1. Developmental Biology
  2. Neuroscience
Download icon

Mechanisms underlying microglial colonization of developing neural retina in zebrafish

  1. Nishtha Ranawat
  2. Ichiro Masai  Is a corresponding author
  1. Developmental Neurobiology Unit, Okinawa Institute of Science and Technology Graduate University, Japan
Research Article
  • Cited 0
  • Views 632
  • Annotations
Cite this article as: eLife 2021;10:e70550 doi: 10.7554/eLife.70550

Abstract

Microglia are brain-resident macrophages that function as the first line of defense in brain. Embryonic microglial precursors originate in peripheral mesoderm and migrate into the brain during development. However, the mechanism by which they colonize the brain is incompletely understood. The retina is one of the first brain regions to accommodate microglia. In zebrafish, embryonic microglial precursors use intraocular hyaloid blood vessels as a pathway to migrate into the optic cup via the choroid fissure. Once retinal progenitor cells exit the cell cycle, microglial precursors associated with hyaloid blood vessels start to infiltrate the retina preferentially through neurogenic regions, suggesting that colonization of retinal tissue depends upon the neurogenic state. Along with blood vessels and retinal neurogenesis, IL34 also participates in microglial precursor colonization of the retina. Altogether, CSF receptor signaling, blood vessels, and neuronal differentiation function as cues to create an essential path for microglial migration into developing retina.

Editor's evaluation

The authors have addressed the remaining concerns raised by reviewers and the revised manuscript has been strengthened with revisions to the text and figures.

This manuscript will be of use to developmental neurobiologists and provides new insight on the mechanisms and microglia-vascular interactions and microglial colonization of the zebrafish retina.

https://doi.org/10.7554/eLife.70550.sa0

eLife digest

The immune system is comprised of many different cells which protect our bodies from infection and other illnesses. The brain contains its own population of immune cells called microglia. Unlike neurons, these cells form outside the brain during development. They then travel to the brain and colonize specific regions like the retina, the light-sensing part of the eye in vertebrates.

It is poorly understood how newly formed microglia migrate to the retina and whether their entry depends on the developmental state of nerve cells (also known as neurons) in this region. To help answer these questions, Ranawat and Masai attached fluorescent labels that can be seen under a microscope to microglia in the embryos of zebrafish. Developing zebrafish are transparent, making it easy to trace the fluorescent microglia as they travel to the retina and insert themselves among its neurons.

Ranawat and Masai found that blood vessels around the retina act as a pathway that microglia move along. Once they reach the retina, the microglia remain attached and only enter the retina at sites where brain cells are starting to mature in to adult neurons. Further experiments showed that microglia fail to infiltrate and colonize the retina when blood vessels are damaged or neuron maturation is blocked.

These findings reveal some of the key elements that guide microglia to the retina during development. However, further work is needed to establish the molecular and biochemical processes that allow microglia to attach to blood vessels and detect when cells in the retina are starting to mature.

Introduction

Microglia are the resident macrophages of brain. These dedicated CNS phagocytes form the innate immune system of embryonic and adult brain. Microglia eliminate cellular debris to prevent neuro-inflammation and to promote neuronal protection in vertebrates (Ashwell, 1991; Calderó et al., 2009; Lawson et al., 1990; Neumann et al., 2009; Sierra et al., 2010). They also prune unnecessary synapses to establish functional, mature neural circuits during brain development, performing a variety of cellular functions (Paolicelli et al., 2011; Tremblay et al., 2010). In contrast to other CNS cells, like neurons and astrocytes, microglia do not originate from neural plate, but are derived from mesoderm (Ashwell, 1991; Boya et al., 1979) through hematopoiesis (Ginhoux et al., 2013). In developing zebrafish, embryonic hematopoiesis occurs in successive waves that are separated anatomically and temporally. The primitive or first wave of microglial precursors is generated from myeloid cells originating in the rostral blood island (RBI) at about 11 hr post-fertilization (hpf) (Stachura and Traver, 2011; Xu et al., 2012). The definitive wave is contributed by the ventral wall of the dorsal aorta (VDA), giving rise to hematopoietic stem cells (HSCs) (Xu et al., 2015). In addition, a short intermediate wave also originates from the posterior blood island (PBI) (Bertrand et al., 2007). After 2 weeks post-fertilization, VDA-derived microglia progressively replace RBI-derived microglia throughout the CNS (Ferrero et al., 2018; Xu et al., 2015). Thus, primitive and definitive hematopoiesis contribute embryonic and adult microglia, respectively, during zebrafish development.

