A zebrafish embryo screen utilizing gastrulation identifies the HTR2C software inhibitor pizotifen as a suppressor of EMT-mediated metastasis

Abstract
Editor's evaluation
Introduction
Results
Discussion
Materials and methods
Data availability
References
Article and author information
Metrics

Abstract

Metastasis is responsible for approximately 90% of cancer-associated mortality but few models exist that allow for rapid and effective screening of anti-metastasis drugs. Current mouse models of metastasis are too expensive and time consuming to use for rapid and high-throughput screening. Therefore, we created a unique screening concept utilizing conserved mechanisms between zebrafish gastrulation and cancer metastasis for identification of potential anti-metastatic drugs. We hypothesized that small chemicals that interrupt zebrafish gastrulation might also suppress metastatic progression of cancer cells and developed a phenotype-based chemical screen to test the hypothesis. The screen used epiboly, the first morphogenetic movement in gastrulation, as a marker and enabled 100 chemicals to be tested in 5 hr. The screen tested 1280 FDA-approved drugs and identified pizotifen, an antagonist for serotonin receptor 2C (HTR2C) as an epiboly-interrupting drug. Pharmacological and genetic inhibition of HTR2C suppressed metastatic progression in a mouse model. Blocking HTR2C with pizotifen restored epithelial properties to metastatic cells through inhibition of Wnt signaling. In contrast, HTR2C induced epithelial-to-mesenchymal transition through activation of Wnt signaling and promoted metastatic dissemination of human cancer cells in a zebrafish xenotransplantation model. Taken together, our concept offers a novel platform for discovery of anti-metastasis drugs.

Editor's evaluation

We are so impressed with this new and ambitious concept for chemical screening using zebrafish embryos to find a novel anti-metastasis drug, Pizotifen. We hope many researchers will use this screening system for anti-cancer drug discovery.

https://doi.org/10.7554/eLife.70151.sa0

Introduction

Metastasis, a leading contributor to the morbidity of cancer patients, occurs through multiple steps: invasion, intravasation, extravasation, colonization, and metastatic tumor formation (Nguyen et al., 2009; Welch and Hurst, 2019; Chaffer and Weinberg, 2011). The physical translocation of cancer cells is an initial step of metastasis and molecular mechanisms of it involve cell motility, the breakdown of local basement membrane, loss of cell polarity, acquisition of stem cell-like properties, and epithelial-to-mesenchymal transition (EMT) (Tsai and Yang, 2013; Lu and Kang, 2019). These cell-biological phenomena are also observed during vertebrate gastrulation in that evolutionarily conserved morphogenetic movements of epiboly, internalization, convergence, and extension progress (Solnica-Krezel, 2005). In zebrafish, the first morphogenetic movement, epiboly, is initiated at approximately 4 hr post fertilization (hpf) to move cells from the animal pole to eventually engulf the entire yolk cell by 10 hpf (Latimer and Jessen, 2010; Solnica-Krezel, 2006). The embryonic cell movements are governed by the molecular mechanisms that are partially shared in metastatic cell dissemination.

At least 50 common genes were shown to be involved in both metastasis and gastrulation progression: Knockdown of these genes in Xenopus or zebrafish induced gastrulation defects; conversely, overexpression of these genes conferred metastatic potential on cancer cells and knockdown of these genes suppressed metastasis (Yang and Weinberg, 2008; Dongre and Weinberg, 2019; Thiery et al., 2009; Nieto et al., 2016; Table 1). This evidence led us to hypothesize that small molecules that interrupt zebrafish gastrulation may suppress metastatic progression of human cancer cells.

Table 1

A list of the genes that are involved between gastrulation and metastasis progression.

A list of the 50 genes that play essential role in governing both metastasis and gastrulation progression. The gastrulation defects in Xenopus or zebrafish that are induced by knockdown of each of these genes were indicated. The molecular mechanism in metastasis that is inhibited by knockdown of each of the same genes was indicated.

Genes	Gastrulation defects	Ref	Effects in metastasis	Ref
BMP	Convergence and extension	Kondo, 2007	EMT	Katsuno et al., 2008
WNT	Convergence and extension	Tada and Smith, 2000	Migration and invasion	Vincan and Barker, 2008
FGF	Convergence and extension	Yang et al., 2002	Invision	Nomura et al., 2008
EGF	Epiboly	Song et al., 2013	Migration	Lu et al., 2001
PDGF	Convergence and extension	Damm and Winklbauer, 2011	EMT	Jechlinger et al., 2006
CXCL12	Migration of endodermal cells	Mizoguchi et al., 2008	Migration and invasion	Shen et al., 2013
CXCR4	Migration of endodermal cells	Mizoguchi et al., 2008	Migration and invasion	Shen et al., 2013
PIK3CA	Convergence and extension	Montero et al., 2003	Migration and invasion	Wander et al., 2013
YES	Epiboly	Tsai et al., 2005	Migration	Barraclough et al., 2007
FYN	Epiboly	Sharma et al., 2005	Migration and invasion	Yadav and Denning, 2011
MAPK1	Epiboly	Krens et al., 2008	Migration	Radtke et al., 2013
SHP2	Convergence and extension	Jopling et al., 2007	Migration	Wang et al., 2005
SNAI1	Convergence and extension	Ip and Gridley, 2002	EMT	Batlle et al., 2000
SNAI2	Mesoderm and neural crest formation	Shi et al., 2011	EMT	Medici et al., 2008
TWIST1	Mesoderm formation	Castanon and Baylies, 2002	EMT	Yang et al., 2004
TBXT	Convergence and extension	Tada and Smith, 2000	EMT	Fernando et al., 2010
ZEB1	Epiboly	Vannier et al., 2013	EMT	Spaderna et al., 2008
GSC	Mesodermal patterning	Sander et al., 2007	EMT	Hartwell et al., 2006
FOXC2	Unclear, defects in gastrulation	Wilm et al., 2004	EMT	Mani et al., 2007
STAT3	Convergence and extension	Miyagi et al., 2004	Migration	Abdulghani et al., 2008
POU5F1	Epiboly	Lachnit et al., 2008	EMT	Dai et al., 2013
EZH2	Unclear, defects in gastrulation	O’Carroll et al., 2001	Invasion	Ren et al., 2012
EHMT2	Defects in neurogenesis	Lin et al., 2005	Migration and invasion	Chen et al., 2010
BMI1	Defects in skeleton formation	van der Lugt et al., 1994	EMT	Guo et al., 2011
RHOA	Convergence and extension	Zhu et al., 2006	Migration and invasion	Yoshioka et al., 1999
CDC42	Convergence and extension	Choi and Han, 2002	Migration and invasion	Reymond et al., 2012
RAC1	Convergence and extension	Habas et al., 2003	Migration and invasion	Vega and Ridley, 2008
ROCK2	Convergence and extension	Marlow et al., 2002	Migration and invasion	Itoh et al., 1999
PAR1	Convergence and extension	Kusakabe and Nishida, 2004	Migration	Shi et al., 2004
PRKCI	Convergence and extension	Kusakabe and Nishida, 2004	EMT	Gunaratne et al., 2013
CAP1	Convergence and extension	Seifert et al., 2009	Migration	Yamazaki et al., 2009
EZR	Epiboly	Link et al., 2006	Migration	Khanna et al., 2004
EPCAM	Epiboly	Slanchev et al., 2009	Migration and invasion	Ni et al., 2012
ITGB1/ ITA5	Mesodermal migration	Skalski et al., 1998	Migration and invasion	Felding-Habermann, 2003
FN1	Convergence and extension	Marsden and DeSimone, 2003	Invasion	Malik et al., 2010
HAS2	Dorsal migration of lateral cells	Bakkers et al., 2004	Invasion	Kim et al., 2004
MMP14	Convergence and extension	Coyle et al., 2008	Invasion	Perentes et al., 2011
COX1	Epiboly	Cha et al., 2006	Invasion	Kundu and Fulton, 2002
PTGES	Convergence and extension	Speirs et al., 2010	Invasion	Wang and Dubois, 2006
SLC39A6	Anterior migration	Yamashita et al., 2004	EMT	Lue et al., 2011
GNA12 /13	Convergence and extension	Lin et al., 2005	Migration and invasion	Yagi et al., 2011
OGT	Epiboly	Webster et al., 2009	Migration and invasion	Lynch et al., 2012
CCN1	Cell movement	Latinkic et al., 2003	Migration and invasion	Lin et al., 2012
TRPM7	Convergence and extension	Liu et al., 2011	Migration	Middelbeek et al., 2012
MAPKAPK2	Epiboly	Holloway et al., 2009	Migration	Kumar et al., 2010
B4GALT1	Convergence and extension	Machingo et al., 2006	Invasion	Zhu et al., 2005
IER2	Convergence and extension	Hong et al., 2011	Migration	Neeb et al., 2012
TIP1	Convergence and extension	Besser et al., 2007	Migration and invasion	Han et al., 2012
PAK5	Convergence and extension	Faure et al., 2005	Migration	Gong et al., 2009
MARCKS	Convergence and extension	Iioka et al., 2004	Migration and invasion	Rombouts et al., 2013

Here, we report a unique screening concept based on the hypothesis. Pizotifen, an antagonist for HTR2C, was identified from the screen as a ‘hit’ that interrupted zebrafish gastrulation. A mouse model of metastasis confirmed pharmacological and genetic inhibition of HTR2C suppressed metastatic progression. Moreover, HTR2C induced EMT and promoted metastatic dissemination of non-metastatic cancer cells in a zebrafish xenotransplantation model. These results demonstrated that this concept could offer a novel high-throughput platform for discovery of anti-metastasis drugs and can be converted to a chemical genetic screening platform.

Results

Small molecules interrupting epiboly of zebrafish have a potential to suppress metastatic progression of human cancer cells

Before performing a screening assay, we validated a core of our concept through comparing the genes expressed in zebrafish gastrulation with the genes which expressed in EMT-mediated metastasis. Gene set enrichment analysis (GSEA) demonstrated that 50%-epiboly, shield, and 75%-epiboly stage of zebrafish embryos expressed the genes which promote EMT-mediated metastasis: EMT induction, TGF-β signaling, wnt/β-catenin signaling, Notch signaling (Figure 1—figure supplement 1).

We further conducted preliminary experiments to test the hypothesis. First, we examined whether hindering the molecular function of reported genes, whose knockdown induced gastrulation defects in zebrafish, might suppress cell motility and invasion of cancer cells. We chose protein arginine methyltransferase 1 (PRMT1) and cytochrome P450 family 11 (CYP11A1), both of whose knockdown induced gastrulation defects in zebrafish but whose involvement in metastatic progression is unclear (Tsai et al., 2011; Hsu et al., 2006). Elevated expression of PRMT1 and CYP11A1 was observed in highly metastatic human breast cancer cell lines and knockdown of these genes through RNA interference suppressed the motility and invasion of MDA-MB-231 cells without affecting their viability (Figure 1—figure supplement 2A-C).

Next, we conducted an inverse examination of whether chemicals which were reported to suppress metastatic dissemination of cancer cells could interrupt epiboly progression of zebrafish embryos. Niclosamide and vinpocetine are reported to suppress metastatic progression (Weinbach and Garbus, 1969; Sack et al., 2011; Huang et al., 2012; Szilágyi et al., 2005). Either niclosamide- or vinpocetine-treated zebrafish embryos showed complete arrest at very early stages or severe delay in epiboly progression, respectively (Figure 1—figure supplement 2D).

These results suggest that epiboly could serve as a marker for this screening assay and epiboly-interrupting drugs that are identified through this screening could have the potential to suppress metastatic progression of human cancer cells.

132 FDA-approved drugs induced delayed in epiboly of zebrafish embryos

We screened 1280 FDA, EMA, or other agencies-approved drugs (Prestwick, Inc) in our zebrafish assay. The screening showed that 0.9% (12/1280) of the drugs, including antimycin A and tolcapone, induced severe or complete arrest of embryonic cell movement when embryos were treated with 10 μM. 5.2% (66/1280) of the drugs, such as dicumarol, racecadotril, pizotifen, and S(-)eticlopride hydrochloride, induced either delayed epiboly or interrupted epiboly of the embryos. 93.3% (1194/1280) of drugs have no effect on epiboly progression of the embryos. 0.6% (8/1280) of drugs induced toxic lethality. Epiboly progression was affected more severely when embryos were treated with 50 μM; 1.7% (22/1280) of the drugs induced severe or complete arrest of it. 8.6% (110/1280) of the drugs induced either delayed epiboly or interrupt epiboly of the embryos. 4.3% (55/1280) of drugs induced a toxic lethality (Figure 1A and B, Table 2). Among the epiboly-interrupting drugs, several drugs have already been reported to inhibit metastasis-related molecular mechanisms: adrenosterone or zardaverine, which target HSD11β1 or PDE3 and -4, respectively, are reported to inhibit EMT (Nakayama et al., 2020; Kolosionek et al., 2009); racecadotril, which targets enkephalinase, is reported to confer metastatic potential on colon cancer cell (Sasaki et al., 2014); and disulfiram, which targets ALDH (aldehyde dehydrogenase), is reported to confer stem-like properties on metastatic cancer cells (Liu et al., 2013). This evidence suggests that epiboly-interrupting drugs have the potential for suppressing metastasis of human cancer cells.

Figure 1 with 2 supplements see all

Download asset Open asset

A chemical screen for identification of epiboly-interrupting drugs.

(A) Cumulative results of the chemical screen in which each drug was used at either 10 µM (left) or 50 µM (right) concentrations. 1280 FDA, EMA, or other agencies-approved drugs were subjected to this screening. Positive ‘hit’ drugs were those that interrupted epiboly progression. (B) Representative samples of the embryos that were treated with indicated drugs.

Table 2

A list of the drugs that interfere with epiboly progression in zebrafish.

Related to Figure 1. A list of positive ‘hit’ drugs that interfered with epiboly progression. Gastrulation defects or status of each of the zebrafish embryos that were treated with either 10 or 50 μM concentrations are indicated.

