the paper so people know where you are going.

5. Throughout, you mention the n in the figure legends but don't refer to what the n is-is it total embryos used for each condition or experimental numbers?

6. What are the differences between ERK activation in nucleus and cytoplasm?

Reviewer #2 (Recommendations for the authors):

1. It is important to directly link the hai1-matriptase system to DAG to implicate that arm of the signaling cascade. Is it possible for the authors to show the elevated levels of DAG in the hai1 mutant or to inhibit DAG in the hai1 mutant background by chemical or genetic means?

2. To support their conclusion that the two arms of the signaling cascade are causally linked with the phenotypic manifestation, the increase in H2O2 levels, Ca++ flashes, the activation of NfkB signaling, nuclear localization of phosphoRSK need to be shown just before the phenotype arise, if not for all at least for pRSK and NFkB activation. It would also be pertinent to block the signaling arms (using inhibitors) before the phenotypic onset and after the phenotype sets in to delineate the requirement of the cascade for phenotypic manifestation versus phenotypic maintenance.

3. Given that the Hai1-Matriptase system activates this bipartite signaling cascade to control the inflammation and epithelial cell motility, it is intriguing that the hai1 alleles are viable. How do authors explain the resolution of phenotype and survival of animals to adulthood? This aspect must be discussed.

Reviewer #3 (Recommendations for the authors):

The main problem with this manuscript lies not with the experimental data but instead with the way it is presented. The manuscript is far too long and the figures too numerous. Much of the data could be removed or moved to supplementary and the paper should be condensed down to five or six figures.

As indicated above, a major concern is that the relevance of these findings to a tissue damage response – which is openly stated in the manuscript's title – are not clear or at least not clearly supported by the data. The title of the paper is misleading as the authors don't show any real evidence that this is a true tissue damage response or show any data on how matriptase is activated (or Hai1a might be inactivated) downstream of damage/wounding. Overexpression of matriptase (or inactivation of Hai1a) leads to many of the same biological outcomes as wounding but claiming this is a tissue damage response without directly linking it to damage is a step too far and unnecessary. This message should be toned down throughout the manuscript and the title should be changed. Despite the manuscript being overly long, in multiple instances, the authors fail to adequately discuss the broader meaning of their findings, The discussion is far too long and reads more like a literature review rather than an attempt to extend their discoveries to other systems or contexts. The authors need to be much more concise throughout. If the authors can fix these problems with the structure and presentation of the paper as well as address the comments below then I would support publication.

1. To this reviewer, the authors did not clearly characterise the "inflammatory phenotype", nor explain the relevance of the "epidermal phenotype" for the fully-formed organism. As a criticism to the conclusion that neutrophils are highly migratory in Hai1a mutants, in comparison to WT, has it been considered that the increase in cell speed could be due to the lack of spatial constraint (which is instead present in WT, since neutrophils are moving within the vasculature?). Furthermore, is the lack of directionality (figure 1D) a real surprise, or a mere consequence of the lack of imposed stimuli (e.g. a wound) in these settings?

2. "We noted that again, whilst there was brief local recruitment in the mutant, more distant neutrophils appeared apathetic to the wound and remained migrating randomly, unlike in wild-type where neutrophils were recruited from a great distance and tracked to the wound with high directionality". The distance traveled by neutrophils cannot be appreciated from figures 1F-G.

3. Using the stain pentafluorobenzenesulfonyl fluorescein (PFBSF) (Maeda et al., 2004), we observed significantly higher levels of H2O2 in the trunk and tails of hai1a mutants at 24 and 48hpf (Figure 1G-I, Figure S1G-H). These figure references are misplaced.