Generation of embryonic microglial precursors and their colonization of brain areas has been extensively described in zebrafish (Herbomel et al., 2001). In zebrafish, embryonic microglial precursors are initially specified in lateral plate mesoderm and then spread on yolk. They start to migrate into the cephalic mesenchymal region after 22 hpf. At 26–30 hpf, a few microglia are observed in the vitreous space or choroid fissure of the optic cup, and around 30 microglia colonize the neural retina by 48 hpf. Microglial colonization of the optic tectum and other regions of zebrafish brain occurs after 48 hpf, indicating that the retina is one of the first brain regions to be colonized by microglia during development.

Previous studies have suggested various signals that promote microglial colonization in brain. In mice, Cxcl12/CxcR4 signaling orchestrates microglial migration into developing cerebral cortex (Arnò et al., 2014; Hattori and Miyata, 2018). In zebrafish, microglia migrate from the yolk-sac and colonize the brain in an apoptosis-dependent manner (Casano et al., 2016; Xu et al., 2016). Microglial precursors also migrate into the cephalic mesenchymal area in a Colony Stimulating Factor-Receptor (CSF-R)-dependent manner (Herbomel et al., 2001; Wu et al., 2018). Zebrafish fms mutants carry a genetic mutation in CSF-R and show severe delays in microglial colonization of both brain and retina, as well as an increase in neuronal apoptosis (Herbomel et al., 2001). Recently, it was reported that brain colonization by microglial precursors depends primarily on one zebrafish CSF-R, CSF1ra, and one CSF-R ligand, IL34, and that this combination of CSF ligand and receptor dominates this process (Wu et al., 2018). Importantly, the number of microglia in the brain and retina is reduced in zebrafish il34 mutants that overexpress anti-apoptotic protein, Bcl2. Thus, apoptosis and the IL34-CSF1ra signaling pathway cooperate to promote microglial colonization of the brain and retina during zebrafish development.

In developing zebrafish retina, neurogenesis is initiated in the ventro-nasal retina, adjacent to the optic stalk at 25 hpf and progresses to the whole region of the neural retina, suggesting a spatio-temporal pattern of retinal neurogenesis in zebrafish (Hu and Easter, 1999; Masai et al., 2000). Retinal progenitor cells are multipotent and give rise to six major classes of neurons and one type of glial cells. Two types of photoreceptors, rods, and cones, form the outer nuclear layer (ONL). Three interneurons, amacrine cells, bipolar cells, and horizontal cells form the inner nuclear layer (INL). Retinal ganglion cells (RGCs) form the RGC layer. Synaptic connections between photoreceptors and bipolar/horizontal cells form the outer plexiform layer (OPL), and synaptic connections between RGCs and bipolar/amacrine cells form the inner plexiform layer (IPL). Cell fate determination is less dependent on the cell lineage of retinal progenitor cells, suggesting that both extrinsic and intrinsic mechanisms influence the status of retinal progenitor multipotency, leading to generation of diverse retinal cell types (He et al., 2012). These developmental profiles of retinal neurogenesis and cell differentiation may be coupled with microglial colonization. Although apoptosis and CSF-R signaling are suggested in microglial colonization of the retina in zebrafish (Wu et al., 2018), the mechanism underlying microglial colonization of the retina remains to be determined.

In this study, using zebrafish, we examined the developmental profile of retinal colonization by microglia precursors. The number of ocular microglial precursors progressively increases from 32 to 54 hpf. Most microglial precursors do not proliferate, suggesting that microglial colonization of the retina depends on cell migration from outside the optic cup. We found three guidance mechanisms driving microglial precursor colonization of the retina. First, IL34 initiates microglial precursor movement from yolk toward the brain and the retina. Second, microglia precursors enter the optic cup via ocular hyaloid blood vessels in the choroid fissure, suggesting that these blood vessels guide microglia to the retina. Third, microglial precursors infiltrate the neural retina preferentially through the neurogenic region, suggesting that the neurogenic state of retinal tissue acts as an entry signal for microglial precursors to infiltrate the retina. Thus, a series of guidance mechanisms promote microglial colonization from yolk to the neural retina in zebrafish.