Chemical name	Chemical formula	Effect of 10 µM	Effect of 50 µM
Acitretin	C₂₁H₂₆O₃	Delayed	Delayed
Adrenosterone	C₁₉H₂₄O₃	Delayed	Delayed
Albendazole	C₁₂H₁₅N₃O₂S	Severe delayed	Severe delayed
Alfadolone acetate	C₂₃H₃₄O₅	Delayed	Delayed
Alfaxalone	C₂₁H₃₂O₃	Delayed	Delayed
Alprostadil	C₂₀H₃₄O₅	Delayed	Delayed
Altrenogest	C₂₁H₂₆O₂	Slightly delayed	Delayed
Ampiroxicam	C₂₀H₂₁N₃O₇S	Non-effect	Delayed
Anethole-trithione	C₁₀H_8OS₃	Delayed	Delayed
Antimycin A	C₂₈H₄₀N₂O₉	Delayed	Delayed
Avobenzone	C₂₀H₂₂O₃	Delayed	Delayed
Benzoxiquine	C₁₆H₁₁NO₂	Non-effect	Delayed
Bosentan	C₂₇H₂₉N₅O₆S	Delayed	Delayed
Butoconazole nitrate	C₁₉H₁₈C_l3N₃O₃S	Delayed	Toxic lethal
Camptothecine (S,+)	C₂₀H₁₆N₂O₄	Severe delayed	Severe delayed
Carbenoxolone disodium salt	C₃₄H₄₈Na₂O₇	Delayed	Toxic lethal
Carmofur	C₁₁H₁₆FN₃O₃	Slightly delayed	Delayed
Carprofen	C₁₅H₁₂ClNO₂	Severe delayed	Toxic lethal
Cefdinir	C₁₄H₁₃N₅O₅S₂	Delayed	Delayed
Celecoxib	C₁₇H₁₄F₃N₃O₂S	Delayed	Delayed
Chlorambucil	C₁₄H₁₉C_l2NO₂	Slightly delayed	Delayed
Chlorhexidine	C₂₂H₃₀C_l2N₁₀	Non-effect	Toxic lethal
Ciclopirox ethanolamine	C₁₄H₂₄N₂O₃	Delayed	Severe delayed
Cinoxacin	C₁₂H₁₀N₂O₅	Delayed	Severe delayed
Clofibrate	C₁₂H₁₅ClO₃	Non-effect	Severe delayed
Clopidogrel	C₁₆H₁₆ClNO₂S	Non-effect	Delayed
Clorgyline hydrochloride	C₁₃H₁₆Cl₃NO	Delayed	Delayed
Colchicine	C₂₂H₂₅NO₆	Non-effect	Delayed
Deptropine citrate	C₂₉H₃₅NO₈	Delayed	Delayed
Desipramine hydrochloride	C₁₈H₂₃ClN₂	Delayed	Delayed
Diclofenac sodium	C₁₄H₁₀Cl₂NNaO₂	Delayed	Severe delayed
Dicumarol	C₁₉H₁₂O₆	Delayed	Severe delayed
Diethylstilbestrol	C₁₈H₂₀O₂	Delayed	Toxic lethal
Dimaprit dihydrochloride	C₆H₁₇Cl₂N₃S	Slightly delayed	Delayed
Disulfiram	C₁₀H₂₀N₂S₄	Delayed	Delayed
Dopamine hydrochloride	C₈H₁₂ClNO₂	Delayed	Delayed
Eburnamonine (-)	C₁₉H₂₂N₂O	Delayed	Delayed
Ethaverine hydrochloride	C₂₄H₃₀ClNO₄	Delayed	Delayed
Ethinylestradiol	C₂₀H₂₄O₂	Delayed	Severe delayed
Ethopropazine hydrochloride	C₁₉H₂₅ClN₂S	Delayed	Delayed
Ethoxyquin	C₁₄H₁₉NO	Non-effect	Delayed
Exemestane	C₂₀H₂₄O₂	Slightly delayed	Delayed
Ezetimibe	C₂₄H₂₁F₂NO₃	Slightly delayed	Delayed
Fenbendazole	C₁₅H₁₃N₃O₂S	Non-effect	Delayed
Fenoprofen calcium salt dihydrate	C₃₀H₃₀CaO₈	Slightly delayed	Delayed
Fentiazac	C₁₇H₁₂ClNO₂S	Toxic lethal	Toxic lethal
Floxuridine	C₉H₁₁FN₂O₅	Delayed	Toxic lethal
Flunixin meglumine	C₂₁H₂₈F₃N₃O₇	Delayed	Toxic lethal
Flutamide	C₁₁H₁₁F₃N₂O₃	Delayed	Toxic lethal
Fluticasone propionate	C₂₅H₃₁F₃O₅S	Non-effect	Delayed
Furosemide	C₁₂H₁₁ClN₂O₅S	Delayed	Delayed
Gatifloxacin	C₁₉H₂₂FN₃O₄	Delayed	Delayed
Gemcitabine	C₉H₁₁F₂N₃O₄	Delayed	Delayed
Gemfibrozil	C₁₅H₂₂O₃	Delayed	Toxic lethal
Gestrinone	C₂₁H₂₄O₂	Delayed	Delayed
Haloprogin	C₉H₄Cl₃IO	Delayed	Toxic lethal
Hexachlorophene	C₁₃H₆Cl₆O₂	Delayed	Severe delayed
Hexestrol	C₁₈H₂₂O₂	Slightly delayed	Delayed
Ibudilast	C₁₄H₁₈N₂O	Non-effect	Delayed
Idazoxan hydrochloride	C₁₁H₁₃ClN₂O₂	Slightly delayed	Delayed
Idazoxan hydrochloride	C₁₁H₁₃ClN₂O₂	Non-effect	Delayed
Idebenone	C₁₉H₃₀O₅	Severe delayed	Toxic lethal
Indomethacin	C₁₉H₁₆ClNO₄	Non-effect	Delayed
Ipriflavone	C₁₈H₁₆O₃	Delayed	Severe delayed
Isotretinoin	C₂₀H₂₈O₂	Non-effect	Severe delayed
Isradipine	C₁₉H₂₁N₃O₅	Non-effect	Delayed
Lansoprazole	C₁₆H₁₄F₃N₃O₂S	Slightly delayed	Delayed
Latanoprost	C₂₆H₄₀O₅	Non-effect	Delayed
Leflunomide	C₁₂H₉F₃N₂O₂	Delayed	Severe delayed
Letrozole	C₁₇H₁₁N₅	Non-effect	Delayed
Lithocholic acid	C₂₄H₄₀O₃	Non-effect	Delayed
Lodoxamide	C₁₁H₆ClN₃O₆	Non-effect	Delayed
Lofepramine	C₂₆H₂₇ClN₂O	Non-effect	Delayed
Loratadine	C₂₂H₂₃ClN₂O₂	Delayed	Delayed
Loxapine succinate	C₂₂H₂₄ClN₃O₅	Delayed	Delayed
Mebendazole	C₁₆H₁₃N₃O₃	Severe delayed	Severe delayed
Mebendazole	C₂₂H₂₆N₂O₂	Non-effect	Delayed
Meloxicam	C₁₄H₁₃N₃O₄S₂	Delayed	Toxic lethal
Methiazole	C₁₂H₁₅N₃O₂S	Delayed	Delayed
Mevastatin	C₂₃H₃₄O₅	Non-effect	Delayed
MK 801 hydrogen maleate	C₂₀H₁₉NO₄	Slightly delayed	Delayed
Nabumetone	C₁₅H₁₆O₂	Non-effect	Severe delayed
Naftopidil dihydrochloride	C₂₄H₃₀Cl₂N₂O₃	Slightly delayed	Delayed
Nandrolone	C₁₈H₂₆O₂	Delayed	Delayed
Naproxen sodium salt	C₁₄H₁₃NaO₃	Delayed	Delayed
Niclosamide	C₁₃H₈Cl₂N₂O₄	Delayed	Delayed
Nifekalant	C₁₉H₂₇N₅O₅	Delayed	Delayed
Niflumic acid	C₁₃H₉F₃N₂O₂	Delayed	Delayed
Nimesulide	C₁₃H₁₂N₂O₅S	Non-effect	Delayed
Nisoldipine	C₂₀H₂₄N₂O₆	Delayed	Toxic lethal
Nitazoxanide	C₁₂H₉N₃O₅S	Severe delayed	Severe delayed
Norethindrone	C₂₀H₂₆O₂	Non-effect	Delayed
Norgestimate	C₂₃H₃₁NO₃	Slightly delayed	Delayed
Oxfendazol	C₁₅H₁₃N₃O₃S	Slightly delayed	Delayed
Oxibendazol	C₁₂H₁₅N₃O₃	Severe delayed	Severe delayed
Oxymetholone	C₂₁H₃₂O₃	Slightly delayed	Delayed
Parbendazole	C₁₃H₁₇N₃O₂	Severe delayed	Severe delayed
Parthenolide	C₁₅H₂₀O₃	Non-effect	Delayed
Penciclovir	C₁₀H₁₅N₅O₃	Non-effect	Delayed
Pentobarbital	C₁₁H₁₈N₂O₃	Non-effect	Delayed
Phenazopyridine hydrochloride	C₁₁H₁₂ClN₅	Delayed	Toxic lethal
Phenothiazine	C₁₂H₉NS	Non-effect	Delayed
Phenoxybenzamine hydrochloride	C₁₈H₂₃Cl₂NO	Non-effect	Delayed
Pizotifen malate	C₂₃H₂₇NO₅S	Delayed	Severe delayed
Pramoxine hydrochloride	C₁₇H₂₈ClNO₃	Slightly delayed	Delayed
Prilocaine hydrochloride	C₁₃H₂₁ClN₂O	Non-effect	Delayed
Primidone	C₁₂H₁₄N₂O₂	Slightly delayed	Delayed
Racecadotril	C₂₁H₂₃NO₄S	Slightly delayed	Delayed
Riluzole hydrochloride	C₈H₆ClF₃N₂OS	Non-effect	Delayed
Ritonavir	C₃₇H₄₈N₆O₅S₂	Non-effect	Severe delayed
S(-)Eticlopride hydrochloride	C₁₇H₂₆Cl₂N₂O₃	Delayed	Delayed
Salmeterol	C₂₅H₃₇NO₄	Non-effect	Delayed
Streptomycin sulfate	C₄₂H₈₄N₁₄O₃₆S₃	Non-effect	Delayed
Sulconazole nitrate	C₁₈H₁₆C_l3N₃O₃S	Delayed	Delayed
Tegafur	C₈H₉FN₂O₃	Delayed	Delayed
Telmisartan	C₃₃H₃₀N₄O₂	Severe delayed	Toxic lethal
Tenatoprazole	C₁₆H₁₈N₄O₃S	Non-effect	Delayed
Terbinafine	C₂₁H₂₅N	Non-effect	Delayed
Thimerosal	C₉H₉HgNaO₂S	Non-effect	Delayed
Thiorphan	C₁₂H₁₅NO₃S	Delayed	Delayed
Tolcapone	C₁₄H₁₁NO₅	Severe delayed	Severe delayed
Topotecan	C₂₃H₂₃N₃O₅	Delayed	Delayed
Tracazolate hydrochloride	C₁₆H₂₅ClN₄O₂	Severe delayed	Delayed
Tribenoside	C₂₉H₃₄O₆	Delayed	Delayed
Triclabendazole	C₁₄H₉Cl₃N₂OS	Delayed	Delayed
Triclosan	C₁₂H₇Cl₃O₂	Delayed	Severe delayed
Trioxsalen	C₁₄H₁₂O₃	Delayed	Delayed
Troglitazone	C₂₄H₂₇NO₅S	Severe delayed	Toxic lethal
Valproic acid	C₈H₁₆O₂	Non-effect	Delayed
Voriconazole	C₁₆H₁₄F₃N₅O	Non-effect	Delayed
Zardaverine	C₁₂H₁₀F₂N₂O₃	Slightly delayed	Delayed
Zuclopenthixol dihydrochloride	C₂₂H₂₇Cl₃N₂OS	Delayed	Delayed

Identified drugs suppressed cell motility and invasion of human cancer cells

It has been reported that zebrafish have orthologues to 86% of 1318 human drug targets (Gunnarsson et al., 2008). However, it was not known whether the epiboly-interrupting drugs could suppress metastatic dissemination of human cancer cells. To test this, we subjected the 78 epiboly-interrupting drugs that showed a suppressor effect on epiboly progression at a 10 μM concentration to in vitro experiments using a human cancer cell line. The experiments examined whether the drugs could suppress cell motility and invasion of MDA-MB-231 cells through a Boyden chamber. Before conducting the experiment, we investigated whether these drugs might affect viability of MDA-MB-231 cells using an MTT assay. Out of the 78 drugs, 16 of them strongly affected cell viability at concentrations less than 1 μM and were not used in the cell motility experiments. The remaining 62 drugs were assayed in Boyden chamber motility experiments. Out of the 62 drugs, 20 of the drugs inhibited cell motility and invasion of MDA-MB-231 cells without affecting cell viability. Among the 20 drugs, hexachlorophene and nitazoxanide were removed since the primary targets of the drugs, D-lactate dehydrogenase and pyruvate ferredoxin oxidoreductase, are not expressed in mammalian cells. With the exception of ipriflavone, whose target is still unclear, the known primary targets of the remaining 17 drugs are reported to be expressed by mammalian cells (Figure 2A and Table 3).

Figure 2 with 2 supplements see all

Download asset Open asset

Pizotifen, one of epiboly-interrupting drugs, suppressed metastatic dissemination of human cancer cells lines in vivo and vitro.

(A) Effect of the epiboly-interrupting drugs on cell motility and invasion of MBA-MB-231 cells. MBA-MB-231 cells were treated with vehicle or each of the epiboly-interrupting drugs and then subjected to Boyden chamber assays. Fetal bovine serum (1% v/v) was used as the chemoattractant in both assays. Each experiment was performed at least twice. (B) Western blot analysis of HTR2C levels (top) in a non-metastatic human cancer cell line, MCF7 (breast) and highly metastatic human cancer cell lines, MDA-MB-231 (breast), MDA-MB-435 (melanoma), PC9 (lung), MIA-PaCa2 (pancreas), PC3 (prostate), and SW620 (colon); GAPDH loading control is shown (bottom). (C) Effect of pizotifen on cell motility and invasion of MBA-MB-231, MDA-MB-435, and PC9 cells. Either vehicle or pizotifen treated the cells were subjected to Boyden chamber assays. Fetal bovine serum (1% v/v) was used as the chemoattractant in both assays. Each experiment was performed at least twice. (D) and (E) Representative images of dissemination of 231R, shLacZ 231R or shHTR2C 231R cells in zebrafish xenotransplantation model. The fish larvae that were inoculated with 231R cells were treated with either vehicle (top left) or the drug (lower left) (D). The fish larvae that were inoculated with either shLacZ 231R or shHTR2C 231R cells (lower left) (E). White arrows head indicate disseminated 231R cells. The images were shown in 4× magnification. Scale bar, 100 µm. The mean frequencies of the fish showing head, trunk, or end-tail dissemination were counted (graph on right). Each value is indicated as the mean ± SEM of two independent experiments. Statistical analysis was determined by Student’s t test.

Table 3

Primary targets of the identified drugs.

