Research Article

Immunology and Inflammation

The alpha/B.1.1.7 SARS-CoV-2 variant exhibits significantly higher affinity for ACE-2 and requires lower inoculation doses to cause disease in K18-hACE2 mice

Recombinant Protein and Antibody Laboratory, Copenhagen University Hospital, Denmark
Laboratory of Molecular Medicine, Department of Clinical Immunology, Section 7631, Rigshospitalet Copenhagen University Hospital, Denmark
Novo Nordisk A/S, Denmark
Department of Biomedicine, Aarhus University, Denmark
Institute of Immunology and Microbiology, University of Copenhagen, Denmark
Department of Molecular Medicine, Aarhus University Hospital, Denmark

Nov 25, 2021

https://doi.org/10.7554/eLife.70002

Version of Record

Accepted for publication after peer review and revision.

Download
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Version of Record published: December 1, 2021 (This version)
Accepted Manuscript updated: November 29, 2021 (Go to version)
Accepted Manuscript published: November 25, 2021 (Go to version)
Accepted: November 24, 2021
Received: May 4, 2021

1. Part of Collection
COVID-19: A Collection of Articles

Edited by Diane M Harper et al.
Further reading

Article
Figures and data
Abstract
Introduction
Results
Discussion
Materials and methods
Data availability
References
Decision letter
Author response
Article and author information
Metrics

Abstract

The alpha/B.1.1.7 SARS-CoV-2 lineage emerged in autumn 2020 in the United Kingdom and transmitted rapidly until winter 2021 when it was responsible for most new COVID-19 cases in many European countries. The incidence domination was likely due to a fitness advantage that could be driven by the receptor-binding domain (RBD) residue change (N501Y), which also emerged independently in other variants of concern such as the beta/B.1.351 and gamma/P.1 strains. Here, we present a functional characterization of the alpha/B.1.1.7 variant and show an eightfold affinity increase towards human angiotensin-converting enzyme-2 (ACE-2). In accordance with this, transgenic hACE2 mice showed a faster disease progression and severity after infection with a low dose of B.1.1.7, compared to an early 2020 SARS-CoV-2 isolate. When challenged with sera from convalescent individuals or anti-RBD monoclonal antibodies, the N501Y variant showed a minor, but significant elevated evasion potential of ACE-2/RBD antibody neutralization. The data suggest that the single asparagine to tyrosine substitution remarkable rise in affinity may be responsible for the higher transmission rate and severity of the B.1.1.7 variant.

Introduction

Since the global expansion of SARS-CoV-2, there has been a world-wide surveillance effort to identify new emerging variants empowered by the unprecedented generation of full-genome sequences of circulating strains shared under the GISAID umbrella (http://www.gisaid.org/). Many genetically drifted SARS-CoV-2 variants have been reported since the early spring of 2020. Some of these that affect the S (spike) gene are non-synonymous mutations. These mutations have received much attention since the spike protein binds directly to the angiotensin-converting enzyme-2 (ACE-2) receptor responsible for viral entry into the human host cells (Hoffmann et al., 2020; Zhou et al., 2020; Walls et al., 2020). Furthermore, almost all current vaccine formulations, except for the few vaccines that rely on the inactivated SARS-CoV-2, focus on raising immunity specifically towards the spike protein or parts of it, mostly the receptor-binding domain (RBD) (Krammer, 2020). The possible humoral or cellular immunity evasion due to critical residue changes in B- and T-lymphocyte epitopes of the spike protein is a major concern. In fact, several of the non-synonymous mutations identified to date are located in the RBD of the spike protein and may improve viral fitness by raising the affinity of the virus towards ACE-2 or by hindering antibody-mediated viral neutralization (Dao et al., 2021). Some of these residue substitutions, including the N501Y mutation, seem to have arisen independently by convergent evolution and selection and are found in the B.1.1.7 (alpha), the South African B.1.351 (beta), and the Brazilian P.1 (gamma) variants of concern (VOC) (Rambaut, 2020; Faria et al., 2021; Tegally et al., 2021) as well as the variant of interest (VOI) B.1.621 (mu), first identified in Colombia (Laiton-Donato et al., 2021), and the former VOI P.3 (theta) from The Philippines (Tablizo et al., 2021). All the above VOC/VOI have been for the most part replaced by the B.1.617.2 (delta), which emerged in India in December 2020 (Cherian et al., 2021; Yadav, 2021) and has become the dominant variant globally (http://www.gisaid.org/, accessed October 2021). A not-yet-peer reviewed publication on vaccine breakthrough, found that the N501Y mutation was associated with increased number of breakthrough infections (Marques et al., 2021). Recent studies suggest that the B.1.1.7, B.1.351, P.1, and B.1.617.2 VOC have increased transmissibility (Faria et al., 2021; Tegally et al., 2021; Davies et al., 2021a; Kidd et al., 2021; Scientific Pandemic Influenza Group on Modelling Operational sub-group (SPI-M-O), 2021) and appear to cause a more severe disease (Davies et al., 2021b; Funk et al., 2021; Pearson, 2021; Sheikh et al., 2021), albeit most rely primarily on epidemiological and prediction data. Moreover, other reports indicate that especially the B.1.351, P.1, and B.1.617.2 have a reduced potential of antibody-dependent virus neutralization from convalescent individuals and might pose a challenge to current vaccines (Wu et al., 2021; Madhi et al., 2021; Liu et al., 2021b; Zhou et al., 2021; Dejnirattisai et al., 2021; Cele et al., 2021). The same immune evasion capacity has not been reported for the B.1.1.7 variant, although some evasion cannot be excluded (Supasa et al., 2021).

More in-depth knowledge of the functional biophysical characteristics of circulating and emerging variants is needed. A large yeast two-hybrid study characterizing the mutational landscape of SARS-CoV-2 RBD indicated that the N501Y residue-change results in increased affinity towards ACE-2 (Starr et al., 2020). Two recent studies, one still non-peer reviewed, have focused on the N501Y mutation showing a variable impact on affinity (from 0.5 nM to sub pM) (Tian et al., 2021; Liu et al., 2021a).

In the present study, we have performed detailed biophysical characterization of the RBD variants N439K (the most prevalent RBD mutation to date) and N501Y (shared between the B.1.1.7, B.1.351, and P.1), showing that the 1:1 interaction affinity to human ACE-2 is two- and eightfold increased, respectively, compared to the original Wuhan RBD.

Using a transgenic humanized ACE-2 mouse model we found that a lower infection dose was required to establish infection when challenged with the alpha/B.1.1.7 variant compared to an early 2020 isolate (differing at the N501Y position) and that the alpha variant resulted in increased disease severity. Additionally, we present data suggesting a partial decrease in the antibody capacity to neutralize N501Y:ACE-2 interaction in vitro using sera from convalescent individuals (n = 140). However, no significant difference was seen when we tested a small cohort of convalescent individuals (n = 10) in a plaque reduction neutralization test (PRNT) and a group of anti-RBD monoclonal antibodies (mAbs; n = 8).

Results

Biophysical characterization

We expressed recombinant SARS-CoV-2 RBD wild-type (wt) (Wuhan-hu-1), RBD N439K, and RBD N501Y in Expi293 HEK cells and performed thermal stability and binding kinetic analyses to determine the biophysical relevance of the RBD variants (Figure 1). Protein purity and homogeneity were evaluated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE; Figure 1A) and size-exclusion high-performance liquid chromatography (HPLC; Figure 1B). We monitored the thermal unfolding using the intrinsic fluorescence ratio at 350 and 330 nm and observed a ~2.5°C reduction in the inflection temperature (Ti) for the N439K variant (Figure 1C). This suggests that the N439K, but not the N501Y, has a moderately deleterious effect on the RBD stability. Next, we measured their binding kinetics towards the human ACE-2 by biolayer interferometry (BLI) to determine their functional importance. The N439K variant bound with an approx. twofold higher affinity than the wt (8.6 vs 17 nM) (Figure 1D, E), while the N501Y variant did so with an eightfold higher affinity (2.23 vs 17 nM) (Figure 1F). Analyses of the binding response curves indicate that the variants bound to ACE-2 faster (Ka_N439K = 4.15 × 10⁵ M⁻¹ s⁻¹, Ka_N501Y = 4.76 × 10⁵ M⁻¹ s⁻¹, Ka_wt = 3.34 × 10⁵ M⁻¹ s⁻¹) and mostly the N501Y had noticeable slower dissociation rates (Kdis_N439K = 3.57 × 10⁻³ s⁻¹, Kdis_N501Y = 1.06 × 10⁻³ s⁻¹, Kdis_wt = 5.9 × 10⁻³ s⁻¹).

Figure 1

Download asset Open asset

Biophysical characterization of recombinant receptor-binding domain (RBD) variants.

(A) Sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE) total protein stain of RBD variants and angiotensin-converting enzyme-2 (ACE-2). (B) Size-exclusion chromatography (SEC) profiles of the purified proteins run in a BioSep-SEC-S3000 column. Purity was determined by peak integration with the Empower software. (C) Thermal denaturation curves of the RBD wild-type (wt), N439K, and N501Y variants. Data are represented as the first derivative of the intrinsic fluorescence ratio 350:330 nm of the mean of three replicates. Vertical dashed lines represent the inflection temperatures (Ti). Biolayer interferometry (BLI) sensorgrams of RBD wt (D), N439K (E), and N501Y (F) binding to ACE-2-Fc immobilized in anti-human Fc capture (AHC) sensors. ACE-2-immobilized sensors were dipped into 7- to 11-point dilution series of RBD for 500 s, followed by dissociation for another 500 s.

Figure 1—source data 1 Accompanying Figure 1.: https://cdn.elifesciences.org/articles/70002/elife-70002-fig1-data1-v3.pdf
Download elife-70002-fig1-data1-v3.pdf
Figure 1—source data 2 Accompanying Figure 1.: https://cdn.elifesciences.org/articles/70002/elife-70002-fig1-data2-v3.pdf
Download elife-70002-fig1-data2-v3.pdf
Figure 1—source data 3 Accompanying Figure 1.: https://cdn.elifesciences.org/articles/70002/elife-70002-fig1-data3-v3.xlsx
Download elife-70002-fig1-data3-v3.xlsx

Alpha/B.1.1.7 establishes disease-causing infection at lower inoculation doses than original SARS-CoV-2 isolate

In order to examine whether the increased affinity of the N501Y variant for ACE-2 was associated with a more efficient establishment of infection and development of disease, we challenged transgenic ACE-2 humanized K18-hACE2 mice with the early 2020 SARS-CoV2 B.1 (Freiburg isolate, FR-4248 Miladi, 2020) and the B1.1.7 (alpha) strains. The model has been reported to reflect many aspects of COVID-19, including viral replication and histopathological changes in the lungs (Winkler et al., 2020). Upon infection with two different doses of the B.1 strain, we observed no weight loss as an indication of disease development (Figure 2A). However, infection with B.1.1.7 at the same doses led to severe disease development in the mice. Mann–Whitney pair-wise comparisons (B.1 vs B.1.1.7) showed a significant difference in weight at low viral doses at days 6 and 7 (multiple comparisons corrected q values 0.009743 and 0.000291, respectively, n = 9 per group). The same tendency, albeit not statistically significant, was observed for the high viral doses (n = 5 per group). We also observed that the virus replicates to higher levels in the lungs at day 2 post-infection with B.1.1.7 compared to B.1 when infected with low viral doses (Figure 2B).

