1. Genetics and Genomics
  2. Medicine
Download icon

EPHX1 mutations cause a lipoatrophic diabetes syndrome due to impaired epoxide hydrolysis and increased cellular senescence

  1. Jeremie Gautheron
  2. Christophe Morisseau
  3. Wendy K Chung
  4. Jamila Zammouri
  5. Martine Auclair
  6. Genevieve Baujat
  7. Emilie Capel
  8. Celia Moulin
  9. Yuxin Wang
  10. Jun Yang
  11. Bruce D Hammock
  12. Barbara Cerame
  13. Franck Phan
  14. Bruno Fève
  15. Corinne Vigouroux
  16. Fabrizio Andreelli
  17. Isabelle Jeru  Is a corresponding author
  1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), France
  2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), France
  3. Department of Entomology and Nematology, and UC Davis Comprehensive Cancer Center, University of California, Davis, United States
  4. Department of Pediatrics, Columbia University Irving Medical Center, United States
  5. Deparment of Medicine, Columbia University Irving Medical Center, United States
  6. Service de Génétique Clinique, Hôpital Necker-Enfants Malades, AP-HP, France
  7. Goryeb Children’s Hospital, Atlantic Health Systems, Morristown Memorial Hospital, United States
  8. Service de Diabétologie-Métabolisme, Hôpital Pitié-Salpêtrière, AP-HP, France
  9. Sorbonne Université-Inserm UMRS_1269, France
  10. Centre National de Référence des Pathologies Rares de l’Insulino-Sécrétion et de l’Insulino-Sensibilité (PRISIS), Service de Diabétologie et Endocrinologie de la Reproduction, Hôpital Saint-Antoine, AP-HP, France
  11. Laboratoire commun de Biologie et Génétique Moléculaires, Hôpital Saint-Antoine, AP-HP, France
Research Article
  • Cited 0
  • Views 243
  • Annotations
Cite this article as: eLife 2021;10:e68445 doi: 10.7554/eLife.68445

Abstract

Epoxide hydrolases (EHs) regulate cellular homeostasis through hydrolysis of epoxides to less-reactive diols. The first discovered EH was EPHX1, also known as mEH. EH functions remain partly unknown, and no pathogenic variants have been reported in humans. We identified two de novo variants located in EPHX1 catalytic site in patients with a lipoatrophic diabetes characterized by loss of adipose tissue, insulin resistance, and multiple organ dysfunction. Functional analyses revealed that these variants led to the protein aggregation within the endoplasmic reticulum and to a loss of its hydrolysis activity. CRISPR-Cas9-mediated EPHX1 knockout (KO) abolished adipocyte differentiation and decreased insulin response. This KO also promoted oxidative stress and cellular senescence, an observation confirmed in patient-derived fibroblasts. Metreleptin therapy had a beneficial effect in one patient. This translational study highlights the importance of epoxide regulation for adipocyte function and provides new insights into the physiological roles of EHs in humans.

Introduction

Epoxide hydrolases (EHs) constitute a small protein family, first characterized as a group of detoxifying enzymes (Oesch et al., 1973). The first EHs were identified more than 40 years ago, and, to date, five genes encoding EH have been identified in humans (Decker et al., 2012; Fretland and Omiecinski, 2000). Human microsomal and soluble EHs (mEH and sEH), also named EPHX1 and EPHX2, respectively, are the best known EHs. Structurally, they are alpha/beta hydrolase fold enzymes. They catalyze the rapid hydrolysis of epoxides, which are three membered cyclic ethers, to less-reactive and readily excretable diols (Oesch et al., 1971). In mammals, epoxides arise from cytochrome P450 (CYP450) oxidative metabolism of both xenobiotics and endogenous compounds (El-Sherbeni and El-Kadi, 2014). Epoxides from xenobiotics are involved in the development of cancers and organ damage through interaction with DNA, lipids, and proteins (Nebert and Dalton, 2006), and EHs are necessary for their detoxification. On the other hand, epoxides derived from endogenous fatty acids, called epoxy fatty acids (EpFAs), are important regulatory lipid mediators. They were shown to mediate several biological processes, including inflammation, angiogenesis, vasodilation, and nociception. By regulating EpFAs levels, EHs play a key role in regulating crucial signaling pathways for cellular homeostasis (McReynolds et al., 2020), and altered levels of EpFAs are associated with many disorders (Morisseau and Hammock, 2013). Although a large amount of work has been made to characterize EH functions, especially through the use of specific inhibitors and animal models, the full spectrum of their substrates and associated biological functions in human remain partly unknown (Gautheron and Jéru, 2020). It is also a challenge to clearly define the contribution of each EH in human disorders.

Association studies suggested a role of several single-nucleotide polymorphisms (SNPs) identified in EPHX1 [MIM132810] and EPHX2 [MIM132811] in multiple conditions, including liver cirrhosis, alcohol dependence, Crohn’s disease, chronic obstructive pulmonary disease, preeclampsia, diabetes mellitus, and many cancers (El-Sherbeni and El-Kadi, 2014; Václavíková et al., 2015). This underscores the pleiotropic and crucial role of EHs in cell homeostasis, but no high-effect variants have been reported to date. In the present study, we identified two unrelated patients with a complex lipoatrophic and neurodevelopmental syndrome with severe metabolic manifestations and carrying a de novo variant in EPHX1 identified by whole-exome sequencing (WES). Lipoatrophic diabetes, also known as lipodystrophic syndromes, are characterized by clinical lipoatrophy due to a defect in adipose tissue storage of triglycerides. This results in ectopic lipid infiltration of non-adipose tissues leading to insulin resistance, increased liver glucose production, hypertriglyceridemia, and liver steatosis. About 30 genes have been implicated in lipoatrophic diabetes (Brown et al., 2016). Although these disorders remain genetically unexplained in the vast majority of cases, there is growing interest in identifying their molecular and cellular bases to improve genetic counseling and personalize treatment (Letourneau and Greeley, 2018; Sollier et al., 2020).

EPHX1 is widely expressed with highest expression in the liver, adipose tissue, and adrenal glands (Coller et al., 2001). It was the first mammalian EH to be identified and was first purified from rabbit liver in the 1970s. It is an evolutionarily highly conserved biotransformation enzyme retained in microsomal membranes of the endoplasmic reticulum (ER) (Coller et al., 2001). For a long time, EPHX1 and EPHX2 were thought to simply fulfill distinct complementary roles (Decker et al., 2009). On the one hand, EPHX1 was well recognized to detoxify xenobiotic epoxides. On the other hand, EPHX2 was shown to hydrolyze endogenous terpenoid epoxides and EpFAs (El-Sherbeni and El-Kadi, 2014). More recently, EPHX1 was also shown in animal models to play a significant role in the hydrolysis of different endogenous EpFAs derived from polyunsaturated fatty acids (Edin et al., 2018; Snider et al., 2007; Marowsky et al., 2017; Blum et al., 2019). These EpFAs, including epoxyeicosatrienoic acids (EETs) and epoxyoctadecenoic acids (also called EpOMEs), are formed by ER-attached CYP450s and hydrolyzed by EPHX1 to their respective diols, the so-called dihydroxyeicosatrienoic acids (DHETs) and dihydroxyoctadecenoic acids (DiHOMEs), respectively. Nevertheless, from an evolutionary perspective, EPHX1 and EPHX2 are very different enzymes, which can be differentially inhibited by distinct chemical inhibitors, and display only a partially overlapping substrate selectivity.

The EPHX1 variants identified in the studied patients are localized in the catalytic domain of the enzyme and were predicted to be pathogenic. This prompted us to assess their functional consequences in several cellular models. The impact of the loss of EPHX1 activity on adipocyte differentiation and function was evaluated by developing CRISPR-Cas9-mediated genome-editing approaches.

Results

Identification of EPHX1 variants in two unrelated patients

To identify novel genetic causes responsible for lipoatrophic diabetes, WES was carried out on a parent–offspring trio. The index case, patient 1, is a 25-year-old woman originating from Mauritania. Her disease phenotype was not explained by variants in genes known to be involved in lipoatrophic diabetes, as assessed by the analysis of a panel of genes used in routine genetic diagnosis (Jéru et al., 2019). The analysis of exome data led to the identification of a heterozygous variant in exon 7 of EPHX1 (Retterer et al., 2016), which was subsequently confirmed by Sanger sequencing: c.997A>C, p.(Thr333Pro) (NM_000120.4) (Figure 1A,B). This variant was found to be de novo after paternity confirmation by genotyping a set of polymorphic markers. Due to the key role of EPHX1 in cellular homeostasis and fatty acid metabolism (Edin et al., 2018), this gene was a good candidate. We then looked for additional individuals carrying a molecular defect in EPHX1. A second patient carrying a different de novo EPHX1 missense variant located in exon 9: c.1288G>C, p.(Gly430Arg) was identified through GeneMatcher (Sobreira et al., 2015Figure 1A,B). Patient 2 is a 17-year-old woman originating from Western Europe and living in the United States. She also had an insulin-resistant lipoatrophic syndrome. We did not identify any alternative molecular etiology compatible with the disease phenotype in either of the two patients. A detailed list of the other rare de novo, compound heterozygous, and homozygous variants, as well as the reasons for their exclusion is provided in Supplementary file 1 and 2. The presence of chromosomal abnormalities was also previously excluded in the two patients by karyotype and SNP chromosome microarrays. Several additional lines of evidence supported the causal role of the two variants in the disease phenotype. These variants were absent from databases reporting variants from the general population (gnomAD, ExAC, dbSNP, and Exome Variant Server), as well as from ClinVar, a database that aggregates information about genomic variations and their relationship to human diseases. The variants identified herein affected amino acids strongly conserved throughout evolution, even in zebrafish and Xenopus tropicalis (Figure 1—figure supplement 1). The two variants predicted changes in the polarity of the corresponding amino acids, as well as in the charge for p.Gly430Arg. They were predicted pathogenic by all tested algorithms (PolyPhen-2, SIFT, CADD).

Figure 1 with 3 supplements see all
EPHX1 pathogenic variants in a newly characterized lipoatrophic diabetes syndrome.

(A) Genealogical trees and segregation analysis for the two EPHX1 variants identified in this study. Arrows indicate probands. p.Thr333Pro and p.Gly430Arg were absent from both parents of each proband, indicating that they occurred de novo. +, normal allele; M, mutant allele. (B) Schematic of EPHX1 transcript displaying the location of the two variants identified. (C) Characteristics of the patient’s head. Left: Black shadow of the patient’s profile over a grayscale photo. Black arrows point to frontal bossing and retrognathism. The white dotted line indicates the base of the scalp showing high hair line. Top right: Front photo of the patient’s face showing lipoatrophy and retrognathism. Bottom right: Profile radiography of the skull showing teeth misalignments and mandibulo-facial dysostosis. (D) Top: Frontal photo of the patient’s abdomen showing prominent abdomen with umbilical herniation and hirsutism. Bottom: axial computed tomography slice of the abdomen showing hepatomegaly and liver steatosis. (E) Picture of the armpit showing acanthosis nigricans and molluscum pendulum. (F) Picture (left) and radiography (right) of the left-hand showing arachnodactyly with tapered fingers and thickening of proximal interphalangeal joints. (G) Front picture of the legs showing distal lipoatrophy.

Clinical features in patient 1

This patient (woman) was born at term after a normal pregnancy without intra-uterine growth retardation. The anthropometric parameters at birth were normal with a height of 49 cm and a weight of 2.8 kg. She was first referred for dysmorphic features including microcephaly with an occipito-frontal circumference (OFC) of 33 cm at birth (−1.5 SD), which remained present in adulthood with an OFC of 51 cm (−2.5 SD) at the age of 18 years. She also presented with a triangular-shaped face, prominent forehead, retrognathism, irregular and high hair line, high-arched palate, mandibulo-facial dysostosis including malar hypoplasia and retrognathism, teeth misalignments, arachnodactyly, camptodactyly, joint stiffness, and clitoromegaly (Figure 1C,F and Table 1). Patient 1 also displayed a progressive lipodystrophic phenotype with severe lipoatrophy of the face and limbs (Figure 1C,G). This lipoatrophic phenotype was further confirmed by dual X-ray absorptiometry (DXA) with a total fat mass of 15.8%, whereas the mean normal age-matched value is 31.4 ± 8.5% (Imboden et al., 2017), corresponding to a Z-score of −2.8. The study of segmental body composition revealed that the loss of adipose tissue was evenly distributed throughout the body (Figure 1—figure supplement 2). Her body mass index (BMI) was 20.2 kg/m2 at the age of 25 years. The serum leptin levels, which are strongly correlated with total body fat mass, were very low in patient 1 (4 ng/mL) and similar to those usually reported in partial lipodystrophy (Haque et al., 2002), further confirming the lipoatrophic phenotype. Patient 1 was diagnosed with severe insulin-resistant diabetes at the age of 12 years, with hyperglycemia (44 mmol/L), and highly elevated HbA1c (18.9%). Insulin resistance was characterized by acanthosis nigricans in the neck, axilla, and back (Figure 1E), as well as by the very high insulin requirements (15 IU/kg/day) and by the low levels of total serum adiponectin (0.5 mg/L – normal range: 3.6–9.6 mg/L). Mild hypertriglyceridemia was observed (2.66 mmol/L), with serum cholesterol levels around the lower limits. She had a major hepatomegaly (Figure 1D) and elevated levels of aspartate aminotransferase (AST – 120 IU/L), alanine aminotransferase (ALT – 148 IU/L), alkaline phosphatase (ALP – 170 IU/L), and gamma glutamyl transpeptidase (GGT – 320 IU/L) (Table 2). Liver computed tomography and magnetic resonance imaging (MRI) revealed liver steatosis with focal accumulation of fat depots, especially in the posterior segment (15–27%) (Figure 1D). Non-invasive FibroTest and Acti-test scores (Munteanu et al., 2008) were in favor of low-grade liver fibrosis with moderate necrosis and/or inflammation. Although pubertal development was normal, oligomenorrhea occurred rapidly and progressed over the last year to complete amenorrhea, although FSH and LH values were normal. She progressively developed hyperandrogenism signs with severe generalized hirsutism. Total serum testosterone levels were first noticed to be moderately increased at the age of 22 years (2.2 nmol/L; N: 0.3–1.5 nmol/L), with deterioration over time. At the age of 25 years, this patient presented major steroidogenesis abnormalities with especially highly elevated levels of dihydrotestosterone (2.3 nmol/L; N: 0.06–0.3 nmol/L) and testosterone (16.9 nmol/L; N: 0.3–1.5 nmol/L). Serum estradiol levels were within the normal range (121 pmol/L) in this woman with amenorrhea, contrasting with the high levels of androgens. MRI showed normal adrenal glands. Adrenal steroid profiling revealed normal levels of cortisone, cortisol, 21-desoxycortisol, 11-desoxycortisol, aldosterone, corticosterone, 21-desoxycorticosterone, 11-desoxycorticosterone, and ACTH. MRI and pelvic ultrasound did not reveal any ovarian or uterine abnormalities. Neurologically, patient 1 had a delay in language acquisition and moderate intellectual disability. An axonal neuropathy, associated with a decrease in tendon reflexes and bilateral pes cavus, was diagnosed at the age of 17 years and further confirmed by an electromyogram. Bilateral sensorineural hearing loss was diagnosed at the age of 10 years, leading to the use of hearing aids. Her parents were clinically unaffected.

Table 1
Clinical and biological features in patients with EPHX1 de novo variants.

Unless otherwise specified, information corresponds to that collected during the last consultation. ALP: alkaline phosphatase; ALT: alanine aminotransferase; AST: aspartate aminotransferase; DXA: dual X-ray absorptiometry; EEG: electroencephalogram; GGT: gamma glutamyl transpeptidase; MRI: magnetic resonance imaging; Na: not available; N: normal value.

Patient 1Patient 2
General characteristics
OriginSub-Saharan AfricaWestern Europe
Age (years)2517
SexFemaleFemale
Height (m)1.621.63
Weight (kg)5345.2
Body mass index (kg/m2)20.217.0
Birth
At termYesYes
Intrauterine growth retardationNoNo
Dysmorphic features
Microcephaly−1.5 SD at birth
−2.5 at 18 years
No
Triangular-shaped faceYesYes
Irregular and high hair lineYesYes
Frontal bossingYesYes
Mid face hypoplasiaNoYes
RetrognathismYesNo
Mandibulo-facial dysostosisYesYes
Teeth misalignmentsYesNa
ArachnodactylyYesNa
Metabolic manifestations
LipoatrophyFace, upper, and lower limbsFace
Total fat mass evaluated by DXA (%)15.8%
Z-score: −2.8
12.4%
Z-score: −3.8
Serum leptin levels
(N < 28 for BMI < 25 kg/m2)
4 ng/mL3 ng/mL
Serum adiponectin levels
(N: 3.6–9.6 mg/L)
0.5 mg/L0.3 mg/L
Insulin resistanceYes, Acanthosis nigricans (back, armpits, neck)
Insulin requirement: up to 15 IU/kg/day before metreleptin therapy
Yes, fasting insulin: 284 pmol/L (N < 70 pmol/L)
Diabetes
(Glycemia - N < 7 mmol/L)
Since the age of 12
Fasting glycemia: 44 mmol/L at diagnosis
No
Liver manifestationsHepatomegaly, steatosis, fibrosis, liver inflammation,
elevated levels of AST, ALT, ALP, and GGT
Fat infiltrate,
elevated levels of AST, ALT, and GGT
Hypertriglyceridemia (mmol/L)
(TG – N < 1.7 mmol/L)
Yes,
TG: 2.66 mmol/L
Yes,
TG: 21.9 mmol/L
Gynecological featuresClitoromegaly during childhood,
oligomenorrhea
No
Hyperandrogenism
(Testosterone – N: 0.3–1.5 nmol/L)
Generalized hirsutism, steroidogenesis alterations including high testosterone levels (16.9 mmol/L)Na
Spine bone densitometryT-score: −2.5 SD
Z-score: −2.5 SD
Na
Neurological signs
Bilateral sensorineural hearing lossSince the age of 6 years and requiring hearing aidsSince birth and requiring cochlear implants
Developmental delayDelay in language onset, moderate intellectual disabilityNo
Brain MRI/EEGNormalNormal
Axonal neuropathySince the age of 17 years
Decrease in osteo-tendinous reflexes (achilles, lower limbs)
EMG abnormalities
No
Pes cavusYesNa
Cardiac and musculoskeletal signs
Cardiovascular symptomsNoNo
Muscular hypertrophyYesNo
Joint stiffnessYes (hands, feet)No
Other symptoms
Ocular signsBilateral cataract,
Peri-corneal colored ring, Diabetic retinopathy
No
T-cell lymphocytosis
(Lymphocytes – N: 1–4.8 G/L)
Yes, 11.4 G/L
CD3+, CD8+, cD57+
Na
HyperkeratosisYes (hands, feet)No
Table 2
Evolution of metabolic markers in patient 1 over a period of 6 months of metreleptin treatment.