The identified drugs	Primary targets of the identified drugs
Hexachlorophene	D-Lactate dehydrogenase (D-LDH), not expressed in mammalian cells
Troglitazone	Agonist for peroxisome proliferator-activated receptor α and γ (PPARα and -γ)
Pizotifen malate	5-Hydroxytryptamine receptor 2C (HTR2C)
Salmeterol	Adrenergic receptor beta 2 (ADRB2)
Nitazoxanide	Pyruvate ferredoxin oxidoreductase (PFOR), not expressed in mammalian cells
Valproic acid	Histone deacetylases (HDACs)
Dicumarol	NAD(P)H dehydrogenase quinone 1 (NQO1)
Loxapine succinate	Dopamine receptor D2 and D4 (DRD2 and DRD4)
Adrenosterone	Hydroxysteroid (11-beta) dehydrogenase 1 (HSD11β1)
Riluzole hydrochloride	Glutamate R andvoltage-dependent Na+ channel
Naftopidil dihydrochloride	5-Hydroxytryptamine receptor 1A (HTR1A) andα1-adrenergic receptor (AR)
S(-)Eticlopride hydrochloride	Dopamine receptor D2 (DRD2)
Racecadotril	Membrane metallo-endopeptidase (MME)
Ipriflavone	Unknown
Flurbiprofen	Cyclooxygenase 1 and 2 (Cox1 and -2)
Zardaverine	Phosphodiesterase III/IV (PDE3/4)
Leflunomide	Dihydroorotate dehydrogenase (DHODH)
Olmesartan	Angiotensin II receptor alpha
Disulfiram	Aldehyde dehydrogenase (ALDH)Dopamine β-hydroxylase (DBH)
Zuclopenthixol dihydrochloride	Dopamine receptors D1 and D2 (DRD1 and -2)

We confirmed that highly metastatic human cancer cell lines expressed target genes through western blotting analyses. Among the genes, serotonin receptor 2C (HTR2C), which is a primary target of pizotifen, was highly expressed in only metastatic cell lines (Figure 2B and Figure 2—figure supplement 2A). Clinical data also shows that that HTR2C expression is correlated with tumor stage of breast cancer patients and is higher in metastatic and Her2/neu-overexpressing tumors (Pai et al., 2009). Pizotifen suppressed cell motility and invasion of several highly metastatic human cancer cell lines in a dose-dependent manner (Figure 2C). Similarly, dopamine receptor D2 (DRD2), which is a primary target of S(-)eticlopride hydrochloride, was highly expressed in only metastatic cell lines, and the drug suppressed cell motility and invasion of these cells in a dose-dependent manner (Figure 2—figure supplement 2A-C).

These results indicate that a number of the epiboly-interrupting drugs also have suppressor effects on cell motility and invasion of highly metastatic human cancer cells.

Pizotifen suppressed metastatic dissemination of human cancer cells in a zebrafish xenotransplantation model

While a number of the epiboly-interrupting drugs suppressed cell motility and invasion of human cell lines in vitro, it was still unclear whether the drugs could suppress metastatic dissemination of cancer cells in vivo. Therefore, we examined whether the identified drugs could suppress metastatic dissemination of these human cancer cells in a zebrafish xenotransplantation model. Pizotifen was selected to test since HTR2C was overexpressed only in highly metastatic cell lines supporting the hypothesis that it could be a novel target for blocking metastatic dissemination of cancer cells (Figure 2B). Red fluorescent protein (RFP)-labelled MDA-MB-231 (231R) cells were injected into the duct of Cuvier of Tg (kdrl:eGFP) zebrafish at 2 dpf and then maintained in the presence of either vehicle or pizotifen. Twenty-four hours post injection, the numbers of fish showing metastatic dissemination of 231R cells were measured via fluorescence microscopy. In this model, the dissemination patterns were generally divided into three categories: (i) head dissemination, in which disseminated 231R cells exist in the vessel of the head part; (ii) trunk dissemination, in which the cells were observed in the vessel dilating from the trunk to the tail; (iii) end-tail dissemination, in which the cells were observed in the vessel of the end-tail part (Nakayama et al., 2020).

Three independent experiments revealed that the frequencies of fish in the drug-treated group showing head, trunk, or end-tail dissemination significantly decreased to 55.3% ± 7.5%, 28.5 ± 5.0%, or 43.5% ± 19.1% when compared with those in the vehicle-treated group; 95.8% ± 5.8%, 47.1 ± 7.7%, or 82.6% ± 12.7%. Conversely, the frequency of the fish in the drug-treated group not showing any dissemination significantly increased to 45.4% ± 0.5% when compared with those in the vehicle-treated group; 2.0% ± 2.9% (Figure 2D, Figure 2—figure supplement 2 and Table 4).

Table 4

Effects of pharmacological inhibition of HTR2C on metastatic dissemination of MDA-MB-231 cells in zebrafish xenografted models.

Related to Figure 2D. The numbers and frequencies of the fish showing the dissemination patterns in vehicle- or pizotifen-treated group were indicated. The fish showed both patterns of dissemination were redundantly counted in this analysis.

		Experiment_#1	Experiment_#2	Experiment_#3	Average of experiments
Drug: VehicleCell: MDA-MB-231	Non-dissemination	0% n1 = 0/17	0% n2 = 0/12	6.66% n3 = 1/15	2.22% ± 3.84%
	Head	58.82% n1 = 10/17	91.66% n2 = 11/12	6.66% n3 = 1/15	72.38% ± 17.15%
	Trunk	52.94% n1 = 9/17	8.33% n2 = 1/12	20% n3 = 2/15	27.09% ± 23.13%
	End-tail	100% n1 = 17/17	100% n2 = 12/12	86.66% n3 = 13/15	95.55% ± 7.69%
Drug: PizotifenCell: MDA-MB-231	Non-dissemination	55% n1 = 11/20	31.57% n2 = 6/19	45.45 % n3 = 10/22	44.01% ± 11.77%
	Head	5% n1 = 1/20	31.57% n2 = 6/19	18.18% n3 = 4/22	18.25% ± 13.28%
	Trunk	5% n1 = 1/20	10.52% n2 = 2/19	4.45% n3 = 1/22	6.69% ± 3.32%
	End-tail	45% n1 = 9/20	57.89% n2 = 11/19	50% n3 = 11/22	50.96% ± 6.50%

Similar effects were observed in another xenograft experiments using an RFP-labelled human pancreatic cancer cell line, MIA-PaCa-2 (MP2R). In the drug-treated group, the frequencies of the fish showing head, trunk, or end-tail dissemination significantly decreased to 15.3% ± 6.7%, 6.2% ± 1.3%, or 41.1% ± 1.5%; conversely, the frequency of the fish not showing any dissemination significantly increased to 46.3% ± 8.9% when compared with those in the vehicle-treated group; 74.5% ± 11.1%, 18.9% ± 14.9%, 77.0% ± 9.0%, or 17.2% ± 0.7% (Figure 2—figure supplement 2A and Table 5).

Table 5

Effects of pharmacological inhibition of HTR2C on metastatic dissemination of Mia-PaCa2 cells in zebrafish xenografted models.

Related to Figure 4. The numbers and frequencies of the fish showing the dissemination patterns in vehicle- or pizotifen-treated group were indicated. The fish showed both patterns of dissemination were redundantly counted in this analysis.

		Experiment_#1	Experiment_#2	Average of experiments
Drug: VehicleCell: MIA-PaCa2	Non-dissemination	17.64% n1 = 3/17	16.66% n2 = 2/12	17.15% + 0.69%
	Head	82.35% n1 = 14/17	66.66% n2 = 8/12	74.50% + 11.09%
	Trunk	29.41% n1 = 5/17	8.33% n2 = 1/12	18.87% + 14.90%
	End-tail	70.58% n1 = 12/17	83.33% n2 = 10/17	76.96% + 9.01
Drug: PizotifenCell: MIA-PaCa2	Non-dissemination	40% n1 = 4/10	52.63% n2 = 10/19	46.31% + 8.93%
	Head	20% n1 = 2/10	10.52% n2 = 2/19	15.26% + 6.69%
	Trunk	10% n1 = 1/10	5.26% n2 = 1/19	7.63% + 3.34%
	End-tail	40% n1 = 4/10	42.05% n2 = 8/19	41.4% + 1.48%

To eliminate the possibility that the metastasis suppressing effects of pizotifen might result from off-target effects of the drug, we conducted validation experiments to determine whether knockdown of HTR2C would show the same effects. Sub-clones of 231R cells that expressed short hairpin RNA (shRNA) targeting either LacZ or HTR2C were injected into the fish at 2 dpf and the fish were maintained in the absence of drug. In the fish that were inoculated with shHTR2C 231R cells, the frequencies of the fish showing head, trunk, and end-tail dissemination significantly decreased to 6.7% ± 4.9%, 6.7% ± 0.7%, or 20.0% ± 16.5%; conversely, the frequency of the fish not showing any dissemination significantly increased to 80.0% ± 4.4% when compared with those that were inoculated with shLacZ 231R cells; 80.0% ± 27.1%, 20.0% ± 4.5%, 90.0% ± 7.7%, or 0% (Figure 2E and Table 6).

Table 6

Effects of genetic inhibition of HTR2C on metastatic dissemination of MDA-MB-231 cells in zebrafish xenografted models.

Related to Figure 2E. The numbers and frequencies of the fish showing the dissemination patterns in the zebrafish that were inoculated with either shLacZ or shHTR2C MDA-MB-231 cells were indicated. The fish showed both patterns of dissemination were redundantly counted in this analysis.

		Experiment_#1	Experiment_#2	Average of experiments
shLacZ	Non-dissemination	0% n1 = 0/10	0% n2 = 0/10	0%
	Head	60% n1 = 6/10	100% n2 = 10/10	80%± 28.28%
	Trunk	30% n1 = 3/10	10% n2 = 1/10	20% ± 14.14%
	End-tail	80% n1 = 8/10	100% n2 = 10/10	90% ± 14.14
shHTR2C	Non-dissemination	80% n1 = 12/15	76.84% n2 = 14/19	76.84 ± 4.46%
	Head	6.66% n1 = 1/15	15.78% n2 = 3/19	11.22% ± 6.45%
	Trunk	6.66% n1 = 1/15	5.26% n2 = 1/19	5.96% ± 0.99%
	End-tail	20% n1 = 3/15	26.31% n2 = 5/19	23.15% ± 4.46%

These results indicate that pharmacological and genetic inhibition of HTR2C suppressed metastatic dissemination of human cancer cells in vivo.

Pizotifen suppressed metastasis progression of a mouse model of metastasis

We examined the metastasis-suppressor effect of pizotifen in a mouse model of metastasis (Tao et al., 2008). Luciferase-expressing 4T1 murine mammary carcinoma cells were inoculated into the mammary fat pads (MFP) of female BALB/c mice. On day 2 post inoculation, the mice were randomly assigned to two groups and one group received once daily intraperitoneal injections of 10 mg/kg pizotifen while the other group received a vehicle injection. Bioluminescence imaging and tumor measurement revealed that the sizes of the primary tumors in pizotifen-treated mice were equal to those in the vehicle-treated mice on day 10 post inoculation. The primary tumors were resected after the analyses. Immunofluorescence (IF) staining also demonstrated that the percentage of Ki67-positive cells in the resected primary tumors of pizotifen-treated mice were the same as those of vehicle-treated mice (Figure 3A–C), additionally, both groups showed less than 1% cleaved caspase 3 positive cells (Figure 3—figure supplement 1). Therefore, no anti-tumor effect of pizotifen was observed on the primary tumor. After 70 days from inoculation, bioluminescence imaging detected light emitted in the lungs, livers, and lymph nodes of vehicle-treated mice but not those of pizotifen-treated mice (Figure 3C). Vehicle-treated mice formed 5–50 metastatic nodules per lung in all 10 mice analyzed; conversely, pizotifen-treated mice (n = 10) formed 0–5 nodules per lung in all 10 mice analyzed (Figure 3D). Histological analyses confirmed that metastatic lesions in the lungs were detected in all vehicle-treated mice; conversely, they were detected in only 2 of 10 pizotifen-treated mice and the rest of the mice showed metastatic colony formations around the bronchiole of the lung. In addition, 4 of 10 vehicle-treated mice exhibited metastasis in the liver and the rest showed metastatic colony formation around the portal tract of the liver. In contrast, none of 10 pizotifen-treated mice showed liver metastases and only half of the 10 mice showed metastatic colony formation around the portal tract (Figure 3E). These results indicate that pizotifen can suppress metastasis progression without affecting primary tumor growth.

Figure 3 with 1 supplement see all

Download asset Open asset

Pizotifen suppressed metastatic progression in a mouse model of metastasis.

(A) Mean volumes (n = 10 per group) of 4T1 primary tumors formed in the mammary fat pad of either vehicle- or pizotifen-treated mice at day 10 post injection. (B) Ki67 expression level in 4T1 primary tumors formed in the mammary fat pad of either vehicle- or pizotifen-treated mice at day 10 post injection. The mean expression levels of Ki67 (n = 10 mice per group) were determined and were calculated as the mean ration of Ki67-positive cells to 4’,6-diamidino-2-phenylindole (DAPI) area. (C) Representative images of primary tumors on day 10 post injection (top panels) and metastatic burden on day 70 post injection (bottom panels) taken using an IVIS Imaging System. (D) Representative images of the lungs from either vehicle- (top) or pizotifen-treated mice (bottom) at 70 days post tumor inoculation. Number of metastatic nodules in the lung of either vehicle- or pizotifen-treated mice (right). (E) Representative hematoxylin and eosin (H&E) staining of the lung (top) and liver (bottom) from either vehicle- or pizotifen-treated mice. Black arrow heads indicate metastatic 4T1 cells. (F) The mean number of metastatic lesions in step sections of the lungs from the mice that were inoculated with 4T1-12B cells expressing short hairpin RNA (shRNA) targeting for either LacZ or HTR2C. (G) Representative H&E staining of the lung and liver from the mice that were inoculated with 4T1-12B cells expressing shRNA targeting for either LacZ or HTR2C. Black arrow heads indicate metastatic 4T1 cells. Each value is indicated as the mean ± SEM. Statistical analysis was determined by Student’s t test.

To eliminate the possibility that the metastasis suppressing effects of pizotifen might result from off-target effects, we conducted validation experiments to determine whether knockdown of HTR2C would show the same effects. The basic experimental process followed the experimental design described above except that sub-clones of 4T1 cells that expressed shRNA targeting either LacZ or HTR2C were injected into the MFP of female BALB/c mice and the mice were maintained without drug. Histological analyses revealed that all of the mice (n = 5) that were inoculated with 4T1 cells expressing shRNA targeting LacZ showed metastases in the lungs. The mean number of metastatic lesions in a lung was 26.4 ± 7.8. In contrast, only one of the mice (n = 5) were inoculated with 4T1 cells expressing shRNA targeting HTR2C showed metastases in the lungs and the rest of the mice showed metastatic colony formation around the bronchiole of the lung. The mean number of metastatic lesions in the lung significantly decreased to 10% of those of mice that were inoculated with 4T1 cells expressing shRNA targeting LacZ (Figure 3F–H).

Taken together, pharmacological and genetic inhibition of HTR2C showed an anti-metastatic effect in the 4T1 model system.