Results

Embryonic microglial precursors progressively colonize developing zebrafish retina

In zebrafish, early macrophages are generated from myeloid cells originating in the RBI around 11 hpf and these macrophages colonize the brain and retina by 55 hpf (Xu et al., 2015). Around 60 hpf, brain and retina-resident macrophages undergo a phenotypic transition, which indicates expression of mature microglial markers, such as apolipoprotein E (apo E) and phagocytic behavior toward dead cells (Herbomel et al., 2001). Importantly, early macrophages outside the brain never express apo E (Herbomel et al., 2001), suggesting that only brain and retina-resident macrophages give rise to microglia. Thus, early macrophages localized in the brain and retina by 60 hpf are generally accepted as microglial precursors in zebrafish. In this study, we focused on two macrophage markers, macrophage expressing gene 1.1 (mpeg1.1) (Ellett et al., 2011) and microfibrillar-associated protein 4 (mfap4) (Walton et al., 2015), and define mpeg1.1; mfap4-positive cells inside the optic cup as microglial precursors colonizing the zebrafish retina.

To ascertain how microglia precursors migrate from peripheral tissues into the neural retina during development, we generated a zebrafish transgenic line, Tg[mpeg1.1:EGFP], using the original DNA construct (Ellett et al., 2011). As previously reported (Ellett et al., 2011), our established transgenic line visualized ocular microglial precursors and enabled us to monitor their number and location in the optic cup from 24 to 54 hpf. Accordingly, we obtained 3D images using confocal laser scanning microscopy (LSM) (Figure 1A and B). The first microglial precursor cells appeared near the choroid fissure and lens around 30–32 hpf. After that, the number of ocular microglial precursors increased to 19.1 ± 1.26 at 42 hpf and 31.0 ± 4.44 at 54 hpf (Figure 1C), indicating a progressive increase in the number of ocular microglial precursors. We also confirmed a similar progressive increase in the number of ocular L-plastin-positive cells, although L-plastin is expressed in microglial precursors and neutrophils in zebrafish brain (Figure 1—figure supplement 1). Next, to determine more precisely the spatial distribution of microglial precursors in the optic cup, we generated another transgenic line, Tg[mfap4:tdTomato-CAAX], using the original DNA construct (Walton et al., 2015). As previously reported (Walton et al., 2015), our established transgenic line efficiently labeled ocular microglial precursor membranes. We labeled this transgenic embryo using Bodipy ceramide conjugated with fluorescent Alexa-488, which visualizes retinal layer structures (Figure 1—figure supplement 2). From 32 to 36 hpf, mfap4+ cells were mostly located in the vitreous space between the neural retina and lens, and possibly associated with ocular blood vessels, which develop around the lens. In 42–44-hpf retina, a few microglial precursor cells start to enter the neural retina and spread toward the emerging IPL, where they are associated with newly born amacrine cells (Figure 1—figure supplement 3). By 54 hpf, IPL formation is complete and microglial precursors were observed throughout all retinal tissue, except the OPL. Thus, microglial precursors enter the optic cup along the choroid fissure at 30 hpf, remain temporarily in the vitreous space between the lens and the retina, and then begin spreading into differentiating retinal tissue after 42 hpf.

Figure 1 with 4 supplements see all
Microglial precursors progressively colonize developing zebrafish retinas.