For data before treatment, values are given as the ranges observed over the last past 3 years. AST: aspartate aminotransferase, ALT: alanine aminotransferase, ALP: alkaline phosphatase, GGT: gamma glutamyl transpeptidase.

Before metreleptinAfter 3 month metreleptin therapy (5 mg/day)After 6 month metreleptin therapy (7.5 mg/day)
Anthropometric markers
Weight535150
BMI20.219.418.9
Glucose homeostasis
HbA1c (%)
(N: 4–6%)
11.6–16.57.97.3
Liver assessment
AST (IU/L)
N: 17–27 IU/L
83–1205754
ALT (IU/L)
N: 11–26 IU/L
81–1485059
ALP (IU/L)
N: 35–105 IU/L
100–11092102
GGT (IU/L)
N: 8–36 IU/L
170–3205867
Steatosis (SteatoTest)Low-grade
(S1)
Not detectable
(S0)
Low grade
(S1)
Fibrosis (FibroTest)Intermediate grade
(F1–F2)
Not detectable
(F0)
Not detectable
(F0)
Necrotic and inflammatory activity (ActiTest)Intermediate grade
(A1–A2)
very low grade
(A0–A1)
Low grade
(A1)
Lipid profile
Triglycerides (mmol/L)
(N: 0.4–1.7 mmol/L)
1.3–2.72.01.6
Insulin requirement
Human insulin (daily doses – IU/kg)2.921.65

Clinical features in patient 2

This patient (woman) was born at term, after a normal pregnancy, with a height of 50 cm and a weight of 3.2 kg. She presented similar dysmorphic features, as compared with patient 1, including a triangular-shaped face, irregular and high hair line, frontal bossing with mid-face hypoplasia, and mandibulo-facial dysostosis (Table 1). Lipoatrophy was first noted in the face and the lipoatrophic phenotype was further confirmed by DXA with a total fat mass of 12.4%, a value within the first percentile as compared to age-matched normal individuals. The study of segmental body composition revealed that the loss of adipose tissue affected the whole body and was more pronounced in upper and lower limbs (Figure 1—figure supplement 3). Her BMI was low (17.0 kg/m2). She had insulin resistance, as assessed by very high fasting insulin levels (284 pmol/L), which increased over time. Her fasting glucose values remained in the normal range, and she was not diabetic at last investigation. Measurement of serum levels of leptin (3 ng/mL) and adiponectin (0.3 mg/L) further confirmed the lipoatrophic and insulin-resistant phenotype. She had severe hypertriglyceridemia (21.9 mmol/L) associated with low HDL-cholesterol levels (0.52 mmol/L). Liver enzymes were elevated: AST (71 IU/L), ALT (94 IU/L), and ALP (145 IU/L). A liver ultrasound demonstrated fatty infiltrate. She also had profound sensorineural hearing loss since birth requiring cochlear implants. Brain computerized tomography and electroencephalogram were normal. The parents of patient 2 were clinically unaffected. Altogether, these data demonstrate that the two affected individuals have a complex disease phenotype and share a number of clinical features including dysmorphic features, lipoatrophy, insulin resistance, hypertriglyceridemia, liver dysfunction, and bilateral sensorineural hearing loss.

Structural characterization of EPHX1 variants

EPHX1 encodes a protein of 455 residues. The enzyme is retained in microsomal membranes of the ER by a single transmembrane segment located at the N-terminus and comprising around 20 amino acids (Friedberg et al., 1994). The C-terminal part of the protein, containing the two variants identified, is exposed at the cytosolic membrane surface and constitutes the catalytic domain (Lewis et al., 2005Figure 2A). The EPHX1 mechanism of hydrolysis involves two chemical steps. A fast-nucleophilic attack leads to the formation of an ester intermediate, a covalent bond linking the substrate to the enzyme. Thereafter, hydrolysis of this complex to the final diol product is mediated by a molecule of water activated by a charge relay system (Oesch et al., 2000Figure 2A). The EPHX1 active site is composed of a so-called catalytic triad consisting of Asp226, Glu404, and His431. In addition, two tyrosine residues (Tyr299 and Tyr374) provide an essential support by polarizing the epoxide (Oesch et al., 2000; Bell and Kasper, 1993; Arand et al., 1999). The localization of the mutated amino acids within the three-dimensional (3D) protein structure strongly supported their pathogenic effect. Although the exact structure of EPHX1 is still not available, the quaternary structure of a closely homologous enzyme was determined from the fungus Aspergillus niger (Zou et al., 2000). Glycine 430 mutated in patient 2 is located beside the crucial His431, which is directly implicated in the water activation and hydrolytic step of the catalytic process (Figure 2B). We used a 3D structure model from the SWISS-MODEL repository to determine the location of Thr333 (Waterhouse et al., 2018). On the 3D structure, this residue appears in close vicinity to Gly430, as well as to the three critical residues of the catalytic site (Asp226, Glu404, His431) (Figure 2C). The location of the two de novo EPHX1 variants suggests that they could affect the enzyme activity and argues for their pathogenic effect.

Figure 2 with 2 supplements see all
Loss of EPHX1 hydrolysis activity due to the p.Thr333Pro and p.Gly430Arg variants.

(A) Schematic representation of the EPHX1 protein, showing its sub-cellular localization and function. Epoxide hydrolases open three membered cyclic ethers, known as epoxides, by the addition of water to yield 1,2-diols. The location of the amino acids affected by the missense variants identified in this study are indicated by stars. (B) Schematic representation of the variants used in functional tests. Residues of the catalytic triad are shown above the protein structure. Variants used in functional assays are depicted below. Variants identified in patients are displayed in red. (C) Model of the 3D structure of EPHX1, based on the quaternary structure of the closely homologous EH enzyme from the Aspergillus niger fungus (Zou et al., 2000). On the left panel, the location of the two variants identified in patients are indicated by a star. On the right panel, the two variants found in patients are depicted in red and the three key residues of the catalytic site in blue. (D) c-SO (cis-stilbene oxide) hydrolysis assay performed in HEK 293 cells transiently expressing Flag-tagged wild-type (WT) and mutated forms of human EPHX1, as indicated. Results are expressed as means ± SEM of three independent biological experiments, each of them being performed in duplicates. # indicates that hydrolysis activity of EPHX1 carrying the p.Thr333Pro and p.Gly430Arg de novo variants was abolished, compared with WT and other variants. (E) Western blot analysis aimed at controlling the expression of WT and mutant forms of EPHX1 in protein extracts used in c-SO hydrolysis assays presented in (D), using antibodies as indicated. Numbers on the left correspond to molecular weight markers (kDa). Western blot images are representative of two independent experiments.

EPHX1 variants dramatically alter the enzyme hydrolysis function

To investigate the functional consequences of the identified EPHX1 variants, we first analyzed their effect on the capacity of EPHX1 to hydrolyze cis-stilbene oxide ([3H]-cSO), one of its well-known substrates (Nithipatikom et al., 2014; Morisseau and Hammock, 2007). Overexpression studies were performed in human epithelial kidney (HEK) 293 cells, since they are of human origin, easily transfectable, and display low endogenous levels of EPHX1. HEK 293 were transfected with plasmids encoding wild-type (WT) and mutated forms of human EPHX1 with a C-terminal Flag tag: hEPHX1WT, hEPHX1Thr333Pro, and hEPHX1Gly430Arg (Figure 2D). c-SO hydrolysis in lysates of HEK 293 cells overexpressing hEPHX1WT was high, as compared to untransfected cells in which it was undetectable. The two variants identified in patients, p.Thr333Pro and p.Gly430Arg, led to a near-complete absence of this enzyme activity (Figure 2D,E). We then analyzed the effect of two SNPs frequent in the general population, p.Tyr113His and p.His139Arg, whose role was debated in association studies (El-Sherbeni and El-Kadi, 2014; Hassett et al., 1994Figure 2B). Neither overexpression of hEPHX1Tyr113His nor that of hEPHX1His139Arg led to reduced c-SO hydrolysis in HEK 293 lysates as compared to hEPHX1WT (Figure 2D,E). We also investigated the effect of a variant affecting one of the catalytic triad residues, p.Glu404Asp, previously proposed to result in an increased enzyme activity (Arand et al., 1999; Marowsky et al., 2016Figure 2B). This variant did not significantly modify the hydrolysis of c-SO compared to hEPHX1WT (Figure 2D,E). Immunoblot analysis against the Flag epitope was used to control the protein level of WT and mutated EPHX1 isoforms. Although the protein expression level was slightly diminished for the p.Gly430Arg variant, there was no significant difference in the expression of the WT and other mutated isoforms (Figure 2E). Collectively, these data showed that the p.Thr333Pro and p.Gly430Arg variants strongly impair EPHX1 hydrolysis function by altering its catalytic triad domain (Figure 2C).

To evaluate the impact of the loss of enzyme activity in vivo, we measured by liquid chromatography (LC) coupled with tandem mass spectrometry (MS/MS) circulating levels of a panel of EpFAs and corresponding diols in plasma samples of patient 1. EPHX1 was previously shown to catalyze the hydrolysis of several EpFAs, also called oxylipins (Edin et al., 2018; Snider et al., 2007; Marowsky et al., 2017; Blum et al., 2019). These profiles, which result from the combined action of several EHs, were compared to the patterns determined in eleven sex- and age-matched control women with normal BMI. An accumulation of 7,8 epoxydocosapentaenoic acid, and a decrease of the corresponding diol (7,8 dihydroxydocosapentaenoic acid), was observed (Figure 2—figure supplement 1). A recent study shows that mEH plays a significant role in the metabolism of this EpFA (Morisseau et al., 2021). Since oxylipin profiling is an emerging field, whose biological interpretation remains difficult, further experiments will be required to confirm this observation in additional patients and/or different cellular models.

EPHX1 variants induce the enzyme aggregation within the endoplasmic reticulum

As mentioned previously, EPHX1 is mainly localized in the microsomal fraction of the ER (Coller et al., 2001). We performed immunofluorescence staining in HEK 293 cells transiently expressing the WT and mutated forms of EPHX1 to evaluate whether missense variants alter its sub-cellular localization. Co-staining with calnexin, which is a marker of ER, confirmed that hEPHX1WT is located in the ER, as well as all mutated EPHX1 isoforms carrying the five previously mentioned missense variants (Figure 3A). However, the EPHX1 isoforms carrying the two de novo variants identified in patients (p.Thr333Pro and p.Gly430Arg) were also found to form higher-order complexes or clumps within the ER, as compared to WT hEPHX1 and other mutated isoforms (Figure 3A). To ensure that the Flag tag did not alter EPHX1 sub-cellular localization, a new set of constructs lacking the Flag tag was generated. Of note, the two de novo variants still led to EPHX1 aggregation within the ER when the Flag tag was removed (Figure 3B). The presence of these oligomers was further confirmed by western blot analysis since both hEPHX1Thr333Pro and hEPHX1Gly430Asp proteins were revealed as two bands, one corresponding to the protein monomer around 55 kDa, and another to an oligomer around 150 kDa (Figure 3C). When the cell lysates were enriched in EPHX1 by immunoprecipitation with an anti-Flag antibody, western blot analysis using an anti-hEPHX1 antibody revealed an increase of these higher-order complexes in the presence of the two p.Thr333Pro and p.Gly430Arg variants (Figure 3C). All these data demonstrate that the p.Thr333Pro and p.Gly430Arg variants confer an aberrant conformation to EPHX1 leading to its aggregation. This likely contributes to abolish the enzyme catalytic activity through a dominant negative mechanism.

The p.Thr333Pro and p.Gly430Arg variants induce the formation of EPHX1 higher-order complexes within the endoplasmic reticulum.

(A) HEK 293 cells transiently expressing Flag-tagged wild-type (WT) and mutated isoforms of human EPHX1 were grown on coverslips, fixed, permeabilized, and stained with an anti-Flag antibody followed by an anti-Calnexin antibody. They were then incubated with Alexa Fluor 594- and 488-conjugated secondary antibodies and visualized by confocal microscopy. Nuclei were counterstained with DAPI (blue). Red arrows point to EPHX1 higher-order complexes. Representative pictures of three independent experiments are presented. Scale bar is 10 μm. (B) Immunofluorescence staining of HEK 293 cells transiently expressing WT and mutated isoforms of human EPHX1 using an anti-EPHX1 antibody and visualized using an Alexa Fluor 488-conjugated goat anti-rabbit secondary antibody. Nuclei were counterstained with DAPI (blue). Representative pictures of two independent experiments are presented. Scale bar is 10 μm. (C) HEK 293 cells were transiently transfected with Flag-tagged WT and mutated isoforms of human EPHX1. Whole-cell extracts were prepared 24 hr later, immunoprecipitated with an anti-Flag antibody and analyzed by western blotting using an anti-EPHX1 antibody. The formation of EPHX1 higher-order complexes in the presence of the p.Thr333Pro and p.Gly430Arg variants is shown by red arrows. The asterisk indicates a non-specific band present only in direct immunoblotting using anti-EPHX1 antibody. Numbers on the left correspond to molecular weight markers (kDa). Western blot images are representative of three independent experiments.

Ephx1 knockout in pre-adipocytes abolishes adipocyte differentiation and decreases insulin response

We then sought to assess the effect of the loss of EPHX1 activity in the tissues most affected by the disease. The two patients have manifestations in adipose tissue, central nervous system, and liver. Recent studies have investigated the function of EPHX1 in liver and brain (Marowsky et al., 2017; Marowsky et al., 2016), but there is little information on the role of EPHX1 in adipose tissue. To investigate the role of EPHX1 in adipocytes, a CRISPR/Cas9-mediated knockout (KO) approach was developed (Figure 4—figure supplements 1 and 2). A custom-designed single-guide RNA (gRNA)/Cas9 expression vector targeting the sixth exon of Ephx1 was used. The murine 3T3-L1 pre-adipocytes were chosen as a cellular model due to their ability to differentiate into mature adipocytes after stimulation in vitro (Figure 4A). 3T3-L1 cells transfected with a Cas9/scramble gRNA plasmid were used as a control (CTL). KO efficiency was further confirmed by western blot analysis. A major loss of Ephx1 expression, which remained stable over time during adipocyte differentiation, was indeed observed (Figure 4B). Consistently, hydrolysis of [3H]-cSO was evaluated in cell lysates and revealed a significant loss of enzyme activity in 3T3-L1 KO cells, as compared to control cells (Figure 4—figure supplement 3). Following validation of the KO model, the efficiency of adipocyte differentiation was evaluated by progressive lipid accumulation, as revealed both by the appearance of refractive droplets in optical microscopy and by an increase in Oil Red O staining, which is a marker of intracellular lipids (Figure 4A,C). WT and control 3T3-L1 pre-adipocytes differentiated into adipocytes within 12 days and displayed strong accumulation of lipid droplets in the cytoplasm (Figure 4C,D). In contrast, Ephx1 KO led to strong and significant decrease in lipid droplet formation (p< 0.0001) (Figure 4C,D). The expression study of adipocyte markers constitutes another way to evaluate adipocyte differentiation. As compared to WT and control cells submitted to in vitro adipocyte differentiation, Ephx1 KO cells displayed a significantly reduced expression of adipogenic markers, including peroxisome proliferator-activated receptor gamma (PPARγ), CCAAT/enhancer-binding protein alpha (C/EBPα), SREBP-1c, as well as reduced expression of mature adipocyte markers, such as fatty acid synthase (FAS), and adiponectin (Figure 4E). We next investigated the effect of the deletion of Ephx1 on insulin sensitivity. In WT and control 3T3-L1 adipocytes stimulated with insulin, western blot analysis revealed a strong increase in the phosphorylation of several signaling intermediates from the mitotic and metabolic pathways including insulin receptor β subunit (IRβ), insulin receptor substrate-1 (IRS1), AKT, and extracellular-regulated kinase (ERK) (Figure 4F). In contrast, the Ephx1 KO cells were resistant to insulin, both in pre-adipocytes and in differentiated cells, as shown by the lack or strong decrease in the phosphorylation of these intermediates upon insulin stimulation (Figure 4F, Figure 4—figure supplement 4).

Figure 4 with 5 supplements see all
Ephx1 deficiency suppresses adipocyte differentiation of 3T3-L1 cells and alters insulin signaling.