HTR2C promoted EMT-mediated metastatic dissemination of human cancer cells

Although pharmacological and genetic inhibition of HTR2C inhibited metastasis progression, a role for HTR2C on metastatic progression has not been reported. Therefore, we examined whether HTR2C could confer metastatic properties on poorly metastatic cells.

First, we established a stable sub-clone of MCF7 human breast cancer cells expressing either vector control or HTR2C. Vector control expressing MCF7 cells maintained highly organized cell-cell adhesion and cell polarity; however, HTR2C-expressing MCF7 cells led to loss of cell-cell contact and cell scattering. The cobblestone-like appearance of these cells was replaced by a spindle-like, fibroblastic morphology. Western blotting and IF analyses revealed that HTR2C-expressing MCF7 cells showed loss of E-cadherin and EpCAM, and elevated expressions of N-cadherin, vimentin, and an EMT-inducible transcriptional factor ZEB1. Similar effects were validated through another experiment using an immortal keratinocyte cell line, HaCaT cells, in that HTR2C-expressing HaCaT cells also showed loss of cell-cell contact and cell scattering with loss of epithelial markers and gain of mesenchymal markers (Figure 4A–C and Figure 4—figure supplement 1A). Therefore, both the morphological and molecular changes in the HTR2C-expressing MCF7 and HaCaT cells demonstrated that these cells had undergone an EMT.

Figure 4 with 1 supplement see all

Download asset Open asset

HTR2C induced epithelial-to-mesenchymal transition (EMT)-mediated metastatic dissemination of human cancer cells.

(A) The morphologies of the MCF7 and HaCaT cells expressing either the control vector or HTR2C were revealed by phase contrast microscopy. (B) Immunofluorescence staining of E-cadherin, EpCAM, vimentin, and N-cadherin expressions in the MCF7 cells from A. (C) Expression of E-cadherin, EpCAM, vimentin, N-cadherin, and HTR2C was examined by western blotting in the MCF7 and HaCaT cells; GAPDH loading control is shown (bottom). (D) Effect of HTR2C on cell motility and invasion of MCF7 cells. MCF7 cells were subjected to Boyden chamber assays. Fetal bovine serum (1% v/v) was used as the chemoattractant in both assays. Each experiment was performed at least twice. (E) Representative images of dissemination patterns of MCF7 cells expressing either the control vector (top left) or HTR2C (lower left) in a zebrafish xenotransplantation model. White arrow heads indicate disseminated MCF7 cells. The mean frequencies of the fish showing head, trunk, or end-tail dissemination tabulated (right). Each value is indicated as the mean ± SEM of two independent experiments. Statistical analysis was determined by Student’s t test.

Next, we examined whether HTR2C-driven EMT could promote metastatic dissemination of human cancer cells. Boyden chamber assay revealed that HTR2C expressing MCF7 cells showed an increased cell motility and invasion compared with vector control-expressing MCF7 cells in vitro (Figure 4D). Moreover, we conducted in vivo examination of whether HTR2C expression could promote metastatic dissemination of human cancer cells in a zebrafish xenotransplantation model. RFP-labelled MCF7 cells expressing either vector control or HTR2C were injected into the duct of Cuvier of Tg (kdrl:eGFP) zebrafish at 2 dpf. Twenty-four hours post injection, the frequencies of the fish showing metastatic dissemination of the inoculated cells were measured using fluorescence microscopy. In the fish that were inoculated with HTR2C expressing MCF7 cells, the frequencies of the fish showing head, trunk, and end-tail dissemination significantly increased to 96.7% ± 4.7%, 68.8% ± 6.4%, or 89.5% ± 3.4%; conversely, the frequency of the fish not showing any dissemination decreased to 0% when compared with those in the fish that were inoculated with vector control expressing MCF7 cells; 33.1% ± 18.5%, 0%, 56.9% ± 4.4%, or 43% (Figure 4E, Figure 4—figure supplement 1B and Table 7).

Table 7

Effects of HTR2C overexpression on metastatic dissemination of MCF7 cells in zebrafish xenografted models.

Related to Figure 4E. The numbers and frequencies of the fish showing the dissemination patterns in the zebrafish that were inoculated with MCF7 cells expressing either vector control (VC) or HTR2C were indicated. The fish showed both patterns of dissemination were redundantly counted in this analysis.

		Experiment_#1	Experiment_#2	Average of experiments
VC	Non-dissemination	46.15% n1 = 6/13	40% n2 = 4/10	43.07% ± 4.35%
	Head	46.15% n1 = 6/13	20% n2 = 2/10	33.07% ± 18.49%
	Trunk	0% n1 = 0/13	0% n2 = 0/10	0%
	End-tail	53.84% n1 = 7/13	60% n2 = 6/10	56.92% ± 4.35%
HTR2C	Non-dissemination	0% n1 = 0/14	0% n2 = 0/15	0%
	Head	100% n1 = 14/14	93.33% n2 = 14/15	96.66% ± 4.71%
	Trunk	64.28% n1 = 9/14	73.33% n2 = 11/15	68.80% ± 6.39%
	End-tail	85.71% n1 = 12/14	93.33% n2 = 14/15	89.52% ± 5.38%

These results indicated that HTR2C promoted metastatic dissemination of cancer cells through induction of EMT, and suggest that the screen can easily be converted to a chemical genetic screening platform.

Pizotifen induced mesenchymal-to-epithelial transition through inhibition of Wnt signaling

Finally, we elucidated the mechanism of action of how pizotifen suppressed metastasis, especially metastatic dissemination of cancer cells. Our results showed that HTR2C induced EMT and that pharmacological and genetic inhibition of HTR2C suppressed metastatic dissemination of MDA-MB-231 cells that had already transitioned to mesenchymal-like traits via EMT. Therefore, we speculated that blocking HTR2C with pizotifen might inhibit the molecular mechanisms which follow EMT induction. We first investigated the expressions of epithelial and mesenchymal markers in pizotifen-treated MDA-MB-231 cells since the activation of an EMT program needs to be transient and reversible, and transition from a fully mesenchymal phenotype to a epithelial-mesenchymal hybrid state or a fully epithelial phenotype is associated with malignant phenotypes (Kröger et al., 2019). IF and FACS analyses revealed 20% of pizotifen-treated MDA-MB-231 cells restored E-cadherin expression. Also, western blotting analysis demonstrated that 4T1 primary tumors from pizotifen-treated mice has elevated E-cadherin expression compared with tumors from vehicle-treated mice (Figure 5A–C and Figure 5—figure supplement 1). However, mesenchymal markers did not change between vehicle and pizotifen-treated MDA-MB-231 cells (data not shown). We further analyzed E-cadherin-positive (E-cad⁺) cells in pizotifen-treated MDA-MB-231 cells. The E-cad⁺ cells showed elevated expressions of epithelial markers KRT14 and KRT19; and decreased expression of mesenchymal makers vimentin, MMP1, MMP3, and S100A4. Recent research reports that an EMT program needs to be transient and reversible and that a mesenchymal phenotype in cancer cells is achieved by constitutive ectopic expression of ZEB1. In accordance with the research, the E-cad⁺ cells and 4T1 primary tumors from pizotifen-treated mice had decreased ZEB1 expression compared with vehicle-treated cells and tumors from vehicle-treated mice (Figure 5D and Figure 5—figure supplement 2). In contrast, HTR2C-expressing MCF7 and HuMEC cells expressed ZEB1 but not vehicle control MCF7 and HuMEC cells (Figure 4C and Figure 5—figure supplement 3). HTR2C-expressing MCF7 cells expressed not only ZEB1 but also Twist1 and Snail. In contrast, pizotifen-treated MDA-MB-231 cells showed decreased expression of ZEB1 and Twist1 compared with that in vehicle-treated cells. Furthermore, in the primary tumors of pizotifen-treated mice, only ZEB1 expression was decreased compared with those of vehicle-treated mice. These results indicate that HTR2C-mediated signaling induced EMT through up-regulation of ZEB1 and blocking HTR2C with pizotifen induced mesenchymal-to-epithelial transition through down-regulation of ZEB1 (Figure 5—figure supplement 4).

Figure 5 with 5 supplements see all

Download asset Open asset

Pizotifen restored mesenchymal-like traits of MDA-MB-231 cells into epithelial traits through blocking nuclear accumulation of β-catenin.

(A) Immunofluorescence (IF) staining of E-cadherin in either vehicle- or pizotifen-treated MDA-MB-231 cells. (B) Surface expression of E-cadherin in either vehicle (black)- or pizotifen (red)-treated MDA-MB-231 cells by FACS analysis. Non-stained controls are shown in gray. (C) Protein expressions levels of E-cadherin, ZEB1, and β-catenin in the cytoplasm and nucleus of 4T1 primary tumors from either vehicle- or pizotifen-treated mice are shown; Luciferase, histone H3, and β-tubulin are used as loading control for whole cell, nuclear, or cytoplasmic lysate, respectively. (D) Protein expression levels of epithelial and mesenchymal markers and ZEB1 in either vehicle- or pizotifen-treated MDA-MB-231 cells or E-cadherin-positive (E-cad⁺) cells in pizotifen-treated MDA-MB-231 cells are shown. (E) IF staining of β-catenin in the MCF7 cells expressing either vector control (top left, bottom left) or HTR2C (top right, bottom right). (F) Expressions of β-catenin in the cytoplasm and nucleus of MCF7 cells. (G) IF staining of β-catenin in either vehicle (top left, bottom left) or pizotifen-treated MDA-MB-231 cells (top right, bottom right). (H) Expressions of β-catenin in the cytoplasm and nucleus of MDA-MB-231 cells and the E-cad⁺ cells.

We further investigated the mechanism of action of how blocking HTR2C with pizotifen induced down-regulation of ZEB1. In embryogenesis, serotonin-mediated signaling is required for Wnt-dependent specification of the superficial mesoderm during gastrulation (Beyer et al., 2012). Wnt signaling plays critical role in inducing EMT. In cancer cells, overexpression of HTR1D is associated with Wnt signaling (Sui et al., 2015; Zhan et al., 2017). This evidence led to a hypothesis that HTR2C-mediated signaling might turn on transcriptional activity of β-catenin and that might induce up-regulation of EMT-TFs. IF analyses revealed β-catenin was accumulated in the nucleus of HTR2C-expressing MCF7 cells but it was located in the cytoplasm of vector control-expressing cells (Figure 5E). Nuclear accumulation of β-catenin in HTR2C-expressing MCF7 cells was confirmed by western blot (Figure 5F and Figure 5—figure supplement 2). In contrast, pizotifen-treated MDA-MB-231 cells showed β-catenin located in the cytoplasm of the cells. Vehicle-treated cells showed that β-catenin accumulated in the nucleus of the cells. (Figure 5G), and western blotting analysis confirmed that it was located in the cytoplasm of pizotifen-treated MDA-MB-231 cells (Figure 5H and Figure 5—figure supplement 5). Furthermore, immunohistochemistry and western blotting analyses showed that β-catenin accumulated in the nucleus, and phospho-GSKβ and ZEB1 expression were decreased in 4T1 primary tumors from pizotifen-treated mice compared with vehicle-treated mice (Figure 5C and Figure 5—figure supplement 1). These results indicated that HTR2C would regulate transcriptional activity of β-catenin and pizotifen could inhibit it.

Taken together, we conclude that blocking HTR2C with pizotifen restored epithelial properties to metastatic cells (MDA-MB-231 and 4T1 cells) through a decrease of transcriptional activity of β-catenin and that suppressed metastatic progression of the cells.

Discussion

Reducing or eliminating mortality associated with metastatic disease is a key goal of medical oncology, but few models exist that allow for rapid, effective screening of novel compounds that target the metastatic dissemination of cancer cells. Based on accumulated evidence that at least 50 genes play an essential role in governing both metastasis and gastrulation progression (Table 1), we hypothesized that small molecule inhibitors that interrupt gastrulation of zebrafish embryos might suppress metastatic progression of human cancer cells. We created a unique screening concept utilizing gastrulation of zebrafish embryos to test the hypothesis. Our results clearly confirmed our hypothesis: 25.6% (20/76 drugs) of epiboly-interrupting drugs could also suppress cell motility and invasion of highly metastatic human cell lines in vitro. In particular, pizotifen, which is an antagonist for serotonin receptor 2C and one of the epiboly-interrupting drugs, could suppress metastasis in a mouse model (Figure 3A–E). Thus, this screen could offer a novel platform for discovery of anti-metastasis drugs.

Among the 20 drugs which suppressed both epiboly progression and cell motility and invasion of MDA-MB-231 cells, hexachlorophene and troglitazone showed the strongest effect on suppressing cell motility and invasion of MDA-MB-231 cells. However, the drug could not suppress cell motility and invasion of other highly metastatic human cancer cell lines: MDA-MB-435 and PC3. With the exception of pizotifen and S(-)eticlopride hydrochloride, the remaining 18 drugs could not show the suppressor effect on more than three highly metastatic human cancer cell lines. These results indicate that the strength of interrupting effect of a drug on epiboly progression is not proportional to the strength of suppressing effect of the drug on metastasis.

We have provided the first evidence that HTR2C, which is a primary target of pizotifen, induced EMT and promoted metastatic dissemination of cancer cells (Figure 4A–E). Clinical data shows that HTR2C expression is correlated with tumor stage of breast cancer patients and is higher in metastatic and Her2/neu-overexpressing tumors (Pai et al., 2009). That would support our finding.

Pharmacological inhibition of DRD2 with S(-)eticlopride hydrochloride suppressed cell invasion and migration of multiple human cancer cell lines in vitro. However, overexpression of DRD2 could not induce EMT on MCF7 cells. Therefore, we stopped focusing on DRD2 and S(-)eticlopride hydrochloride.

There are at least two advantages to the screen described herein. One is that the screen can easily be converted to a chemical genetic screening platform. Indeed, our screen succeeded to identify HTR2C as an EMT inducer (Figure 4A–E). In this research, 1280 FDA approval drugs were screened, this is less than a few percent of all of druggable targets (approximately 100 targets) in the human proteome in the body. If chemical genetic screening using specific inhibitor libraries were conducted, more genes that contribute to metastasis and gastrulation could be identified. The second advantage is that the screen enables one researcher to test 100 drugs in 5 hr with using optical microscopy, drugs, and zebrafish embryos. That indicates this screen is not only highly efficient, low-cost, and low-labor but also enables researchers who do not have high-throughput screening instruments to conduct drug screening for anti-metastasis drugs.