Figure 2

Download asset Open asset

Development of COVID-19-like disease in mice.

(A) Weight evolution of K18-hACE2 mice challenged intranasally with 2.5 × 10³ (low, n = 9 per group) or 2.5 × 10⁴ p.f.u. (high, n = 5 per group) SARS-CoV-2 B.1 (Freiburg isolate, FR-4286) or B.1.1.7. Global differences between the groups were analysed with the Kruskal–Wallis test. (B) Viral load measured in the lungs on day 2 post-infection. The mice were infected with the same doses as described in (A). The expression of SARS-CoV-2 RNA was analysed by real-time quantitative polymerase chain reaction (qPCR). Values normalized to 18S-rRNA are presented as mean ± standard error of the mean (SEM). * = 0.019.

Figure 2—source data 1 Accompanying Figure 2.: https://cdn.elifesciences.org/articles/70002/elife-70002-fig2-data1-v3.xlsx
Download elife-70002-fig2-data1-v3.xlsx

Determination of the evasion capacity of the N439K and N501Y variants in naturally induced antibody-mediated immunity

Next, we sought to clarify whether the residue changes could affect the folding and binding properties of the RBD and viral fitness by providing immune evasion. To do so, we first determined the antibody-mediated inhibition potency, measured as the inhibition of the ACE-2/RBD interaction, in sera of recovered COVID-19 patients (n = 140) using a validated in vitro antibody inhibition assay (Bayarri-Olmos et al., 2021a; Figure 3A–C). There was a statistically significant reduction in the inhibition of the N439K and N501Y RBD compared to the wt (p < 0.0001 for both) (Figure 3A). The inhibition potencies towards the wt and the variants had a highly significant correlation (ρ = 0.9774 and ρ = 0.9581 for N439K and N501Y, respectively, p < 0.0001), with the best-fit X-intercept ranging from 12.38 to 15.89 for the N439K and N501Y, respectively (Figure 3B, C). However, analyses of convalescent sera (n = 10) using a PRNT virus neutralization platform (Fougeroux et al., 2021) showed no significant difference in the neutralization potency towards the B.1 and B.1.1.7 strains (Figure 3D).

Figure 3

Download asset Open asset

Antibody-mediated inhibition potency of recovered COVID-19 patient sera.

(A) Inhibition of wild-type (wt), N439K, and N501Y receptor-binding domain (RBD) towards angiotensin-converting enzyme-2 (ACE-2) in serum from convalescent COVID-19 individuals (n = 140). Friedman test with Dunn’s multiple comparisons. Orange lines represent medians. ****p < 0.0001. Linear regression and Spearman correlation analyses for N439K vs wt (B) and N501Y vs wt (C). Trend line represents linear regression. (D) Neutralization of serum from convalescent COVID-19 individuals (n = 10) against B.1 and B.1.1.7 calculated by the plaque reduction neutralization test (PRNT) and analysed using Wilcoxon matched-pairs signed ranked tests with multiple comparisons corrections. NS, no serum.

Figure 3—source data 1 Accompanying Figure 3.: https://cdn.elifesciences.org/articles/70002/elife-70002-fig3-data1-v3.xlsx
Download elife-70002-fig3-data1-v3.xlsx

Determination of the evasion capacity of the RBD variants in vaccine-induced immunity

Next, we analysed the variants’ evasion capacity using a previously established vaccine mouse model (Sheikh et al., 2021). Briefly, mice were immunized with wt RBD (n = 3) or wt prefusion-stabilized spike protein ectodomain (n = 3). Polyclonal sera were collected after three rounds of immunizations, and mAbs were developed and characterized from cloned hybridomas. As shown previously (Bayarri-Olmos et al., 2021a; Bayarri-Olmos et al., 2021b), polyclonal sera from RBD-immunized mice were approx. fourfold more effective than spike-immunized mice sera, with IC₅₀ values of 2.4–2.6 × 10⁴ (RBD) and 6.6–8.2 × 10³ (spike), respectively (Figure 4A, B). Sera from RBD-immunized mice showed no difference in the inhibitory potency against the wt and the variants. However, best-fit IC₅₀ values from sera from mice immunized with spike differed slightly between strains, as 11% and 19% higher serum concentration was required for the N439K and N501Y variants, respectively, to achieve the same inhibition levels as for the wt RBD. We also evaluated the inhibition potency of mouse mAbs raised against wt RBD and wt spike (n = 18) (Figure 4C, D). The mAbs were screened for high affinity towards the SARS-CoV-2 RBD wt, and their epitopes mapped via competition assays (Bayarri-Olmos et al., 2021a). Linear regression and Spearman correlation analyses of the mAbs with best-fit IC₅₀s within the range of concentration tested (n = 8) showed that the N439K and N501Y mutations had very minor effects on the inhibition potency of the mAbs (N439K R² = 0.9777, ρ = 1, p < 0.0001; N501Y R² = 0.9832, ρ = 0.9762, p < 0.0001).

Figure 4

Download asset Open asset

Antibody-mediated inhibition potency of polyclonal sera and monoclonal antibodies (mAbs) isolated from mice immunized against wild-type (wt) receptor-binding domain (RBD) or spike protein.

IC₅₀ comparison of the inhibition of polyclonal mice sera from an animal vaccine model based on RBD (A) or spike (B) challenged with RBD wt, N439K, and N501Y. Connecting lines represent non-linear fits using the equation [inhibitor] vs normalized response with variable slope. Vertical dashed lines delimit the IC₅₀ values, where they intersect the horizontal 50% inhibition dashed line. Data are presented as mean ± standard error of the mean (SEM). Comparison of the inhibition potency (log[IC₅₀]) of mouse mAbs (n = 8) calculated from three independent experiments against RBD wt and RBD N439K (C) or RBD N501Y (D), analysed by linear regression and Spearman correlation. The trend represents a linear regression. Dashed line signals equidistance between axis (i.e. slope 1). Neutralization fold changes over 1.5 are highlighted. Only mAbs with IC₅₀ values within the range of concentrations tested were included in the statistical analyses (i.e. 8 out of 18 tested mAbs).

Figure 4—source data 1 Accompanying Figure 4.: https://cdn.elifesciences.org/articles/70002/elife-70002-fig4-data1-v3.xlsx
Download elife-70002-fig4-data1-v3.xlsx

Discussion

Emerging clusters of genetically drifted SARS-CoV-2 variants have received much attention due to concerns of enhanced adaptive fitness and viral escape of neutralizing antibodies or T-cell-mediated responses. A specific focus has been on the spike protein changes that interact with the ACE-2 receptor and mediate host cell entry. This is also the target for the vast majority of the vaccine strategies. A worldwide effort to sequence viral strains has revealed many emerging variants. However, although many spike variants have been reported so far, there seems to be a limitation in terms of the ‘freedom’ possibilities to which and how many non-synonymous mutations are emerging in the S gene and particularly in the RBD coding region (Starr et al., 2020). One of these RBD residue changes is N501Y, which has appeared by convergent evolution in three of the so-called VOC: B.1.351 (beta), P.1 (gamma), and the B.1.1.7 (alpha) variant, but interestingly not in the rapidly spreading B.1.617.2 (delta) variant, where other mutations appear to be of importance. Nevertheless, from an epidemiological viewpoint, all these variants seem to have a higher transmission rate and have outcompeted the original Wuhan strain in the regions they have arisen or been introduced to. In Europe, the B.1.1.7 (alpha) variant was, at the end of March 2021, dominating many countries only few months after its emergence with severe consequences on the health care system, while now just a few months later in the end of August 2021, the B1.617.2 (delta) variant has taken over (http://www.gisaid.com/, accessed August 2021).

We aimed to characterize the functional properties of the B.1.1.7 (alpha) variant and address any potential evasion capacity of antibody-mediated neutralization. We also did this for the prevalent RBD mutation N439K and we found a twofold affinity increase to ACE-2 and a partial evasion of antibody-mediated neutralization, lending support to a recently published paper (Dao et al., 2021).

When we did BLI measurements of the 1:1 interaction of N501Y RBD on ACE-2 immobilized sensors, we found a remarkable eightfold affinity increase of the variant (2.2 nM) compared to wt Wuhan RBD (17 nM). This might be a central explanation for the observed higher transmission rate and the fitness advantage of the B.1.1.7 variant. Furthermore, the 1:1 molecular affinity determination might even underestimate the true in vivo interaction potential covering multivalent avidity interactions between the trimeric spike scaffolds on the viral surface and the ACE-2-covered host membrane. In agreement with this, we found that transgenic ACE-2 humanized K18-hACE2 mice developed severe disease following a low inoculation dose of B.1.1.7, which did not cause disease for the early B.1 strain. Another report has shown that the B.1.1.7 variant might also infect WT mice though not as efficient as the P.1 and B.1.351 (Tian et al., 2021).

Two recent studies, one yet-to-be peer reviewed, have focused on the biophysics of the N501Y variant, reporting affinities ranging from 0.5 nM (Tian et al., 2021) to undefined sub pM (Liu et al., 2021a). Even though they numerically deviate from our findings, they conceptually observe increased affinity of the N501Y variant. However, in both studies, immobilized RBD was incubated with dimeric ACE-2 in the soluble phase. Therefore, avidity interactions might have contributed to the determined K_D values using the 1:1 fitting model employed in the studies. Of note, our affinity findings are in good agreement with those of a recent study using surface plasmon resonance spectrometry to evaluate the binding between immobilized ACE-2 and soluble RBD (K_D 2.4 ± 0.4), published during the revision process for the current manuscript (Laffeber et al., 2021).

Whether the alpha variant escapes immunity is still a matter of debate, but it has been shown that alpha might confer some reduction in virus neutralization potential compared with the wt both in naturally infected and vaccinated individuals (Supasa et al., 2021). However, the decrease in response varies highly between individuals and whether the variation has clinical relevance requires further studies.

When we tested the antibody-mediated inhibition of the wt, N439K, and N501Y RBD interaction with human ACE-2, we found a minor, but significant reduction of the neutralization potency of convalescent sera (n = 140) compatible with the data observed by Supasa et al., 2021. The relative neutralization evasion level from these experiments was WT RBD < N439K < N501Y. Conversely, hyperimmune sera and high-affinity mAbs from mice that received several immunizations with recombinant wt spike or RBD did not show this significant neutralization difference, indicating that a fully established vaccine response will overcome the evasion potential of the N501Y. As shown by others (Ravichandran et al., 2020) and us Bayarri-Olmos et al., 2021a, focused immunization with RBD leads to higher antibody titres and higher neutralization potency than immunization with the full spike ectodomain. At sufficiently high antibody titres, the N439K and N501Y variants' potential evasion advantage might of less immunological importance.

When we addressed the antibody neutralization in sera from a group of convalescent individuals using the PRNT assay, we found no statistical difference between the early 2020 Freiburg isolate and the alpha variant; an observation also made by others performing live virus PRNT assays (Liu et al., 2021b), which is not in full agreement with the study from Supasa et al., 2021. The discrepancy between the findings can be attributed to several reasons: First, the viral neutralization assays are challenging to perform and might be hampered by intrinsic high biological variation compared with the ACE-2/RBD ELISA inhibition assay that can be performed on a large scale and is optimized to display little assay variability. Another critical issue is that the neutralization assays address the whole virus and contain multiple elements involved in the interaction and infection, that is membrane clusters of trimeric spike and the intracellular structural proteins that determine viral fitness, which might lead to differences. Since the different neutralization studies involve relatively few investigated individuals, the risk of type 1 and type 2 errors should be taken into account. Interestingly, one study proposes that the N501Y variant might pose challenges for the MHC class II presentation and the CD4+ T-cell response (Castro et al., 2021). In contrast to this, another study has demonstrated a negligible impact of SARS-CoV-2 variants on CD4+ and CD8+ T-cell reactivity (Tarke et al., 2021).