4. In figure 4, the authors demonstrate that Hai1a mutants have hyperactivation of the NFkB signalling (Figure 4B), and that this is due to H2O2, as it can be rescued by treatment with a DUOX morpholino (Figure 4K). Strangely however, they also found that inhibition of calcium flashes via 2-APB only very moderately ameliorates the NFkB overactivation (Figure S4F-G). If DUOX is activated by Calcium, shouldn't the two treatments (DUOX morpholino and 2-APB treatment) yield the same response? How do the authors explain this observation, and fit it within their working model?

5. The authors briefly mention that in a subset of cells (TP63 +ve cells), pERK was observed both in the nucleus and cytosol, while in another subset of cells (peridermal cells) it was only observed in the nucleus. As in other instances throughout the manuscript, the authors fail to further comment on this observation. What is the implication for such different subcellular localisation? Are, for instance, post-translation modifications or trafficking throughout the cells different in the two subsets of cells? (Figure 8)

6. In multiple parts of the manuscript the authors hint at the likelihood of a cross-talk between the two identified signaling pathways, as these may well be co-responsible for the inflammatory phenotype. This is for instance the case when they show that treating embryos with a PKC inhibitor ameliorates the epidermal phenotype but only slightly the inflammatory phenotype. This is an interesting observation, but to this reviewer the authors failed to adequately discuss it both throughout the Results section and in the discussion.

Author response

Essential Revisions:

Having conferred, we all agree that the paper is of interest and very thoroughly done regarding most aspects of the paper. The main things we would like you to address are the following:

1. Test whether the inflammatory response is a downstream consequence of poor epithelial barrier function, due to the primary epidermal phenotype. This seems to bear out in your experiments but could be addressed with dextran permeability or other approaches.

We have tested this using fluorescein dextran and methylene blue permeability assays (Zhang, J et al., (2015) Exp Dermatol, 24: 605-610; Richardson, R., et al. (2013) The Journal of Investigative Dermatology, 133(6), 1655–1665). Whilst larval fin wounds show strong uptake of the dyes, we were unable to show robust staining in hai1a mutants. This data has been added as Figure 9 – —figure supplement 2. The lack of overt dye penetration made it difficult to draw conclusions from this as it is still possible there is permeability problems, just that we cannot detect it through these assays. We think more pertinent was the fact that we can rescue the epithelial defects robustly (eg with MAPK or PKC inhibition) without completely rescuing the inflammation phenotype, which you would expect if inflammation was purely a consequence of epithelial defects. Finally, new data added in response to a request by reviewer #2 has shown that the increase in Ca++ and H2O2 occurs very early, prior to epidermal phenotypic presentation (New panels 1L and 3H). As these are well described pro-inflammatory drivers in zebrafish, we believe this adds to the case that the inflammation is, to some extent, independent of the epithelial defects. We thus think it unlikely that inflammation in hai1a is solely due to epithelial defects. HOWEVER, there is clear evidence from us and others that PKC and MAPK activation can also promote inflammation. We have added remarks on this to the discussion.

2. Address if the cell motility phenotype really lies downstream of DAG or is in a parallel pathway.

We have used a GFP-tagged PKCδ construct (Sivak, et al. (2005). Dev Cell, 8(5), 689-701) to show that PKC is relocated to plasma and nuclear membranes in hai1a from a homogeneous cytoplasmic distribution in WT (new panels 7B and Figure 7 – —figure supplement 1). This relocation assay is commonly used for demonstrating increased DAG in cells, as the activity of PLC cleaves PIP2 and increases DAG levels in the membranes. In addition, we have previously show that Gq inhibitors rescue the epithelial phenotype, which would be expected to block PLC activity and thus reduce IP3 and DAG levels, whilst PMA phenocopies the epithelial defects. Finally, inhibition of the DAG receptor, PKC, also strongly rescues the epithelial defects. Thus, these four independent experiments make a strong case for DAG contributing to the epithelial phenotype.