Materials and methods

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Zebrafish)	AB line	National University of Singapore
Strain, strain background (Zebrafish)	Tg (kdrl:eGFP) zebrafish	Provided by Dr Stainier
Strain, strain background (Mus musculus)	BALB/c	Charles River Laboratories
Cell line (Homo sapiens)	MDA-MB-231	ATCC	HTB-26
Cell line (Homo sapiens)	MCF7	ATCC	HTB-22
Cell line (Homo sapiens)	MDA-MB-435	ATCC	HTB-129
Cell line (Homo sapiens)	MIA-PaCa2	ATCC	CRM-CRL-1420
Cell line (Homo sapiens)	PC3	ATCC	CRL-3471
Cell line (Homo sapiens)	SW620	ATCC	CCL-227
Cell line (Homo sapiens)	PC9	RIKEN BRC	RCB0446
Cell line (Homo sapiens)	HaCaT	CLI	300493
Cell line (BALB/c Mus)	4T1-12B	Provided from Dr Gary Sahagian
Antibody	PRMT1 (A33)(Rabbit polyclonal)	Cell Signaling Technology	Cat#_2449	WB (1:1000)
Antibody	CYP11A1 (D8F4F)(Rabbit polyclonal)	Cell Signaling Technology	Cat#_14217	WB (1:1000)
Antibody	E-cadherin (4A2)(Mouse monoclonal)	Cell Signaling Technology	Cat#_14472	WB (1:1000)IF (1:100)
Antibody	EpCAM (VU1D9)(Mouse monoclonal)	Cell Signaling Technology	Cat#_2929	WB (1:1000)IF (1:100)
Antibody	Vimentin (D21H3)(Rabbit polyclonal)	Cell Signaling Technology	Cat#_5741	WB (1:1000)IF (1:100)
Antibody	N-cadherin (D4R1H)(Rabbit polyclonal)	Cell Signaling Technology	Cat#_13116	WB (1:1000)IF (1:100)
Antibody	ZEB1 (D80D3)(Rabbit polyclonal)	Cell Signaling Technology	Cat#_3396	WB (1:1000)
Antibody	Histone H3 (D1H2)(Rabbit polyclonal)	Cell Signaling Technology	Cat#_4499	WB (1:1000)
Antibody	β-Tubulin (9F3)(Rabbit polyclonal)	Cell Signaling Technology	Cat#_2128	WB (1:1000)
Antibody	GAPDH (14C10)(Rabbit polyclonal)	Cell Signaling Technology	Cat#_2118	WB (1:1000)
Antibody	HTR2C (ab133570)(Rabbit polyclonal)	Abcam	Cat#_ab133570	WB (1:1000)
Antibody	DRD2 (ab85367)(Rabbit polyclonal)	Abcam	Cat#_ab85367	WB (1:1000)
Antibody	Phospho-GSK3β (Ser9) (F-2)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-373800	WB (1:1000)
Antibody	GSK3β (1F7)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-53931	WB (1:1000)
Antibody	KRT18 (DC-10)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-6259	WB (1:1000)
Antibody	KRT19 (A53-B/A2)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-6278	WB (1:1000)
Antibody	MMP1 (3B6)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-21731	WB (1:1000)
Antibody	MMP2 (8B4)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-13595	WB (1:1000)
Antibody	S100A4 (A-7)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-377059	WB (1:1000)
Antibody	Luciferase (C-12)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-74548	WB (1:1000)
Antibody	ki67 (ki-67)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-23900	WB (1:1000)
Antibody	β-Catenin (E-5)(Mouse monoclonal)	Santa Cruz Biotechnology	Cat#_sc-7963	WB (1:1000)IF (1:100)
Antibody	FITC-conjugated E-cadherin antibody (67A4)	Biolegend	Cat#_324104	FACS (1:100)
Antibody	Anti-mouse anti-rabbit immunoglobulin G (IgG) antibodies conjugated to Alexa Fluor 488	Life Technologies	A-11029	IF (1:100)
Antibody	Anti-goat anti-rabbit immunoglobulin G (IgG) antibodies conjugated to Alexa Fluor 488	Life Technologies	A-11034	IF (1:100)
Recombinant DNA reagent	pLVX-shRNA1	Clontech	Cat#_ 632,177
Recombinant DNA reagent	pCDH-CMV-MCS-EF1α-Hygro	System Biosciences	Cat#_CD515B-1	Gene expression vector
Recombinant DNA reagent	pMDLg/pRRE	Addgene	Addgene Plasmid #12251 RRID:Addgene_12251	Lentivirus packaging vector
Recombinant DNA reagent	pRSV-rev	Addgene	Addgene Plasmid #12253 RRID:Addgene_12253	Lentivirus packaging vector
Recombinant DNA reagent	pMD2.G	Addgene	Addgene Plasmid #12259 RRID:Addgene_12259	Lentivirus packaging vector
Recombinant DNA reagent	Providing pCMV-h5TH2C-VSV	Provided from Dr Herrick
Chemical compound, drug	FDA-approved chemical libraries	Prestwick Chemical
Chemical compound, drug	Pizotifen	Santa Cruz Biotechnology	Cat#_sc-201143
Chemical compound, drug	S(-)Eticlopride hydrochloride	Santa Cruz Biotechnology	Cat#_E101
Software, algorithm	GraphPad Prism7	GraphPad Software Inc	RRID:SCR_002798	Data analysis
Software, algorithm	FlowJo	BD Biosciences	RRID:SCR_008520	FACS data analysis

Zebrafish embryo screening

View detailed protocol

Zebrafish embryos at two-cell stage were collected at 20 min after their fertilization. Each drug was added to a well of a 24-well plate containing approximately 20 zebrafish embryos per well in either 10 or 50 μM final concentration when the embryos reached the sphere stage. Chemical treatment was initiated at 4 hpf and approximately 20 embryos were treated with two different concentrations for each compound tested. The treatment was ended at 9 hpf when vehicle- (DMSO) treated embryos as control reach 80–90% completion of the epiboly stage. The compounds which induced delay (<50% epiboly) in epiboly were selected as hit compounds for in vitro testing using highly metastatic human cancer cell lines. The study protocol was approved by the Institutional Animal Care and Use Committee of the National University of Singapore (protocol number: R16-1068).

Reagents

FDA, EMA, and other agencies-approved chemical libraries were purchased from Prestwick Chemical (Illkirch, France). Pizotifen (sc-201143) and S(-)eticlopride hydrochloride (E101) were purchased from Santa Cruz (Dallas, TX) and Sigma-Aldrich (St Louis, MO).

Cell culture and cell viability assay

Request a detailed protocol

MCF7, MDA-MB-231, MDA-MB-435, MIA-PaCa2, PC3, SW620, PC9, and HaCaT cells were obtained from American Type Culture Collection (ATCC, Manassas, VA). Luciferase-expressing 4T1 (4T1-12B) cells were provided from Dr Gary Sahagian (Tufts University, Boston, MA). All culture methods followed the supplier’s instruction. Cell viability assay was performed as previously described (Nakayama et al., 2020). PCR-based mycoplasma testing on these cells was performed once in 4 months.

Plasmid

Request a detailed protocol

A DNA fragment coding for HTR2C was amplified by PCR with primers containing restriction enzyme recognition sequences. The HTR2C coding fragment was amplified from hsp70l:mCherry-T2A-CreERT2 plasmid (Huang et al., 2012).

Immunoblotting

Request a detailed protocol

Western blotting was performed as described previously (Nakayama et al., 2020). Raw data of images of western blotting analyses are uploaded as source data for western. Anti-PRMT1 (A33), anti-CYP11A1 (D8F4F), anti-E-cadherin (4A2), anti-EpCAM (VU1D9), anti-vimentin (D21H3), anti-N-cadherin (D4R1H), anti-ZEB1 (D80D3), anti-histone H3 (D1H2), anti-β-tubulin (9F3), and anti-GAPDH (14C10) antibodies were purchased from Cell Signaling Technology (Danvers, MA). Anti-HTR2C (ab133570) and anti-DRD2 (ab85367) antibodies were purchased form Abcam (Cambridge, UK). Anti-phospho-GSK3β (Ser9) (F-2), anti-GSK3β (1F7), anti-KRT18 (DC-10), anti-KRT19 (A53-B/A2), anti-MMP1 (3B6), anti-MMP2 (8B4), anti-S100A4 (A-7), anti-luciferase (C-12), anti-ki67 (ki-67), and anti-β-catenin (E-5) antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX).

Flow cytometry

Request a detailed protocol

Cells were stained with FITC-conjugated E-cadherin antibody (67A4, Biolegend, San Diego, CA). Flow cytometry was performed as described (Nakayama et al., 2009) and analyzed with FlowJo software (TreeStar, Ashland, OR).

shRNA-mediated gene knockdown

Request a detailed protocol

The shRNA-expressing lentivirus vectors were constructed using pLVX-shRNA1 vector (632177, TAKARA Bio, Shiga, Japan). PRMT1-shRNA_#3-targeting sequence is GTGTTCCAGTATCTCTGATTA; PRMT1-shRNA_#4-targeting sequence is TTGACTCCTACGCACACTTTG. CYP11A1-shRNA_#4-targeting sequence is GCGATTCATTGATGCCATCTA; CYP11A1-shRNA_#4-targeting sequence is GAAATCCAACACCTCAGCGAT. Human HTR2C-shRNA-targeting sequence is TCATGCACCTCTGCGCTATAT. Mouse HTR2C-shRNA-targeting sequence is CTTCATACCGCTGACGATTAT. LacZ-shRNA-targeting sequence is CTACACAAATCAGCGATT.

Immunofluorescence

Request a detailed protocol

IF microscopy assay was performed as previously described (Nakayama et al., 2020). Goat anti-mouse and goat anti-rabbit immunoglobulin G (IgG) antibodies conjugated to Alexa Fluor 488 (A-11029 and A-11034, Life Technologies, Carlsbad, CA) and diluted at 1:100 were used. Nuclei were visualized by the addition of 2 μg/ml of 4’,6-diamidino-2-phenylindole (DAPI) (62248, Thermo Fisher, Waltham, MA) and photographed at 100× magnification by a fluorescent microscope BZ-X700 (KEYENCE, Osaka, Japan).

Boyden chamber cell motility and invasion assay

Request a detailed protocol

These assays were performed as previously described (Nakayama et al., 2020). In Boyden chamber assay, either 3 × 10⁵ MDA-MB-231, 1 × 10⁶ MDA-MB-435 or 5 × 10⁵ PC9 cells were applied to each well in the upper chamber.

Zebrafish xenotransplantation model

Request a detailed protocol

Tg(kdrl:eGFP) zebrafish was provided by Dr Stainier (Max Planck Institute for Heart and Lung Research). Embryos that were derived from the line were maintained in E3 medium containing 200 μM 1-phenyl-2-thiourea (P7629, Sigma-Aldrich, St Louis, MO). Approximately 100–400 RFP-labelled MBA-MB-231 or MIA-PaCa2 cells were injected into the duct of Cuvier of the zebrafish at 2 dpf. The fish were randomly assigned to two groups. One group was maintained in the presence of pizotifen-containing E3 medium and the other group was maintained in vehicle-containing E3 medium.

Spontaneous metastasis mouse model

Request a detailed protocol

4T1-12B cells (2 × 10⁴) were injected into the #4 MFP while the mice were anesthetized. To monitor tumor growth and metastases, mice were imaged biweekly by IVIS Imaging System (ParkinElmer, Waltham, MA). The primary tumor was resected 10 days after inoculation. D-Luciferin Potassium Salt (LUCK-100) was purchased from GoldBio (St Louis, MO). The study protocol (protocol number: BRC IACUC #110612) was approved by A*STAR (Agency for Science, Technology and Research, Singapore).

Gene set enrichment analysis

Request a detailed protocol

Gene expression profiles obtained from zebrafish embryos at either 50%-epiboly, shield, or 75%-epiboly stage were analyzed based on the hallmark gene sets derived from the Molecular Signatures Database (MSigDB) (Subramanian et al., 2005; Liberzon et al., 2015). The zebrafish transcriptomic data was sourced from White et al., 2017. Gene sets that were significantly enriched (FDR < 0.25) were presented with the normalized enrichment score (NES) and nominal p value. Source data files for analysis of either gene expression and enriched pathways are uploaded as GSEA Source data 1 and 2, respectively.

Histological analysis

Request a detailed protocol

All OCT-embedded primary tumors, lungs, and livers of mice from the spontaneous metastasis 4T1 model were sectioned on a cryostat. Eight micron sections were taken at 500 µm intervals through the entirety of the livers and lungs. Sections were subsequently stained with hematoxylin and eosin. Metastatic lesions were counted under a microscope in each section for both lungs and livers.

Statistics

Data were analyzed by Student’s t test; p < 0.05 was considered significant.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

1. Abdulghani J
2. Gu L
3. Dagvadorj A
4. Lutz J
5. Leiby B
6. Bonuccelli G
7. Lisanti MP
8. Zellweger T
9. Alanen K
10. Mirtti T
11. Visakorpi T
12. Bubendorf L
13. Nevalainen MT
(2008) Stat3 promotes metastatic progression of prostate cancer
The American Journal of Pathology 172:1717–1728.

https://doi.org/10.2353/ajpath.2008.071054
- PubMed
- Google Scholar
(2004) Has2 is required upstream of Rac1 to govern dorsal migration of lateral cells during zebrafish gastrulation
Development 131:525–537.

https://doi.org/10.1242/dev.00954
- PubMed
- Google Scholar
1. Barraclough J
2. Hodgkinson C
3. Hogg A
4. Dive C
5. Welman A
(2007) Increases in c-Yes expression level and activity promote motility but not proliferation of human colorectal carcinoma cells
Neoplasia 9:745–754.

https://doi.org/10.1593/neo.07442
- PubMed
- Google Scholar
(2000) The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells
Nature Cell Biology 2:84–89.

https://doi.org/10.1038/35000034
- Google Scholar
(2007) Tip-1 induces filopodia growth and is important for gastrulation movements during zebrafish development
Development, Growth & Differentiation 49:205–214.

https://doi.org/10.1111/j.1440-169X.2007.00921.x
- PubMed
- Google Scholar
1. Beyer T
2. Danilchik M
3. Thumberger T
4. Vick P
5. Tisler M
6. Schneider I
7. Bogusch S
8. Andre P
9. Ulmer B
10. Walentek P
11. Niesler B
12. Blum M
13. Schweickert A
(2012) Serotonin signaling is required for Wnt-dependent GRP specification and leftward flow in Xenopus
Current Biology 22:33–39.

https://doi.org/10.1016/j.cub.2011.11.027
- PubMed
- Google Scholar
1. Castanon I
2. Baylies MK
(2002) A Twist in fate: evolutionary comparison of Twist structure and function
Gene 287:11–22.

https://doi.org/10.1016/S0378-1119(01)00893-9
- PubMed
- Google Scholar
(2006) Cyclooxygenase-1-derived PGE2 promotes cell motility via the G-protein-coupled EP4 receptor during vertebrate gastrulation
Genes & Development 20:77–86.

https://doi.org/10.1101/gad.1374506
- PubMed
- Google Scholar
1. Chaffer CL
2. Weinberg RA
(2011) A perspective on cancer cell metastasis
Science 331:1559–1564.