In this study, we present comprehensive biophysical data showing that the single N501Y residue change in the RBD region results in an eightfold increase in the affinity to human ACE-2. This affinity adaptation is likely also to be found in the two other VOC, the B.1.351 and P.1. In line with this, we find that the alpha variant induces a more severe disease that an early 2020 SARS-CoV-2 isolate in K18-hACE2 mice, indicating a more efficient establishment of infection in vivo. Moreover, our data show a minor but significant immune evasion effect of the N501Y substitution.

Materials and methods

Production of recombinant SARS-CoV-2 RBD variants and human ACE-2 ectodomain

Request a detailed protocol

The nucleotide sequence corresponding to the SARS-CoV-2 RBD (QIC53204.1, aa R319–S593) with either an N439K or N501Y substitution and a C-terminal 10xHis-AviTag were synthesized and subcloned into pcDNA3.4-TOPO expression vectors by GeneArt (Thermo Fisher Scientific, Massachusetts, USA). The sequences were optimized towards higher codon adaptation indexes, 5′ mRNA folding energies, removal of cryptic splice sites, and tandem repeats as described elsewhere (Hertz et al., 2018). The production and purification of recombinant human ACE-2 ectodomain and ACE-2-Fc; and production, purification, and biotinylation of the RBD variants were performed as described elsewhere (Bayarri-Olmos et al., 2021a; Bayarri-Olmos et al., 2021b). Protein purity and quality were determined by 4–12% Bis-Tris SDS–PAGE and Coomassie staining and size-exclusion HPLC. The recombinantly produced RBDs were identified as having the expected mass by intact mass LC–MS.

Protein stability determination

Request a detailed protocol

The impact of the N439K and N501Y substitutions on the thermal stability of the RBD was analysed in triplicates on a Tycho NT.6 (NanoTemper Technologies GmbH, Munich, Germany) using a thermal ramp of 30°C/min in phosphate-buffered Saline (PBS). Protein unfolding was assessed from the ratio of the intrinsic fluorescence recorded at 350 and 330 nm. Inflection temperatures (Ti), representing a discrete unfolding transition or change in the structural integrity of the proteins, were calculated by the Tycho software.

ACE-2/RBD affinity determination by BLI

Request a detailed protocol

Binding kinetics experiments were performed on an Octet RED383 system (ForteBio, California, USA) as described elsewhere with minor modifications (Bayarri-Olmos et al., 2021b). Briefly, 13 µg/ml ACE-2-Fc was loaded on anti-human Fc capture sensors (Pall Life Sciences, California, USA) for 500 s, followed by baseline for 60 s, association to 12-point 1.5-fold serial dilutions starting at 150 nM for RBD wt, N439K, and N501Y for 500 s, and finally dissociation for another 500 s. For each 16-channel column sensor, four sensors loaded with ACE-2-Fc were assigned as a reference and dipped into buffer during the association and dissociation phases. Final sensorgrams were reference subtracted column-wise and globally fitted to a 1:1 binding model.

ACE-2/RBD antibody inhibition assay

Request a detailed protocol

The antibody neutralization potency, calculated from the degree of inhibition of the ACE-2:RBD interaction, was measured in serum samples from recovered individuals with a past PCR-confirmed COVID-19 infection, mice immunized with wt RBD or spike, and anti-RBD mouse mAbs using an ELISA-based ACE-2/RBD antibody inhibition test described elsewhere (Bayarri-Olmos et al., 2021a). Briefly, ACE-2 ectodomain (1 µg/ml) was coated onto Nunc Maxisorp microtitre plates (Thermo Fisher Scientific) overnight at 4°C in PBS. Samples were incubated with a solution of biotinylated RBD (4 ng/ml) and Pierce high sensitivity streptavidin (Thermo Fisher Scientific) (1:16,000) as follows: convalescent sera in a 10% dilution, immunized mice sera in an eight-point fourfold dilution starting at a 0.625% dilution, and mAbs in a six-point fourfold dilution starting at 20 µg/ml. After 1 hr incubation in low-binding round-bottom plates (Thermo Fisher Scientific), the samples/RBD mixes were transferred to ACE-2-coated wells for 15 min. The plates were developed with TMB One (KemEnTec Diagnostics, Taastrup, Denmark) for 20 min, the reaction stopped with 0.3 M H₂SO₄, and the optical density recorded at 450 nm. Coating buffer (PBS, 10.1 mM Na₂HPO₄, 1.5 mM KH₂PO₄, 2.7 mM KCl, 137 mM NaCl), sample and washing buffer (PBS, 0.05% Tween-20). The wells were washed three times with washing buffer between steps, and all incubations—unless otherwise stated—were done at room temperature in an orbital shaker.

K18-hACE2 mouse COVID-19 model

Request a detailed protocol

K18-hACE C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory (Stock number: 034860). Age-matched male and female mice, randomized in groups, were fed standard chow diet and housed in a pathogen-free facility. Animals were anesthetized with an intraperitoneal injection of ketamine (100 mg/kg body weight) and xylazine (10 mg/kg body weight) and administered either 2.5 × 10³ or 2.5 × 10⁴ plaque-forming units (p.f.u.) SARS-CoV-2 via intranasal administration. Mice were weighed every day at the same time of the day until day 7 post-infection.

RNA isolation and real-time PCR (qPCR)

Request a detailed protocol

Lungs were homogenized with steel beads in a Tissuelyser (II) (both from Qiagen, Hilden, Germany) in PBS and immediately used for RNA isolation. RNA was isolated using the High Pure RNA Isolation Kit (Roche, Basel, Switzerland) and an equal amount of RNA was used for standard One-Step RT-PCR (TaqMan RNA-to-Ct 1-Step Kit, Applied Biosystems, Massachusetts, USA). For the SARS-CoV-2 N gene, qPCR primers AAATTTTGGGGACCAGGAAC and TGGCACCTGTGTAGGTCAAC and probe FAM-ATGTCGCGCATTGGCATGGA-BHQ were used. For the 18S-rRNA qPCR the Hs99999901_s1 18S rRNA Taqman Gene Expression Assays were used (Applied Biosystems). RNA levels of SARS-CoV-2 N gene were normalized to the mouse housekeeping gene 18S-rRNA using the formula: 2Ct(18S-rRNA) − Ct(Sars-CoV-2 RNA). The resulting normalized ratio is presented directly in the figures.

SARS-CoV-2

Request a detailed protocol

The early 2020 B.1 strain, Freiburg isolate FR-4286, was kindly provided by Professor Georg Kochs, University of Freiburg, Germany and B.1.1.7 SARS-CoV2 (Kent, UK, isolate) was provided under MTA by Professor Arvind Patel, University of Glasgow. The viruses were propagated in VeroE6 cells expressing human TMPRSS2 (VeroE6-hTMPRSS2) (kindly provided by Professor Stefan Pöhlmann, University of Göttingen) (Hoffmann et al., 2020). We have confirmed the expression of hTMPRSS2 in the Green monkey VeroE6 cell line with PCR analysis and the cells were tested negative for mycoplasma contamination. Briefly, VeroE6-hTMPRSS2 cells were infected with a multiplicity of infection of 0.05, in Dulbecco’s modified Eagle Medium (DMEM; Gibco) + 2% Fetal calf serum (FCS) (Sigma-Aldrich) + 1% Pen/Strep (Gibco)+ L-glutamine (Sigma-Aldrich) (from here, complete medium). The supernatant containing new virus progeny was harvested 72 hr post-infection, and concentrated on 100 kDa Amicon ultrafiltration columns (Merck, New Jersey, USA) by centrifugation at 4000 × g for 30 min. Virus titer was determined by TCID_50% assay and calculated by the Reed–Muench method (Reed and Muench, 1938).

Virus isolates were prepared for whole-genome sequencing using the EasySeq RC-PCR SARS CoV-2 Whole Genome Sequencing kit (Nimagen, Nijmegen, Netherlands) and sequenced using Illumina sequencing (Illumina, California, USA). Adapter and primer sequences were removed, and reads were mapped to the NC_045512.2 reference using Minimap and iVar (PMID: 29750242, PMID: 30621750). Variants and pangolin lineages (PMID: 32669681) were determined based on iVar consensus sequences with minimum 80% base frequency.

The Freiburg isolate FR-4286 is the Wuhan-like early European B.1 lineage containing the S:D614G, and ORF1b:P314L, as well as E:L37R. The B.1.1.7 differs from the B.1 in the spike protein on positions S:N501Y, S:A570D, S:T716I, S:P681H, S:S982A, S:D1118H, S:del69/70, and S:del144/145. Both the B.1.1.7 and the B.1 strains contains the S:D614G and ORF1b:P314L mutations. The viruses used are clinical isolates. The B.1.1.7 variant is in the database as MZ314997. The Freiburg isolate sequence has been uploaded and has the accession ID no: EPI_ISL_852748.

Plaque reduction neutralization test

Request a detailed protocol

Neutralizing capacity of convalescent serum against B.1 SARS-CoV2 (FR-4286) or B.1.1.7 was assessed in a neutralization assay (PRNT), performed as previously described (Fougeroux et al., 2021). In short, convalescent serum from human COVID-19 patients was heat inactivated (30 min at 56°C) and prepared in a nine-point twofold serum dilution starting at 1:20, in DMEM (Gibco) + 2% FCS (Sigma-Aldrich) + 1% Pen/Strep (Gibco) + L-glutamine (Sigma-Aldrich). Sera were mixed with SARS-CoV-2 to a final titre of 100 TCID_50%/well, and incubated at 4°C overnight. A ‘no serum’ and a ‘no virus’ (uninfected) control samples were included. TCID_50% control plates (in triplicates) of each of the viruses were included to control for actual virus titre of B.1 and B.1.1.7, respectively. The following day, virus:serum mixtures were added in octuplicates to 2 × 10⁴ VeroE6-hTMPRSS2 cells (Hoffmann et al., 2020) seeded in flat-bottomed 96-well plates (Thermo Fisher), and incubated 72 hr in a humidified CO₂ incubator at 37°C, 5% CO₂. Cytopathic effect was scored after fixing with 5% formalin (Sigma-Aldrich) and crystal violet stain (Sigma-Aldrich), using a light microscope (Leica DMi1).

Blood samples

Request a detailed protocol

The antibody neutralization potency was assessed in 140 randomly selected convalescent serum samples (the patient cohort has been described elsewhere Hansen et al., 2021) with IC₅₀ values for the ACE-2/RBD wt interaction ranging from low to high (estimated from six-point fourfold dilution series done as part of a previous study Bayarri-Olmos et al., 2021a). A serum pool from healthy individuals was used as a negative control.

Biosafety

Request a detailed protocol

All aspects of this study were approved by the office of the Danish Working Environment Authority, Landskronagade 33, 2,100 Copenhagen Ø, before the initiation of this study. Work with SARS-CoV-2 was performed in a biosafety level 2+ laboratory by personnel equipped with powered air-purifying respirators.