3. The paper is generally well-written but quite long. Please consider editing for conciseness and brevity.

Agreed. We apologise for the initial length of the manuscript. We have rationalised and streamlined the introduction and discussion to improve clarity and conciseness. We have shortened the Introduction from 781 words to 540, whilst the Discussion has been revised from 1578 to 1307 words yet has also incorporated the more detailed discussions on the topics required by the reviewers. We think the new flow has made it much clearer and improved readability. We have removed the emphasis on tissue damage in the discussion as suggested by Reviewer 3. We are also now under the eLife 5000-word recommendation for Research Articles.

Reviewer #1 (Recommendations for the authors):

1. Are the epithelial cells really more motile or is the primary cause that they no longer act collectively together like an epithelium, and migrate because of this?

It’s difficult for us to say at this point. The extent of active cytoskeletal rearrangement in hai1a mutants has never been directly assessed as far as we are aware, but RSK is known to activate GEFs such as LARG (see discussion). Further it is known that hai1a mutants have increased MMPs (LeBert, et al. (2015). Development 142(12), 2136–2146). Our data and videos certainly show loss of adherens junctions and cells migrate over each other which has prompted us to label this behaviour simply as mesenchymal. We point out that this is unlikely to be due to a full EMT process as our previous analysis failed to show LOSS of E-Cadherin levels, rather just relocation. This is consistent with the know role of RSK in p120 phosphorylation.

2. You mention a comprehensive proteomic screen yet there is no real reference to this in how you went about it in your experiments. Were the proteomics results, in fact, used? The rationale seems to go without it. If not, do you need to include it?

This 2D gel proteomic screen identified Peroxiredoxin-4 as having altered pI, and this was our critical inroad into the mechanism by highlighting likely H2O2 changes. We have now included the full reports for this screen in supplementary data for the readers.

3. Your analysis frequently depends on inhibitors. While you explain that sometimes morphants didn't work, I think you need to at least change the language in your results to suggest, as you could be having some off-target effects with drugs like U0126 and others.

We have now added qualifiers to our conclusion statements throughout.

4. Throughout, I found that the paper was logically ordered, and the results were very clear. However, I did find that the introduction and the discussion of the pathway could be more concise and clearer. It may be useful here to use a schematic to show the pathway implied before and then how your findings changed that, which could go at the beginning of the paper so people know where you are going.

Yes – agreed. It was quite impenetrable. Sorry! We have re-written the introduction and discussion to streamline and include only the relevant background information. I think this has made the main contributions of the paper to the field much clearer and more accessible. I believe now that the simplified introduction has obviated the need for a schematic in the introduction, but happy to draft one if you think it is still required above the summary diagram Figure 11. The verbosity of the paper was a common theme from the reviewers, and we are happy to take further reviewer and editor guidance on this if our edited version is still deemed to be too long. We are now under the 5000 suggested length for eLife Research Articles.

5. Throughout, you mention the n in the figure legends but don't refer to what the n is-is it total embryos used for each condition or experimental numbers?

Generally, n was number of embryos for each condition, except where we have counted a number of cells in a range of embryos, where we have been explicit about this in the figure legend. We have now added this explanation to the Materials and methods.

6. What are the differences between ERK activation in nucleus and cytoplasm?

Activated pERK1/2 are known to have phosphorylation targets at the membrane (eg EGFR), in the cytoplasm (eg p90RSK) and in the nucleus (eg transcription factor Ets). The mechanisms regulating sub-cellular localisation, and thus availability of pERK for phosphorylating substrates, is a large field of its own, but levels of scaffolding proteins, activating kinases and phosphorylation of nuclear pore proteins likely contribute (Pouysségur J, Volmat V, Lenormand P. Biochem Pharmacol. 2002 Sep;64(5-6):755-63.). We suspect that there will also be other ERK mediated changes in different cell types in hai1a, including modulation of other cytoplasmic targets and transcriptional effects. We have added a sentence to the discussion highlighting this.

Reviewer #2 (Recommendations for the authors):

1. It is important to directly link the hai1-matriptase system to DAG to implicate that arm of the signaling cascade. Is it possible for the authors to show the elevated levels of DAG in the hai1 mutant or to inhibit DAG in the hai1 mutant background by chemical or genetic means?