https://doi.org/10.1126/science.1203543
- PubMed
- Google Scholar
1. Chen M-W
2. Hua K-T
3. Kao H-J
4. Chi C-C
5. Wei L-H
6. Johansson G
7. Shiah S-G
8. Chen P-S
9. Jeng Y-M
10. Cheng T-Y
11. Lai T-C
12. Chang J-S
13. Jan Y-H
14. Chien M-H
15. Yang C-J
16. Huang M-S
17. Hsiao M
18. Kuo M-L
(2010) H3K9 histone methyltransferase G9a promotes lung cancer invasion and metastasis by silencing the cell adhesion molecule Ep-CAM
Cancer Research 70:7830–7840.

https://doi.org/10.1158/0008-5472.CAN-10-0833
- PubMed
- Google Scholar
1. Choi SC
2. Han JK
(2002) Xenopus Cdc42 regulates convergent extension movements during gastrulation through Wnt/Ca2+ signaling pathway
Developmental Biology 244:342–357.

https://doi.org/10.1006/dbio.2002.0602
- PubMed
- Google Scholar
(2008) Membrane-type 1 matrix metalloproteinase regulates cell migration during zebrafish gastrulation: evidence for an interaction with non-canonical Wnt signaling
Experimental Cell Research 314:2150–2162.

https://doi.org/10.1016/j.yexcr.2008.03.010
- PubMed
- Google Scholar
1. Dai X
2. Ge J
3. Wang X
4. Qian X
5. Zhang C
6. Li X
(2013) OCT4 regulates epithelial-mesenchymal transition and its knockdown inhibits colorectal cancer cell migration and invasion
Oncology Reports 29:155–160.

https://doi.org/10.3892/or.2012.2086
- PubMed
- Google Scholar
1. Damm EW
2. Winklbauer R
(2011) PDGF-A controls mesoderm cell orientation and radial intercalation during Xenopus gastrulation
Development 138:565–575.

https://doi.org/10.1242/dev.056903
- PubMed
- Google Scholar
1. Dongre A
2. Weinberg RA
(2019) New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer
Nature Reviews. Molecular Cell Biology 20:69–84.

https://doi.org/10.1038/s41580-018-0080-4
- PubMed
- Google Scholar
1. Faure S
2. Cau J
3. de Santa Barbara P
4. Bigou S
5. Ge Q
6. Delsert C
7. Morin N
(2005) Xenopus p21-activated kinase 5 regulates blastomeres’ adhesive properties during convergent extension movements
Developmental Biology 277:472–492.

https://doi.org/10.1016/j.ydbio.2004.10.005
- PubMed
- Google Scholar
1. Felding-Habermann B
(2003) Integrin adhesion receptors in tumor metastasis
Clinical & Experimental Metastasis 20:203–213.

https://doi.org/10.1023/a:1022983000355
- PubMed
- Google Scholar
1. Fernando RI
2. Litzinger M
3. Trono P
4. Hamilton DH
5. Schlom J
6. Palena C
(2010) The T-box transcription factor Brachyury promotes epithelial-mesenchymal transition in human tumor cells
The Journal of Clinical Investigation 120:533–544.

https://doi.org/10.1172/JCI38379
- PubMed
- Google Scholar
1. Gong W
2. An Z
3. Wang Y
4. Pan X
5. Fang W
6. Jiang B
7. Zhang H
(2009) P21-activated kinase 5 is overexpressed during colorectal cancer progression and regulates colorectal carcinoma cell adhesion and migration
International Journal of Cancer 125:548–555.

https://doi.org/10.1002/ijc.24428
- PubMed
- Google Scholar
(2013) Atypical protein kinase C phosphorylates Par6 and facilitates transforming growth factor β-induced epithelial-to-mesenchymal transition
Molecular and Cellular Biology 33:874–886.

https://doi.org/10.1128/MCB.00837-12
- PubMed
- Google Scholar
(2008) Evolutionary conservation of human drug targets in organisms used for environmental risk assessments
Environmental Science & Technology 42:5807–5813.

https://doi.org/10.1021/es8005173
- PubMed
- Google Scholar
1. Guo BH
2. Feng Y
3. Zhang R
4. Xu LH
5. Li MZ
6. Kung HF
7. Song LB
8. Zeng MS
(2011) Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer
Molecular Cancer 10:10.

https://doi.org/10.1186/1476-4598-10-10
- Google Scholar
1. Habas R
2. Dawid IB
3. He X
(2003) Coactivation of Rac and Rho by Wnt/Frizzled signaling is required for vertebrate gastrulation
Genes & Development 17:295–309.

https://doi.org/10.1101/gad.1022203
- PubMed
- Google Scholar
1. Han M
2. Wang H
3. Zhang HT
4. Han Z
(2012) The PDZ protein TIP-1 facilitates cell migration and pulmonary metastasis of human invasive breast cancer cells in athymic mice
Biochemical and Biophysical Research Communications 422:139–145.

https://doi.org/10.1016/j.bbrc.2012.04.123
- PubMed
- Google Scholar
(2006) The Spemann organizer gene, Goosecoid, promotes tumor metastasis
PNAS 103:18969–18974.

https://doi.org/10.1073/pnas.0608636103
- PubMed
- Google Scholar
(2009) A novel role for MAPKAPK2 in morphogenesis during zebrafish development
PLOS Genetics 5:e1000413.

https://doi.org/10.1371/journal.pgen.1000413
- PubMed
- Google Scholar
(2011) XIer2 is required for convergent extension movements during Xenopus development
The International Journal of Developmental Biology 55:917–921.

https://doi.org/10.1387/ijdb.113288sh
- PubMed
- Google Scholar
1. Hsu HJ
2. Liang MR
3. Chen CT
4. Chung B
(2006) Pregnenolone stabilizes microtubules and promotes zebrafish embryonic cell movement
Nature 439:480–483.

https://doi.org/10.1038/nature04436
- PubMed
- Google Scholar
1. Huang EW
2. Xue SJ
3. Zhang Z
4. Zhou JG
5. Guan YY
6. Tang YB
(2012) Vinpocetine inhibits breast cancer cells growth in vitro and in vivo
Apoptosis : An International Journal on Programmed Cell Death 17:1120–1130.

https://doi.org/10.1007/s10495-012-0743-0
- PubMed
- Google Scholar
(2004) Essential role of MARCKS in cortical actin dynamics during gastrulation movements
The Journal of Cell Biology 164:169–174.

https://doi.org/10.1083/jcb.200310027
- PubMed
- Google Scholar
1. Ip YT
2. Gridley T
(2002) Cell movements during gastrulation: Snail dependent and independent pathways
Current Opinion in Genetics & Development 12:423–429.

https://doi.org/10.1016/S0959-437X(02)00320-9
- PubMed
- Google Scholar
1. Itoh K
2. Yoshioka K
3. Akedo H
4. Uehata M
5. Ishizaki T
6. Narumiya S
(1999) An essential part for Rho-associated kinase in the transcellular invasion of tumor cells
Nature Medicine 5:221–225.

https://doi.org/10.1038/5587
- PubMed
- Google Scholar
1. Jechlinger M
2. Sommer A
3. Moriggl R
4. Seither P
5. Kraut N
6. Capodiecci P
7. Donovan M
8. Cordon-Cardo C
9. Beug H
10. Grünert S
(2006) Autocrine PDGFR signaling promotes mammary cancer metastasis
The Journal of Clinical Investigation 116:1561–1570.

https://doi.org/10.1172/JCI24652
- PubMed
- Google Scholar
(2007) Shp2 knockdown and Noonan/LEOPARD mutant Shp2-induced gastrulation defects
PLOS Genetics 3:e225.

https://doi.org/10.1371/journal.pgen.0030225
- PubMed
- Google Scholar
1. Katsuno Y
2. Hanyu A
3. Kanda H
4. Ishikawa Y
5. Akiyama F
6. Iwase T
7. Ogata E
8. Ehata S
9. Miyazono K
10. Imamura T
(2008) Bone morphogenetic protein signaling enhances invasion and bone metastasis of breast cancer cells through Smad pathway
Oncogene 27:6322–6333.

https://doi.org/10.1038/onc.2008.232
- PubMed
- Google Scholar
1. Khanna C
2. Wan X
3. Bose S
4. Cassaday R
5. Olomu O
6. Mendoza A
7. Yeung C
8. Gorlick R
9. Hewitt SM
10. Helman LJ
(2004) The membrane-cytoskeleton linker ezrin is necessary for osteosarcoma metastasis
Nature Medicine 10:182–186.

https://doi.org/10.1038/nm982
- PubMed
- Google Scholar
1. Kim H-R
2. Wheeler MA
3. Wilson CM
4. Iida J
5. Eng D
6. Simpson MA
7. McCarthy JB
8. Bullard KM
(2004) Hyaluronan facilitates invasion of colon carcinoma cells in vitro via interaction with CD44
Cancer Research 64:4569–4576.

https://doi.org/10.1158/0008-5472.CAN-04-0202
- PubMed
- Google Scholar
(2009) Expression and activity of phosphodiesterase isoforms during epithelial mesenchymal transition: the role of phosphodiesterase 4
Molecular Biology of the Cell 20:4751–4765.

https://doi.org/10.1091/mbc.E09-01-0019
- PubMed
- Google Scholar
1. Kondo M
(2007) Bone morphogenetic proteins in the early development of zebrafish
The FEBS Journal 274:2960–2967.

https://doi.org/10.1111/j.1742-4658.2007.05838.x
- PubMed
- Google Scholar
1. Krens SFG
2. He S
3. Lamers GEM
4. Meijer AH
5. Bakkers J
6. Schmidt T
7. Spaink HP
8. Snaar-Jagalska BE
(2008) Distinct functions for ERK1 and ERK2 in cell migration processes during zebrafish gastrulation
Developmental Biology 319:370–383.

https://doi.org/10.1016/j.ydbio.2008.04.032
- PubMed
- Google Scholar
1. Kröger C
2. Afeyan A
3. Mraz J
4. Eaton EN
5. Reinhardt F
6. Khodor YL
7. Thiru P
8. Bierie B
9. Ye X
10. Burge CB
11. Weinberg RA
(2019) Acquisition of a hybrid E/M state is essential for tumorigenicity of basal breast cancer cells
PNAS 116:7353–7362.

https://doi.org/10.1073/pnas.1812876116
- PubMed
- Google Scholar
1. Kumar B
2. Koul S
3. Petersen J
4. Khandrika L
5. Hwa JS
6. Meacham RB
7. Wilson S
8. Koul HK
(2010) p38 mitogen-activated protein kinase-driven MAPKAPK2 regulates invasion of bladder cancer by modulation of MMP-2 and MMP-9 activity
Cancer Research 70:832–841.

https://doi.org/10.1158/0008-5472.CAN-09-2918
- PubMed
- Google Scholar
1. Kundu N
2. Fulton AM
(2002)
Selective cyclooxygenase (COX)-1 or COX-2 inhibitors control metastatic disease in a murine model of breast cancer

Cancer Research 62:2343–2346.
- PubMed
- Google Scholar
1. Kusakabe M
2. Nishida E
(2004) The polarity-inducing kinase Par-1 controls Xenopus gastrulation in cooperation with 14-3-3 and aPKC
The EMBO Journal 23:4190–4201.

https://doi.org/10.1038/sj.emboj.7600381
- PubMed
- Google Scholar
(2008) Alterations of the cytoskeleton in all three embryonic lineages contribute to the epiboly defect of Pou5f1/Oct4 deficient MZspg zebrafish embryos
Developmental Biology 315:1–17.

https://doi.org/10.1016/j.ydbio.2007.10.008
- PubMed
- Google Scholar
1. Latimer A
2. Jessen JR
(2010) Extracellular matrix assembly and organization during zebrafish gastrulation
Matrix Biology 29:89–96.

https://doi.org/10.1016/j.matbio.2009.10.002
- PubMed
- Google Scholar
1. Latinkic BV
2. Mercurio S
3. Bennett B
4. Hirst EMA
5. Xu Q
6. Lau LF
7. Mohun TJ
8. Smith JC
(2003) Xenopus Cyr61 regulates gastrulation movements and modulates Wnt signalling
Development 130:2429–2441.

https://doi.org/10.1242/dev.00449
- PubMed
- Google Scholar
(2015) The Molecular Signatures Database (MSigDB) hallmark gene set collection
Cell Systems 1:417–425.

https://doi.org/10.1016/j.cels.2015.12.004
- PubMed
- Google Scholar
1. Lin F
2. Sepich DS
3. Chen S
4. Topczewski J
5. Yin C
6. Solnica-Krezel L
7. Hamm H
(2005) Essential roles of G{alpha}12/13 signaling in distinct cell behaviors driving zebrafish convergence and extension gastrulation movements
The Journal of Cell Biology 169:777–787.

https://doi.org/10.1083/jcb.200501104
- PubMed
- Google Scholar
1. Lin J
2. Huo R
3. Wang L
4. Zhou Z
5. Sun Y
6. Shen B
7. Wang R
8. Li N
(2012) A novel anti-Cyr61 antibody inhibits breast cancer growth and metastasis in vivo
Cancer Immunology, Immunotherapy 61:677–687.

https://doi.org/10.1007/s00262-011-1135-y
- PubMed
- Google Scholar
(2006) Identification of regulators of germ layer morphogenesis using proteomics in zebrafish
Journal of Cell Science 119:2073–2083.

https://doi.org/10.1242/jcs.02928
- PubMed
- Google Scholar
1. Liu W
2. Su L-T
3. Khadka DK
4. Mezzacappa C
5. Komiya Y
6. Sato A
7. Habas R
8. Runnels LW
(2011) TRPM7 regulates gastrulation during vertebrate embryogenesis
Developmental Biology 350:348–357.

https://doi.org/10.1016/j.ydbio.2010.11.034
- PubMed
- Google Scholar
1. Liu P
2. Kumar IS
3. Brown S
4. Kannappan V
5. Tawari PE
6. Tang JZ
7. Jiang W
8. Armesilla AL
9. Darling JL
10. Wang W
(2013) Disulfiram targets cancer stem-like cells and reverses resistance and cross-resistance in acquired paclitaxel-resistant triple-negative breast cancer cells
British Journal of Cancer 109:1876–1885.

https://doi.org/10.1038/bjc.2013.534
- PubMed
- Google Scholar
1. Lu Z
2. Jiang G
3. Blume-Jensen P
4. Hunter T
(2001) Epidermal growth factor-induced tumor cell invasion and metastasis initiated by dephosphorylation and downregulation of focal adhesion kinase
Molecular and Cellular Biology 21:4016–4031.

https://doi.org/10.1128/MCB.21.12.4016-4031.2001
- PubMed
- Google Scholar
1. Lu W
2. Kang Y
(2019) Epithelial-Mesenchymal Plasticity in Cancer Progression and Metastasis
Developmental Cell 49:361–374.