Statistics

Statistical analyses were performed with GraphPad Prism 9 (GraphPad Software, California, USA). Global differences in the weight of K18-hACE2 mice exposed to high and low doses of SARS-CoV-2 were analysed with Kruskal–Wallis. Pair-wise comparisons of the effect of SARS-CoV-2 variants in weight loss were performed with multiple Mann–Whitney tests (ranks computed for each day) and false discovery rate approach using the two-stage step-up method of Benjamini, Krieger, and Yekutieli. Comparison of the neutralization potency of serum samples from COVID-19 recovered, vaccinated individuals, and mouse mAbs was performed by Friedman test comparing the mean of each of the variants with the wt, as well as pair-wise (variant vs wt) Spearman rank correlation tests (two-tailed, reported as ρ and a significance value p) and linear regression analyses (reported as R²). Neutralization indexes of convalescent sera for the B.1 and B.1.1.7 strains obtained from the PRNT were analysed by Wilcoxon matched-pairs signed ranked tests corrected for multiple comparisons using the Holm–Šídák method. The extra-sum-of-squares F-test was used to compare best-fit IC₅₀ values, interpolated with the equation [inhibitor] vs normalized response with a variable slope as described elsewhere (Sheikh et al., 2021), of mice sera and mice mAbs. p values <0.05 were considered statistically significant.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. We have no restrictions with regards to data availability.

References

1. Bayarri-Olmos R
2. Idorn M
3. Rosbjerg A
4. Pérez-Alós L
5. Hansen CB
6. Johnsen LB
7. Helgstrand C
8. Zosel F
9. Bjelke JR
10. Öberg FK
11. Søgaard M
12. Paludan SR
13. Bak-Thomsen T
14. Jardine JG
15. Skjoedt M-O
16. Garred P
(2021a) SARS-CoV-2 Neutralizing Antibody Responses towards Full-Length Spike Protein and the Receptor-Binding Domain
Journal of Immunology 207:878–887.
https://doi.org/10.4049/jimmunol.2100272
- PubMed
- Google Scholar
(2021b) The SARS-CoV-2 Y453F mink variant displays a pronounced increase in ACE-2 affinity but does not challenge antibody neutralization
The Journal of Biological Chemistry 296:100536.
https://doi.org/10.1016/j.jbc.2021.100536
- PubMed
- Google Scholar
Preprint
(2021) Potential Global Impact of the N501Y Mutation on MHC-II Presentation and Immune Escape
bioRxiv.
https://doi.org/10.1101/2021.02.02.429431
- Google Scholar
1. Cele S
2. Gazy I
3. Jackson L
4. Hwa SH
5. Tegally H
6. Lustig G
7. Giandhari J
8. Pillay S
9. Wilkinson E
10. Naidoo Y
11. Karim F
12. Ganga Y
13. Khan K
14. Bernstein M
15. Balazs AB
16. Gosnell BI
17. Hanekom W
18. Moosa MYS
19. Network for Genomic Surveillance in South Africa
20. COMMIT-KZN Team
21. Lessells RJ
22. de Oliveira T
23. Sigal A
(2021) Escape of SARS-CoV-2 501Y.V2 from neutralization by convalescent plasma
Nature 593:142–146.
https://doi.org/10.1038/s41586-021-03471-w
- PubMed
- Google Scholar
1. Cherian S
2. Potdar V
3. Jadhav S
4. Yadav P
5. Gupta N
6. Das M
7. Rakshit P
8. Singh S
9. Abraham P
10. Panda S
11. Team N
(2021) SARS-CoV-2 Spike Mutations, L452R, T478K, E484Q and P681R, in the Second Wave of COVID-19 in Maharashtra, India
Microorganisms 9:1542.
https://doi.org/10.3390/microorganisms9071542
- PubMed
- Google Scholar
1. Dao TL
2. Hoang VT
3. Colson P
4. Lagier JC
5. Million M
6. Raoult D
7. Levasseur A
8. Gautret P
(2021) SARS-CoV-2 Infectivity and Severity of COVID-19 According to SARS-CoV-2 Variants: Current Evidence
Journal of Clinical Medicine 10:2635.
https://doi.org/10.3390/jcm10122635
- Google Scholar
(2021a) Estimated transmissibility and impact of SARS-CoV-2 lineage B.1.1.7 in England
Science 372:eabg3055.
https://doi.org/10.1126/science.abg3055
- Google Scholar
(2021b) Increased mortality in community-tested cases of SARS-CoV-2 lineage B.1.1.7
Nature 593:270–274.
https://doi.org/10.1038/s41586-021-03426-1
- Google Scholar
1. Dejnirattisai W
2. Zhou D
3. Supasa P
4. Liu C
5. Mentzer AJ
6. Ginn HM
7. Zhao Y
8. Duyvesteyn HME
9. Tuekprakhon A
10. Nutalai R
11. Wang B
12. López-Camacho C
13. Slon-Campos J
14. Walter TS
15. Skelly D
16. Costa Clemens SA
17. Naveca FG
18. Nascimento V
19. Nascimento F
20. Fernandes da Costa C
21. Resende PC
22. Pauvolid-Correa A
23. Siqueira MM
24. Dold C
25. Levin R
26. Dong T
27. Pollard AJ
28. Knight JC
29. Crook D
30. Lambe T
31. Clutterbuck E
32. Bibi S
33. Flaxman A
34. Bittaye M
35. Belij-Rammerstorfer S
36. Gilbert SC
37. Carroll MW
38. Klenerman P
39. Barnes E
40. Dunachie SJ
41. Paterson NG
42. Williams MA
43. Hall DR
44. Hulswit RJG
45. Bowden TA
46. Fry EE
47. Mongkolsapaya J
48. Ren J
49. Stuart DI
50. Screaton GR
(2021) Antibody evasion by the P.1 strain of SARS-CoV-2
Cell 184:2939–2954.
https://doi.org/10.1016/j.cell.2021.03.055
- PubMed
- Google Scholar
1. Faria NR
2. Mellan TA
3. Whittaker C
4. Claro IM
5. Candido D
6. Mishra S
7. Crispim MAE
8. Sales FCS
9. Hawryluk I
10. McCrone JT
11. Hulswit RJG
12. Franco LAM
13. Ramundo MS
14. de Jesus JG
15. Andrade PS
16. Coletti TM
17. Ferreira GM
18. Silva CAM
19. Manuli ER
20. Pereira RHM
21. Peixoto PS
22. Kraemer MUG
23. Gaburo N
24. Camilo C
25. Hoeltgebaum H
26. Souza WM
27. Rocha EC
28. de Souza LM
29. de Pinho MC
30. Araujo LJT
31. Malta FSV
32. de Lima AB
33. Silva J
34. Zauli DAG
35. Ferreira A
36. Schnekenberg RP
37. Laydon DJ
38. Walker PGT
39. Schlüter HM
40. dos Santos ALP
41. Vidal MS
42. Del Caro VS
43. Filho RMF
44. dos Santos HM
45. Aguiar RS
46. Proença-Modena JL
47. Nelson B
48. Hay JA
49. Monod M
50. Miscouridou X
51. Coupland H
52. Sonabend R
53. Vollmer M
54. Gandy A
55. Prete CA
56. Nascimento VH
57. Suchard MA
58. Bowden TA
59. Pond SLK
60. Wu CH
61. Ratmann O
62. Ferguson NM
63. Dye C
64. Loman NJ
65. Lemey P
66. Rambaut A
67. Fraiji NA
68. Carvalho M
69. Pybus OG
70. Flaxman S
71. Bhatt S
72. Sabino EC
(2021) Genomics and epidemiology of the P.1 SARS-CoV-2 lineage in Manaus, Brazil
Science 372:815–821.
https://doi.org/10.1126/science.abh2644
- Google Scholar
1. Fougeroux C
2. Goksøyr L
3. Idorn M
4. Soroka V
5. Myeni SK
6. Dagil R
7. Janitzek CM
8. Søgaard M
9. Aves K-L
10. Horsted EW
11. Erdoğan SM
12. Gustavsson T
13. Dorosz J
14. Clemmensen S
15. Fredsgaard L
16. Thrane S
17. Vidal-Calvo EE
18. Khalifé P
19. Hulen TM
20. Choudhary S
21. Theisen M
22. Singh SK
23. Garcia-Senosiain A
24. Van Oosten L
25. Pijlman G
26. Hierzberger B
27. Domeyer T
28. Nalewajek BW
29. Strøbæk A
30. Skrzypczak M
31. Andersson LF
32. Buus S
33. Buus AS
34. Christensen JP
35. Dalebout TJ
36. Iversen K
37. Harritshøj LH
38. Mordmüller B
39. Ullum H
40. Reinert LS
41. de Jongh WA
42. Kikkert M
43. Paludan SR
44. Theander TG
45. Nielsen MA
46. Salanti A
47. Sander AF
(2021) Capsid-like particles decorated with the SARS-CoV-2 receptor-binding domain elicit strong virus neutralization activity
Nature Communications 12:324.
https://doi.org/10.1038/s41467-020-20251-8
- PubMed
- Google Scholar
1. Funk T
2. Pharris A
3. Spiteri G
4. Bundle N
5. Melidou A
6. Carr M
7. Gonzalez G
8. Garcia-Leon A
9. Crispie F
10. O’Connor L
11. Murphy N
12. Mossong J
13. Vergison A
14. Wienecke-Baldacchino AK
15. Abdelrahman T
16. Riccardo F
17. Stefanelli P
18. Di Martino A
19. Bella A
20. Lo Presti A
21. Casaca P
22. Moreno J
23. Borges V
24. Isidro J
25. Ferreira R
26. Gomes JP
27. Dotsenko L
28. Suija H
29. Epstein J
30. Sadikova O
31. Sepp H
32. Ikonen N
33. Savolainen-Kopra C
34. Blomqvist S
35. Möttönen T
36. Helve O
37. Gomes-Dias J
38. Adlhoch C
39. COVID study groups
(2021) Characteristics of SARS-CoV-2 variants of concern B.1.1.7, B.1.351 or P.1: data from seven EU/EEA countries, weeks 38/2020 to 10/2021
Euro Surveillance 26:2100348.
https://doi.org/10.2807/1560-7917.ES.2021.26.16.2100348
- PubMed
- Google Scholar
(2021) SARS-CoV-2 Antibody Responses Are Correlated to Disease Severity in COVID-19 Convalescent Individuals
Journal of Immunology 206:109–117.
https://doi.org/10.4049/jimmunol.2000898
- PubMed
- Google Scholar
(2018) Chimeric Proteins Containing MAP-1 and Functional Domains of C4b-Binding Protein Reveal Strong Complement Inhibitory Capacities
Frontiers in Immunology 9:1945.
https://doi.org/10.3389/fimmu.2018.01945
- PubMed
- Google Scholar
1. Hoffmann M
2. Kleine-Weber H
3. Schroeder S
4. Krüger N
5. Herrler T
6. Erichsen S
7. Schiergens TS
8. Herrler G
9. Wu N-H
10. Nitsche A
11. Müller MA
12. Drosten C
13. Pöhlmann S
(2020) SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor
Cell 181:271–280.
https://doi.org/10.1016/j.cell.2020.02.052
- PubMed
- Google Scholar
1. Kidd M
2. Richter A
3. Best A
4. Cumley N
5. Mirza J
6. Percival B
7. Mayhew M
8. Megram O
9. Ashford F
10. White T
11. Moles-Garcia E
12. Crawford L
13. Bosworth A
14. Atabani SF
15. Plant T
16. McNally A
(2021) S-Variant SARS-CoV-2 Lineage B1.1.7 Is Associated With Significantly Higher Viral Load in Samples Tested by TaqPath Polymerase Chain Reaction
The Journal of Infectious Diseases 223:1666–1670.
https://doi.org/10.1093/infdis/jiab082
- PubMed
- Google Scholar
1. Krammer F
(2020) SARS-CoV-2 vaccines in development
Nature 586:516–527.
https://doi.org/10.1038/s41586-020-2798-3
- PubMed
- Google Scholar
(2021) Experimental Evidence for Enhanced Receptor Binding by Rapidly Spreading SARS-CoV-2 Variants
Journal of Molecular Biology 433:167058.
https://doi.org/10.1016/j.jmb.2021.167058
- PubMed
- Google Scholar
(2021) Characterization of the emerging B.1.621 variant of interest of SARS-CoV-2
Infection, Genetics and Evolution 95:105038.
https://doi.org/10.1016/j.meegid.2021.105038
- PubMed
- Google Scholar
Preprint
1. Liu Y
2. Liu J
3. Plante KS
4. Plante JA
5. Xie X
6. Zhang X
7. Ku Z
8. An Z
9. Scharton D
10. Schindewolf C
11. Menachery VD
12. Shi PY
13. Weaver SC
(2021a) The N501Y Spike Substitution Enhances SARS-CoV-2 Transmission
bioRxiv.
https://doi.org/10.1101/2021.03.08.434499
- Google Scholar
1. Liu Y
2. Liu J
3. Xia H
4. Zhang X
5. Fontes-Garfias CR
6. Swanson KA
7. Cai H
8. Sarkar R
9. Chen W
10. Cutler M
11. Cooper D
12. Weaver SC
13. Muik A
14. Sahin U
15. Jansen KU
16. Xie X
17. Dormitzer PR
18. Shi P-Y
(2021b) Neutralizing Activity of BNT162b2-Elicited Serum
The New England Journal of Medicine 384:1466–1468.
https://doi.org/10.1056/NEJMc2102017
- PubMed
- Google Scholar
1. Madhi SA
2. Baillie V
3. Cutland CL
4. Voysey M
5. Koen AL
6. Fairlie L
7. Padayachee SD
8. Dheda K
9. Barnabas SL
10. Bhorat QE
11. Briner C
12. Kwatra G
13. Ahmed K
14. Aley P
15. Bhikha S
16. Bhiman JN
17. Bhorat AE
18. du Plessis J
19. Esmail A
20. Groenewald M
21. Horne E
22. Hwa S-H
23. Jose A
24. Lambe T
25. Laubscher M
26. Malahleha M
27. Masenya M
28. Masilela M
29. McKenzie S
30. Molapo K
31. Moultrie A
32. Oelofse S
33. Patel F
34. Pillay S
35. Rhead S
36. Rodel H
37. Rossouw L
38. Taoushanis C
39. Tegally H
40. Thombrayil A
41. van Eck S
42. Wibmer CK
43. Durham NM
44. Kelly EJ
45. Villafana TL
46. Gilbert S
47. Pollard AJ
48. de Oliveira T
49. Moore PL
50. Sigal A
51. Izu A
52. NGS-SA Group
53. Wits-VIDA COVID Group
(2021) Efficacy of the ChAdOx1 nCoV-19 Covid-19 Vaccine against the B.1.351 Variant
The New England Journal of Medicine 384:1885–1898.
https://doi.org/10.1056/NEJMoa2102214
- PubMed
- Google Scholar
Preprint
1. Marques AD
2. Sherrill-Mix S
3. Everett J
4. Reddy S
5. Hokama P
6. Roche AM
7. Hwang Y
8. Glascock A
9. Whiteside SA
10. Graham-Wooten J
11. Khatib LA
12. Fitzgerald AS
13. Moustafa AM
14. Bianco C
15. Rajagopal S
16. Helton J
17. Deming R
18. Denu L
19. Ahmed A
20. Kitt E
21. Coffin SE
22. Newbern C
23. Mell JC
24. Planet PJ
25. Badjatia N
26. Richards B
27. Wang ZX
28. Cannuscio CC
29. Strelau KM
30. Jaskowiak-Barr A
31. Cressman L
32. Loughrey S
33. Ganguly A
34. Feldman MD
35. Collman RG
36. Rodino KG
37. Kelly BJ
38. Bushman FD
(2021) SARS-CoV-2 Variants Associated with Vaccine Breakthrough in the Delaware Valley through Summer 2021
medRxiv.
https://doi.org/10.1101/2021.10.18.21264623
- Google Scholar
Preprint
1. Miladi M
(2020) The Landscape of SARS-CoV-2 RNA Modifications
bioRxiv.
https://doi.org/10.1101/2020.07.18.204362
- Google Scholar
Conference
1. Pearson CAB
(2021)
Estimates of severity and transmissibility of novel SARS-CoV-2 variant 501Y.V2 in South Africa