Data were obtained in 3T3-L1 pre-adipocytes from ATCC, 3T3-L1 cells with a CRISPR-Cas9-mediated Ephx1-knockout (KO), and 3T3-L1 cells transfected with a Cas9/scramble gRNA plasmid corresponding to control (CTL) cells. (A) Timeline representation of the 3T3-L1 pre-adipocyte differentiation process using a hormonal cocktail. Dexa: dexamethasone; IBMX: 3-isobutyl-1-methylxanthine; D0–D12: Day 0 to Day 12. (B) Validation of Ephx1 KO in 3T3-L1 pre-adipocytes and study of its expression during adipocyte differentiation. Numbers on the left correspond to molecular weight markers (kDa). Western blot images are representative of three independent experiments. (C) Adipocyte differentiation assessed by Oil Red O lipid staining. 3T3-L1 pre-adipocytes were studied during adipocyte differentiation for 12 days. First and third lines: Pictures of dishes stained by Oil Red O. Images are representative of three independent experiments. Second and fourth lines: representative images of fluorescence microscopy after staining of intracellular lipids (Oil Red O, red) and nuclei (DAPI, blue). Images are representative of five independent experiments. (D) Quantification of Oil Red O fluorescence normalized to DNA content (DAPI). Results are expressed as means ± SEM of five independent experiments. ****p<0.0001. p-values were determined by analysis of variance (ANOVA) with Kruskal–Wallis post hoc multiple comparison test. (E) Protein expression of adipocyte markers obtained by western blotting during in vitro adipocyte differentiation of 3T3-L1 pre-adipocytes. Numbers on the left correspond to molecular weight markers (kDa). Western blot images are representative of three independent experiments. PPARγ: peroxisome proliferator-activated receptor gamma; C/EBPα: CCAAT/enhancer-binding protein alpha; SREBP-1c: sterol regulatory element-binding protein-1c; FAS: fatty acid synthase. (F) Activation of insulin signaling in 3T3-L1 pre-adipocytes after 10 days of adipocyte differentiation. The 3T3-L1 cells from ATCC, CTL, and Ephx1-KO cells were deprived of serum for 6 hr, stimulated with 20 nM insulin for 5 min or left untreated, and subjected to immunoblotting with antibodies against total and phospho-insulin receptor β-subunit (IRβ), insulin receptor substrate-1 (IRS1), AKT, and extracellular-regulated kinase (ERK)1/2. Numbers on the left correspond to molecular weight markers (kDa). Western blot images are representative of three independent experiments.

To exclude the possibility that undesired off-target mutations were responsible for the effects observed in KO cells, we used another gRNA, which targets Ephx1 exon 5. As assessed by western blot analysis, we could knock-down Ephx1 as efficiently as with the initial gRNA (Figure 4—figure supplement 5). As revealed by Oil Red O staining, this new KO cellular model had a similar defect in adipocyte differentiation as the first KO cell line used throughout this study (Figure 4—figure supplement 5). Taken together, these results show that Ephx1 deficiency alters adipogenesis and inhibits insulin signaling, consistent with the lipoatrophic and insulin-resistant phenotype.

Ephx1 knockout in pre-adipocytes promotes oxidative stress and senescence

A previous study has shown that EPHX1 might protect cells from oxidative stress (Cheong et al., 2009). In addition, increased cellular senescence has been functionally linked to fat-related metabolic dysfunction (Tchkonia et al., 2010) and has been observed in a few lipodystrophic syndromes (Bidault et al., 2013; Fiorillo et al., 2018). Cellular aging has also been associated with an increased production of reactive oxygen species (ROS) (Davalli et al., 2016). Consequently, we wondered if Ephx1 deficiency might promote ROS production and senescence. To test this hypothesis, oxidative stress was first evaluated. Ephx1 KO cells displayed higher levels of ROS in cell lysates, compared to either WT or control 3T3-L1 cells (p<0.0001) (Figure 5A). The proliferative capacity and biochemical markers of cellular senescence was then evaluated in edited 3T3-L1 pre-adipocytes. Bromodeoxyuridine (BrdU) incorporation was lower in Ephx1 KO cells compared to WT and control cells (p<0.0001), consistent with a reduced proliferation rate (Figure 5B). In parallel, the levels of P21 and P16, two cell cycle cyclin-dependent kinase inhibitors were significantly increased in KO cells, consistent with increased senescence (Figure 5C). Additionally, compared to WT and control 3T3-L1 cells, Ephx1 KO cells were characterized by a significant increase in senescence-associated β-galactosidase (SA-β-gal) activity (p<0.0001), which is another marker of cellular senescence (Figure 5D,ELópez-Otín et al., 2013). Finally, enhanced levels of phosphorylated P53 were observed in KO cells (Figure 5C), further underlining the senescent cellular phenotype (Qian and Chen, 2013).

Ephx1 deficiency causes oxidative stress and cellular senescence in murine 3T3-L1 pre-adipocytes and human ASCs.

Data were obtained in 3T3-L1 pre-adipocytes from ATCC, as well as ASCs isolated from a sub-cutaneous abdominal adipose tissue biopsy from a control woman of the same sex and age as patient 1 and normal BMI. CRISPR-Cas9-mediated EPHX1-knockout (KO) was obtained in the two cell types. Cells transfected with a Cas9/scramble gRNA plasmid were used as control (CTL). Differences between the three cell lines were determined by analysis of variance (ANOVA) with Bonferroni’s post hoc multiple comparison test. All results are expressed as means ± SEM of three independent experiments. (A–E) refer to 3T3-L1 cells. (F–H) refer to ASC cells. (A) Reactive oxygen species (ROS) production assessed by oxidation of 5–6-chloromethyl-2,7-dichlorodihydro-fluorescein diacetate (CM-H2DCFDA) in 3T3-L1 pre-adipocytes. Results were normalized to DNA content measured by DAPI. ****p<0.0001. (B) Evaluation of cellular proliferation by BrDU incorporation. ****p<0.0001. (C) Evaluation of cellular senescence by western blotting using antibodies against the indicated proteins. Numbers on the left correspond to molecular weight markers (kDa). (D) Representative immunofluorescence images of senescence (SA-β-gal) after staining at pH4 and pH6. Scale bar is 100 μm. (E) The SA-β-gal staining ratio at pH 6.0/pH 4.0 was calculated. ****p<0.0001. (F) Validation of EPHX1 KO in the ASC model and evaluation of expression of several cellular senescence markers by western blotting. Numbers on the left correspond to molecular weight markers (kDa). (G) Representative immunofluorescence images of senescence (SA-β-gal) after staining at pH4 and pH6. Scale bar is 100 μm. (H) The SA-β-gal staining ratio at pH 6.0/pH 4.0 was calculated. ***p<0.001; ****p<0.0001.

To further demonstrate the relevance of the 3T3-L1 murine model, a lentiviral CRISPR/Cas9-mediated EPHX1 KO was generated in human adipose stem cells (ASCs) using a custom-designed gRNA targeting the third exon of EPHX1. A scramble gRNA was used as control (CTL). KO efficiency was confirmed by western blot analysis showing a near-complete loss of EPHX1 expression (Figure 5F). This KO led to a major increase in cellular senescence, as assessed by the significant increase in SA-β-gal activity (p<0.001) (Figure 5G,H) and enhanced levels of phosphorylated P53, P21, and P16 (Figure 5F). The level of senescence was so high (~20-fold increase) that it prevented the EPHX1 KO ASCs to be further differentiated into adipocytes. Altogether, these data obtained in a murine cell line and validated in a human cellular model strongly argue for a functional link between EPHX1 dysfunction, oxidative stress, and cellular senescence.

Fibroblasts from patient 1 display a senescent phenotype

Although skin is not a tissue in which EPHX1 is highly expressed, the protein was detected by western blot in cultured fibroblasts from skin biopsies of two normal individuals (T1 and T2) and patient 1 (Figure 6—figure supplement 1). These immunoblot analyses using several anti-EPHX1 polyclonal antibodies allowed us to detect only the monomeric EPHX1 form (55 kDa) but not the higher-order complexes. We next assessed oxidative stress. The mutant fibroblasts showed increased levels of ROS in cell lysates compared with controls (p<0.0001) (Figure 6A). Regarding the impact of the EPHX1 variant on cellular senescence, the patient 1-derived fibroblasts displayed an altered morphology with an enlarged, flattened, and irregular shape, as compared to spindle-shaped control fibroblasts (Figure 6—figure supplement 2). BrdU incorporation was significantly reduced in mutant fibroblasts (p<0.0001), which was correlated with increased levels of P21 and P16 (Figure 6B,C). Furthermore, SA-β-gal activity was markedly increased in the mutant fibroblasts (p<0.0001), even though these fibroblasts were at an earlier passage than controls (Figure 6D,E). This increased SA-β-gal activity was accompanied by enhanced levels of phosphorylated P53 in mutant fibroblasts (Figure 6C). Together, these results were similar to those obtained using Ephx1-KO pre-adipocytes, confirming ex vivo the key role of EPHX1 in controlling senescence-associated oxidative stress.

Figure 6 with 2 supplements see all
The p. Thr333Pro variant causes oxidative stress and cellular senescence in patient 1-derived fibroblasts.

Data were obtained using cultured fibroblasts from skin biopsies of two normal individuals (T1 and T2) and patient 1. Differences between the three fibroblast cultures were determined by analysis of variance (ANOVA) with Bonferroni’s post hoc multiple comparison test. All results are expressed as means ± SEM of three independent experiments. (A) Reactive oxygen species (ROS) production assessed by oxidation of 5–6-chloromethyl-2,7-dichlorodihydro-fluorescein diacetate (CM-H2DCFDA) in fibroblasts derived from T1, T2, and patient 1. Results were normalized to DNA content measured by DAPI. ****p<0.0001. (B) Evaluation of cellular proliferation by BrDU incorporation. ****p<0.0001. (C) Evaluation of cellular senescence by western blotting using antibodies against the indicated proteins. Numbers on the left indicate molecular weight markers (kDa). (D) Representative immunofluorescence images of senescence (SA-β-gal) after staining at pH4 and pH6. Scale bar is 100 μm. (E) The SA-β-gal staining ratio at pH 6.0/pH 4.0 was calculated. ****p<0.0001.

Treatment of patient 1 with metreleptin is very beneficial

Since patient 1 suffered from severe diabetes, insulin therapy was started since the age of 12 years. High doses (up to 15 IU/kg/day) of rapid acting insulin analogs and then Humulin Regular U-500 were required through a basal-bolus regimen then an insulin pump. However, this did not provide suitable glycemic control (HbA1c: 10–16.5%). Other anti-diabetic treatments, including metformin and exenatide, did not bring additional effectiveness, and the patient’s hyperphagia hampered the compliance with diet. Treatment with metreleptin, a recombinant form of leptin used in the treatment of lipoatrophic syndromes, was initiated at the age of 22 years at the initial dose of 5 mg, then readjusted after 6 months at the dose of 7.5 mg. The treatment efficacy was evaluated 3 and 6 months after its introduction (Table 2). There was a major beneficial effect on metabolic manifestations since it led to a decrease of HbA1c to 7.3% after 6 months of treatment, allowing to reduce daily insulin doses by almost 50% (Table 2). Metreleptin effectiveness was also evidenced by a decrease in liver enzymes and an improvement of liver scores for steatosis, fibrosis, and necrosis/inflammation (Table 2).

Discussion

This translational study presents the first example of a monogenic disorder related to a gene in the EH family. The data demonstrate the pleiotropic effect of EPHX1 and its key role in cell homeostasis. This is consistent with the high evolutionary conservation of EHs across multiple organisms, including animals, insects, plants, fungi, and bacteria (van Loo et al., 2006), and underscores their essential biological function.

In this study, two different EPHX1 de novo missense variants were identified in patients with a progressive multisystemic disorder. According to the American College of Medical Genetics and Genomics (ACMG) criteria (Richards et al., 2015), these variants can be classified as ‘pathogenic’ with the inclusion of our functional data. The two patients share a number of clinical characteristics including dysmorphic features and manifestations affecting the liver, adipose tissue, and nervous system. The broad expression of EPHX1 explains how germline variants in this gene result in this multisystemic phenotype. As an example, EPHX1 transcripts have been detected in various areas of the brain (Farin and Omiecinski, 1993), and EPHX1 was also recently shown to play a complementary role to EPHX2 in the brain metabolism of naturally occurring EETs, which constitute a major class of EpFAs (Marowsky et al., 2016; Marowsky et al., 2009). The involvement of the EPHX1 de novo variants identified herein in diabetes and liver dysfunction is also consistent with a number of previous observations. Firstly, the expression of EPHX1 is regulated by various transcriptional factors including GATA4 and HNF4A (Liang et al., 2005; Peng et al., 2013), two genes implicated in other forms of monogenic diabetes. In regard to systemic hormonal regulation, it was demonstrated in primary hepatocytes that insulin positively and glucagon negatively regulate EPHX1 expression (Kim et al., 2003). A previous study also showed that a common polymorphism in EPHX1 (p.Tyr113His) was associated with an increased risk of type 2 diabetes mellitus and insulin resistance (Ghattas and Amer, 2012), as well as liver cirrhosis (Sonzogni et al., 2002). It was shown that EPHX1 plays a key role in the liver metabolism of endogenous lipids (Marowsky et al., 2017). Regarding hormonal pathophysiology, patient 1 developed amenorrhea associated with steroidogenesis alterations. Partial and generalized lipoatrophy are commonly associated with insulin resistance and hyperandrogenism (Joy and Hegele, 2008). Indeed, hyperinsulinemia directly stimulates ovarian androgen production, which in turn alters insulin sensitivity with a positive feedback loop between insulin resistance and hyperandrogenism. The major insulin resistance observed in patient 1 might thus contribute to hyperandrogenism signs. Nevertheless, her total testosterone levels are much higher than those usually observed in lipodystrophic patients (Huang-Doran et al., 2021). Such an elevation of testosterone levels in the absence of tumor and in the presence of normal estradiol levels rather argue for a direct or indirect blockade of the aromatase activity. In this regard, a potential role of EPHX1 in reproductive physiology was suggested previously. EPHX1 is expressed in ovarian follicle cells (Cannady et al., 2002) and is regulated by progesterone during the menstrual cycle (Popp et al., 2010). Several endogenous biologically active epoxide mediators of the steroidogenic pathway were found to be EPHX1 substrates, such as androstene oxide (16α,17α-epoxyandrosten-3-one) and estroxide (epoxyestratrienol) (Vogel-Bindel et al., 1982). EPHX1 protects cells from oxidative stress in oviducts (Cheong et al., 2009). A decrease in estradiol formation from testosterone was seen in human ovaries upon treatment with an EPHX1 inhibitor (Hattori et al., 2000). Polycystic ovary syndrome, characterized by hyperandrogenism and elevated serum testosterone levels, is observed in patients taking sodium valproate (Isojarvi et al., 1993), an anti-epileptic and anti-convulsant drug known to inhibit EPHX1 activity (Kerr et al., 1989). This observation is reminiscent of what is seen in our patient, who displays signs of hyperandrogenism in association with a loss of EPHX1 activity. The role of EPHX1 on the reproductive function could also be illustrated by the reported link between EPHX1 polymorphisms and spontaneous abortion (Wang et al., 1998) or preeclampsia (Laasanen et al., 2002). Consequently, further functional experiments in estrogen-producing granulosa cell models would be helpful to understand how EPHX1 could modulate aromatase activity or other steps of the steroidogenic pathway.

There were few data on the role of EPHX1 in adipose tissue, and its function in adipocytes remained elusive. The current study supports a role for EPHX1 in adipogenesis and adipocyte functions. We observed a defect in adipocyte differentiation in 3T3-L1 cells with CRISPR-Cas9 KO of Ephx1. This cellular model also revealed decreased expression of mature adipocyte markers, as well as altered insulin signaling even in pre-adipocytes. This is consistent with the lipoatrophic phenotype observed in the two patients carrying de novo EPHX1 pathogenic variants. Such an adipocyte differentiation defect has been reported in several other lipoatrophic diabetes of various genetic origins (Akinci et al., 2018a; Capel et al., 2018; Sollier et al., 2021). Lipoatrophic diabetes are indeed characterized by an incapacity of adipose tissue to store triglycerides, leading to ectopic fat depots and insulin resistance. The profound serum leptin and adiponectin deficiency observed in patients further confirms an endocrine defect of adipose tissue, since these hormones are secreted by mature adipocytes. What is the cellular link between the loss of EPHX1 activity and adipogenesis defect? EPHX1 substrates might play a key role since oxylipins, which are EPHX1 substrates, target peroxisome proliferator-activated receptors (PPARs) to modify adipocyte formation and function (Barquissau et al., 2017). It has also been reported that EETs decrease mesenchymal stem cells (MSC)-derived adipocyte differentiation by inhibiting PPARγ, C/EBPα, and FAS (Kim et al., 2010). In addition, PPARγ agonists have been shown to increase the expression of EPHX2 (De Taeye et al., 2010), whose expression is also interdependent of that of EPHX1 (Edin et al., 2018). Additional experiments will be required to precisely define the link between the loss of EPHX1 and adipogenesis alteration, which might involve the deregulation of PPARγ agonists or antagonists. Altogether, these data show that EPHX1, with its crucial role in epoxide reactive species biotransformation, stands at the crossroad of several signaling pathways and thereby plays a key role in cell metabolism and homeostasis.

EpFAs are endogenous lipid mediators functionally regulated in part by their hydrolysis by EPHX1 and EPHX2. Strategies stabilizing or mimicking EpFAs are commonly reported to contribute to cell homeostasis maintenance (Bettaieb et al., 2013; Wang et al., 2014; Liu et al., 2018). In this regard, it has been proposed that EpFAs prevent mitochondrial dysfunction, reduce ROS formation, and alleviate ER stress (Inceoglu et al., 2017). EETs exhibit numerous beneficial effects, such as anti-inflammatory, analgesic, vasodilatory, angiogenic, fibrinolytic, tissue-regenerating, and cytoprotective effects (Marowsky et al., 2017; Imig, 2012; Morisseau, 2013). This has been deeply investigated for EPHX2, and specific inhibitors have shown beneficial effects on a wide range of apparently unrelated conditions, including diabetes, fibrosis, chronic pain, cardiovascular, and neurodegenerative diseases (Ghosh et al., 2020), so that several of these EPHX2 inhibitors were tested in phase I clinical trials (Morisseau and Hammock, 2013; Imig and Hammock, 2009). In contrast, the current study shows that a loss of EPHX1 activity can be associated with a severe multisystemic phenotype. How to reconcile these apparently conflicting data? Like numerous other signaling molecules, the function of EpFAs strongly depend on the biological context (Inceoglu et al., 2017). The absence of a measurable effect of EpFAs under basal conditions is consistently observed across different laboratories and is in stark contrast to their strong efficacy under pathological situations. EpFAs seem to function with fine tuning to regulate and maintain cell homeostasis. This point is best illustrated by the ability of EPHX2 inhibitors to shift both hypertension and hypotension toward normotension in rodent models (Sinal et al., 2000; Ulu et al., 2016).