https://doi.org/10.1016/j.devcel.2019.04.010
- PubMed
- Google Scholar
1. Lue H-W
2. Yang X
3. Wang R
4. Qian W
5. Xu RZH
6. Lyles R
7. Osunkoya AO
8. Zhou BP
9. Vessella RL
10. Zayzafoon M
11. Liu Z-R
12. Zhau HE
13. Chung LWK
(2011) LIV-1 promotes prostate cancer epithelial-to-mesenchymal transition and metastasis through HB-EGF shedding and EGFR-mediated ERK signaling
PLOS ONE 6:e27720.

https://doi.org/10.1371/journal.pone.0027720
- PubMed
- Google Scholar
(2012) Critical role of O-Linked β-N-acetylglucosamine transferase in prostate cancer invasion, angiogenesis, and metastasis
The Journal of Biological Chemistry 287:11070–11081.

https://doi.org/10.1074/jbc.M111.302547
- PubMed
- Google Scholar
(2006) A beta1,4-galactosyltransferase is required for convergent extension movements in zebrafish
Developmental Biology 297:471–482.

https://doi.org/10.1016/j.ydbio.2006.05.024
- PubMed
- Google Scholar
1. Malik G
2. Knowles LM
3. Dhir R
4. Xu S
5. Yang S
6. Ruoslahti E
7. Pilch J
(2010) Plasma fibronectin promotes lung metastasis by contributions to fibrin clots and tumor cell invasion
Cancer Research 70:4327–4334.

https://doi.org/10.1158/0008-5472.CAN-09-3312
- PubMed
- Google Scholar
1. Mani SA
2. Yang J
3. Brooks M
4. Schwaninger G
5. Zhou A
6. Miura N
7. Kutok JL
8. Hartwell K
9. Richardson AL
10. Weinberg RA
(2007) Mesenchyme Forkhead 1 (FOXC2) plays a key role in metastasis and is associated with aggressive basal-like breast cancers
PNAS 104:10069–10074.

https://doi.org/10.1073/pnas.0703900104
- PubMed
- Google Scholar
(2002) Zebrafish Rho kinase 2 acts downstream of Wnt11 to mediate cell polarity and effective convergence and extension movements
Current Biology 12:876–884.

https://doi.org/10.1016/s0960-9822(02)00864-3
- PubMed
- Google Scholar
1. Marsden M
2. DeSimone DW
(2003) Integrin-ECM interactions regulate cadherin-dependent cell adhesion and are required for convergent extension in Xenopus
Current Biology 13:1182–1191.

https://doi.org/10.1016/s0960-9822(03)00433-0
- PubMed
- Google Scholar
(2008) Snail and Slug Promote Epithelial-Mesenchymal Transition through β-Catenin–T-Cell Factor-4-dependent Expression of Transforming Growth Factor-β3
Molecular Biology of the Cell 19:4875–4887.

https://doi.org/10.1091/mbc.e08-05-0506
- PubMed
- Google Scholar
1. Middelbeek J
2. Kuipers AJ
3. Henneman L
4. Visser D
5. Eidhof I
6. van Horssen R
7. Wieringa B
8. Canisius SV
9. Zwart W
10. Wessels LF
11. Sweep FCGJ
12. Bult P
13. Span PN
14. van Leeuwen FN
15. Jalink K
(2012) TRPM7 is required for breast tumor cell metastasis
Cancer Research 72:4250–4261.

https://doi.org/10.1158/0008-5472.CAN-11-3863
- PubMed
- Google Scholar
1. Miyagi C
2. Yamashita S
3. Ohba Y
4. Yoshizaki H
5. Matsuda M
6. Hirano T
(2004) STAT3 noncell-autonomously controls planar cell polarity during zebrafish convergence and extension
The Journal of Cell Biology 166:975–981.

https://doi.org/10.1083/jcb.200403110
- PubMed
- Google Scholar
(2008) Sdf1/Cxcr4 signaling controls the dorsal migration of endodermal cells during zebrafish gastrulation
Development 135:2521–2529.

https://doi.org/10.1242/dev.020107
- PubMed
- Google Scholar
(2003) Phosphoinositide 3-kinase is required for process outgrowth and cell polarization of gastrulating mesendodermal cells
Current Biology 13:1279–1289.

https://doi.org/10.1016/s0960-9822(03)00505-0
- PubMed
- Google Scholar
1. Nakayama J
2. Yamamoto M
3. Hayashi K
4. Satoh H
5. Bundo K
6. Kubo M
7. Goitsuka R
8. Farrar MA
9. Kitamura D
(2009) BLNK suppresses pre-B-cell leukemogenesis through inhibition of JAK3
Blood 113:1483–1492.

https://doi.org/10.1182/blood-2008-07-166355
- PubMed
- Google Scholar
1. Nakayama J
2. Lu JW
3. Makinoshima H
4. Gong Z
(2020) A Novel Zebrafish Model of Metastasis Identifies the HSD11β1 Inhibitor Adrenosterone as a Suppressor of Epithelial-Mesenchymal Transition and Metastatic Dissemination
Molecular Cancer Research 18:477–487.

https://doi.org/10.1158/1541-7786.MCR-19-0759
- PubMed
- Google Scholar
1. Neeb A
2. Wallbaum S
3. Novac N
4. Dukovic-Schulze S
5. Scholl I
6. Schreiber C
7. Schlag P
8. Moll J
9. Stein U
10. Sleeman JP
(2012) The immediate early gene Ier2 promotes tumor cell motility and metastasis, and predicts poor survival of colorectal cancer patients
Oncogene 31:3796–3806.

https://doi.org/10.1038/onc.2011.535
- PubMed
- Google Scholar
(2009) Metastasis: from dissemination to organ-specific colonization
Nature Reviews. Cancer 9:274–284.

https://doi.org/10.1038/nrc2622
- PubMed
- Google Scholar
1. Ni J
2. Cozzi PJ
3. Duan W
4. Shigdar S
5. Graham PH
6. John KH
7. Li Y
(2012) Role of the EpCAM (CD326) in prostate cancer metastasis and progression
Cancer Metastasis Reviews 31:779–791.

https://doi.org/10.1007/s10555-012-9389-1
- PubMed
- Google Scholar
(2016) EMT: 2016
Cell 166:21–45.

https://doi.org/10.1016/j.cell.2016.06.028
- PubMed
- Google Scholar
1. Nomura S
2. Yoshitomi H
3. Takano S
4. Shida T
5. Kobayashi S
6. Ohtsuka M
7. Kimura F
8. Shimizu H
9. Yoshidome H
10. Kato A
11. Miyazaki M
(2008) FGF10/FGFR2 signal induces cell migration and invasion in pancreatic cancer
British Journal of Cancer 99:305–313.

https://doi.org/10.1038/sj.bjc.6604473
- PubMed
- Google Scholar
(2001) The polycomb-group gene Ezh2 is required for early mouse development
Molecular and Cellular Biology 21:4330–4336.

https://doi.org/10.1128/MCB.21.13.4330-4336.2001
- PubMed
- Google Scholar
(2009) Altered serotonin physiology in human breast cancers favors paradoxical growth and cell survival
Breast Cancer Research 11:bcr2448.

https://doi.org/10.1186/bcr2448
- Google Scholar
1. Perentes JY
2. Kirkpatrick ND
3. Nagano S
4. Smith EY
5. Shaver CM
6. Sgroi D
7. Garkavtsev I
8. Munn LL
9. Jain RK
10. Boucher Y
(2011) Cancer cell-associated MT1-MMP promotes blood vessel invasion and distant metastasis in triple-negative mammary tumors
Cancer Research 71:4527–4538.

https://doi.org/10.1158/0008-5472.CAN-10-4376
- PubMed
- Google Scholar
1. Radtke S
2. Milanovic M
3. Rossé C
4. De Rycker M
5. Lachmann S
6. Hibbert A
7. Kermorgant S
8. Parker PJ
(2013) ERK2 but not ERK1 mediates HGF-induced motility in non-small cell lung carcinoma cell lines
Journal of Cell Science 126:2381–2391.

https://doi.org/10.1242/jcs.115832
- PubMed
- Google Scholar
1. Ren G
2. Baritaki S
3. Marathe H
4. Feng J
5. Park S
6. Beach S
7. Bazeley PS
8. Beshir AB
9. Fenteany G
10. Mehra R
11. Daignault S
12. Al-Mulla F
13. Keller E
14. Bonavida B
15. de la Serna I
16. Yeung KC
(2012) Polycomb protein EZH2 regulates tumor invasion via the transcriptional repression of the metastasis suppressor RKIP in breast and prostate cancer
Cancer Research 72:3091–3104.

https://doi.org/10.1158/0008-5472.CAN-11-3546
- PubMed
- Google Scholar
1. Reymond N
2. Im JH
3. Garg R
4. Vega FM
5. Borda d’Agua B
6. Riou P
7. Cox S
8. Valderrama F
9. Muschel RJ
10. Ridley AJ
(2012) Cdc42 promotes transendothelial migration of cancer cells through β1 integrin
The Journal of Cell Biology 199:653–668.

https://doi.org/10.1083/jcb.201205169
- PubMed
- Google Scholar
1. Rombouts K
2. Carloni V
3. Mello T
4. Omenetti S
5. Galastri S
6. Madiai S
7. Galli A
8. Pinzani M
(2013) Myristoylated Alanine-Rich protein Kinase C Substrate (MARCKS) expression modulates the metastatic phenotype in human and murine colon carcinoma in vitro and in vivo
Cancer Letters 333:244–252.

https://doi.org/10.1016/j.canlet.2013.01.040
- PubMed
- Google Scholar
1. Sack U
2. Walther W
3. Scudiero D
4. Selby M
5. Kobelt D
6. Lemm M
7. Fichtner I
8. Schlag PM
9. Shoemaker RH
10. Stein U
(2011) Novel effect of antihelminthic Niclosamide on S100A4-mediated metastatic progression in colon cancer
Journal of the National Cancer Institute 103:1018–1036.

https://doi.org/10.1093/jnci/djr190
- PubMed
- Google Scholar
(2007) The opposing homeobox genes Goosecoid and Vent1/2 self-regulate Xenopus patterning
The EMBO Journal 26:2955–2965.

https://doi.org/10.1038/sj.emboj.7601705
- PubMed
- Google Scholar
1. Sasaki T
2. Kuniyasu H
3. Luo Y
4. Fujiwara R
5. Kitayoshi M
6. Tanabe E
7. Kato D
8. Shinya S
9. Fujii K
10. Ohmori H
11. Yamashita Y
(2014) Serum CD10 is associated with liver metastasis in colorectal cancer
The Journal of Surgical Research 192:390–394.

https://doi.org/10.1016/j.jss.2014.05.071
- PubMed
- Google Scholar
(2009) An adhesion-independent, aPKC-dependent function for cadherins in morphogenetic movements
Journal of Cell Science 122:2514–2523.

https://doi.org/10.1242/jcs.042796
- PubMed
- Google Scholar
1. Sharma D
2. Holets L
3. Zhang X
4. Kinsey WH
(2005) Role of Fyn kinase in signaling associated with epiboly during zebrafish development
Developmental Biology 285:462–476.

https://doi.org/10.1016/j.ydbio.2005.07.018
- PubMed
- Google Scholar
1. Shen H
2. Gu Z
3. Jian K
4. Qi J
(2013) CXCR4-mediated Stat3 activation is essential for CXCL12-induced cell invasion in bladder cancer
Tumour Biology 34:1839–1845.

https://doi.org/10.1007/s13277-013-0725-z
- PubMed
- Google Scholar
1. Shi X
2. Gangadharan B
3. Brass LF
4. Ruf W
5. Mueller BM
(2004)
Protease-activated receptors (PAR1 and PAR2) contribute to tumor cell motility and metastasis

Molecular Cancer Research 2:395–402.
- PubMed
- Google Scholar
1. Shi J
2. Severson C
3. Yang J
4. Wedlich D
5. Klymkowsky MW
(2011) Snail2 controls mesodermal BMP/Wnt induction of neural crest
Development 138:3135–3145.

https://doi.org/10.1242/dev.064394
- PubMed
- Google Scholar
(1998) A key function for alphav containing integrins in mesodermal cell migration during Pleurodeles waltl gastrulation
Developmental Biology 195:158–173.

https://doi.org/10.1006/dbio.1997.8838
- PubMed
- Google Scholar
(2009) The epithelial cell adhesion molecule EpCAM is required for epithelial morphogenesis and integrity during zebrafish epiboly and skin development
PLOS Genetics 5:e1000563.

https://doi.org/10.1371/journal.pgen.1000563
- PubMed
- Google Scholar
1. Solnica-Krezel L
(2005) Conserved patterns of cell movements during vertebrate gastrulation
Current Biology 15:R213–R228.

https://doi.org/10.1016/j.cub.2005.03.016
- PubMed
- Google Scholar
1. Solnica-Krezel L
(2006) Gastrulation in zebrafish -- all just about adhesion?
Current Opinion in Genetics & Development 16:433–441.

https://doi.org/10.1016/j.gde.2006.06.009
- PubMed
- Google Scholar
1. Song S
2. Eckerle S
3. Onichtchouk D
4. Marrs JA
5. Nitschke R
6. Driever W
(2013) Pou5f1-dependent EGF expression controls E-cadherin endocytosis, cell adhesion, and zebrafish epiboly movements
Developmental Cell 24:486–501.

https://doi.org/10.1016/j.devcel.2013.01.016
- PubMed
- Google Scholar
1. Spaderna S
2. Schmalhofer O
3. Wahlbuhl M
4. Dimmler A
5. Bauer K
6. Sultan A
7. Hlubek F
8. Jung A
9. Strand D
10. Eger A
11. Kirchner T
12. Behrens J
13. Brabletz T
(2008) The transcriptional repressor ZEB1 promotes metastasis and loss of cell polarity in cancer
Cancer Research 68:537–544.

https://doi.org/10.1158/0008-5472.CAN-07-5682
- PubMed
- Google Scholar
1. Speirs CK
2. Jernigan KK
3. Kim S-H
4. Cha YI
5. Lin F
6. Sepich DS
7. DuBois RN
8. Lee E
9. Solnica-Krezel L
(2010) Prostaglandin Gbetagamma signaling stimulates gastrulation movements by limiting cell adhesion through Snai1a stabilization
Development 137:1327–1337.

https://doi.org/10.1242/dev.045971
- PubMed
- Google Scholar
1. Subramanian A
2. Tamayo P
3. Mootha VK
4. Mukherjee S
5. Ebert BL
6. Gillette MA
7. Paulovich A
8. Pomeroy SL
9. Golub TR
10. Lander ES
11. Mesirov JP
(2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles
PNAS 102:15545–15550.

https://doi.org/10.1073/pnas.0506580102
- PubMed
- Google Scholar
1. Sui H
2. Xu H
3. Ji Q
4. Liu X
5. Zhou L
6. Song H
7. Zhou X
8. Xu Y
9. Chen Z
10. Cai J
11. Ji G
12. Li Q
(2015) 5-hydroxytryptamine receptor (5-HT1DR) promotes colorectal cancer metastasis by regulating Axin1/β-catenin/MMP-7 signaling pathway
Oncotarget 6:25975–25987.