CMMID COVID-19 working group.
- Google Scholar
1. Rambaut A
(2020)
Preliminary genomic characterisation of an emergent SARS-CoV-2 lineage in the UK defined by a novel set of spike mutations

Genom. Epidemiol.
- Google Scholar
1. Ravichandran S
2. Coyle EM
3. Klenow L
4. Tang J
5. Grubbs G
6. Liu S
7. Wang T
8. Golding H
9. Khurana S
(2020) Antibody signature induced by SARS-CoV-2 spike protein immunogens in rabbits
Science Translational Medicine 12:eabc3539.
https://doi.org/10.1126/scitranslmed.abc3539
- PubMed
- Google Scholar
1. Reed LJ
2. Muench H
(1938) A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT ENDPOINTS12
American Journal of Epidemiology 27:493–497.
https://doi.org/10.1093/oxfordjournals.aje.a118408
- Google Scholar
Conference
1. Scientific Pandemic Influenza Group on Modelling Operational sub-group (SPI-M-O)
(2021)
SPI-M-O: Consensus Statement on COVID-19

Scientific Advisory Group for Emergencies.
- Google Scholar
(2021) SARS-CoV-2 Delta VOC in Scotland: demographics, risk of hospital admission, and vaccine effectiveness
Lancet 397:2461–2462.
https://doi.org/10.1016/S0140-6736(21)01358-1
- PubMed
- Google Scholar
1. Starr TN
2. Greaney AJ
3. Hilton SK
4. Ellis D
5. Crawford KHD
6. Dingens AS
7. Navarro MJ
8. Bowen JE
9. Tortorici MA
10. Walls AC
11. King NP
12. Veesler D
13. Bloom JD
(2020) Deep Mutational Scanning of SARS-CoV-2 Receptor Binding Domain Reveals Constraints on Folding and ACE2 Binding
Cell 182:1295–1310.
https://doi.org/10.1016/j.cell.2020.08.012
- PubMed
- Google Scholar
1. Supasa P
2. Zhou D
3. Dejnirattisai W
4. Liu C
5. Mentzer AJ
6. Ginn HM
7. Zhao Y
8. Duyvesteyn HME
9. Nutalai R
10. Tuekprakhon A
11. Wang B
12. Paesen GC
13. Slon-Campos J
14. López-Camacho C
15. Hallis B
16. Coombes N
17. Bewley KR
18. Charlton S
19. Walter TS
20. Barnes E
21. Dunachie SJ
22. Skelly D
23. Lumley SF
24. Baker N
25. Shaik I
26. Humphries HE
27. Godwin K
28. Gent N
29. Sienkiewicz A
30. Dold C
31. Levin R
32. Dong T
33. Pollard AJ
34. Knight JC
35. Klenerman P
36. Crook D
37. Lambe T
38. Clutterbuck E
39. Bibi S
40. Flaxman A
41. Bittaye M
42. Belij-Rammerstorfer S
43. Gilbert S
44. Hall DR
45. Williams MA
46. Paterson NG
47. James W
48. Carroll MW
49. Fry EE
50. Mongkolsapaya J
51. Ren J
52. Stuart DI
53. Screaton GR
(2021) Reduced neutralization of SARS-CoV-2 B.1.1.7 variant by convalescent and vaccine sera
Cell 184:2201–2211.
https://doi.org/10.1016/j.cell.2021.02.033
- PubMed
- Google Scholar
1. Tablizo FA
2. Saloma CP
3. Castro MJR
4. Kim KM
5. Yangzon MSL
6. Lapid CM
7. Maralit BA
8. Ayes MEC
9. Yap JMC
10. Llames JHS
11. Araiza SMM
12. Punayan KP
13. Asin ICA
14. Tambaoan CFB
15. Chong ALU
16. Padilla K
17. Cruz RPS
18. Morado EKD
19. Dizon JGA
20. Cutiongco-de la Paz EM
21. de Guzman AR
22. Hao RNM
23. Zamora AA
24. Pacial DR
25. Magalang JAR
26. Alejandria M
27. Carlos C
28. Ong-Lim A
29. Salvaña EM
30. Wong JQ
31. Montoya JC
32. Singh-Vergeire MR
(2021) Detection and Genome Sequencing of SARS-CoV-2 Variants Belonging to the B.1.1.7 Lineage in the Philippines
Microbiology Resource Announcements 1:e00219-21.
https://doi.org/10.1128/MRA.00219-21
- PubMed
- Google Scholar
1. Tarke A
2. Sidney J
3. Methot N
4. Yu ED
5. Zhang Y
6. Dan JM
7. Goodwin B
8. Rubiro P
9. Sutherland A
10. Wang E
11. Frazier A
12. Ramirez SI
13. Rawlings SA
14. Smith DM
15. da Silva Antunes R
16. Peters B
17. Scheuermann RH
18. Weiskopf D
19. Crotty S
20. Grifoni A
21. Sette A
(2021) Impact of SARS-CoV-2 variants on the total CD4+ and CD8+ T cell reactivity in infected or vaccinated individuals
Cell Reports Medicine 2:100355.
https://doi.org/10.1016/j.xcrm.2021.100355
- Google Scholar
1. Tegally H
2. Wilkinson E
3. Giovanetti M
4. Iranzadeh A
5. Fonseca V
6. Giandhari J
7. Doolabh D
8. Pillay S
9. San EJ
10. Msomi N
11. Mlisana K
12. von Gottberg A
13. Walaza S
14. Allam M
15. Ismail A
16. Mohale T
17. Glass AJ
18. Engelbrecht S
19. Van Zyl G
20. Preiser W
21. Petruccione F
22. Sigal A
23. Hardie D
24. Marais G
25. Hsiao N-Y
26. Korsman S
27. Davies M-A
28. Tyers L
29. Mudau I
30. York D
31. Maslo C
32. Goedhals D
33. Abrahams S
34. Laguda-Akingba O
35. Alisoltani-Dehkordi A
36. Godzik A
37. Wibmer CK
38. Sewell BT
39. Lourenço J
40. Alcantara LCJ
41. Kosakovsky Pond SL
42. Weaver S
43. Martin D
44. Lessells RJ
45. Bhiman JN
46. Williamson C
47. de Oliveira T
(2021) Detection of a SARS-CoV-2 variant of concern in South Africa
Nature 592:438–443.
https://doi.org/10.1038/s41586-021-03402-9
- PubMed
- Google Scholar
1. Tian F
2. Tong B
3. Sun L
4. Shi S
5. Zheng B
6. Wang Z
7. Dong X
8. Zheng P
(2021) N501Y mutation of spike protein in SARS-CoV-2 strengthens its binding to receptor ACE2
eLife 10:e69091.
https://doi.org/10.7554/eLife.69091
- PubMed
- Google Scholar
1. Walls AC
2. Park Y-J
3. Tortorici MA
4. Wall A
5. McGuire AT
6. Veesler D
(2020) Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein
Cell 181:281–292.
https://doi.org/10.1016/j.cell.2020.02.058
- PubMed
- Google Scholar
1. Winkler ES
2. Bailey AL
3. Kafai NM
4. Nair S
5. McCune BT
6. Yu J
7. Fox JM
8. Chen RE
9. Earnest JT
10. Keeler SP
11. Ritter JH
12. Kang L-I
13. Dort S
14. Robichaud A
15. Head R
16. Holtzman MJ
17. Diamond MS
(2020) SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung inflammation and impaired function
Nature Immunology 21:1327–1335.
https://doi.org/10.1038/s41590-020-0778-2
- PubMed
- Google Scholar
1. Wu K
2. Werner AP
3. Koch M
4. Choi A
5. Narayanan E
6. Stewart-Jones GBE
7. Colpitts T
8. Bennett H
9. Boyoglu-Barnum S
10. Shi W
11. Moliva JI
12. Sullivan NJ
13. Graham BS
14. Carfi A
15. Corbett KS
16. Seder RA
17. Edwards DK
(2021) Serum Neutralizing Activity Elicited by mRNA-1273 Vaccine
The New England Journal of Medicine 384:1468–1470.
https://doi.org/10.1056/NEJMc2102179
- PubMed
- Google Scholar
1. Yadav PD
(2021) Neutralization of variant under investigation B.1.617 with sera of BBV152 vaccinees
Clin. Infect. Dis. an Off. Publ. Infect. Dis. Soc. Am 1:ciab411.
https://doi.org/10.1093/cid/ciab411
- Google Scholar
1. Zhou P
2. Yang X-L
3. Wang X-G
4. Hu B
5. Zhang L
6. Zhang W
7. Si H-R
8. Zhu Y
9. Li B
10. Huang C-L
11. Chen H-D
12. Chen J
13. Luo Y
14. Guo H
15. Jiang R-D
16. Liu M-Q
17. Chen Y
18. Shen X-R
19. Wang X
20. Zheng X-S
21. Zhao K
22. Chen Q-J
23. Deng F
24. Liu L-L
25. Yan B
26. Zhan F-X
27. Wang Y-Y
28. Xiao G-F
29. Shi Z-L
(2020) A pneumonia outbreak associated with a new coronavirus of probable bat origin
Nature 579:270–273.
https://doi.org/10.1038/s41586-020-2012-7
- PubMed
- Google Scholar
1. Zhou D
2. Dejnirattisai W
3. Supasa P
4. Liu C
5. Mentzer AJ
6. Ginn HM
7. Zhao Y
8. Duyvesteyn HME
9. Tuekprakhon A
10. Nutalai R
11. Wang B
12. Paesen GC
13. Lopez-Camacho C
14. Slon-Campos J
15. Hallis B
16. Coombes N
17. Bewley K
18. Charlton S
19. Walter TS
20. Skelly D
21. Lumley SF
22. Dold C
23. Levin R
24. Dong T
25. Pollard AJ
26. Knight JC
27. Crook D
28. Lambe T
29. Clutterbuck E
30. Bibi S
31. Flaxman A
32. Bittaye M
33. Belij-Rammerstorfer S
34. Gilbert S
35. James W
36. Carroll MW
37. Klenerman P
38. Barnes E
39. Dunachie SJ
40. Fry EE
41. Mongkolsapaya J
42. Ren J
43. Stuart DI
44. Screaton GR
(2021) Evidence of escape of SARS-CoV-2 variant B.1.351 from natural and vaccine-induced sera
Cell 184:2348–2361.
https://doi.org/10.1016/j.cell.2021.02.037
- PubMed
- Google Scholar