The gnomAD database, which collects variants from the general population, reports several dozen predicted loss-of-function variants in EPHX1, including nonsense, frameshift, and canonical splice site variants. This suggests that the pathogenic effect of the missense variants identified in patients 1 and 2 is not only due to a loss-of-function, but may be associated with a dominant negative mechanism. A previous study on the 3D-structure of EPHX1 suggests that this enzyme, which is mostly membrane bound, might be dimeric (Zou et al., 2000). This would be in favor of a dominant negative effect, as well as the formation of higher-order complexes within the ER observed in overexpression studies. Although this aspect of EPHX1 structure has so far been poorly explored, it may have important consequences for EPHX1 function, for example, by pre-orienting the enzyme for binding of either substrates or functional partners. We did not detect any dominant negative effect in the c-SO hydrolysis assay when co-expressing WT and mutated forms of EPHX1 (Figure 2—figure supplement 2). However, overexpression studies are probably not the most appropriate system to investigate such properties. Additional studies will be required to better understand EPHX1 activity when embedded in the microsomal ER membranes in endogenous conditions. In any case, the final result is a loss of the enzyme activity, consistent with the localization of the variants at the center of EPHX1 catalytic site. EPHX1 KO in 3T3-L1-pre-adipocytes revealed a high rate of ROS production, an observation confirmed in patient 1-derived fibroblasts. These data reinforce the proposed role of EHs as regulators of oxidative stress (Cheong et al., 2009; Inceoglu et al., 2017; Ulu et al., 2016). Patient 1-derived fibroblasts displayed an altered morphology, senescent features such as an increase in the SA-β-gal marker, as well as a reduced proliferative rate. This senescent phenotype was reproduced by removing EPHX1 in 3T3-L1 pre-adipocytes and ASCs, which subsequently loss their capacity to differentiate into adipocytes. Our findings not only support the notion that cellular senescence is an important player in adipogenesis, but also argue that EPHX1 might directly regulate adipocyte differentiation.

Regarding available animal models, Ephx1 knockout mice have already been generated (Miyata et al., 1999). Deletion of the gene in the heterozygous or homozygous state did not induce an obvious phenotype and histological examination of several organs revealed no difference between Ephx1-null mice and wild-type littermates. The first complexity when attempting to model lipodystrophy in mice is the differences between human and murine fat distribution and lipid metabolism, particularly the handling and oxidation of lipids (Rochford, 2014). So far, it appears that observations made in models of congenital generalized lipodystrophies (CGL) can translate quite accurately from mice to humans. Indeed, the most frequent CGL are autosomal recessive disorders due to bi-allelic null variants. In contrast, familial partial lipodystrophy syndromes are more difficult to study in mice, since they are often autosomal dominant and some variants induce a dominant negative effect (Garg, 2011). Knock-in mice would be required to better investigate such pathophysiological mechanisms for EPHX1 variants, and additional metabolic stress is sometimes needed to uncover more aspects of the human phenotype (Gray et al., 2006).

In this study, we were also interested in improving the therapeutic management of this novel clinical entity, which justifies careful clinical evaluation and requires multidisciplinary care. Patient 1 suffered from very severe diabetes with persistent glycemic imbalance despite very high insulin doses. Metreleptin was shown to reduce hyperphagia leading to weight loss, to improve insulin sensitivity and secretion, to reduce hypertriglyceridemia, hyperglycemia, and fatty liver disease in many patients with lipoatrophic diabetes (Vatier et al., 2016; Akinci et al., 2018b). All these beneficial effects were rapidly observed in patient 1 after treatment initiation. Besides, regarding the specific role of EPHX1 as a xenobiotic detoxifying enzyme, another practical implication of this study for the patient is the contraindication to all drugs known to be metabolized by EPHX1, especially carbamazepine, phenobarbital, and phenytoin (El-Sherbeni and El-Kadi, 2014). They would not be properly metabolized by EPHX1 and eliminated by the patient leading to toxicity.

The data presented here emphasize that lipid mediator regulation by EHs is essential for homeostasis and that its alteration is a newly discovered mechanism in monogenic insulin-resistant lipoatrophic diabetes. The field of monogenic diabetes is quickly advancing, and knowledge gained in recent years led to great improvements in understanding of their molecular and cellular bases. This allows to improve overall quality of life for patients and their families, with earlier diagnoses and personalized treatments. Continued efforts at gene discovery may help reveal mechanistic pathways implicated in the more common forms of type 1 and type 2 diabetes and lead to better treatments and outcomes.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HEK 293ATCCCRL-1573Embryonic kidney
Cell line (Mus musculus)3T3-L1ATCCCL-173The cells undergo a pre-adipose to adipose like conversion as they progress from a rapidly dividing to a confluent state
Primary fibroblastsT1Pr. Fève lab at CRSA, ParisN/ANon-obese and non-diabetic female, skin biopsy
Primary fibroblastsT2Pr. Fève lab at CRSA, ParisN/ANon-obese and non-diabetic female, skin biopsy
Primary fibroblastsPatient 1Pr. Fève lab at CRSA, ParisN/APatient 1, female, skin biopsy
Adipose stem cellsASCsPr. Fève lab at CRSA, ParisN/AFemale, from subcutaneous abdominal adipose tissue
AntibodyAnti-adiponectinThermo Fisher ScientificCat# MA1-054WB (1:1000)
AntibodyAnti-AKTSanta Cruz BiotechnologyCat# sc-8312WB (1:1000)
AntibodyAnti β-actinSigma AldrichCat# A2228WB (1:10,000)
AntibodyAnti-CalnexinENZO Life ScienceCat# ADO-SPA-860IF (1:200)
AntibodyAnti-C/EPBαProtein TechCat# 18311-1-1PWB (1:1000)
AntibodyAnti-EPHX1NovusCat# NBP1-3301WB (1:1000) - IF (1:1000)
AntibodyAnti-ERKCell Signaling TechnologyCat# 9102WB (1:1000)
AntibodyAnti-FASCell Signaling TechnologyCat# 3180WB (1:1000)
AntibodyAnti-FlagOrigeneCat# TA50011-100WB (1:1000) - IF (1:1000) - IP (1:200)
AntibodyAnti-IRΒCell Signaling TechnologyCat# 3025WB (1:1000)
AntibodyAnti-IRS1Protein TechCat# 17509–1-APWB (1:1000)
AntibodyAnti-P16Protein TechCat# 10883–1-APWB (1:1000)
AntibodyAnti-P21Protein TechCat# 10355–1-APWB (1:1000)
AntibodyAnti-P53AbcamCat# ab1101WB (1:1000)
AntibodyAnti-P-AKTSanta Cruz BiotechnologyCat# sc-7985-RWB (1:1000)
AntibodyAnti-P-ERKCell Signaling TechnologyCat# 9101WB (1:1000)
AntibodyAnti-P-P53AbcamCat# ab38497WB (1:1000)
AntibodyAnti-PPARgProtein TechCat# 16643–1-APWB (1:1000)
AntibodyAnti-SREBP-1Santa Cruz BiotechnologyCat# sc-366WB (1:1000)
AntibodyAnti-TubulinProtein TechCat# 66031–1-lgWB (1:10,000)
AntibodyAnti-P-TyrSanta Cruz BiotechnologyCat# sc-7020WB (1:1000)
AntibodyAnti-rabbit-HRPGE HealthcareCat# NA934VWB (1:2000)
AntibodyAnti-mouse-HRPGE HealthcareCat# NA931VWB (1:2000)
Recombinant DNA reagent (plasmid)pCMV-entry-FlagOrigeneCat # PS100001
Recombinant DNA reagent (plasmid)pCMV-EPHX1 WT-Flag or without FlagThis paperN/ADescribed in Materials and methods
Publicly available (Addgene)
Recombinant DNA reagent (plasmid)pCMV-EPHX1 c.337T>C -Flag or without FlagThis paperN/ADescribed in Materials and methods
Publicly available (Addgene)
Recombinant DNA reagent (plasmid)pCMV-EPHX1 c.416A>G -Flag or without FlagThis paperN/ADescribed in Materials and methods
Publicly available (Addgene)
Recombinant DNA reagent (plasmid)pCMV-EPHX1 c.997A>C -Flag or without FlagThis paperN/ADescribed in Materials and methods
Publicly available (Addgene)
Recombinant DNA reagent (plasmid)pCMV-EPHX1 c.1212G>C -Flag or without FlagThis paperN/ADescribed in Materials and methods
Publicly available (Addgene)
Recombinant DNA reagent (plasmid)pCMV-EPHX1 c.1288G>C -Flag or without FlagThis paperN/ADescribed in Materials and methods
Publicly available (Addgene)
Recombinant DNA reagent (plasmid)pSpCas9(BB)−2A-GFP (PX458)AddgeneCat# 48138A gift from Zhang lab
Recombinant DNA reagent (plasmid)pLentiCRISPR v2AddgeneCat# 52961A gift from Zhang lab
Software algorithmFIJI softwareNIHN/A
Software algorithmGraphPadGraphpad SoftwareN/A
Software algorithmPrismGraphpad SoftwareN/A

Genetic studies

Request a detailed protocol

Diagnostic laboratories performed genetic analyses on genomic blood DNA extracted from peripheral blood leukocytes using standard procedures. Exons and flanking intronic sequences of a panel of genes involved in lipoatrophic diabetes (Jéru et al., 2019) were captured from fragmented DNA with the SeqCapEZ enrichment protocol (Roche NimbleGen, USA). Paired-end massively parallel sequencing was achieved on a MiSeq platform (Illumina, USA). Bioinformatic analysis was performed using the Sophia DDM pipeline (Sophia Genetics, Switzerland). Identification of EPHX1 variants was obtained by WES. For patient 1, library preparation, exome capture, sequencing, and variant calling and annotation were performed by IntegraGen SA (Evry, France). Genomic DNA was captured using Twist Human Core Exome Enrichment System (Twist Bioscience, USA) and IntegraGen Custom, followed by paired-end 75 bases massively parallel sequencing on Illumina HiSeq4000. Identification of the potentially pathogenic variants were determined using Sirius software (IntegraGen SA, France). For patient 2, exome sequencing was performed on the proband and both parents as previously described (Retterer et al., 2016). EPHX1 variants were confirmed by Sanger sequencing with the Big Dye Terminator v3.1 sequencing kit (Thermo Fisher Scientific, MS, USA) after PCR amplification and analyzed on a 3500xL Dx device with the SeqScape v2.7 software (Thermo Fisher Scientific, MS, USA). EPHX1 variants were described based on the longest isoform (NM_000120.4) using Alamut 2.11 (Sophia Genetics, Switzerland) and Human Genome Variation Society guidelines. Variants were classified according to the ACMG recommendations (van Loo et al., 2006). Protein sequences were aligned using the Clustal Omega software, and the degree of conservation was presented with help of the BoxShade software. EPHX1 variants were queried in human populations using gnomAD.

Plasmids and transfection

Request a detailed protocol

EPHX1 cDNA was amplified by RT-qPCR using RNA from HepG2 cells and inserted into the pCMV6-entry mammalian expression vector containing a C-terminal Flag Tag (#PS100001; Origene, MD, USA). EPHX1 variants (c.337T>C, c.416A>G, c.997A>C, c.1212G>C, and c.1288G>C) were introduced using the Quikchange II Site-directed mutagenesis kit (#200523; Agilent Technologies, CA, USA), and constructs were checked by Sanger sequencing. To remove the C-terminal Flag Tag of the different plasmids, a nonsense variant was introduced by site-directed mutagenesis. Transient transfection of the different cell lines was carried out in six-well plates with TurboFect Transfection Reagent (#R0532; Thermo Fisher Scientific, MS, USA) according to the manufacturer’s instructions.

Cell culture

Request a detailed protocol

HEK 293 cells purchased from ATCC with a negative mycoplasma contamination test were cultured in high-glucose (4.5 g/L) Dulbecco’s modified Eagle’s medium (DMEM; #11960085; Thermo Fisher Scientific) containing 10% fetal calf serum (FCS) (#F7524; Sigma-Aldrich, MI, USA), 1% penicillin/streptomycin (PS). 3T3-L1 pre-adipocytes purchased from ATCC with a negative mycoplasma contamination test were maintained in an undifferentiated state in high-glucose (4.5 g/L) DMEM supplemented with 10% newborn calf serum and 1% PS (#CA-1151500; Biosera, MI, USA). Adipocyte differentiation was induced by treating 2 day post-confluent cultures with high-glucose (4.5 g/L) DMEM supplemented with 10% FCS, 1% PS, 1 µM dexamethasone (#D4902; Sigma-Aldrich), 250 µM 3-isobutyl-1-methyl xanthine (IBMX) (#I7018; Sigma-Aldrich), and 0.17 µM insulin (#I0516; Sigma-Aldrich) for 3 days. The medium was then replaced with high-glucose DMEM supplemented with 10% FCS, 1% PS, and 0.17 µM insulin and changed to fresh medium every 2 days until the 12th day. Primary fibroblast cultures were established using skin biopsies from two healthy non-obese non-diabetic women, named T1 and T2, as well as from patient 1. Fibroblasts were grown in low glucose (1 g/L) DMEM with pyruvate (#31885049; Thermo Fisher Scientific) and supplemented with 10% FCS, 1% PS, and 2 mM glutamine. Fibroblasts were stained at a low passage number (i.e., passage 4 for patient 1, passage 9 for T1 and T2). ASCs were isolated from surgical samples of sub-cutaneous abdominal adipose tissue from a control woman of the same sex and age as patient 1 and normal BMI. Adipose tissue samples were enzymatically digested with collagenase B (0.2%). After centrifugation, stromal vascular fraction was filtered, rinsed, plated, and cultured in α-MEM with 10% FCS, 2 mmol/L glutamin, 1% PS (10,000 UI/mL), 1% HEPES, and fibroblast growth factor-2 (145 nmol/L). After 24 hr, only ASCs adhered to plastic surfaces, while other cells were removed after culture medium replacement. ASCs were maintained in an undifferentiated state in high-glucose (4.5 g/L) DMEM supplemented with 10% newborn calf serum and 1% PS. All culture conditions were kept constant throughout the experiments.

CRISPR/Cas9-mediated deletion of Ephx1 in 3T3-L1 pre-adipocytes

Request a detailed protocol

pSpCas9(BB)−2A-GFP (PX458) was a gift from Zhang lab (Addgene, MA, USA; plasmid #48138) and was used to transfect 3T3-L1 cells with Cas9 along with the targeting guide RNAs (gRNAs). gRNAs were designed and checked for efficiency (http://cistrome.org/SSC) and specificity (http://crispr.mit.edu). We used the web-based tool, CRISPOR (http://crispor.tefor.net/), to avoid off-target sequences. Subsequently, gRNAs were cloned in the plasmid and transfected into cells using TurboFect (#R0532; Thermo Fisher Scientific) according to the manufacturer’s instructions. Forty-eight hours post-transfection, cells were sorted by flow cytometry (Cell Sorting Core Facility, Centre de Recherche Saint-Antoine), and cells with the highest GFP positivity were transferred into a 24-well plate and propagated. We favored a plasmid transient transfection method rather than a viral transduction to reduce the expression of Cas9 in cells and prevent its integration into the host cell genome, which may lead to increased off-target activities. Moreover, to minimize the effect of possible off-target mutations, we analyzed heterogeneous populations issued from the FACS sorting rather than clonal populations. The gRNA sequences used in this study to target Ephx1 were the following: gRNA (exon 6) sense:

5’ TCTTAGAGAAGTTCTCCACC 3’; antisense: 5’ GGTGGAGAACTTCTCTAAGA 3’. gRNA (exon 5) sense: 5’ TACAACATCATGAGGGAGAG 3’; antisense: 5’ CTCTCCCTCATGATGTTGTA 3’.

CRISPR/Cas9-mediated deletion of EPHX1 in human ASCs

Request a detailed protocol

The lentiviral plasmid plentiCRISPRv2 was a gift from Zhang lab (Addgene, MA, USA; plasmid #52961) and contains the puromycin resistance, hSpCas9 and the chimeric guide RNA (gRNAs). The gRNA targeting EPHX1 exon 3 was designed and checked for efficiency (http://cistrome.org/SSC) and specificity (http://crispr.mit.edu). Its sequence was the following: sense 5’ CCCTGGCTATGGCTTCTCAG 3’; antisense 5’ CTGAGAAGCCATAGCCAGGG 3’. The web-based tool, CRISPOR (http://crispor.tefor.net), was used to evaluate potential off-target sequences. Subsequently, the gRNA was cloned into plentiCRISPRv2 and lentivirus were produced by the VVTG platform (SFR Necker, France). ASCs were infected with viral particles at a minimal titer of 108 transducing units per mL. Forty-eight hours post-infection, cells were selected with 5 μg/mL puromycin dihydrochloride (#P9620; Sigma-Aldrich). Surviving cells were propagated, and the heterogeneous cell pool was used for experiments.

Immunofluorescence

Request a detailed protocol

For indirect immunofluorescence, HEK 293 cells were grown on glass coverslips, and after transfection, they were fixed for 15 min in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) and then permeabilized for 15 min with 0.1% Triton X-100 in PBS at room temperature. Cells were washed three times with a blocking solution containing PBS with 5% fatty acid free bovine serum albumin. Primary antibodies used for immunostaining were as follows: mouse anti-Flag (Origene) (1/1000), rabbit anti-EPHX1 (Novus) (1/1000), and rabbit anti-Calnexin (#ADO-SPA-860; Enzo Life Sciences, France) (1/200). Cells were incubated 1 hr at 37°C, rinsed, and then incubated for 45 min at room temperature with the appropriate Alexa-conjugated isotype-specific secondary antibodies (Thermo Fisher Scientific) and 4',6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific). The coverslips were mounted in DAKO fluorescence mounting media (#S3023; Agilent Technologies, CA, USA). Images were acquired using a SP2-inverted confocal microscope (Leica Biosystems, Germany), equipped with an HCX PL APO CS 63X/1.32 oil immersion objective, and analyzed using Leica Confocal Software and FIJI Software. For each experiment, all images were acquired with constant settings (acquisition time and correction of signal intensities).