https://doi.org/10.18632/oncotarget.4543
- PubMed
- Google Scholar
1. Szilágyi G
2. Nagy Z
3. Balkay L
4. Boros I
5. Emri M
6. Lehel S
7. Márián T
8. Molnár T
9. Szakáll S
10. Trón L
11. Bereczki D
12. Csiba L
13. Fekete I
14. Kerényi L
15. Galuska L
16. Varga J
17. Bönöczk P
18. Vas A
19. Gulyás B
(2005) Effects of vinpocetine on the redistribution of cerebral blood flow and glucose metabolism in chronic ischemic stroke patients: a PET study
Journal of the Neurological Sciences 229–230:275–284.

https://doi.org/10.1016/j.jns.2004.11.053
- PubMed
- Google Scholar
1. Tada M
2. Smith JC
(2000) Xwnt11 is a target of Xenopus Brachyury: regulation of gastrulation movements via Dishevelled, but not through the canonical Wnt pathway
Development 127:2227–2238.

https://doi.org/10.1242/dev.127.10.2227
- PubMed
- Google Scholar
1. Tao K
2. Fang M
3. Alroy J
4. Sahagian GG
(2008) Imagable 4T1 model for the study of late stage breast cancer
BMC Cancer 8:228.

https://doi.org/10.1186/1471-2407-8-228
- PubMed
- Google Scholar
(2009) Epithelial-Mesenchymal Transitions in Development and Disease
Cell 139:871–890.

https://doi.org/10.1016/j.cell.2009.11.007
- Google Scholar
1. Tsai WB
2. Zhang X
3. Sharma D
4. Wu W
5. Kinsey WH
(2005) Role of Yes kinase during early zebrafish development
Developmental Biology 277:129–141.

https://doi.org/10.1016/j.ydbio.2004.08.052
- PubMed
- Google Scholar
1. Tsai Y-J
2. Pan H
3. Hung C-M
4. Hou P-T
5. Li Y-C
6. Lee Y-J
7. Shen Y-T
8. Wu T-T
9. Li C
(2011) The predominant protein arginine methyltransferase PRMT1 is critical for zebrafish convergence and extension during gastrulation
The FEBS Journal 278:905–917.

https://doi.org/10.1111/j.1742-4658.2011.08006.x
- PubMed
- Google Scholar
1. Tsai JH
2. Yang J
(2013) Epithelial-mesenchymal plasticity in carcinoma metastasis
Genes & Development 27:2192–2206.

https://doi.org/10.1101/gad.225334.113
- PubMed
- Google Scholar
(1994) Posterior transformation, neurological abnormalities, and severe hematopoietic defects in mice with a targeted deletion of the bmi-1 proto-oncogene
Genes & Development 8:757–769.

https://doi.org/10.1101/gad.8.7.757
- PubMed
- Google Scholar
1. Vannier C
2. Mock K
3. Brabletz T
4. Driever W
(2013) Zeb1 regulates E-cadherin and Epcam (epithelial cell adhesion molecule) expression to control cell behavior in early zebrafish development
The Journal of Biological Chemistry 288:18643–18659.

https://doi.org/10.1074/jbc.M113.467787
- PubMed
- Google Scholar
1. Vega FM
2. Ridley AJ
(2008) Rho GTPases in cancer cell biology
FEBS Letters 582:2093–2101.

https://doi.org/10.1016/j.febslet.2008.04.039
- PubMed
- Google Scholar
1. Vincan E
2. Barker N
(2008) The upstream components of the Wnt signalling pathway in the dynamic EMT and MET associated with colorectal cancer progression
Clinical & Experimental Metastasis 25:657–663.

https://doi.org/10.1007/s10585-008-9156-4
- PubMed
- Google Scholar
1. Wander SA
2. Zhao D
3. Besser AH
4. Hong F
5. Wei J
6. Ince TA
7. Milikowski C
8. Bishopric NH
9. Minn AJ
10. Creighton CJ
11. Slingerland JM
(2013) PI3K/mTOR inhibition can impair tumor invasion and metastasis in vivo despite a lack of antiproliferative action in vitro: implications for targeted therapy
Breast Cancer Research and Treatment 138:369–381.

https://doi.org/10.1007/s10549-012-2389-6
- PubMed
- Google Scholar
1. Wang F
2. Liu H
3. Liu S
4. Tang S
5. Yang L
6. Feng G
(2005) SHP-2 promoting migration and metastasis of MCF-7 with loss of E-cadherin, dephosphorylation of FAK and secretion of MMP-9 induced by IL-1beta in vivo and in vitro
Breast Cancer Research and Treatment 89:5–14.

https://doi.org/10.1007/s10549-004-1002-z
- PubMed
- Google Scholar
1. Wang D
2. Dubois RN
(2006) Prostaglandins and cancer
Gut 55:115–122.

https://doi.org/10.1136/gut.2004.047100
- PubMed
- Google Scholar
1. Webster DM
2. Teo CF
3. Sun Y
4. Wloga D
5. Gay S
6. Klonowski KD
7. Wells L
8. Dougan ST
(2009) O-GlcNAc modifications regulate cell survival and epiboly during zebrafish development
BMC Developmental Biology 9:28.

https://doi.org/10.1186/1471-213X-9-28
- PubMed
- Google Scholar
1. Weinbach EC
2. Garbus J
(1969) Mechanism of action of reagents that uncouple oxidative phosphorylation
Nature 221:1016–1018.

https://doi.org/10.1038/2211016a0
- PubMed
- Google Scholar
1. Welch DR
2. Hurst DR
(2019) Defining the Hallmarks of Metastasis
Cancer Research 79:3011–3027.

https://doi.org/10.1158/0008-5472.CAN-19-0458
- Google Scholar
1. White RJ
2. Collins JE
3. Sealy IM
4. Wali N
5. Dooley CM
6. Digby Z
7. Stemple DL
8. Murphy DN
9. Billis K
10. Hourlier T
11. Füllgrabe A
12. Davis MP
13. Enright AJ
14. Busch-Nentwich EM
(2017) A high-resolution mRNA expression time course of embryonic development in zebrafish
eLife 6:e30860.

https://doi.org/10.7554/eLife.30860
- PubMed
- Google Scholar
(2004) The forkhead genes, Foxc1 and Foxc2, regulate paraxial versus intermediate mesoderm cell fate
Developmental Biology 271:176–189.

https://doi.org/10.1016/j.ydbio.2004.03.034
- PubMed
- Google Scholar
1. Yadav V
2. Denning MF
(2011) Fyn is induced by Ras/PI3K/Akt signaling and is required for enhanced invasion/migration
Molecular Carcinogenesis 50:346–352.

https://doi.org/10.1002/mc.20716
- PubMed
- Google Scholar
1. Yagi H
2. Tan W
3. Dillenburg-Pilla P
4. Armando S
5. Amornphimoltham P
6. Simaan M
7. Weigert R
8. Molinolo AA
9. Bouvier M
10. Gutkind JS
(2011) A synthetic biology approach reveals a CXCR4-G13-Rho signaling axis driving transendothelial migration of metastatic breast cancer cells
Science Signaling 4:ra60.

https://doi.org/10.1126/scisignal.2002221
- PubMed
- Google Scholar
1. Yamashita S
2. Miyagi C
3. Fukada T
4. Kagara N
5. Che Y-S
6. Hirano T
(2004) Zinc transporter LIVI controls epithelial-mesenchymal transition in zebrafish gastrula organizer
Nature 429:298–302.

https://doi.org/10.1038/nature02545
- PubMed
- Google Scholar
1. Yamazaki K
2. Takamura M
3. Masugi Y
4. Mori T
5. Du W
6. Hibi T
7. Hiraoka N
8. Ohta T
9. Ohki M
10. Hirohashi S
11. Sakamoto M
(2009) Adenylate cyclase-associated protein 1 overexpressed in pancreatic cancers is involved in cancer cell motility
Laboratory Investigation; a Journal of Technical Methods and Pathology 89:425–432.

https://doi.org/10.1038/labinvest.2009.5
- PubMed
- Google Scholar
(2002) Cell movement patterns during gastrulation in the chick are controlled by positive and negative chemotaxis mediated by FGF4 and FGF8
Developmental Cell 3:425–437.

https://doi.org/10.1016/s1534-5807(02)00256-3
- PubMed
- Google Scholar
1. Yang J
2. Mani SA
3. Donaher JL
4. Ramaswamy S
5. Itzykson RA
6. Come C
7. Savagner P
8. Gitelman I
9. Richardson A
10. Weinberg RA
(2004) Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis
Cell 117:927–939.

https://doi.org/10.1016/j.cell.2004.06.006
- PubMed
- Google Scholar
1. Yang J
2. Weinberg RA
(2008) Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis
Developmental Cell 14:818–829.

https://doi.org/10.1016/j.devcel.2008.05.009
- PubMed
- Google Scholar
(1999)
Overexpression of small GTP-binding protein RhoA promotes invasion of tumor cells

Cancer Research 59:2004–2010.
- PubMed
- Google Scholar
(2017) Wnt signaling in cancer
Oncogene 36:1461–1473.

https://doi.org/10.1038/onc.2016.304
- PubMed
- Google Scholar
1. Zhu X
2. Jiang J
3. Shen H
4. Wang H
5. Zong H
6. Li Z
7. Yang Y
8. Niu Z
9. Liu W
10. Chen X
11. Hu Y
12. Gu J
(2005) Elevated β1,4-Galactosyltransferase I in Highly Metastatic Human Lung Cancer Cells
Journal of Biological Chemistry 280:12503–12516.

https://doi.org/10.1074/jbc.M413631200
- Google Scholar
1. Zhu S
2. Liu L
3. Korzh V
4. Gong Z
5. Low BC
(2006) RhoA acts downstream of Wnt5 and Wnt11 to regulate convergence and extension movements by involving effectors Rho kinase and Diaphanous: use of zebrafish as an in vivo model for GTPase signaling
Cellular Signalling 18:359–372.

https://doi.org/10.1016/j.cellsig.2005.05.019
- PubMed
- Google Scholar

Article and author information

Author details

Joji Nakayama
1. Department of Biological Science, National University of Singapore, Singapore, Singapore
2. Cancer Science Institute of Singapore, National University of Singapore, Singapore, Singapore
3. Tsuruoka Metabolomics Laboratory, National Cancer Center, Tsuruoka, Japan
4. Shonai Regional Industry Promotion Center, Tsuruoka, Japan
Contribution
Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Supervision, Validation, Visualization, Writing - original draft, Writing - review and editing

For correspondence
zmetastasis@gmail.com

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-1077-140X
Lora Tan

Department of Biological Science, National University of Singapore, Singapore, Singapore

Contribution
Formal analysis, Investigation, Validation, Visualization

Competing interests
No competing interests declared
Yan Li

Department of Biological Science, National University of Singapore, Singapore, Singapore

Contribution
Data curation, Investigation

Competing interests
No competing interests declared
Boon Cher Goh

Cancer Science Institute of Singapore, National University of Singapore, Singapore, Singapore

Contribution
Funding acquisition, Project administration, Resources

Competing interests
No competing interests declared
Shu Wang
1. Department of Biological Science, National University of Singapore, Singapore, Singapore
2. Institute of Bioengineering and Nanotechnology, Singapore, Singapore
Contribution
Funding acquisition, Resources

Competing interests
No competing interests declared
Hideki Makinoshima
1. Tsuruoka Metabolomics Laboratory, National Cancer Center, Tsuruoka, Japan
2. Division of Translational Research, Exploratory Oncology Research and Clinical Trial Center, National Cancer Center, Kashiwa, Japan
Contribution
Funding acquisition, Project administration, Resources

Competing interests
No competing interests declared
Zhiyuan Gong

Department of Biological Science, National University of Singapore, Singapore, Singapore

Contribution
Funding acquisition, Project administration, Resources, Supervision

For correspondence
dbsgzy@nus.edu.sg

Competing interests
No competing interests declared

Funding

National Medical Research Council (R-154000547511)

Zhiyuan Gong

Ministry of Education - Singapore (R-154000A23112)

Zhiyuan Gong

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We sincerely appreciate Dr Joshua Collins (NIH/NIDCR) and Dr Shimada (Mie University) for helping this research. We thank Dr Herrick (Albany Medical College) for providing pCMV-h5TH2C-VSV with us. This study was funded by grants from National Medical Research Council of Singapore (R-154000547511) and Ministry of Education of Singapore (R-154000A23112) to ZG.

Ethics

The study protocol using zebrafish was approved by the Institutional Animal Care and Use Committee of the National University of Singapore (protocol number: R16-1068). The study protocol using mice (protocol number: BRC IACUC #110612) was approved by A*STAR (Agency for Science, Technology and Research, Singapore).

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

2,137

views
196

downloads
11

citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Joji Nakayama
Lora Tan
Yan Li
Boon Cher Goh
Shu Wang
Hideki Makinoshima
Zhiyuan Gong

(2021)

A zebrafish embryo screen utilizing gastrulation identifies the HTR2C software inhibitor pizotifen as a suppressor of EMT-mediated metastasis

eLife 10:e70151.

https://doi.org/10.7554/eLife.70151

Categories and tags

Research organism

Zebrafish

Share this article

Cite this article

A list of the genes that are involved between gastrulation and metastasis progression.

A chemical screen for identification of epiboly-interrupting drugs.

A list of the drugs that interfere with epiboly progression in zebrafish.

Pizotifen, one of epiboly-interrupting drugs, suppressed metastatic dissemination of human cancer cells lines in vivo and vitro.

Primary targets of the identified drugs.

Effects of pharmacological inhibition of HTR2C on metastatic dissemination of MDA-MB-231 cells in zebrafish xenografted models.

Effects of pharmacological inhibition of HTR2C on metastatic dissemination of Mia-PaCa2 cells in zebrafish xenografted models.

Effects of genetic inhibition of HTR2C on metastatic dissemination of MDA-MB-231 cells in zebrafish xenografted models.

Pizotifen suppressed metastatic progression in a mouse model of metastasis.

HTR2C induced epithelial-to-mesenchymal transition (EMT)-mediated metastatic dissemination of human cancer cells.

Effects of HTR2C overexpression on metastatic dissemination of MCF7 cells in zebrafish xenografted models.

Pizotifen restored mesenchymal-like traits of MDA-MB-231 cells into epithelial traits through blocking nuclear accumulation of β-catenin.

Author details

Joji Nakayama

Contribution

For correspondence

Competing interests

Lora Tan

Contribution

Competing interests

Yan Li

Contribution

Competing interests

Boon Cher Goh

Contribution

Competing interests

Shu Wang

Contribution

Competing interests

Hideki Makinoshima

Contribution

Competing interests

Zhiyuan Gong

Contribution

For correspondence

Competing interests

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Categories and tags

Research organism

Further reading