As described above in the response to Essential Revision #2, we have now included data on the GFP-tagged PKCδ construct (Sivak, et al. (2005). Dev Cell, 8(5), 689-701) to show that PKC is relocated to plasma and nuclear membranes in hai1a from a homogeneous cytoplasmic distribution in WT (new panels 7B and Figure 7 – —figure supplement 1). This is a common assay for increased DAG levels in cells.

We now have 4 main results supporting our case that DAG contributes to the cell motility phenotype of hai1a mutants.

a. PKCδ-GFP relocates to nuclear and plasma membranes from the cytoplasm in hai1a as expected for increase in cellular DAG levels.

b. Gq, activator of PLC, rescues the epithelial defects, whilst the IP3R inhibitor does not. By elimination this suggests the other product of PLC activity, DAG, as responsible for the epithelial defects

c. Inhibition of the DAG receptor, PKC, rescues the epithelial defects

d. A DAG mimic, PMA, phenocopies the hai1a epithelial phenotypes.

2. To support their conclusion that the two arms of the signaling cascade are causally linked with the phenotypic manifestation, the increase in H2O2 levels, Ca++ flashes, the activation of NfkB signaling, nuclear localization of phosphoRSK need to be shown just before the phenotype arise, if not for all at least for pRSK and NFkB activation. It would also be pertinent to block the signaling arms (using inhibitors) before the phenotypic onset and after the phenotype sets in to delineate the requirement of the cascade for phenotypic manifestation versus phenotypic maintenance.

We have now included early staining and videos at 15-17hpf to look at the levels of these signals prior to phenotype presentation. These analyses required us to genotype embryos after staining and imaging as the epithelial defects were not apparent at this early stage. We have found that prior to phenotype manifestation:

a. H2O2 is highly increased in the yolk area at 16hpf (Figure 1K-L)

b. Calcium flashes are seen at 16hpf extensively over the yolk epidermis (Video 4; Figure 3G-H)

c. Nfkb is NOT increased noticeably at 15hpf, suggesting that this might be a driver of later chronic inflammation unlike the known early role of H2O2. (Figure 4 – —figure supplement 1C-D)

d. pERK levels are increased at early stages in nascent aggregates (Figure 8 – —figure supplement 1H) and in regions prior to forming aggregates (Figure 8G)

e. Similarly, cytoplasmic levels of pRSK are increased at 17hpf in regions outside of aggregate formation (Figure 10 – —figure supplement 1A-C)

We have compared U0126 treatment from 16hpf with later treatment from 26hpf and see that the latter gives a milder rescue. We interpret this to mean that the epithelial phenotype in hai1a mutants requires sustained pERK activity (Figure 9 – —figure supplement 1K-M’).

3. Given that the Hai1-Matriptase system activates this bipartite signaling cascade to control the inflammation and epithelial cell motility, it is intriguing that the hai1 alleles are viable. How do authors explain the resolution of phenotype and survival of animals to adulthood? This aspect must be discussed.

Apologies for the confusion here, the strong alleles (fr26, ti257, t419) are early lethal and die within the first week. The mild allele hi2217 is semi-viable to a highly variable extent. We used to see adult survival, but less so know, and it is common for them to die at 1 month. We think that there are modifiers that alter severity. The reason some mild hai1ahi2217 mutants survive has been recently determined to be due to cell extrusion and entosis (see Armistead et al. 2020). We have clarified this in the introduction.

Reviewer #3 (Recommendations for the authors):

The main problem with this manuscript lies not with the experimental data but instead with the way it is presented. The manuscript is far too long and the figures too numerous. Much of the data could be removed or moved to supplementary and the paper should be condensed down to five or six figures.