Measurement of EPHX1 activity

Request a detailed protocol

EPHX1 activity in lysates of transfected HEK 293 or 3T3-L1 cells was determined using [3H]-cis-stilbene oxide ([3H]-cSO), as described previously (Hassett et al., 1994). After thawing on ice, cells were diluted with chilled sodium phosphate buffer (20 mM, pH 7.4) containing 5 mM ethylenediaminetetraacetic acid (EDTA), 1 mM dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride, and 0.2% (v/v) Triton X-100. Cells were then broken with a 10 s ultrasonic pulse. The mixture was centrifuged at 5000 g for 20 min at 4°C. Supernatants were collected and flashed frozen, before being used for further analysis. Protein concentration was quantified using the Pierce BCA assay (Pierce, IL, USA), using Fraction V bovine serum albumin (BSA) as the calibrating standard. After thawing on ice, supernatants were diluted (5- to 20-folds) with Tris–HCl buffer (0.1 M, pH 9.0) containing freshly added BSA (0.1 mg/mL). In glass tubes containing 100 μL of the diluted extract, the reaction was started by adding 1 µL of 5 mM [3H]-cSO in ethanol (10,000 cpm, [S]final = 50 µM). The mixture was incubated at 37°C for 5–120 min. The reaction was then quenched by the addition of 250 μL of isooctane, which extracts the remaining epoxide from the aqueous phase. The activity was followed by measuring the quantity of radioactive diols formed in the aqueous phase using a scintillation counter (TriCarb 2810 TR, Perkin Elmer, Shelton, CT). Assays were performed in triplicates.

Western blot

Request a detailed protocol

Cells were homogenized in NP-40 lysis buffer to obtain protein lysates. Thirty micrograms of protein extracts was separated by sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membrane, and analyzed by immunoblotting.

Immunoprecipitation

Request a detailed protocol

Transfected HEK 293 cells were recovered in 1 mL of PBS. They were centrifuged at 4025 g for 1 min in a microfuge and resuspended in 50–100 µL of TNT buffer (20 mM Tris–HCl - pH 7.5, 200 mM NaCl, 1% Triton X-100). After incubation on ice for 10 min and centrifugation at 16,099 g for 10 min, supernatants were recovered and protein concentrations determined. Protein lysates (100–200 mg in 200 µL of TNT) were either directly analyzed by western blotting or first immunoprecipitated. In this latter case, extracts were incubated under rotation for 2 hr at 4°C with the relevant antibody. Protein G Sepharose (Sigma) was then added and the mixture incubated for a further 1 hr at 4°C. Sepharose beads were quickly centrifuged in a microfuge (30 s at 11,180 g) and washed three times with TNT. After final wash, the beads were resuspended in 30 mL of buffer A (10 mM KCl, 2 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 10 mM HEPES – pH 7.8) complemented with loading dye, before being processed as described in western blot analysis.

Oxylipin extraction and quantification in plasma

Request a detailed protocol

The targeted oxylipin analysis was designed based on the metabolic pathway of n-3 and n-6 polyunsaturated fatty acid precursors as described previously (Yang et al., 2009). The LC/MS-MS analysis was performed with an Agilent 1200SL UHPLC system interfaced with a 4000 QTRAP mass spectrometer (Sciex). Separation of oxylipins was performed with the Agilent Eclipse Plus C18 150 × 2.1 mm 1.8 μm column with mobile phases of water with 0.1% acetic acid as mobile phase A and acetonitrile/methanol (84/16) with 0.1% acetic acid as mobile phase B.

Oil Red O staining, image processing, and quantification

Request a detailed protocol

Intracellular lipids were stained by Oil Red O (#O0625; Sigma-Aldrich). Cells were washed with PBS and fixed with 4% PFA in PBS, for 10 min. Fixed cells were incubated with Oil Red O solution for 1 hr at room temperature and then with DAPI (Thermo Fischer Scientific) for 5 min. Fluorescence images were generated with IX83 Olympus microscope, acquired with Cell-Sens V1.6 and analyzed with FIJI software. Images of 8–10 different areas per condition were visualized by fluorescence microscopy using mCherry filter, followed by computer image analysis using FIJI software. Briefly, analysis was performed by threshold converting the 8-bit Red-Green-Blue image into a binary image, which consists only of pixels representing lipid droplets (i.e., red). Importantly, after separation, the binary image was manually compared with the original image for consistency and correct binary conversion. The area occupied by lipid droplets in the image was displayed by FIJI software as surface area in μm2 and normalized to cell number by semi-automated counting of DAPI-stained nuclei.

Cell proliferation assay

Request a detailed protocol

3T3-L1 cells and fibroblasts were seeded in a 12-well plate (5000 per well) and incubated overnight at 37°C in DMEM supplemented with 10% FCS and 1% PS. Cell proliferation was evaluated by BrdU incorporation using a colorimetric ELISA assay (#QIA58; Sigma-Aldrich) 16 hr after seeding, according to the manufacturer’s instructions.

Oxidative stress and cellular senescence

Request a detailed protocol

The oxidation of the fluorogenic probe 2,7-dichlorodihydro-fluorescein diacetate (CM-H2DCFHDA) (2 µg/mL, #C6827; Sigma-Aldrich) was used to evaluate intracellular levels of ROS on a 200-plate fluorescence reader (Tecan Infinite, Switzerland) at 520–595 nm. The blue staining of β-galactosidase (β-gal) at pH 6 was used as a biomarker of cellular senescence. Cells were fixed with 4% PFA in PBS for 5 min at room temperature. Cells were washed twice with PBS and incubated overnight in fresh SA-β-gal staining solution containing 1 mg/mL of X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) (#3117073001; Sigma-Aldrich), 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, 2 mM MgCl2, and 0.4 mM phosphate buffer, pH 6.0, in darkness at 37°C without CO2. For positive staining controls, fixed cells were treated with the same solution, but at pH 4.0. After imaging with an IX83 Olympus microscope, stained cells were resuspended with 2% SDS, scratched, and sonicated. Finally, the absorbance (630 nm) was read with a Tecan Infinite 200-plate reader and the staining ratio at pH 6.0/pH 4.0 was calculated.

Statistics

Data are presented as means ± SEM (standard error of the mean). GraphPad Prism software (GraphPad Software) was used to calculate statistical significance. Gaussian distribution was tested with the Kolmogorov–Smirnov test. Multiple comparisons were conducted by one-way analysis of variance (ANOVA) with Bonferroni test or Kruskal–Wallis test for post hoc analysis. p<0.05 was considered statistically significant.

Study approval

Request a detailed protocol

We obtained written informed consent for all genetic studies as well as for the use of photographs shown in Figure 1. The study was approved by the CPP Ile de France five research ethics board (DC 2009–963, Paris, France) and the Columbia institutional review board (AAAJ8651, New York, United States).

Data availability

Plasmids used in this study have been deposited in Addgene under accession number 79368. Exome data from human subjects cannot been made available, since the informed written consents did not permit sharing of the full sequence data. To circumvent this fact and to fit with the Editor and Reviewers' comment, two supplementary files have been provided listing all other rare variants identified in the two families investigated herein, according to the corresponding mode of inheritance. For each variant, we indicated the items arguing against its involvement in the disease phenotype. All data generated or analysed during this study are included in the manuscript and supporting files. Source data have been provided for all western blot experiments.

References

    1. Munteanu M
    2. Ratziu V
    3. Morra R
    4. Messous D
    5. Imbert-Bismut F
    6. Poynard T
    (2008)
    Noninvasive biomarkers for the screening of fibrosis, steatosis and steatohepatitis in patients with metabolic risk factors: fibrotest-fibromax experience
    Journal of Gastrointestinal and Liver Diseases : JGLD 17:187–191.
    1. Vogel-Bindel U
    2. Bentley P
    3. Oesch F
    (1982)
    Endogenous role of microsomal epoxide hydrolase Ontogenesis, induction inhibition, tissue distribution, immunological behaviour and purification of microsomal epoxide hydrolase with 16 Alpha, 17 alpha-epoxyandrostene-3-one as substrate
    European Journal of Biochemistry 126:425–431.

Decision letter

  1. Michael Czech
    Reviewing Editor; University of Massachusetts Medical School, United States
  2. David E James
    Senior Editor; The University of Sydney, Australia
  3. Robert Semple
    Reviewer

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This manuscript describes a novel genetic basis for human lipodystrophy associated with diabetes and insulin resistance. Two human subjects with mutations in the catalytic region of the epoxide hydrolase EPHX1 which catalyzes hydrolysis of epoxides to diols display this disease, and disruption of this enzyme in cultured cells attenuates differentiation into adipocytes. These results implicate epoxides as important disruptors of adipose tissue functions required for metabolic health.

Decision letter after peer review:

Thank you for submitting your article "EPHX1 mutations cause a lipoatrophic diabetes syndrome due to impaired epoxide hydrolysis and increased cellular senescence" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by David James as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Robert Semple (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

This manuscript presents novel and important information on a new form of human lipodystrophy related to mutations in EPHX1, and proposes a likely mechanistic hypothesis on how this occurs based on modest support from in vitro studies. The reviewers are in general agreement that this study is meritorious and advances the field. A revised manuscript is anticipated. We have left virtually the entire texts of the reviewers for your considerations in the revision, but they are related to only 3 issues that should need to be considered or addressed.

1) As outlined in Reviewer 3's first 5 bullet points and in Reviewer 2's comments for revision, more information would be needed on the clinical phenotype and genetics of the patients analyzed. Please see the details of these requests in their reviews.

2) As outlined by Reviewer 1, might epoxide content be analyzed in human adipocytes in order to use a more relevant in vitro model and additional mechanistic information that may more strongly support the overarching hypothesis?

3) Some technical issues in data presentation, as outlines in Reviewer 3's bullet points 6 and 7

4) Off target effects of the CRISPR-based deletions would be required to assess the possibility (which is low) that the effects you observed in cultured adipocytes are due to toxic non-specific gene modificaitons by the CRISPR procedure. (Reviewer 2). This is standard practice in the field.

Reviewer #1:

A major strength of this study is the identification of novel mutations in EPHX1 that are linked to lipodystrophy in humans. Mechanistic data are also nicely provided, suggesting dysfunctional EPHX1 in adipocytes is detrimental to differentiation and the viability of those adipocytes that do differentiate. The data suggest the mechanism of toxicity due to EPHX1 mutation is the inability of such adipocytes to remove epoxides, and the m vitro data are supportive of this hypothesis.

Further evidence in support of the major hypothesis would be the possible identification of epoxides that may accumulate in adipocytes with mutated EPHX1. Also it would be of interest to show effects of EPHX1 disruption in human adipocytes rather than relying on the mouse 3T3-L1 cells.

Nonetheless, the study is novel, mechanistically insightful and advances the field significantly.

1. Further evidence in support of the major hypothesis would be the possible identification of epoxides that may accumulate in adipocytes with mutated EPHX1. Have the authors performed lipidomic analysis of the adipocytes that are deficient in EPHX1? Could epoxide content be measured?

2. It would be of interest to show effects of EPHX1 disruption in human adipocytes rather than relying on the mouse 3T3-L1 cells. This could be done with human preadipocytes using Cas9/sgRNA RNPs, which yield high efficiency knockdowns without the need for selection of cells.

Reviewer #2:

1. The key starting point for this work is the human genetics, so is it convincing. In general, I think it is highly suggestive but clearly a few more cases with EPHX1 mutations would be helpful. In the absence of this I suggest that some additional information be shared. A standard trio analysis such as that performed herein should include consideration of any homozygous variants, compound heterozygous variants and all de novo variants. This should be provided for both cases so that readers can review these data too.

2. Regarding the clinical phenotyping – this is reasonable but was more limited in the second case – there are some clinical points which ought to be addressed. Specifically, a full description of the patient's fat distribution should be included and ideally fat mass (DXA), leptin and adiponectin ought to be measured, though I appreciate this may not be feasible for some reason. Either way it should be overtly clarified.

– The image in figure 1D is not clear enough to show lipodystrophy – is it possible to improve on this or show images of the fat distribution – even if only from the DXA scan.

3. The bioinformatic structural predictions of the impact of the mutations and the impact on enzyme activity look convincing though I am not familiar with the assay.

4. The functional studies described in figure 3 are suboptimal as I worry that without the arrows in 3A, it might not be easy for a reader to see the differences. I also wonder if an 'aggregate' would really run as a clean single band as shown in the gels in 3B.

It might help to see more zoomed in views of the cells and for the authors to clarify whether or not 'aggregates' were also apparent in cells expressing the other mutations. If they were, then some form of quantification should be included.

5. CRISPR/Cas9 mediated gene deletion is widely felt to be challenging in 3T3L1 adipocytes as they are typically aneuploid. Then whilst the data clearly shows impaired differentiation, the underlying mechanism is unclear. I don't think this is formally required at this stage as this can be challenging to pin down conclusively but can the authors be certain that the impact is not due to an off target effect of the CRISPR strategy? Did they sequence the gene etc to confirm the expected impact?

The claim that this is a novel phenotype caused by EPHX1 mutations seems very likely to be true and the functional work is probably adequate for an initial publication. Ultimately more similar cases will be needed to validate the claims. I have highlighted some technical issues, the most important one being inclusion of more sequencing detail.

Reviewer #3:

In this manuscript Gautheron and colleagues describe two people with heavily overlapping clinical problems including insulin resistance, reduced adipose tissue (lipodystrophy) and features of "lipotoxicity" (e.g. fatty liver, high serum triglyceride concentration). Other shared syndromic features include an abnormal facial appearance, and sensorineural deafness. Both probands were found to harbour de novo missense mutations in EPHX1 (i.e. the mutation is absent from the parents). EPHX1 encodes a microsomal epoxide hydrolase known to hydrolyse a range of xenobiotic and endogenous epoxides, which are a source of redox stress and cellular damage. Overexpression studies in HEK293 cells with biochemical assay of hydrolysis of a labelled substrate convincingly demonstrate nearly complete loss of function of the missense mutations identified in the probands, in keeping with structural modelling suggesting important roles in stabilising the active site of the enzyme. Overexpressed mutant but not wild type enzyme appeared to aggregate in the endoplasmic reticulum, giving rise to speculation that they might exert a dominant negative effect over co-expressed wild type.

In further studies, Crispr/CAS9 editing was used to knock out Ephx1 in 3T3-L1 cells, a clonal mouse embryo-fibroblast preadipocyte model. After selection of a polyclonal population of cells with knockdown, it was demonstrated that knockout but not control cells could differentiate into mature adipocytes, with reduced insulin responsiveness. Finally, both knockout 3T3-L1 cells and primary dermal fibroblasts were shown to have some increased markers of replicative senescence, including reduced proliferation, increased SA β-gal staining, increased reactive oxygen species, increased phosphorylation of p53, and increased protein expression of p21 and p16.

Overall, this study will be of interest in particular to genetecists, metabolic physicians, adipose biologists, and to those studying ageing. Although the argument is not developed in detail, loss of EPHX1 could confer lipodystrophy and insulin resistance in at least 2 ways. First, by allowing accumulation of toxic ROS, it may increase DNA damage and cellular ageing in adipose precursor or mesenchymal stem cells. Disorders such as Werner syndrome already suggest that this lineage is particularly vulnerable to DNA damage. It is also possible that EPHX1 deficiency reduces generation of an important endogenous ligand of PPARG, the master adipogenic transcription factor, though this is more difficult to prove.

The evidence in this study that EPHX1 mutations cause the syndrome described is moderately convincing but could be enhanced, and the variants found clearly abrogate enzyme function. The evidence for a dominant mechanism mechanism of action is circumstancial only, while some aspects of the phenotypic description seem an overreach based on the data presented. I would add the following specific observations:

Clinical phenotype:

1. There is quite a lot of discussion of "steroidogenesis abnormalities" but there is no clear evidence offered of anything more than is common seen in severe insulin resistance (IR), when ovarian androgen production may be extremely elevated. Please could the authors place their observations in the context of other forms of severe IR? Is there any evidence that the steroid profile is different?

2. EPHX1 expression is very high in the adrenal glands, and it is commented that these are normal in volume and morphology on MRI. But what about their function? Was synacthen testing or other profiling of adrenal steroids undertaken?

3. It is implied that leptin may be a specific treatment for this disorder. In fact the response to leptin is entirely as expected from this degree of lipodystrophy and baseline serum leptin. Parenthetically, it is claimed that the serum leptin concentration (4mcg/L) is consistent with generalised lipodystrophy, whereas to me this looks much more in keeping with known forms of partial lipodystrophy.

Evidence for causation of syndrome by EPHX1 mutations:

4. Raw exome data are not made available as part of this study. This is commonly done in human genetic studies, and I assume that when the authors say it cannot be done here, they mean that suitable consent is not in place. This is reasonable but should be explicit. Without such raw data it would be helpful to readers to have more genetic information. The headline finding of a de novo EPHX1 mutation is given, but were there any other de novo, compound heterozygous or homozygous, rare, likely loss of function mutations in the first proband studied?

5. In the GnomAD repository (up to around 250,000 alleles), there is no evidence of selection against EPHX1 loss of function variants in the general population. I counted 66 loss-of-function alleles (nonsense/frameshift/essential splice site) and a large number of missense variants, including at least one affecting a residue in the catalytic triad. It is implausible, to me, that this syndrome occurs in all these people, and this suggests that heterozygous EPHX1 loss-of-function mutations are likely only rarely associated with the syndrome described, either because of low penetrance, or because simple loss of function of one allele is insufficient. This gives circumstancial support for the notion that only certain mutations that produce dominant negative activity may be required for disease. This does not undermine the case made in the manuscript, but may be worthy of comment.

Evidence for mechanism linking EPHX1 mutations to lipodystrophy:

6. Biochemical studies in overexpressing HEK293 cells show convincingly that the EPHX1 mutations nearly abolish enzyme activity

7. 3T3-L1 knockout studies in mixed populations appear to have been well executed, and the finding that adipogenesis is impaired with increased senescence markers seems sound. Nevertheless 3T3-L1 cells are derived from mouse embryonic fibroblasts, and it is notable that Ephx1 knockout mouse were reported to be phenotypically normal (J. Biol. Chem. 274: 23963-23968). This is worth discussing.