Decision letter

Kei Sato

Reviewing Editor; The Institute of Medical Science, The University of Tokyo, Japan
Miles P Davenport

Senior Editor; University of New South Wales, Australia

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

Thank you for submitting your article "The B.1.1.7 SARS-CoV-2 variant exhibits significantly higher affinity for ACE-2 and accelerates disease severity in transgenic hACE-2 mice" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Miles Davenport as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) To assess the pathogenicity and potential immune evasion of B.1.1.7, the authors use a control isolate termed FR-4286. In which sites do the Spike proteins of B.1.1.7 and FR-4286 differ? The respective sequences may be provided. Can the authors exclude mutations that occurred during propagation in cell culture (in Vero cells)?

2) Line 68: In the introduction, the authors highlight that a lower infection dose was required to establish infection. In figure 2, however, they do not state how many of the mice per group were actually infected. Did the authors test this or monitor viral loads over time? Is the absence of weight loss in some animals due to absence of infection?

Similarly, the authors state that they observed "faster disease progression and severity after infection with a low dose of B.1.1.7" without demonstrating that the mice were actually infected.

3) Figure 4C, D; lines 169/170: The authors highlight a few antibodies that require 2- to 3-fold higher concentrations to inhibit the N501Y variant (compared to WT). According to the source files, however, there are also antibodies that require 2-fold lower concentrations to inhibit the N501Y or N439K variants. These findings are not mentioned in the text. Which of the antibodies tested show statistically significant differences?

4) Figure 4C, D: About half of the antibodies do not reach an inhibition of 50% in the concentrations tested. Still, the authors set the respective IC50 values to 100 µg/ml and included them in the correlation/regression analyses. This may be misleading.

5) To examine whether the affinity of N501Y and ACE2 is involved in the efficient establishment of infection and development of disease, the authors showed that the weight of transgenic humanized ACE2 mice infected with B.1.1.7 is more decreasing than that with Freiberg. However, in fact, it is difficult to determine whether the virus is really high based on this data alone. The authors should show that the virus titer in the lung of B.1.1.7 or Freiberg infected mice and the number of SARS-CoV-2 positive cells in the infected mice lung using immunohistochemistry. Moreover, the causes of mice weight loss induced by virus infection is various. The authors should describe the amino acid difference between Freiberg isolation and B.1.1.7 strain or each strain's accession number. If there are amino acid mutation in the virus protein involved in pathogenicity, the authors describe it in Discussion section. It is also strange that no weight loss was observed in Freiberg strain-infected mice, as a cited paper demonstrated sever weight loss of SARS-CoV-2 strain 2019n CoV/USA_WA1/2020infected mice (more than UK strain in this study actually).

6) In Figure 1, the authors examined the effect of N439K and N501Y in biophysical interaction between S and ACE2 proteins. These data suggest that the mutations increase the affinity with ACE2. In Figure 2, to examine whether the increased affinity of the N501Y variants for ACE2 was associated with a more efficient establishment of infection and development of disease, the authors challenged K18-hACE2 mice with clinically isolated two viruses including B.1.1.7 strain. However, since each clinical isolate contains about 30 mutations, it is not suitable as a model for examining the effects of specific mutations such as N501Y. In several reports, reverse genetics system has already been established. To clarify the role of mutations in viral infection or disease development, recombinant virus with specific mutation is suitable as the model.

7) Several reports suggest that mutations in S proteins support the infection of SARS-CoV-2 into mouse cells. It is possible that B.1.1.7 can infect to the cells through the interaction with mouse ACE2, therefore the authors should check the infectivity of B.1.1.7 to WT mouse.

8) To claim that analysis of convalescent sera using a PRNT virus neutralization platform showed no difference in the neutralization efficacy against the WT and B1.1.7 strains, the authors should show the neutralization efficacy against the B.1.351 or P.1 as a positive control.Reviewer #1:

In their present manuscript, Bayarri-Olmos and colleagues investigate the effects of SARS-CoV-2 Spike mutations N501Y and N439K on ACE2 binding, viral pathogenicity in mice and/or antibody neutralization. Using biolayer interferometry, they convincingly show that the N501Y change increases affinity to the receptor-binding domain of human ACE2 by about 8-fold. Furthermore, transgenic mice infected with the B.1.1.7 variant (harboring N501Y) show a more pronounced weight loss at 6 and 7 days post infection than mice infected with a control virus (Freiburg isolate FR-4286). While interaction of ACE2 with the N501Y RBD was slightly less sensitive to convalescent sera than the respective WT RBD control, the authors observed no significant difference in a viral neutralization assay using B.1.1.7 and FR-4286.

One major strength of the manuscript is the combination of several independent approaches to elucidate the impact of the N501Y and/or N439K mutation on ACE2 binding, pathogenicity and antibody evasion. However, some of the main conclusions are not fully justified by the data shown:

1) The exact sequence of the control virus (FR-4286) remains unclear. Thus, it remains unclear whether the N501Y mutation or any other changes are responsible for the observed differences in weight loss in infected mice (Figure 2).

2) Although the authors do not confirm successful infection of their ACE2 transgenic mice, they conclude that a lower infection dose was required to establish infection (Figure 2; line 68).

3) In the abstract, the authors highlight that "the 501Y variant showed a minor, but significant elevated evasion potential of RBD:ACE-2 antibody neutralization" when "challenged with […] monoclonal antibodies". While this may be true for some antibodies, others showed the opposite effect in their inhibition assay (Figure 4C/D). Furthermore, they do not observe any differences in neutralization sensitivity when performing a (more relevant) plaque reduction neutralization test.Reviewer #2:

The author's aim is to reveal the functional biophysical characterization of N501Y mutation in the receptor binding domain (RBD) of SARS-CoV-2 spike protein. First, they showed that the interaction of recombinant RBD N501Y and ACE2 is higher affinity than that of RBD WT.

This result indicated the possibility of the B.1.1.7 strain having N501Y mutation is more efficient infection than SARS-CoV-2 Freiberg isolate. In fact, they showed that B.1.1.7 strain induced weight reduction in transgenic humanized ACE2 mice at lower doses than Freiberg　isolate. Moreover, this paper investigated the relationship of N501Y and immune evasion. They showed that the antibody capacity to neutralize N501Y and ACE2 interaction is decreased using the sera of convalescent individuals and monoclonal antibodies.

However, it has been already proved from the three-dimensional structural analysis that the affinity of N501Y mutant was increased toward hACE2, while it seems first study proving it using a recombinant protein. Moreover, evasion of B.1.1.7 strain from vaccine-induced immunity has already been demonstrated. This study is potentially interesting, but the conclusion of this study is not novel and several experiments will be needed for elucidation of the exact effect of N501Y substitution.Reviewer #3:

'The B.1.1.7 SARS-CoV-2 variant exhibits significantly higher affinity for ACE-2 and accelerates disease severity in transgenic hACE-2 mice' by Bayarri-Olmos et al., examines the impact of the N501Y mutation on binding to the human ACE2 protein and further explores the virulence of the B.1.1.7 variant of concern using the transgenic k18 hACE2 mouse model. Using a combination of mechanistic in vitro techniques, classical neutralization assays and in vivo mouse infections the authors found subtle but significant differences between peptides and/or viruses containing the N501Y mutation vs. wild type controls. These findings are generally convincing but particularly in the case of the mouse model data, require more detail explain the B.1.1.7 phenotype.