As indicated above, a major concern is that the relevance of these findings to a tissue damage response – which is openly stated in the manuscript's title – are not clear or at least not clearly supported by the data. The title of the paper is misleading as the authors don't show any real evidence that this is a true tissue damage response or show any data on how matriptase is activated (or Hai1a might be inactivated) downstream of damage/wounding. Overexpression of matriptase (or inactivation of Hai1a) leads to many of the same biological outcomes as wounding but claiming this is a tissue damage response without directly linking it to damage is a step too far and unnecessary. This message should be toned down throughout the manuscript and the title should be changed.

This is quite a reasonable suggestion, and I did get a little carried away with this topic. So I have changed the title and significantly reduced the emphasis on tissue damage. I point out however that we are not the first to make this claim about what the phenotypes of zebrafish hai1a represent, with the Coughlin lab concluding that these appear as tissue injury responses (Schepis, A., et al. (2018). J Cell Biol, 217(3), 1097-1112), whilst our original analysis of the hai1a mutant also discussed the phenotype in the context of wounding (Carney, T. J., et al. (2007). Development, 134(19), 3461-3471). I have referenced the Schepis paper specifically where I have briefly alluded to this topic. However, I fully agree that the discussion inappropriately overemphasised this. I hope this reads far more balanced now.

Despite the manuscript being overly long, in multiple instances, the authors fail to adequately discuss the broader meaning of their findings, The discussion is far too long and reads more like a literature review rather than an attempt to extend their discoveries to other systems or contexts. The authors need to be much more concise throughout. If the authors can fix these problems with the structure and presentation of the paper as well as address the comments below then I would support publication.

1. To this reviewer, the authors did not clearly characterise the "inflammatory phenotype", nor explain the relevance of the "epidermal phenotype" for the fully-formed organism. As a criticism to the conclusion that neutrophils are highly migratory in Hai1a mutants, in comparison to WT, has it been considered that the increase in cell speed could be due to the lack of spatial constraint (which is instead present in WT, since neutrophils are moving within the vasculature?). Furthermore, is the lack of directionality (figure 1D) a real surprise, or a mere consequence of the lack of imposed stimuli (e.g. a wound) in these settings?

We think it unlikely that the epidermis constrains neutrophils or retards their migration to any appreciable extent. Evidence for this can be seen in the WT fin wounding in Video 2, where at 178mins, a neutrophil appears from the anterior and tracks under the epidermis towards the wound with great speed. It is difficult to envisage that the epidermis this far from the wound is compromised and permitting increased neutrophil speed. Further to this reviewer’s concerns, we looked at 2 mutants with subepidermal blistering of the fin folds immediately under the posterior cardinal vein (pif and nel). This blistering alone did not induce extravasation of neutrophils out of the vasculature, except when the fin degenerated to cause a localised wound, towards which they migrated very specifically (Author response image 1).

Author response image 1
Epidermal detachment does not lead to increased neutrophil motility.

A-E: Lateral confocal images of the tails of 36hpf WT (A), hai1ahl227 (B), piftm95b (C), and neltq207 (D-E) immunofluorescently stained for Mpx (Green) and superimposed on the DIC channel. The sub-lamina densa blistering of the fins in pif and nel mutants does not lead to the epidermal inflammation seen in hai1a mutants. Only where there is epidermal damage and degeneration are neutrophils seen outside the vasculature, and then they only migrate to the damage site (E, red arrowhead). Scale bar A = 100μm.

2. "We noted that again, whilst there was brief local recruitment in the mutant, more distant neutrophils appeared apathetic to the wound and remained migrating randomly, unlike in wild-type where neutrophils were recruited from a great distance and tracked to the wound with high directionality". The distance traveled by neutrophils cannot be appreciated from figures 1F-G.

We have now included graphical representation of this data as a new panel (Figure 10 – —figure supplement 1D).