8. Although insulin signalling appears impaired, is this simply a consequence of impaired differentiation, when expression of the insulin receptor normally increases? What about insulin signalling in preadipocytes? Any reduction could also be an indirect consequence of senescence. Although the patients have systemic insulin resistance, this does NOT necessarily need to correspond to a cell autonomous defect in insulin action. Adipose dysfunction would suffice to explain the clinical derangement.

9. The evidence for a dominant negative mechanism of action of the mutant enzymes is circumstancial only, though very plausible. The aggregates seen in HEK293s may be relevant, but this is not clear in such overexpression studies. Nevertheless it would appear straightforward to conduct some further studies in this model, looking at the ability of co-expressed mutant to reduce activity of co-expressed wild type enzyme, as long as care is taken to include suitable controls.

10. One of the challenges in studying primary dermal fibroblasts is that "passage 1" is often timed from establishment of outgrown cells in the lab, which in turn may take weeks from the time of tissue biospy. Could the authors clarify that the cells and controls used had roughly been through the same length of time and/or doubling times in culture?

11. Was there evidence of increased DNA damage in affected cells?

12. Speculation that loss of Ephx1 may alter generation of endogenous agonists (and maybe) antagonists of PPARG is interesting but untested.

13. More detail on birthweights and growth parameters would be useful for both probands. Was the microcephaly sustained in the first patient? What about the second patient?

14. Please address the other clinical questions above.

15. Please list other de novo, compound heterozygous or homozygous, rare, likely loss of function mutations in the first proband and add a statement in text that all parents and any siblings were clinically unaffected.

16. I assume that EPHX1 mutations were also sought in other lipodystrophy cohorts but weren't found. Can any information be offered about this?

17. Through GeneMatcher were any other EPHX1 mutations reported linked to different phenotypes?

18. HEK293 studies were undertaken as duplicates of n=2. Showing data as mean +/- SEM is inappropriate. Better just show points as a scatter plot (see below).

19. "dynamite plunger" plots when numbers are small can hide important data heterogeneity and are now widely disfavoured. Please could all data points be shown superimposed as a scatter plot on these graphs.

20. Language: generally good but with small grammatical lapses (e.g. in abstract). Also, even for this clinically qualified reader some of the technical jargon is obscure and not widely used in anglophone medicine. An "ogival palate" would usually be a "high-arched palate" and "spaniomenorrhoea" is better called "oligomenorrhoea". There are other examples of whether more routine medical jargon could be made more accessible for non-clinical readers, too.

https://doi.org/10.7554/eLife.68445.sa1

Author response

Essential revisions:

This manuscript presents novel and important information on a new form of human lipodystrophy related to mutations in EPHX1, and proposes a likely mechanistic hypothesis on how this occurs based on modest support from in vitro studies. The reviewers are in general agreement that this study is meritorious and advances the field. A revised manuscript is anticipated. We have left virtually the entire texts of the reviewers for your considerations in the revision, but they are related to only 3 issues that should need to be considered or addressed.

1) As outlined in Reviewer 3's first 5 bullet points and in Reviewer 2's comments for revision, more information would be needed on the clinical phenotype and genetics of the patients analyzed. Please see the details of these requests in their reviews.

Genetic issue:

The Reviewers 2 and 3 requested the presentation of all alternative genetic hypotheses that could be considered to explain the disease in patients presented in this study. To address this important issue, we have added two Supplementary Files listing the characteristics of all other rare variants identified in the two families investigated herein, according to the corresponding mode of inheritance. For each variant, we indicated the items arguing against its involvement in the disease phenotype. For both patients, we did not find any likely alternative molecular etiology. This is now stated in the Results section of the manuscript (Page 5) as follows: “We did not identify any alternative molecular etiology compatible with the disease phenotype in either of the two patients. A detailed list of the other rare de novo, compound heterozygous, and homozygous variants, as well as the reasons for their exclusion is provided in Supplementary File 1 and 2.”

Clinical issue:

The reviewers also requested more clinical information. We have collected as much information as possible, while respecting the patients' willingness to perform additional investigations. In particular, patient 2 requested no publication of her photos.

Please find below the clinical data that have been added into the revised manuscript:

– Birthweights and growth parameters

– For patient 1:

Page 6: “This patient (woman) was born at term after a normal pregnancy without intra-uterine growth retardation. The anthropometric parameters at birth were normal with a height of 49 cm, and a weight of 2.8 kg. She was first referred for dysmorphic features including microcephaly with an occipito-frontal circumference (OFC) of 33 cm at birth (-1.5 SD), which remained present in adulthood with an OFC of 51 cm (-2.5 SD) at the age of 18 years.”

– For patient 2:

Page 7: “This patient (woman) was born at term, after a normal pregnancy, with a height of 50 cm and a weight of 3.2 kg.”

– Lipoatrophic phenotype

A dual-energy x-ray absorptiometry (DXA)-scan was performed in patients 1 and 2 providing whole body and segmental measures of fat percentage and further confirming the lipoatrophic phenotype. This is now detailed in the Results section of the revised manuscript:

– For patient 1 (Page 6): “This lipoatrophic phenotype was further confirmed by dual X-ray absorptiometry (DXA) with a total fat mass of 15.8%, whereas the mean normal age-matched value is 31.4 ± 8.5% (23), corresponding to a Z-score of -2.8. The study of segmental body composition revealed that the loss of adipose tissue was evenly distributed throughout the body (Figure 1—figure supplement 2).”

– For patient 2 (Page 7): “Lipoatrophy was first noted in the face and the lipoatrophic phenotype was further confirmed by DXA with a total fat mass of 12.4%, a value within the first percentile as compared to age-matched normal individuals. The study of segmental body composition revealed that the loss of adipose tissue affected the whole body and was more pronounced in upper and lower limbs (Figure 1—figure supplement 3).”

Two figure supplements to figure 1 have also been added presenting DXA results, detailed body composition, and adipose indices.

Values for additional biological parameters have been obtained and added in the revised version of the manuscript (Page 7) as follows: “Measurement of serum levels of leptin (3 ng/mL) and adiponectin (0.3 mg/L) further confirmed the lipoatrophic and insulin-resistant phenotype.” These values have also been added in Table 1.

– Adrenal steroid profiling

Results of adrenal steroid profiling, performed several times for patient 1, have been added in the revised version of the manuscript (Page 7): “Adrenal steroid profiling revealed normal levels of cortisone, cortisol, 21-desoxycortisol, 11-desoxycortisol, aldosterone, corticosterone, 21-desoxycorticosterone, 11-desoxycorticosterone, and ACTH.”

2) As outlined by Reviewer 1, might epoxide content be analyzed in human adipocytes in order to use a more relevant in vitro model and additional mechanistic information that may more strongly support the overarching hypothesis?

Measurement of epoxides is an important point and several complementary approaches were considered to address this issue.

– None of the two patients wished to undergo an adipose tissue biopsy, which could have been used to study adipocyte stem cells (ASCs). Moreover, given that the fat mass was very low in patient 1, the clinicians in charge of the patient considered that the sampling would be very painful and would certainly not make possible to collect a sufficient quantity of tissue.

– We have thus measured the levels of epoxy fatty acids and corresponding diols in the plasma of patient 1. These experiments have been performed by the team of Christophe Morisseau and Bruce Hammock, co-authors of the paper and internationally recognized experts in the field. These data have been added in the revised version of the manuscript (Page 9) together with an additional Figure 2—figure supplement 1 as follows: “To evaluate the impact of the loss of enzyme activity in vivo, we measured by liquid chromatography (LC) coupled with tandem mass spectrometry (MS/MS) circulating levels of a panel of epoxy-fatty acids (EpFAs) and corresponding diols in plasma samples of patient 1. […] Since oxylipin profiling is an emerging field, whose biological interpretation remains difficult, further experiments will be required to confirm this observation in additional patients and/or different cellular models.”

– Since we could not measure EpFAs in cell lines due to the low levels of fatty acids and the requirement of hundred million cells, we have measured the hydrolysis of cis-stilbene oxide (c-SO), a well-characterized substrate of EPHX1, in lysates of Ephx1 KO 3T3-L1 cells, as compared to WT and control (scramble RNA guide) 3T3-L1 cells. As shown in the new Figure 4—figure supplement 3, KO cells exhibit a strong and significant reduction of c-SO hydrolysis when compared with WT and control 3T3-L1 cells (~60% reduction). This information, which strengthens the relevance of the 3T3-L1 cellular model, has been added in the revised version of the manuscript (Page 10) as follows: “Consistently, hydrolysis of [3H]-cSO was evaluated in cell lysates and revealed a significant loss of enzyme activity in 3T3-L1 KO cells, as compared to control cells (Figure 4—figure supplement 3)”.

3) Some technical issues in data presentation, as outlines in Reviewer 3's bullet points 6 and 7.

We agree with Reviewer #3 that it was inappropriate to show Figure 2D with only two independent biological experiments. We have now repeated this experiment a third time and we could confirm that the two variants identified in patients, p.Thr333Pro and p.Gly430Arg, led to an absence of the enzyme activity as compared to the WT protein and the three other isoforms carrying variants from the general population. We have enriched Figure 2D with these additional data, but we did not replace all graphs by scatter plots since all the other experiments were conducted with at least three independent assays.

4) Off target effects of the CRISPR-based deletions would be required to assess the possibility ( which is low) that the effects you observed in cultured adipocytes are due to toxic non-specific gene modificaitons by the CRISPR procedure. (Reviewer 2). This is standard practice in the field.

Off-target effects have been reported for various CRISPR effectors, including Cas9, which was used in our cellular system. As detailed below, we have now designed three different RNA guides (gRNA) and generated two murine and one human EPHX1 KO cellular models. The three of them led to similar cellular alterations. This is a major point to demonstrate that the effects observed are not due to off-target mutations. In addition, we strictly followed the recommendation of several current genome editing protocols to select gRNA carefully in order to avoid off-target effects and to ensure high cleavage efficiency (Ran FA et al. Nat Protoc 2013 Nov;8(11):2281-308). Please find below, the list of measures undertaken to prevent off-target activities in each cellular model.

For the gRNA targeting Ephx1 exon 6, used in murine 3T3-L1 cells in the first version of the manuscript:

– The CRISPOR web tool (http://crispor.tefor.net/) is well recognized to predict the risk of off-target sequences by providing a cutting frequency determination (CFD) specificity score ranging from 1 to 100. The higher the number, the lower the risk of off-target effects. It is based on the accurate CFD off-target model from Doench JG et al. (Nat Biotechnol 2016 Feb;34(2):184-196,) which recommends guides with a CFD specificity score > 50. The gRNA targeting exon 6 has a CFD score of 88. First of all, the gRNA used did not match perfectly any other genomic region outside of the Ephx1 locus. Please find below a list of off-target sequences for this gRNA with up to three mismatches as compared to our gRNA sequence (TCTTAGAGAAGTTCTCCACCTGG). Notably, off-targets are considered if they are flanked by an NGG motif, which corresponds to the PAM sequence allowing the Cas9 to cut DNA.

Author response table 1
Number of mismatchesPotential off-target sequences (mismatches are in red and bold characters)Locus of the off-target (gene / location)
2TCTTAGTGAAGTGCTCCACCTAGZfhx3 / intron
3TTTTAGAGAAGTTGACCACCTGGGdpgp1 / exon
3TAATAGAGAAGTTCTCGACCTGATrpc7 / intron
3TACTAGAGAAGTTCTCCAGCTGAintergenic
3TCTCAGCCAAGTTCTCCACCAAGintergenic
3TCTCAGACATGTTCTCCACCAAGintergenic
3TCTTGGAGAAGTTCTTCAACAGGintergenic
3TCTTAGATAATTTCTCAACCAGGintergenic
3TCTTAGAGAAGTTTACCACTAGGintergenic
3TCCTAGAGAATTCCTCCACCTGGintergenic
3CCTTGGAGATGTTCTCCACCCAGFign / intron
3TCTAGGAGAAGTTCTCCACAAGGintergenic
3TCTTGGAGAAGTCCTTCACCTGGintergenic
3TGTTACAGAAGTTCTCAACCTGGintergenic
3TTTCAGAGAAGTTCTCTACCAGGintergenic
3GCTGAGAGAAGTTCTCCACAAGGClnk / intron

We have clarified this point into the Methods section of the revised manuscript (Page 22) as follows: “We used the web-based tool, CRISPOR () to avoid off-target effects.”

– To avoid off-target activities of Cas9, we privileged a plasmid transient transfection method rather than a viral transduction method to (i) reduce the expression of Cas9 in cells and (ii) prevent its integration into the genome of host cells. Indeed, it was demonstrated that extended expression of Cas9 in cells can lead to accumulation of off-targeting events (Kim S et al. Genome Res 2014 Jun; 24(6):1012-1019). Also, we favored the use of GFP to positively select transfected cells rather than an antibiotic resistance cassette, which would allow the integration of the plasmid into the genome (although the frequency of this event would be very low).

We have updated this point into the Methods section of the revised manuscript (Page 23) as follows: “We favored a plasmid transient transfection method rather than a viral transduction to reduce the expression of Cas9 in cells and prevent its integration into the host cell genome, which may lead to increased off-target activities.”

– To minimize the effect of possible off-target mutations, we analyzed heterogeneous populations issued from the FACS sorting rather than clonal populations (i.e., 10.997 sorted cells for the knock-out cell line). It is unlikely that the same off-target activities would occur in all cells.

This strategy to minimize off-target effects has been clarified into the Methods section of the revised manuscript (Page 23) as follows: “Moreover, to minimize the effect of possible off-target mutations, we analyzed heterogeneous populations issued from the FACS sorting rather than clonal populations.”

– To avoid the delivery of ineffective gRNA in our cells, we tested the gRNA efficacy in vitro. As expected from the CRISPOR designer tool, synthesized gRNA associated with recombinant Cas9 was able to cleave PCR products comprising Ephx1 exon 6 in vitro.

Author response image 1
Line 1: untreated EPHX1 PCR fragments; Line 2: EPHX 1 PCR fragments trated with gRNA and recombinant Cas9 enzyme.

Second gRNA targeting Ephx1 exon 5, used in murine 3T3-L1 cells in the revised version of the manuscript:

– We have designed another gRNA, which targets Ephx1 exon 5. Its CFD specificity score was 75 and, of note, the potential off-targets were completely different to those related to the initial gRNA.

The results related to this additional gRNA have been added and discussed into the revised manuscript (Page 11) as follows: “To exclude the possibility that undesired off-target mutations were responsible for the effects observed in KO cells, we used another gRNA, which targets Ephx1 exon 5. […] As revealed by Oil Red O staining, this new KO cellular model had a similar defect in adipocyte differentiation as the first KO cell line used throughout this study (Figure 4—figure supplement 5).”

Third gRNA targeting Ephx1 exon 5, used in human adipose stem cells (ASCs) in the revised version of the manuscript:

– To comply with Reviewer #1’s suggestion, we have knocked down EPHX1 in human ASCs using a third gRNA targeting EPHX1 exon 3 with a CFD score of 77. We could recapitulate the senescence phenotype observed in 3T3-L1 KO cells and in fibroblasts from patient 1. The level of cellular senescence was extremely high preventing the KO cells to be differentiated into adipocytes. These novel data in primary human cells confirm a functional link between EPHX1 and cellular senescence, which may underlie the lipodystrophy phenotype. The results have been added in the Results section of the manuscript (page 12) as follows: “To further demonstrate the relevance of the 3T3-L1 murine model, a lentiviral CRISPR/Cas9-mediated EPHX1 KO was generated in human adipose stem cells (ASCs) using a custom-designed gRNA targeting the third exon of EPHX1. […] Altogether, these data obtained in a murine cell line and validated in a human cellular model strongly argue for a functional link between EPHX1 dysfunction, oxidative stress, and cellular senescence.”

Collectively, the gRNA used in this study appears to be highly specific and it is unlikely that the observed cellular effects are due to unwanted off-target mutations.

Reviewer #1:

A major strength of this study is the identification of novel mutations in EPHX1 that are linked to lipodystrophy in humans. Mechanistic data are also nicely provided, suggesting dysfunctional EPHX1 in adipocytes is detrimental to differentiation and the viability of those adipocytes that do differentiate. The data suggest the mechanism of toxicity due to EPHX1 mutation is the inability of such adipocytes to remove epoxides, and the m vitro data are supportive of this hypothesis.

Further evidence in support of the major hypothesis would be the possible identification of epoxides that may accumulate in adipocytes with mutated EPHX1. Also it would be of interest to show effects of EPHX1 disruption in human adipocytes rather than relying on the mouse 3T3-L1 cells.

Nonetheless, the study is novel, mechanistically insightful and advances the field significantly.

We would like to thank Reviewer #1 for his/her kind words and detailed evaluation of our manuscript. Based on his/her comments, we have added several experiments to show the effect of EPHX1 mutations in patient 1 and to strengthen the mechanistic aspects of our study.

Please find below our point-by-point response.

1. Further evidence in support of the major hypothesis would be the possible identification of epoxides that may accumulate in adipocytes with mutated EPHX1. Have the authors performed lipidomic analysis of the adipocytes that are deficient in EPHX1? Could epoxide content be measured?

We agree with Reviewer #1 that measurement of epoxides is an important point and several complementary approaches were considered to address this issue. For more details, please also refer to comment 2 of the Editor. To summarize:

– None of the two patients wished to undergo an adipose tissue biopsy. Moreover, given that the fat mass was very low in patient 1, the clinicians in charge of the patient considered that the sampling would be very painful and would certainly not make possible to collect a sufficient quantity of tissue.

– We have measured the levels of several epoxy fatty acids and corresponding diols in the plasma of patient 1. These experiments have been performed by the team of Christophe Morisseau and Bruce Hammock, co-authors of the paper and internationally recognized experts in the field. These data have been added in the revised version of the manuscript together with a Figure 2—figure supplement 1.