The B.1.1.7 variant was first recognized in late 2020 and rapidly became the dominant circulating strain in most countries. While epidemiological modeling clearly showed a transmission advantage, and in silico studies suggested increase affinity to hACE2, full details to explain the rise of B.1.17 have been lacking. In this manuscript Bayarri-Olmos et al., examine the role of the N501Y mutation in hACE2 binding as well as the broader question of the VOC B.1.1.7 virulence using the k18 mouse model. While much has recently been written about B.1.1.7 and other variants of concern, detailed mechanistic wet lab studies are lacking and this work is a welcome addition to the field.

The authors demonstrate that spike RBDs containing the N501Y mutation had similar stability as wild type RBDs but had 8 fold higher affinity for hACE2. This precise biophysical characterization is very convincing and provides important mechanistic insight into the spread of B.1.1.7; however; the RBD domain exists as part of a larger protein (and that as part of a trimer) and changes in quaternary structure or protein stability may impact the assays used in this work.

in vivo infection using the k18 mouse model shows more weight loss after B.1.1.7 infection than after infection with an early isolate that does not contain the N501Y mutation, however it is unclear if there is any difference in virus replication or spread to neurotropism between the two strains. The weight loss data presented shows a clear difference in the lower dose, however further details l to address the mechanism of increased pathogenesis caused by B.1.1.7 infection is important to explain this finding.

Consistent with other reports, Byarri-Olmos et al., found similar virus neutralization of B.1.1.7 and a non N501Y control using convalescent serum. Use of a live virus assay instead of a pseudovirus assay in this report is a strength.

Overall, the data presented support the author's conclusion that the change in Spike-ACE2 binding affinity caused by the N501Y mutation is responsible for the increased transmission of B.1.1.7. The biophysical data presented in this work provides an important mechanism behind enhanced transmission of B.1.1.7 around the world and adds important understanding to the evolving COVID-19 pandemic.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "The α/B.1.1.7 SARS-CoV-2 variant exhibits significantly higher affinity for ACE-2 and requires lower inoculation doses to cause disease in K18-hACE2 mice" for further consideration by eLife. Your revised article has been evaluated by Miles Davenport (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

1. In the revised manuscript, the authors provided the data about viral load in the lungs of mice infected with SARS-CoV-2 only at day 2 after infection. The authors should show the data at multiple time points, such as day 1 and day 4. In addition, to investigate the pathogenicity, pathological analysis should also be performed. Furthermore, the source file is incorrect since identical values are provided for weight and viral load.

2. The authors should reply to the reviewer's comment: "Is is also strange that no weight loss was observed in Freiberg strain-infected mice, as a cited paper demonstrated severe weight loss of SARS-CoV-2 strain 2019n CoV/USA_WA1/2020 infected mice".

3. In several reports, a simple reverse genetics method has been reported. The authors should make mutant recombinant SARS-CoV-2 carrying N439K and/or N501Y by reverse genetics and examine the characteristics of mutant recombinant viruses.

4. Figure 4: While the authors excluded all mAbs with IC50s above the concentrations tested, they still provide IC50 values of 100 µg/ml in the respective source file. This may be misleading.

5. Since the authors have sequenced the Freiburg isolate, the respective sequence may be deposited and an accession number should be provided.

6. It seems that a preliminary version of the rebuttal was submitted. Particularly the introduction requires an update of the literature. For example, B1.621 may be introduced as "Mu variant of interest" (line 55) and P.3/Theta (line 54) is no longer considered a variant of interest by the WHO. Furthermore, some of the preprints cited have been published in the meantime (see e.g. line 239).

7. Figure 4C, D: The authors state that 1.5- to 1.8-fold effects "may be caused by biological/technical variation". Nevertheless, their values are based on a single duplicate measurement only. I strongly recommend performing three independent experiments since this is a key experiment of the study.

8. Lines 76-79: "This was associated with a lower infection dose requirement to establish infection in transgenic humanized ACE-2 mice challenged with the α/B.1.1.7 variant compared to an early 2020 isolate and resulted in increased disease severity." Since the previous sentence mentions both, the N439K and N501Y change, this statement may be misleading, given that the two isolates used do not differ at Spike position 439.

9. Line 386: Typo: the original amino acid residue at position 982 is missing.

As mentioned above, the reviewers think the manuscript was improved. However, the reviewers also think more in vivo data, such as the pathological analysis and experiments using recombinant virus, should be included. Addressing these issues would be essential for the acceptance.

https://doi.org/10.7554/eLife.70002.sa1

Author response

Essential revisions:

1) To assess the pathogenicity and potential immune evasion of B.1.1.7, the authors use a control isolate termed FR-4286. In which sites do the Spike proteins of B.1.1.7 and FR-4286 differ? The respective sequences may be provided. Can the authors exclude mutations that occurred during propagation in cell culture (in Vero cells)?

Sequence analysis of the variant FR-4286 shows that it is the Wuhan-like early European B.1 lineage strain, with the lineage characterizing mutations S:D614G, ORF1b:P314L. In addition, the strain carries an E:L37R amino acid variation.

This means, that the spike proteins of B.1.1.7 strain differ from FR-4286 on position S:N501Y, S:A570D, S:T716I, S:P681H, S:982A, S:D1118H, S:del69/70, S:del144/145. Both the B.1.1.7 and the FR-4286 strains contains the S:D614G and ORF1b:P314L mutations. This is based on sequencing of the isolates in Vero cells. This information has been added to the methods section in the revised manuscript (pp. 18-19, lines 347-366).

2) Line 68: In the introduction, the authors highlight that a lower infection dose was required to establish infection. In figure 2, however, they do not state how many of the mice per group were actually infected. Did the authors test this or monitor viral loads over time? Is the absence of weight loss in some animals due to absence of infection? Similarly, the authors state that they observed "faster disease progression and severity after infection with a low dose of B.1.1.7" without demonstrating that the mice were actually infected.

In the revised manuscript we now provide data on viral load in the lungs of mice infected with FR-4286 vs. Α (B.1.1.7) at day 2 after infection (New figure 2B). These data confirm that identical infection doses of Α and FR-4286 leads to higher viral load of the Α variant. In the graph we show values from individual mice, which demonstrate that the mice were actually infected.

3) Figure 4C, D; lines 169/170: The authors highlight a few antibodies that require 2- to 3-fold higher concentrations to inhibit the N501Y variant (compared to WT). According to the source files, however, there are also antibodies that require 2-fold lower concentrations to inhibit the N501Y or N439K variants. These findings are not mentioned in the text. Which of the antibodies tested show statistically significant differences?

We highlighted the antibodies that were compromised by the single mutations, for we considered those were the most biologically relevant. The editors are right when they mentioned that two antibodies neutralize the variants more effectively (1.5- and 1.8-fold), even when they were generated after RBD wt immunization. Nonetheless, such small differences may be caused by biological/technical variation.

We have updated the figures explicitly stating the fold difference (both decreased and enhanced neutralization) for all antibodies when it was above 1.5-fold. We have also updated the text in the Figure legend (L-196–198) and Results (L. 176–185). We did not perform statistical analyses on the individual antibodies, because the kDs were interpolated from duplicate measurements.

4) Figure 4C, D: About half of the antibodies do not reach an inhibition of 50% in the concentrations tested. Still, the authors set the respective IC50 values to 100 µg/ml and included them in the correlation/regression analyses. This may be misleading.

We understand the concerns raised regarding including non-inhibitory antibodies in the statistical analyses. We considered relevant to include all data in the analysis. Notwithstanding, we have now excluded from the analyses all mAbs with IC50s above the concentrations tested (previously normalized to 100). Figure 4C, D have been updated accordingly, as well as the figure legend (196–198).

5) To examine whether the affinity of N501Y and ACE2 is involved in the efficient establishment of infection and development of disease, the authors showed that the weight of transgenic humanized ACE2 mice infected with B.1.1.7 is more decreasing than that with Freiberg. However, in fact, it is difficult to determine whether the virus is really high based on this data alone. The authors should show that the virus titer in the lung of B.1.1.7 or Freiberg infected mice and the number of SARS-CoV-2 positive cells in the infected mice lung using immunohistochemistry. Moreover, the causes of mice weight loss induced by virus infection is various. The authors should describe the amino acid difference between Freiberg isolation and B.1.1.7 strain or each strain's accession number. If there are amino acid mutation in the virus protein involved in pathogenicity, the authors describe it in Discussion section. It is also strange that no weight loss was observed in Freiberg strain-infected mice, as a cited paper demonstrated sever weight loss of SARS-CoV-2 strain 2019n CoV/USA_WA1/2020infected mice (more than UK strain in this study actually).

Please see response to point 1 and 2 above, where we address the issues on mutations in the spike protein and mutations virus load in individual mice.

6) In Figure 1, the authors examined the effect of N439K and N501Y in biophysical interaction between S and ACE2 proteins. These data suggest that the mutations increase the affinity with ACE2. In Figure 2, to examine whether the increased affinity of the N501Y variants for ACE2 was associated with a more efficient establishment of infection and development of disease, the authors challenged K18-hACE2 mice with clinically isolated two viruses including B.1.1.7 strain. However, since each clinical isolate contains about 30 mutations, it is not suitable as a model for examining the effects of specific mutations such as N501Y. In several reports, reverse genetics system has already been established. To clarify the role of mutations in viral infection or disease development, recombinant virus with specific mutation is suitable as the model.

We agree that the RBD N501Y variant does not directly reflect the full spike/virus infection situation in vivo. For the biophysical characterization, however, we considered that side-by-side comparisons of RBD harboring single mutations is a appropriate approach. The RBD determines the affinity towards ACE-2, and while we cannot discard minor effects from mutations outside the RBD, it is likely that the RBD_N501Y/ACE-2 interaction can be extrapolated to the B.1.1.7 spike. Nonetheless, we do not claim that the RBD affinity increase caused by the N501Y is the sole reason for the apparent higher transmission and disease progression in vivo. We understand the concern and have introduced a paragraph in the discussion regarding the other mutations in the spike gene.

7) Several reports suggest that mutations in S proteins support the infection of SARS-CoV-2 into mouse cells. It is possible that B.1.1.7 can infect to the cells through the interaction with mouse ACE2, therefore the authors should check the infectivity of B.1.1.7 to WT mouse.

We agree that this is an important point. We have not been able to do the infection studies in wt mice but there is a recent report suggesting that B.1.1.7 can infect mice cells to some degree, though not as efficient as the P.1 and B.1.351. (https://doi.org/10.1101/2021.03.18.436013). We have included a paragraph in the discussion highlighting this.

8) To claim that analysis of convalescent sera using a PRNT virus neutralization platform showed no difference in the neutralization efficacy against the WT and B1.1.7 strains, the authors should show the neutralization efficacy against the B.1.351 or P.1 as a positive control.

Our ELISA-based neutralization assay highly correlates with the PRNT, as shown in the figure from Bayarri-Olmos et al., (The Journal of Immunology, 2021, in print).

Using our assay in a publication currently under review in another journal, we have compared the neutralization efficacy of convalescent sera against RBD harboring different mutations, like the P.1. A modified figure is included, see Author response image 1.

Author response image 1

Download asset Open asset

Inhibitory potency of COVID-19 convalescent patient sera against RBD variants.

Antibody-mediated inhibition of serum from recovered COVID-19 patients (n = 150) against RBD wt, N501Y and P.1 (harboring the Y417N, E484K, and N501Y mutations). Statistical comparisons between groups were performed using the Friedman test with Dunn’s multiple comparisons. Orange lines represent medians.