3. Using the stain pentafluorobenzenesulfonyl fluorescein (PFBSF) (Maeda et al., 2004), we observed significantly higher levels of H2O2 in the trunk and tails of hai1a mutants at 24 and 48hpf (Figure 1G-I, Figure S1G-H). These figure references are misplaced.

Apologies. These figure references have now been corrected.

4. In figure 4, the authors demonstrate that Hai1a mutants have hyperactivation of the NFkB signalling (Figure 4B), and that this is due to H2O2, as it can be rescued by treatment with a DUOX morpholino (Figure 4K). Strangely however, they also found that inhibition of calcium flashes via 2-APB only very moderately ameliorates the NFkB overactivation (Figure S4F-G). If DUOX is activated by Calcium, shouldn't the two treatments (DUOX morpholino and 2-APB treatment) yield the same response? How do the authors explain this observation, and fit it within their working model?

Our model (Figure 11) also includes activation of Duox by PKC which has been described previously (Rigutto et al. JBC 284(11), 6725-6734). This reconciles the ability of PMA to generate H2O2, (Figure 6M) and NfkB (Figure 6U) but not calcium (Figure 6Q, S). It also explains why IP3R inhibition has a strong effect on H2O2 but only a moderate effect on NfKb levels (Figure 3J, Figure 4 – —figure supplement 1I). We have included this in the discussion.

5. The authors briefly mention that in a subset of cells (TP63 +ve cells), pERK was observed both in the nucleus and cytosol, while in another subset of cells (peridermal cells) it was only observed in the nucleus. As in other instances throughout the manuscript, the authors fail to further comment on this observation. What is the implication for such different subcellular localisation? Are, for instance, post-translation modifications or trafficking throughout the cells different in the two subsets of cells? (Figure 8)

Reviewer #1 also had this query and I refer to the answer above. In truth, we have no data on this at all. We note that there are differences in reliance on ErbB2 function between the cells and this may translate to different pERK behaviours, but this is just a guess. Briefly there are transcriptional, membrane and cytoplasmic targets of pERK phosphorylation. Subcellular localisation of pERK, and thus accessibility to substrates, is determined by amount of scaffolding proteins, activating kinases and phosphorylation of nuclear pore proteins. The full picture of how pERK is localised within the cell is quite poorly understood (Pouysségur J, Volmat V, Lenormand P. Biochem Pharmacol. 2002 Sep;64(5-6):755-63.). Recently calcium levels are described to alter pERK subcellular localisation (Chuderland D, Marmor G, Shainskaya A, Seger R. Cell Physiol Biochem. 2020 May 12;54(3):474-492). We have now added comments on this to the discussion, but I have to confess that at his point, we are unclear on what this means in terms of the biology, beyond the RSK target.

6. In multiple parts of the manuscript the authors hint at the likelihood of a cross-talk between the two identified signaling pathways, as these may well be co-responsible for the inflammatory phenotype. This is for instance the case when they show that treating embryos with a PKC inhibitor ameliorates the epidermal phenotype but only slightly the inflammatory phenotype. This is an interesting observation, but to this reviewer the authors failed to adequately discuss it both throughout the Results section and in the discussion.

We have now discussed this in the discussion, and integrated this into our model clearly, justifying it through referring to our own observations and also by referencing the literature. We have now also included reference to (Feng et al. (2010) PLoS Biol, 8(12), e1000562), which showed that RasV12 transformed zebrafish keratinocytes also show increased hydrogen peroxide release and inflammation.