– Measurement of EpFAs in cell lines is a very hard task due to the low amount of fatty acids and the need of hundred million cells. This would have been all the more difficult as the Ephx1 KO 3T3-L1 do not differentiate into adipocytes. However, to strengthen the relevance of the cellular model used, we have measured the hydrolysis of cis-stilbene oxide (c-SO), a well-characterized substrate of EPHX1, in lysates of 3T3-L1 cells. As shown in the new Figure 4—figure supplement 3, Ephx1 KO cells exhibit a strong and significant reduction of c-SO hydrolysis as compared to WT and control (scramble gRNA) 3T3-L1 cells (~60% reduction). This information has been added in the revised version of the manuscript together with a Figure 4—figure supplement 3. Please also refer to comment 2 of the Editor for more details.

2. It would be of interest to show effects of EPHX1 disruption in human adipocytes rather than relying on the mouse 3T3-L1 cells. This could be done with human preadipocytes using Cas9/sgRNA RNPs, which yield high efficiency knockdowns without the need for selection of cells.

As suggested by Reviewer #1, we thought of using adipose stem cells (ASCs), which can be differentiated into adipocytes. The standard differentiation protocol requires the use of an adipogenic induction cocktail containing insulin, glucocorticoids (e.g., dexamethasone), and 1-methyl-3-isobutylxanthine (IBMX) (Lee M-J et al. Methods Enzymol. 2014;538:49-65). In addition, PPARγ agonists, such as rosiglitazone, are often used to improve cell differentiation capacity since human ASCs do not differentiate well in the absence of PPARγ ligands (Ahmadian M et al. Nat Med 2013 May:19(5):10.1038/nm.3159). For this study, we initially excluded the use of ASCs because PPARγ agonists are known to regulate the expression of epoxide hydrolases (De Taye BM et al. Obesity. 2010 Mar;18(3):489-98), notably EPHX2, and functional compensation between EPHX1 and EPHX2 has been shown to occur in vivo (Edin ML et al. J Biol Chem. 2018 Mar2; 293(9):3281-92). Therefore, the use of PPARγ agonists to differentiate ASCs may induce a compensatory phenomenon making the analysis of EPHX1 KO hazardous. Since the differentiation protocol of 3T3-L1 pre-adipocytes does not require PPARγ agonists, we favored this model, which led to major advances in our understanding of adipogenesis and lipid metabolism over the last decade.

– Nevertheless, to comply with Reviewer #1’s suggestion, we have generated a human ASC model. As stem cells are notoriously difficult to transfect with standard methods/reagents (e.g., electroporation, lipid-based transfection), we favored the use of a lentiviral CRISPR/Cas9 system to knock down EPHX1. This additional set of data confirms the observations made in 3T3-L1 cells and fibroblasts derived from patient 1 and the functional link between EPHX1 dysfunction and cellular senescence. Please also refer to comment 4 of the Editor for more details.

The new lentiviral CRISPR/Cas9 system is now described in the Methods section of the revised manuscript (Page 23): “The lentiviral plasmid plentiCRISPRv2 was a gift from Zhang lab (Addgene, MA, USA; plasmid #52961) and contains the puromycin resistance, hSpCas9 and the chimeric guide RNA (gRNAs). […] ASCs were infected with viral particles at a minimal titer of 108 transducing units per mL. 48 h post infection, cells were selected with 5 μg/ml puromycin dihydrochloride (#P9620; Sigma-Aldrich). Surviving cells were propagated and the heterogeneous cell pool was used for experiments.”

The description of ASC isolation and culture has been added in the Methods section of the revised manuscript (Page 22) as follows: “ASCs were isolated from surgical samples of sub-cutaneous abdominal adipose tissue from a control woman of the same sex and age as patient 1 and normal BMI. […] ASCs were maintained in an undifferentiated state in high-glucose (4.5 g/L) DMEM supplemented with 10 % newborn calf serum and PS 1 %.”

The results obtained in these human cells have been added into the revised manuscript (Page 12) as follows: “To further demonstrate the relevance of the 3T3-L1 murine model, a lentiviral CRISPR/Cas9-mediated EPHX1 KO was generated in human adipose stem cells (ASCs) using a custom-designed gRNA targeting the third exon of EPHX1. […] Altogether, these data obtained in a murine cell line and validated in a human cellular model strongly argue for a functional link between EPHX1 dysfunction, oxidative stress, and cellular senescence.”

Reviewer #2:

1. The key starting point for this work is the human genetics, so is it convincing. In general, I think it is highly suggestive but clearly a few more cases with EPHX1 mutations would be helpful. In the absence of this I suggest that some additional information be shared. A standard trio analysis such as that performed herein should include consideration of any homozygous variants, compound heterozygous variants and all de novo variants. This should be provided for both cases so that readers can review these data too.

To address this important issue, we have added two Supplementary Files listing the characteristics of all rare de novo, compound heterozygous, and homozygous variants, as well as the reasons accounting for their exclusion. No alternative molecular etiology was identified in either patient. This is discussed in the revised version of the manuscript. For a more detailed response, please see the answer to the first comment of the Editor.

2. Regarding the clinical phenotyping – this is reasonable but was more limited in the second case – there are some clinical points which ought to be addressed. Specifically, a full description of the patient's fat distribution should be included and ideally fat mass (DXA), leptin and adiponectin ought to be measured, though I appreciate this may not be feasible for some reason. Either way it should be overtly clarified.

– The image in figure 1D is not clear enough to show lipodystrophy – is it possible to improve on this or show images of the fat distribution – even if only from the DXA scan.

We have collected as much information as possible, while respecting the patients' willingness to perform additional investigations. In particular, patient 2 requested no publication of her photos.

A dual-energy x-ray absorptiometry (DXA)-scan was performed in patients 1 and 2 providing whole body and segmental measures of fat percentage and further confirming the lipoatrophic phenotype. This is now detailed in the Results section of the revised manuscript:

– For patient 1 (Page 6): “This lipoatrophic phenotype was further confirmed by dual X-ray absorptiometry (DXA) with a total fat mass of 15.8%, whereas the mean normal age-matched value is 31.4 ± 8.5% (23), corresponding to a Z-score of -2.8. The study of segmental body composition revealed that the loss of adipose tissue was evenly distributed throughout the body (Figure 1—figure supplement 2).”

– For patient 2 (Page 7): “Lipoatrophy was first noted in the face and the lipoatrophic phenotype was further confirmed by DXA with a total fat mass of 12.4%, a value within the first percentile as compared to age-matched normal individuals. The study of segmental body composition revealed that the loss of adipose tissue affected the whole body and was more pronounced in upper and lower limbs (Figure 1—figure supplement 3).”

Two figure supplements to figure 1 have also been added presenting DXA results, detailed body composition, and adipose indices.

Values for additional biological parameters have been added for patient 2 in the revised version of the manuscript (page 7) as follows: “Measurement of serum levels of leptin (3 ng/mL) and adiponectin (0.3 mg/L) further confirmed the lipoatrophic and insulin-resistant phenotype.” These values have also been added in Table 1.

3. The bioinformatic structural predictions of the impact of the mutations and the impact on enzyme activity look convincing though I am not familiar with the assay.

We thank Reviewer #2 for this comment.

4. The functional studies described in figure 3 are suboptimal as I worry that without the arrows in 3A, it might not be easy for a reader to see the differences. I also wonder if an 'aggregate' would really run as a clean single band as shown in the gels in 3B.

It might help to see more zoomed in views of the cells and for the authors to clarify whether or not 'aggregates' were also apparent in cells expressing the other mutations. If they were, then some form of quantification should be included.

We agree with Reviewer #2 that “aggregate” was an imprecise word. We have clarified this within the revised manuscript by changing “aggregates” by “higher-order complexes”, a term better reflecting the observations made by Western blot analysis.

5. CRISPR/Cas9 mediated gene deletion is widely felt to be challenging in 3T3L1 adipocytes as they are typically aneuploid. Then whilst the data clearly shows impaired differentiation, the underlying mechanism is unclear. I don't think this is formally required at this stage as this can be challenging to pin down conclusively but can the authors be certain that the impact is not due to an off target effect of the CRISPR strategy? Did they sequence the gene etc to confirm the expected impact?

We acknowledge that this is an important point and we have now included a new set of experiments to strengthen the validity of our cellular model and to ensure that the effects were independent of off-target mutations. Please refer to point 4 of the Editor for a more detailed response. To summarize:

– We used the powerful and well-recognized tool “http://crispor.tefor.net” to predict and avoid off-targets.

– We favored a transient transfection method and GFP cell sorting to avoid prolonged Cas9 expression, which may enhance off-target effects.

– We analyzed heterogeneous populations issued from the FACS sorting rather than sub-clonal populations to minimize effect of possible deleterious off-target mutations. It is unlikely that a main off-target mutation occurred in all cells.

– We tested the gRNA efficacy in vitro to avoid delivery of ineffective gRNA in 3T3-L1 cells.

– We could confirm a strong and significant reduction of the hydrolysis of cis-stilbene oxide (c-SO) in lysates of EphX1 KO 3T3-L1 cells. This confirms the Western blot analysis and the knock-down efficiency.

– We conducted KO experiments using a different gRNA targeting Ephx1 exon 5 in 3T3-L1 cells. We could confirm a strong reduction of adipocyte differentiation with this new KO cell line, as seen with the initial gRNA. Since the sequence of this gRNA is completely different from that of the initial one, it argues against off-target effects.

– We generated an additional EPHX1 KO model in human adipose stem cells (ASCs) using another gRNA targeting the third exon of human EPHX1. A near complete loss of EPHX1 expression was observed by Western blot analysis (Figure 5F). This led to a reduction of the proliferative capacity of the cells and to a major increase of cellular senescence (Figure 5G and 5H) and recapitulated the effects seen in 3T3-L1 cells.

Reviewer #3:

In this manuscript Gautheron and colleagues describe two people with heavily overlapping clinical problems including insulin resistance, reduced adipose tissue (lipodystrophy) and features of "lipotoxicity" (e.g. fatty liver, high serum triglyceride concentration). Other shared syndromic features include an abnormal facial appearance, and sensorineural deafness. Both probands were found to harbour de novo missense mutations in EPHX1 (i.e. the mutation is absent from the parents). EPHX1 encodes a microsomal epoxide hydrolase known to hydrolyse a range of xenobiotic and endogenous epoxides, which are a source of redox stress and cellular damage. Overexpression studies in HEK293 cells with biochemical assay of hydrolysis of a labelled substrate convincingly demonstrate nearly complete loss of function of the missense mutations identified in the probands, in keeping with structural modelling suggesting important roles in stabilising the active site of the enzyme. Overexpressed mutant but not wild type enzyme appeared to aggregate in the endoplasmic reticulum, giving rise to speculation that they might exert a dominant negative effect over co-expressed wild type.

In further studies, Crispr/CAS9 editing was used to knock out Ephx1 in 3T3-L1 cells, a clonal mouse embryo-fibroblast preadipocyte model. After selection of a polyclonal population of cells with knockdown, it was demonstrated that knockout but not control cells could differentiate into mature adipocytes, with reduced insulin responsiveness. Finally, both knockout 3T3-L1 cells and primary dermal fibroblasts were shown to have some increased markers of replicative senescence, including reduced proliferation, increased SA β-gal staining, increased reactive oxygen species, increased phosphorylation of p53, and increased protein expression of p21 and p16.

Overall, this study will be of interest in particular to genetecists, metabolic physicians, adipose biologists, and to those studying ageing. Although the argument is not developed in detail, loss of EPHX1 could confer lipodystrophy and insulin resistance in at least 2 ways. First, by allowing accumulation of toxic ROS, it may increase DNA damage and cellular ageing in adipose precursor or mesenchymal stem cells. Disorders such as Werner syndrome already suggest that this lineage is particularly vulnerable to DNA damage. It is also possible that EPHX1 deficiency reduces generation of an important endogenous ligand of PPARG, the master adipogenic transcription factor, though this is more difficult to prove.

The evidence in this study that EPHX1 mutations cause the syndrome described is moderately convincing but could be enhanced, and the variants found clearly abrogate enzyme function. The evidence for a dominant mechanism mechanism of action is circumstantial only, while some aspects of the phenotypic description seem an overreach based on the data presented. I would add the following specific observations:

We thank the Reviewer #3, Prof. Robert Semple, for his detailed and positive evaluation of our manuscript. Based on his comments, we have added a number of additional information and experimental data. We have also thoroughly revised the manuscript in order to gain in clarity and to better discuss our findings in light of the existing literature.

Clinical phenotype:

1. There is quite a lot of discussion of "steroidogenesis abnormalities" but there is no clear evidence offered of anything more than is common seen in severe insulin resistance (IR), when ovarian androgen production may be extremely elevated. Please could the authors place their observations in the context of other forms of severe IR? Is there any evidence that the steroid profile is different?

We thank the Reviewer for this interesting question. In searching for specific information to address this issue, we found a very recent publication by the Reviewer 3’s team providing key elements (Huang-Doran I et al. J Clin Endocrinol Metab. 2021 Apr 26). In particular, total testosterone (TT) levels were measured in 173 women with lipodystrophy with a median level of 24.0 ng/dL (interquartile range: 20 – 59 ng/dL), i.e. median: 0.83 nmol/L (interquartile range: 0.69 – 2.04 nmol/L), whereas the TT levels in patient 1 were 16.9 nmol/L. In the revised version of the manuscript (Page 14), we now discuss the potential contribution of insulin resistance in hyperandrogenism signs, in relation to TT levels as follows: “Regarding hormonal pathophysiology, patient 1 developed amenorrhea associated with steroidogenesis alterations. […] In this regard, a potential role of EPHX1 in reproductive physiology was suggested previously.”

2. EPHX1 expression is very high in the adrenal glands, and it is commented that these are normal in volume and morphology on MRI. But what about their function? Was synacthen testing or other profiling of adrenal steroids undertaken?

Results of adrenal steroid profiling, performed several times for patient 1, have been added in the revised version of the manuscript (Page 7) as follows: “Adrenal steroid profiling revealed normal levels of cortisone, cortisol, 21-desoxycortisol, 11-desoxycortisol, aldosterone, corticosterone, 21-desoxycorticosterone, 11-desoxycorticosterone, and ACTH.”

3. It is implied that leptin may be a specific treatment for this disorder. In fact the response to leptin is entirely as expected from this degree of lipodystrophy and baseline serum leptin. Parenthetically, it is claimed that the serum leptin concentration (4mcg/L) is consistent with generalised lipodystrophy, whereas to me this looks much more in keeping with known forms of partial lipodystrophy.

– Metreleptin treatment

We agree that our message on the efficacy of metreleptin treatment was maybe too enthusiastic and could have been misleading to a non-expert reader. We have clarified this point in the Result (Page 13) and Discussion (Page 17) sections as follows: “Treatment with metreleptin, a recombinant form of leptin used in the treatment of lipoatrophic syndromes, was initiated…” and “Metreleptin was shown to reduce hyperphagia leading to weight loss, to improve insulin sensitivity and secretion, to reduce hypertriglyceridemia, hyperglycemia, and fatty liver disease in many patients with lipoatrophic diabetes (84,85). All these beneficial effects were rapidly observed in patient 1…”

– Leptin values

Using Reviewer 3’s advice, we have corrected the sentence related to leptin values (Page 6) as follows: “The serum leptin levels, which are strongly correlated with total body fat mass, were very low in patient 1 (4 ng/mL) and similar to those usually reported in partial lipodystrophy (24), further confirming the lipoatrophic phenotype.”

Evidence for causation of syndrome by EPHX1 mutations:

4. Raw exome data are not made available as part of this study. This is commonly done in human genetic studies, and I assume that when the authors say it cannot be done here, they mean that suitable consent is not in place. This is reasonable but should be explicit. Without such raw data it would be helpful to readers to have more genetic information. The headline finding of a de novo EPHX1 mutation is given, but were there any other de novo, compound heterozygous or homozygous, rare, likely loss of function mutations in the first proband studied?

To address this important issue, we have provided two Supplementary Files listing the characteristics of all rare de novo, compound heterozygous, and homozygous variants, as well as the reasons for their exclusion. No alternative molecular etiology was identified in either patient. This is discussed in the revised version of the manuscript. For a more detailed response, please see the answer to the first comment of the Editor.

5. In the GnomAD repository (up to around 250,000 alleles), there is no evidence of selection against EPHX1 loss of function variants in the general population. I counted 66 loss-of-function alleles (nonsense/frameshift/essential splice site) and a large number of missense variants, including at least one affecting a residue in the catalytic triad. It is implausible, to me, that this syndrome occurs in all these people, and this suggests that heterozygous EPHX1 loss-of-function mutations are likely only rarely associated with the syndrome described, either because of low penetrance, or because simple loss of function of one allele is insufficient. This gives circumstancial support for the notion that only certain mutations that produce dominant negative activity may be required for disease. This does not undermine the case made in the manuscript, but may be worthy of comment.

The reviewer is correct with this comment, and we have better discussed this issue in the revised version of the manuscript (Pages 16-17) as follows: “The gnomAD database, which collects variants from the general population, reports several dozen predicted loss-of-function variants in EPHX1, including nonsense, frameshift and canonical splice site variants. […] Additional studies will be required to better understand EPHX1 activity when embedded in the microsomal ER membranes in endogenous conditions.”

Evidence for mechanism linking EPHX1 mutations to lipodystrophy:

6. Biochemical studies in overexpressing HEK293 cells show convincingly that the EPHX1 mutations nearly abolish enzyme activity.

We thank Reviewer #3 for this positive comment.

7. 3T3-L1 knockout studies in mixed populations appear to have been well executed, and the finding that adipogenesis is impaired with increased senescence markers seems sound. Nevertheless 3T3-L1 cells are derived from mouse embryonic fibroblasts, and it is notable that Ephx1 knockout mouse were reported to be phenotypically normal (J. Biol. Chem. 274: 23963-23968). This is worth discussing.