All in all, the PRNT is a robust and well-characterized assay, and the moderate decrease in neutralization by the N501Y variant is in accordance with a growing body of evidence.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

1. In the revised manuscript, the authors provided the data about viral load in the lungs of mice infected with SARS-CoV-2 only at day 2 after infection. The authors should show the data at multiple time points, such as day 1 and day 4. In addition, to investigate the pathogenicity, pathological analysis should also be performed. Furthermore, the source file is incorrect since identical values are provided for weight and viral load.

Thank you for the relevant suggestion. Generally, we and others (e.g. ref 32) do not see profound differences in the titer at day 2-4 p.i. and around day 6-7 the virus is being eliminated from the lungs in this model. We believe that day 2 p.i is best representing the disease development and monitoring the viral load at day 1 and 4, although adding to the breadth of the analysis, would not add significant additional information. We have done TCID50 assays on lung tissues from the in vivo experiments that essentially resemble the viral load measurements (from figure 2b) but with a different observed statical significance. The results from the TCID50 are presented in Author response image 2. These data can be included in the manuscript if the editors think it will be of value.

Author response image 2

Download asset Open asset

Thank you for noticing that the source files for figure 2b were not uploaded correctly. These are now corrected and attached in the resubmission.

2. The authors should reply to the reviewer's comment: "Is is also strange that no weight loss was observed in Freiberg strain-infected mice, as a cited paper demonstrated severe weight loss of SARS-CoV-2 strain 2019n CoV/USA_WA1/2020 infected mice".

The authors agree that there are differences in disease development in K18-hACE mice infected with the parental virus when compared to other published data. However, as also reported in the literature, and similar to humans, the mice exhibit age-dependence development of disease. The mice used in this study were in the lower age-range, and hence likely explaining why only limited development of disease was observed. Interestingly, the mice infected with the B.1.1.7 variant did nevertheless develop severe disease and higher viral load despite the low age of the mice.

3. In several reports, a simple reverse genetics method has been reported. The authors should make mutant recombinant SARS-CoV-2 carrying N439K and/or N501Y by reverse genetics and examine the characteristics of mutant recombinant viruses.

We fully agree with the editors and think that this is an interesting suggestion. However due to safety restrictions in working with genetically modified SARS-CoV2 this is currently not an option for us within the Danish legislation. This would require a combined GMO-3 and BSL3 facility, which currently does not exist in Denmark.

4. Figure 4: While the authors excluded all mAbs with IC50s above the concentrations tested, they still provide IC50 values of 100 µg/ml in the respective source file. This may be misleading.

We have updated the source file and highlighted the mAbs with IC50s above the range of concentrations tested as “excluded”. We have given them an arbitrary value and excluded them from any analyses.

5. Since the authors have sequenced the Freiburg isolate, the respective sequence may be deposited and an accession number should be provided.

The Freiburg isolate sequence has been uploaded and has the accession ID no: EPI_ISL_852748. This has been disclosed and included in the revised manuscript.

6. It seems that a preliminary version of the rebuttal was submitted. Particularly the introduction requires an update of the literature. For example, B1.621 may be introduced as "Mu variant of interest" (line 55) and P.3/Theta (line 54) is no longer considered a variant of interest by the WHO. Furthermore, some of the preprints cited have been published in the meantime (see e.g. line 239).

We thank the editors for highlighting this. We have updated the introduction regarding the Mu VOI and the theta, a former VOI according to https://www.who.int/en/activities/tracking-SARS-CoV-2-variants/. We have also revised the reference list and updated all articles that have been published on the meantime.

7. Figure 4C, D: The authors state that 1.5- to 1.8-fold effects "may be caused by biological/technical variation". Nevertheless, their values are based on a single duplicate measurement only. I strongly recommend performing three independent experiments since this is a key experiment of the study.

We agree. And as suggested, we have performed the experiment again, as three independent replicates. The figure and source file have been updated accordingly.

8. Lines 76-79: "This was associated with a lower infection dose requirement to establish infection in transgenic humanized ACE-2 mice challenged with the α/B.1.1.7 variant compared to an early 2020 isolate and resulted in increased disease severity." Since the previous sentence mentions both, the N439K and N501Y change, this statement may be misleading, given that the two isolates used do not differ at Spike position 439.

We agree that the statement could be misleading and have changed the paragraph in the manuscript.

9. Line 386: Typo: the original amino acid residue at position 982 is missing.

We apologize for the oversight. It has been corrected to S:S982A.

https://doi.org/10.7554/eLife.70002.sa2

Article and author information

Author details

Rafael Bayarri-Olmos
1. Recombinant Protein and Antibody Laboratory, Copenhagen University Hospital, Copenhagen, Denmark
2. Laboratory of Molecular Medicine, Department of Clinical Immunology, Section 7631, Rigshospitalet Copenhagen University Hospital, Copenhagen, Denmark
Contribution
Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing - original draft, Funding acquisition

Competing interests
No competing interests declared
Laust Bruun Johnsen

Novo Nordisk A/S, Måløv, Denmark

Contribution
Data curation, Formal analysis, Investigation, Methodology, Funding acquisition

Competing interests
No competing interests declared
Manja Idorn

Department of Biomedicine, Aarhus University, Århus, Denmark

Contribution
Formal analysis, Methodology, Funding acquisition

Competing interests
No competing interests declared
Line S Reinert

Department of Biomedicine, Aarhus University, Århus, Denmark

Contribution
Investigation, Methodology, Funding acquisition

Competing interests
No competing interests declared
Anne Rosbjerg
1. Recombinant Protein and Antibody Laboratory, Copenhagen University Hospital, Copenhagen, Denmark
2. Institute of Immunology and Microbiology, University of Copenhagen, Copenhagen, Denmark
Contribution
Investigation, Methodology, Funding acquisition

Competing interests
No competing interests declared
Søren Vang

Department of Molecular Medicine, Aarhus University Hospital, Aarhus, Denmark

Contribution
Formal analysis, Investigation, Methodology

Competing interests
No competing interests declared
Cecilie Bo Hansen

Laboratory of Molecular Medicine, Department of Clinical Immunology, Section 7631, Rigshospitalet Copenhagen University Hospital, Copenhagen, Denmark

Contribution
Data curation, Formal analysis, Funding acquisition

Competing interests
No competing interests declared
Charlotte Helgstrand

Novo Nordisk A/S, Måløv, Denmark

Contribution
Data curation, Investigation, Methodology, Funding acquisition

Competing interests
No competing interests declared
Jais Rose Bjelke

Novo Nordisk A/S, Måløv, Denmark

Contribution
Data curation, Investigation, Methodology, Funding acquisition

Competing interests
No competing interests declared
Theresa Bak-Thomsen

Novo Nordisk A/S, Måløv, Denmark

Contribution
Conceptualization, Supervision, Funding acquisition

Competing interests
No competing interests declared
Søren R Paludan

Department of Biomedicine, Aarhus University, Århus, Denmark

Contribution
Conceptualization, Validation, Supervision, Funding acquisition

Competing interests
No competing interests declared
Peter Garred

Laboratory of Molecular Medicine, Department of Clinical Immunology, Section 7631, Rigshospitalet Copenhagen University Hospital, Copenhagen, Denmark

Contribution
Conceptualization, Supervision, Writing - original draft, Funding acquisition

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-2876-8586
Mikkel-Ole Skjoedt
1. Laboratory of Molecular Medicine, Department of Clinical Immunology, Section 7631, Rigshospitalet Copenhagen University Hospital, Copenhagen, Denmark
2. Institute of Immunology and Microbiology, University of Copenhagen, Copenhagen, Denmark
Contribution
Conceptualization, Data curation, Formal analysis, Validation, Investigation, Methodology, Supervision, Writing – review and editing, Project administration, Writing - original draft, Funding acquisition

For correspondence
moskjoedt@sund.ku.dk

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-1306-6482

Funding

Carlsbergfondet (CF20-0045)

Rafael Bayarri-Olmos
Anne Rosbjerg
Peter Garred
Mikkel-Ole Skjoedt

Novo Nordisk Fonden (NFF205A0063505)

Rafael Bayarri-Olmos
Anne Rosbjerg
Peter Garred
Mikkel-Ole Skjoedt

Novo Nordisk Fonden (NNF20OC0063436)

Rafael Bayarri-Olmos
Anne Rosbjerg
Peter Garred
Mikkel-Ole Skjoedt

Novo Nordisk Fonden (NNF20SA0064201)

Rafael Bayarri-Olmos
Anne Rosbjerg
Peter Garred
Mikkel-Ole Skjoedt

European Research Council (ERC-AdG ENVISION; 786602)

Søren R Paludan

Independent Research Fund Denmark (0214-00001B)

Søren R Paludan

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

The authors would like to thank Camilla Xenia Holtermann Jahn, Sif Kaas Nielsen, Bettina Eide Holm, and Mads Engelhardt Knudsen from the Laboratory of Molecular Medicine at Rigshospitalet, and Ea Stoltze Andersen from the Department of Molecular Medicine at Aarhus Universy Hospital for their excellent technical assistance, and Per Franklin Nielsen from Novo Nordisk A/S for mass spectrometry identification of all recombinant proteins. Professor Stefan Pöhlman, University of Göttingen, Germany kindly provided us with VeroE6-hTMPRSS2 cells, and Professors Georg Kochs, University of Freiburg and Arvind Patel, University of Glasgow, United Kingdom, kindly provided us with the SARS-CoV2 Freiburg isolate and the alpha/B.1.1.7 SARS-CoV-2 Kent isolate, respectively. This work was financially supported from grants from the Carlsberg Foundation (CF20-0045), independent Research Fund Denmark (0214-00001B), The European Research Council (ERC-AdG ENVISION; 786602), and the Novo Nordisk Foundation (NFF205A0063505, NNF20OC0063436, and NNF20SA0064201).

Ethics

The collection and use of blood samples has been approved by the Regional Ethical Committee of the Capital Region of Denmark (H-20028627 and H-20079890). The human studies were conducted in agreement with the Helsinki declaration. We have received informed consent to do the examinations included in this study including to publish data.

The Danish Animal Experiments Inspectorate has approved the experimental animal procedures and they were carried out in accordance with the Danish Animal Welfare Act for the Care and Use of Animals for Scientific Purposes (License ID 2019-15-0201-00090 and 2020-15-0201-00726). All procedures followed the recommendations of the Animal Facilities at the Universities of Copenhagen and Aarhus.

Senior Editor

Miles P Davenport, University of New South Wales, Australia

Reviewing Editor

Kei Sato, The Institute of Medical Science, The University of Tokyo, Japan

Publication history

Received: May 4, 2021
Accepted: November 24, 2021
Accepted Manuscript published: November 25, 2021 (version 1)
Accepted Manuscript updated: November 29, 2021 (version 2)
Version of Record published: December 1, 2021 (version 3)

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

977

Page views
101

Downloads
15

Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Article PDF

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Rafael Bayarri-Olmos
Laust Bruun Johnsen
Manja Idorn
Line S Reinert
Anne Rosbjerg
Søren Vang
Cecilie Bo Hansen
Charlotte Helgstrand
Jais Rose Bjelke
Theresa Bak-Thomsen
Søren R Paludan
Peter Garred
Mikkel-Ole Skjoedt

(2021)

The alpha/B.1.1.7 SARS-CoV-2 variant exhibits significantly higher affinity for ACE-2 and requires lower inoculation doses to cause disease in K18-hACE2 mice

eLife 10:e70002.

https://doi.org/10.7554/eLife.70002