Article and author information

Author details

  1. Jiajia Ma

    Lee Kong Chian School of Medicine, Experimental Medicine Building, Yunnan Garden Campus, 59 Nanyang Drive, Nanyang Technological University, Singapore, Singapore
    Formal analysis, Investigation, Writing - original draft
    Competing interests
    No competing interests declared
  2. Claire A Scott

    1. Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore, Singapore
    2. Division of Cell Matrix Biology and Regenerative Medicine, School of Biological Sciences, Faculty of Biology, Medicine and Health, University of Manchester, Manchester, United Kingdom
    Formal analysis, Investigation
    Competing interests
    No competing interests declared
  3. Ying Na Ho

    Lee Kong Chian School of Medicine, Experimental Medicine Building, Yunnan Garden Campus, 59 Nanyang Drive, Nanyang Technological University, Singapore, Singapore
    Formal analysis, Investigation
    Competing interests
    No competing interests declared
  4. Harsha Mahabaleshwar

    Lee Kong Chian School of Medicine, Experimental Medicine Building, Yunnan Garden Campus, 59 Nanyang Drive, Nanyang Technological University, Singapore, Singapore
    Data curation, Formal analysis
    Competing interests
    No competing interests declared
  5. Katherine S Marsay

    1. Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore, Singapore
    2. Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield, United Kingdom
    Competing interests
    No competing interests declared
  6. Changqing Zhang

    Lee Kong Chian School of Medicine, Experimental Medicine Building, Yunnan Garden Campus, 59 Nanyang Drive, Nanyang Technological University, Singapore, Singapore
    Competing interests
    No competing interests declared
  7. Christopher KJ Teow

    Lee Kong Chian School of Medicine, Experimental Medicine Building, Yunnan Garden Campus, 59 Nanyang Drive, Nanyang Technological University, Singapore, Singapore
    Competing interests
    No competing interests declared
  8. Ser Sue Ng

    Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore, Singapore
    Formal analysis, Investigation
    Competing interests
    No competing interests declared
  9. Weibin Zhang

    Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore, Singapore
    Competing interests
    No competing interests declared
  10. Vinay Tergaonkar

    Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore, Singapore
    Resources, Supervision
    Competing interests
    No competing interests declared
  11. Lynda J Partridge

    Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield, United Kingdom
    Competing interests
    No competing interests declared
  12. Sudipto Roy

    1. Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore, Singapore
    2. Department of Biological Sciences, National University of Singapore, Singapore, Singapore
    3. Department of Pediatrics, Yong Loo Ling School of Medicine, National University of Singapore, Singapore, Singapore
    Resources, Supervision
    Competing interests
    No competing interests declared
  13. Enrique Amaya

    Division of Cell Matrix Biology and Regenerative Medicine, School of Biological Sciences, Faculty of Biology, Medicine and Health, University of Manchester, Manchester, United Kingdom
    Competing interests
    No competing interests declared
  14. Tom J Carney

    1. Lee Kong Chian School of Medicine, Experimental Medicine Building, Yunnan Garden Campus, 59 Nanyang Drive, Nanyang Technological University, Singapore, Singapore
    2. Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore, Singapore
    Conceptualization, Formal analysis, Supervision, Funding acquisition, Investigation, Writing - original draft, Project administration
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-2371-1924


Ministry of Education - Singapore (2015-T1-001-035)

  • Jiajia Ma
  • Tom J Carney

Ministry of Education - Singapore (MOE2016-T3-1-005)

  • Harsha Mahabaleshwar

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


Animal experimentation: Fish were housed at the IMCB and the NTU zebrafish facilities under IACUC numbers #140924 and #A18002 respectively, and according to the guidelines of the National Advisory Committee for Laboratory Animal Research. Approval was provided by the Institutional Animal Care and Use Committees of the Biological Resource Centre (IMCB) and NTU according to Agri-Food and Veterinary Authority (AVA) Rules and the National Advisory Committee for Laboratory Animal Research (NACLAR) requirements.