We agree with Reviewer #3 that the fact that Ephx1 knock-out mice are phenotypically normal is worth being discussed. This information has been discussed into the revised manuscript (Page 17) as follows: “Regarding available animal models, Ephx1 knock-out mice have already been generated (80). […] Knock-in mice would be required to better investigate such pathophysiological mechanisms for EPHX1 variants, and additional metabolic stress is sometimes needed to uncover more aspects of the human phenotype (83).”

8. Although insulin signalling appears impaired, is this simply a consequence of impaired differentiation, when expression of the insulin receptor normally increases? What about insulin signalling in preadipocytes? Any reduction could also be an indirect consequence of senescence. Although the patients have systemic insulin resistance, this does NOT necessarily need to correspond to a cell autonomous defect in insulin action. Adipose dysfunction would suffice to explain the clinical derangement.

We acknowledge that impaired insulin signaling may be a simple consequence of impaired differentiation, we thus investigated insulin signaling in pre-adipocytes. These data have been included, together with a Figure 4—figure supplement 4, into the revised manuscript (Page 11) as follows: “In contrast, the Ephx1 KO cells were resistant to insulin, both in pre-adipocytes and differentiated cells, as shown by the lack or strong decrease in the phosphorylation of these intermediates upon insulin stimulation (Figure 4F and Figure 4—figure supplement 4)”.

9. The evidence for a dominant negative mechanism of action of the mutant enzymes is circumstantial only, though very plausible. The aggregates seen in HEK293s may be relevant, but this is not clear in such overexpression studies. Nevertheless it would appear straightforward to conduct some further studies in this model, looking at the ability of co-expressed mutant to reduce activity of co-expressed wild type enzyme, as long as care is taken to include suitable controls.

As suggested by Reviewer #3, we have investigated the ability of co-expressed mutant EPHX1 isoforms to reduce the activity of the wild-type (WT) protein. We first transfected increasing amounts of plasmids encoding the WT and mutated forms of EPHX1 in HEK293 cells, and examined the ability of cell lysates to hydrolyze [3H]-cSO substrate, as described in the first version of the manuscript. The total amount of transfected plasmid was kept constant using an empty vector (2 μg). We could confirm that the two variants identified in patients completely abolish the enzyme activity, whereas the WT isoform catalyzes c-SO hydrolysis in a dose-dependent manner. However, we could not observe a dominant negative effect when we co-expressed WT and mutated isoforms. For example, the hydrolysis activity of lysates co-expressing WT EPHX1 (1μg) and one mutated isoform (1μg) was roughly the same as that of lysates transfected only with WT EPHX1 (1μg).

Author response image 2

Of note, this cellular assay consisted of the hydrolysis of a radioactive synthetic substrate and was performed on protein lysates in overexpression studies. Thus, we cannot exclude that the mutants will exert a dominant negative effect on WT EPHX1 in vivo, since the dynamics of protein interaction in the endoplasmic reticulum under endogenous conditions might be different. In this regard, it has been proposed that EPHX1 might aggregate into oligomers (Zhou J, et al., Structure. 2000 Feb 15;8(2):111-22). Technical advances are needed to further investigate this dominant negative effect. For example, good antibodies and relevant assays to visualize hydrolysis activity in cells, such as Bioluminescence Resonance Energy Transfer, need to be developed.The possibility that mutants may exert a dominant negative effect on the WT protein in vivo is better addressed in the revised manuscript (Pages 16-17) and a Figure 2—figure supplement 2 has been added: “The gnomAD database, which collects variants from the general population, reports several dozen predicted loss-of-function variants in EPHX1, including nonsense, frameshift and canonical splice site variants. […] Additional studies will be required to better understand EPHX1 activity when embedded in the microsomal ER membranes in endogenous conditions.”

10. One of the challenges in studying primary dermal fibroblasts is that "passage 1" is often timed from establishment of outgrown cells in the lab, which in turn may take weeks from the time of tissue biospy. Could the authors clarify that the cells and controls used had roughly been through the same length of time and/or doubling times in culture?

We confirm that dermal fibroblasts from patients and controls spent roughly the same length of time in culture for the establishment of each cell culture. They were cryopreserved at passage 2. For the experiment presented in the manuscript, fibroblasts from controls were at passage 9 while those from patient 1 at passage 4. This is described in the Methods section (Page 22).

11. Was there evidence of increased DNA damage in affected cells?

Compelling evidence demonstrate that DNA damage is a common mediator for both replicative senescence, which is triggered by telomere shortening, and premature cellular senescence induced by various stressors such as oncogenic and oxidative stress (Chen J-H et al. Nucleic Acids Res. 2007 Dec;35(22):7417-28). Reviewer #3 is certainly right that DNA damage may occur in both fibroblasts of patient 1 and 3T3-L1 knock-out cells. However, we believe that DNA damage investigation may distract the reader from our main messages, and that these experiments should be part of a follow-up study.

12. Speculation that loss of Ephx1 may alter generation of endogenous agonists (and maybe) antagonists of PPARG is interesting but untested.

As stressed by Reviewer #3, the link between the lack of EPHX1 activity, the adipogenesis defect and the deregulation of PPARγ signaling is an interesting perspective to this study. We have better discussed this possibility (Page 15) as follows: “What is the cellular link between the loss of EPHX1 activity and adipogenesis defect? EPHX1 substrates might play a key role since oxylipins, which are EPHXA substrates, target peroxisome proliferator-activated receptors (PPARs) to modify adipocyte formation and function (67). […] Additional experiments will be required to precisely define the link between the loss of EPHX1 and adipogenesis alteration, which might involve the deregulation of endogenous PPARγ agonists or antagonists.”

13. More detail on birthweights and growth parameters would be useful for both probands. Was the microcephaly sustained in the first patient? What about the second patient?

We have added information in the Results section of the revised manuscript (Pages 5-6) as follows:

For patient 1: “This patient (woman) was born at term after a normal pregnancy without intra-uterine growth retardation. […] She was first referred for dysmorphic features including microcephaly with an occipitofrontal-frontal circumference (OFC) of 33 cm at birth (-1.5 SD), which remained present in adulthood with an OFC of 51 cm (-2.5 SD) at the age of 18 years.”

For patient 2:

“This patient (woman) was born at term, after a normal pregnancy, with a height of 50 cm and a weight of 3.2 kg.”

14. Please address the other clinical questions above.

This has been done to the best of our ability, while respecting the patients' wishes in terms of clinical investigations and publication of photos.

15. Please list other de novo, compound heterozygous or homozygous, rare, likely loss of function mutations in the first proband and add a statement in text that all parents and any siblings were clinically unaffected.

To address this important issue, we have provided two Supplementary Files listing the characteristics of all rare de novo, compound heterozygous, and homozygous variants, as well as the reasons accounting for their exclusion. No alternative molecular etiology was identified in either patient. This is discussed in the revised version of the manuscript. For a more detailed response, please see the answer to the first comment of the Editor. Moreover, two sentences have been added (page 7) to explain that parents of patients 1 and 2 are clinically unaffected: “Her parents were clinically unaffected.” / “The parents of patient 2 were clinically unaffected.”

16. I assume that EPHX1 mutations were also sought in other lipodystrophy cohorts but weren't found. Can any information be offered about this?

We looked in our exome results for patients with a genetically-unexplained lipodystrophic syndrome. None of them had a phenotype matching that of the two patients presented in the manuscript, and we identified no rare variants in EPHX1. To have a more systematic approach in order to determine the frequency of lipoatrophic diabetes due to a molecular defect in EPHX1, this gene is now included in our gene panel and will be analyzed in all patients referred to our laboratory for genetic diagnosis.

17. Through GeneMatcher were any other EPHX1 mutations reported linked to different phenotypes?

There was a single match on GeneMatcher between Isabelle Jéru and Wendy Chung, co-authors of the paper and in charge of genetic analyses in patient 1 and patient 2, respectively. There were no other matches with other phenotypes.

18. HEK293 studies were undertaken as duplicates of n=2. Showing data as mean +/- SEM is inappropriate. Better just show points as a scatter plot (see below).

It was indeed inappropriate to present results of Figure 2D with duplicates of n=2 as mean +/- SEM. We have now repeated this experiment a third time and we could confirm that the two variants identified in patients, p.Thr333Pro and p.Gly430Arg, led to an absence of enzyme activity as compared to the WT protein and to the three other isoforms carrying variants from the general population. We have updated Figure 2D accordingly.

19. "dynamite plunger" plots when numbers are small can hide important data heterogeneity and are now widely disfavoured. Please could all data points be shown superimposed as a scatter plot on these graphs.

As all experiments are now conducted with at least three independent assays and each of them displaying strong homogeneity, we have not added scatter plots to the initial bar graphs.

20. Language: generally good but with small grammatical lapses (e.g. in abstract). Also, even for this clinically qualified reader some of the technical jargon is obscure and not widely used in anglophone medicine. An "ogival palate" would usually be a "high-arched palate" and "spaniomenorrhoea" is better called "oligomenorrhoea". There are other examples of whether more routine medical jargon could be made more accessible for non-clinical readers, too.

We thank Reviewer 3 for his corrections. We have now updated the medical terms as suggested, tried to clarify the manuscript for non-clinical readers, and corrected at least one grammatical mistake in the abstract.

https://doi.org/10.7554/eLife.68445.sa2

Article and author information

Author details

  1. Jeremie Gautheron

    1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), Paris, France
    2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    Contribution
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7727-9893
  2. Christophe Morisseau

    Department of Entomology and Nematology, and UC Davis Comprehensive Cancer Center, University of California, Davis, Davis, United States
    Contribution
    Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  3. Wendy K Chung

    1. Department of Pediatrics, Columbia University Irving Medical Center, New York, United States
    2. Deparment of Medicine, Columbia University Irving Medical Center, New York, United States
    Contribution
    Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  4. Jamila Zammouri

    1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), Paris, France
    2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    Contribution
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  5. Martine Auclair

    1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), Paris, France
    2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    Contribution
    Data curation, Formal analysis, Investigation, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
  6. Genevieve Baujat

    Service de Génétique Clinique, Hôpital Necker-Enfants Malades, AP-HP, Paris, France
    Contribution
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  7. Emilie Capel

    1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), Paris, France
    2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    Contribution
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  8. Celia Moulin

    1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), Paris, France
    2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    Contribution
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  9. Yuxin Wang

    Department of Entomology and Nematology, and UC Davis Comprehensive Cancer Center, University of California, Davis, Davis, United States
    Contribution
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  10. Jun Yang

    Department of Entomology and Nematology, and UC Davis Comprehensive Cancer Center, University of California, Davis, Davis, United States
    Contribution
    Data curation, Formal analysis, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  11. Bruce D Hammock

    Department of Entomology and Nematology, and UC Davis Comprehensive Cancer Center, University of California, Davis, Davis, United States
    Contribution
    Data curation, Formal analysis, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1408-8317
  12. Barbara Cerame

    Goryeb Children’s Hospital, Atlantic Health Systems, Morristown Memorial Hospital, Morristown, United States
    Contribution
    Data curation, Formal analysis, Writing - review and editing
    Competing interests
    No competing interests declared
  13. Franck Phan

    1. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    2. Service de Diabétologie-Métabolisme, Hôpital Pitié-Salpêtrière, AP-HP, Paris, France
    3. Sorbonne Université-Inserm UMRS_1269, Paris, France
    Contribution
    Data curation, Formal analysis, Writing - review and editing
    Competing interests
    No competing interests declared
  14. Bruno Fève

    1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), Paris, France
    2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    3. Centre National de Référence des Pathologies Rares de l’Insulino-Sécrétion et de l’Insulino-Sensibilité (PRISIS), Service de Diabétologie et Endocrinologie de la Reproduction, Hôpital Saint-Antoine, AP-HP, Paris, France
    Contribution
    Conceptualization, Formal analysis, Validation, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  15. Corinne Vigouroux

    1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), Paris, France
    2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    3. Centre National de Référence des Pathologies Rares de l’Insulino-Sécrétion et de l’Insulino-Sensibilité (PRISIS), Service de Diabétologie et Endocrinologie de la Reproduction, Hôpital Saint-Antoine, AP-HP, Paris, France
    4. Laboratoire commun de Biologie et Génétique Moléculaires, Hôpital Saint-Antoine, AP-HP, Paris, France
    Contribution
    Conceptualization, Formal analysis, Validation, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  16. Fabrizio Andreelli

    1. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    2. Service de Diabétologie-Métabolisme, Hôpital Pitié-Salpêtrière, AP-HP, Paris, France
    3. Sorbonne Université-Inserm UMRS_1269, Paris, France
    Contribution
    Conceptualization, Formal analysis, Validation, Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  17. Isabelle Jeru

    1. Sorbonne Université-Inserm UMRS_938, Centre de Recherche Saint-Antoine (CRSA), Paris, France
    2. Institute of Cardiometabolism and Nutrition (ICAN), CHU Pitié-Salpêtrière - Saint-Antoine, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France
    3. Laboratoire commun de Biologie et Génétique Moléculaires, Hôpital Saint-Antoine, AP-HP, Paris, France
    Contribution
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    isabelle.jeru@aphp.fr
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7171-0577

Funding

Mairie de Paris (R18139DD)

  • Jeremie Gautheron

Société Francophone du Diabète (R19114DD)

  • Jeremie Gautheron

Fondation pour la Recherche Médicale (ARF20170938613)

  • Jeremie Gautheron

Fondation pour la Recherche Médicale (EQU202003010517)

  • Jeremie Gautheron

Fondation pour la Recherche Médicale (EQU201903007868)

  • Bruno Fève
  • Corinne Vigouroux
  • Isabelle Jeru

National Institutes of Health (DK52431)

  • Wendy K Chung

National Institute of Environmental Health Sciences (R35ES030443)

  • Christophe Morisseau
  • Bruce D Hammock

National Institute of Environmental Health Sciences (P42ES004699)

  • Christophe Morisseau
  • Bruce D Hammock

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank the patients and their families for their participation. The authors would like to thank Dr. Boris Keren (Unité Fonctionnelle de Génomique du Développement, AP-HP, Paris, France) for analyses of SNP DNA chips, Beth Hudson (GeneDx, Gaithersburg, United States) for her involvement in searching patients with EPHX1 variants, Annie Munier (Cytométrie et Imagerie Saint-Antoine, Sorbonne Université, Paris, France) for cell sorting of transfected 3T3-L1 pre-adipocytes, Romain Morichon for image processing (UMS30 Lumic, Sorbonne Université, Paris, France), and Yves Chrétien (CRSA, Paris, France) for expert artwork.

Ethics

Human subjects: We obtained written informed consent for all genetic studies as well as for the use of photographs. The study was approved by the CPP Ile de France 5 research ethics board (DC 2009-963, Paris, France) and the Columbia institutional review board (AAAJ8651, New York, United States).

Senior Editor

  1. David E James, The University of Sydney, Australia

Reviewing Editor

  1. Michael Czech, University of Massachusetts Medical School, United States

Reviewer

  1. Robert Semple

Publication history

  1. Received: March 16, 2021
  2. Preprint posted: May 7, 2021 (view preprint)
  3. Accepted: July 23, 2021
  4. Version of Record published: August 3, 2021 (version 1)

Copyright

© 2021, Gautheron et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 243
    Page views
  • 54
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Genetics and Genomics
    Gabriel A Guerrero et al.
    Research Article Updated

    Longevity is often associated with stress resistance, but whether they are causally linked is incompletely understood. Here we investigate chemosensory-defective Caenorhabditis elegans mutants that are long-lived and stress resistant. We find that mutants in the intraflagellar transport protein gene osm-3 were significantly protected from tunicamycin-induced ER stress. While osm-3 lifespan extension is dependent on the key longevity factor DAF-16/FOXO, tunicamycin resistance was not. osm-3 mutants are protected from bacterial pathogens, which is pmk-1 p38 MAP kinase dependent, while TM resistance was pmk-1 independent. Expression of P-glycoprotein (PGP) xenobiotic detoxification genes was elevated in osm-3 mutants and their knockdown or inhibition with verapamil suppressed tunicamycin resistance. The nuclear hormone receptor nhr-8 was necessary to regulate a subset of PGPs. We thus identify a cell-nonautonomous regulation of xenobiotic detoxification and show that separate pathways are engaged to mediate longevity, pathogen resistance, and xenobiotic detoxification in osm-3 mutants.

    1. Epidemiology and Global Health
    2. Genetics and Genomics
    Mohd Anisul et al.
    Research Article Updated

    Background:

    The virus SARS-CoV-2 can exploit biological vulnerabilities (e.g. host proteins) in susceptible hosts that predispose to the development of severe COVID-19.

    Methods:

    To identify host proteins that may contribute to the risk of severe COVID-19, we undertook proteome-wide genetic colocalisation tests, and polygenic (pan) and cis-Mendelian randomisation analyses leveraging publicly available protein and COVID-19 datasets.

    Results:

    Our analytic approach identified several known targets (e.g. ABO, OAS1), but also nominated new proteins such as soluble Fas (colocalisation probability >0.9, p=1 × 10-4), implicating Fas-mediated apoptosis as a potential target for COVID-19 risk. The polygenic (pan) and cis-Mendelian randomisation analyses showed consistent associations of genetically predicted ABO protein with several COVID-19 phenotypes. The ABO signal is highly pleiotropic, and a look-up of proteins associated with the ABO signal revealed that the strongest association was with soluble CD209. We demonstrated experimentally that CD209 directly interacts with the spike protein of SARS-CoV-2, suggesting a mechanism that could explain the ABO association with COVID-19.

    Conclusions:

    Our work provides a prioritised list of host targets potentially exploited by SARS-CoV-2 and is a precursor for further research on CD209 and FAS as therapeutically tractable targets for COVID-19.

    Funding:

    MAK, JSc, JH, AB, DO, MC, EMM, MG, ID were funded by Open Targets. J.Z. and T.R.G were funded by the UK Medical Research Council Integrative Epidemiology Unit (MC_UU_00011/4). JSh and GJW were funded by the Wellcome Trust Grant 206194. This research was funded in part by the Wellcome Trust [Grant 206194]. For the purpose of open access, the author has applied a CC BY public copyright licence to any Author Accepted Manuscript version arising from this submission.