Senior and Reviewing Editor

  1. Jonathan A Cooper, Fred Hutchinson Cancer Research Center, United States


  1. Jody Rosenblatt, King's College London, United Kingdom

Publication history

  1. Received: January 15, 2021
  2. Accepted: June 23, 2021
  3. Accepted Manuscript published: June 24, 2021 (version 1)
  4. Version of Record published: July 20, 2021 (version 2)


© 2021, Ma et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,703
    Page views
  • 185
  • 0

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jiajia Ma
  2. Claire A Scott
  3. Ying Na Ho
  4. Harsha Mahabaleshwar
  5. Katherine S Marsay
  6. Changqing Zhang
  7. Christopher KJ Teow
  8. Ser Sue Ng
  9. Weibin Zhang
  10. Vinay Tergaonkar
  11. Lynda J Partridge
  12. Sudipto Roy
  13. Enrique Amaya
  14. Tom J Carney
Matriptase activation of Gq drives epithelial disruption and inflammation via RSK and DUOX
eLife 10:e66596.
  1. Further reading

Further reading

    1. Cell Biology
    Hiroaki Ishikawa, Jeremy Moore ... Wallace F Marshall
    Research Article Updated

    Eukaryotic cilia and flagella are microtubule-based organelles whose relatively simple shape makes them ideal for investigating the fundamental question of organelle size regulation. Most of the flagellar materials are transported from the cell body via an active transport process called intraflagellar transport (IFT). The rate of IFT entry into flagella, known as IFT injection, has been shown to negatively correlate with flagellar length. However, it remains unknown how the cell measures the length of its flagella and controls IFT injection. One of the most-discussed theoretical models for length sensing to control IFT is the ion-current model, which posits that there is a uniform distribution of Ca2+ channels along the flagellum and that the Ca2+ current from the flagellum into the cell body increases linearly with flagellar length. In this model, the cell uses the Ca2+ current to negatively regulate IFT injection. The recent discovery that IFT entry into flagella is regulated by the phosphorylation of kinesin through a calcium-dependent protein kinase has provided further impetus for the ion-current model. To test this model, we measured and manipulated the levels of Ca2+ inside of Chlamydomonas flagella and quantified IFT injection. Although the concentration of Ca2+ inside of flagella was weakly correlated with the length of flagella, we found that IFT injection was reduced in calcium-deficient flagella, rather than increased as the model predicted, and that variation in IFT injection was uncorrelated with the occurrence of flagellar Ca2+ spikes. Thus, Ca2+ does not appear to function as a negative regulator of IFT injection, hence it cannot form the basis of a stable length control system.

    1. Cell Biology
    2. Microbiology and Infectious Disease
    Yi Fan, Ping Lyu ... Chenchen Zhou
    Tools and Resources

    Oral inflammatory diseases such as apical periodontitis are common bacterial infectious diseases that may affect the periapical alveolar bone tissues. A protective process occurs simultaneously with the inflammatory tissue destruction, in which mesenchymal stem cells (MSCs) play a primary role. However, a systematic and precise description of the cellular and molecular composition of the microenvironment of bone affected by inflammation is lacking. In this study, we created a single cell atlas of cell populations that compose alveolar bone in healthy and inflammatory disease states. We investigated changes in expression frequency and patterns related to apical periodontitis, as well as the interactions between MSCs and immunocytes. Our results highlight an enhanced self-supporting network and osteogenic potential within MSCs during apical periodontitis-associated inflammation. MSCs not only differentiated towards osteoblast lineage cells, but also expressed higher levels of osteogenic related markers, including Sparc and Col1a1. This was confirmed by lineage tracing in transgenic mouse models and human samples from oral inflammatory-related alveolar bone lesions. In summary, the current study provides an in-depth description of the microenvironment of MSCs and immunocytes in both healthy and disease states. We also identified key apical periodontitis-associated MSC subclusters and their biomarkers, which could further our understanding of the protective process and the underlying mechanisms of oral inflammatory-related bone disease. Taken together, these results enhance our understanding of heterogeneity and cellular interactions of alveolar bone cells under pathogenic and inflammatory conditions. We provide these data as a tool for investigators not only to better appreciate the repertoire of progenitors that are stress responsive but importantly to help design new therapeutic targets to restore bone lesions caused by apical periodontitis and other inflammatory-related bone diseases.