(A) Lateral view of zebrafish eyes used for confocal scanning shown in panel (B). Anterior is left and dorsal is up. The choroid fissure (cf, arrows) is formed at the ventral retina. At 32 hpf, the interface space between the neural retina (nr) and lens appears, in which ocular blood vessels are formed after 36 hpf. At 48 hpf, RGCL and INL are distinct. At 54 hpf, the ONL becomes evident. (B) Three-dimensional confocal images of mpeg1.1:EGFP-positive microglial precursors (green) in the retina from 32 to 54 hpf. Dotted circles indicate the outline of the optic cup. The first microglial precursors appear in the choroid fissure and near the lens at 32 hpf. Microglial precursors in the optic cup progressively increase in number. At 42 hpf, they start to enter retinal tissue and spread into the entire neural retina by 54 hpf. Scale: 30 µm. (C) Histogram of the number of intraocular microglial precursors from 32 to 54 hpf. Horizonal and vertical bars indicate means ± SD. (D) Three-dimensional confocal images of Tg[EF1α:mCherry-zGem; mpeg1.1:EGFP] retinas from 32 to 54 hpf. Tg[EF1α:mCherry-zGem] (magenta) indicates cells undergoing S and G2 phases. mpeg1.1:EGFP-positive microglial precursors (green) are mostly negative for mCherry-zGem, suggesting that most ocular microglial precursors are in G1 phase. Scale: 30µm. (E) Histogram of numbers of intraocular microglial precursors expressing only mpeg1.1:EGFP, and microglial precursors expressing both mCherry-zGem and mpeg1.1:EGFP in retinas from 32 to 54 hpf. Double-positive microglial precursors represent proliferating microglial precursors undergoing S/G2 phase. Single mpeg1.1:EGFP-positive microglial precursors represent microglial precursors in G1 phase. Bars and lines indicate means ± SD. (F) Sections of Tg[mpeg1.1:EGFP] transgenic retinas with BrdU incorporated and labeled with anti-BrdU (magenta) and anti-EGFP (green) antibody. Nuclei were counterstained by TOPRO3 (blue). The arrowhead indicates BrdU- and mpeg1.1:EGFP double-positive cells. Most mpeg1.1:EGFP+ cells are BrdU-negative at 54 hpf, suggesting that they are not proliferative. Scale: 20 µm. (G) Histogram of numbers of mpeg1.1:EGFP+ cells and BrdU-positive mpeg1.1:EGFP+ cells per retinal section. Bars and lines indicate means ± SD. **p < 0.01. (H) Fraction of BrdU-positive proliferative mpeg1.1:EGFP+ cells in total mpeg1.1:EGFP+ cells. The average is less than 20%, indicating that more than 80 % of ocular microglial precursors are in the G1 phase. Bars and lines indicate means ± SD.

Next, to evaluate the contribution of cell proliferation to the increasing number of ocular microglial precursors, we labeled ocular microglial precursors with markers of DNA replication. Here, we used a zebrafish transgenic line, Tg[EF1α: mCherry-zGem] that specifically marks proliferative cells in S and G2 phases (Mochizuki et al., 2017; Mochizuki et al., 2014). We combined this Tg[EF1α: mCherry-zGem] system with Tg[mpeg1.1:EGFP] to calculate the fraction of proliferative microglial precursors undergoing S phase (Figure 1D and Video 1). First, we observed mCherry-zGem; mpeg1.1:EGFP double-positive cells in the peripheral tissue (Figure 1—figure supplement 4A-C) and found that more than 60 % of mpeg1.1:EGFP-positive cells expressed mCherry-zGem (Figure 1—figure supplement 4D), confirming that this Tg[EF1α: mCherry-zGem] system works in early macrophages in zebrafish. However, in the retina, the fraction of mCherry-zGem; mpeg1.1:EGFP double-positive cells was less than 2 % of all microglial precursors from 32 to 54 hpf (Figure 1E). Furthermore, more than 80 % of mpeg1.1:EGFP-positive cells did not incorporate BrdU at 48 hpf (Figure 1F–H), suggesting that a majority of ocular microglial precursors do not undergo S phase. Thus, microglial colonization of the retina mostly depends on cell migration from outside the optic cup.

Video 1
3D rendering of an eye of Tg[EF1α: mCherry-zGem;mpeg1.1:EGFP] zebrafish embryo at 42 hpf.

mCherry-zGem signals indicate cells in S and G2 phase (magenta), whereas mpeg1.1:EGFP -positive cells are ocular microglial precursors (green). The fraction of mCherry-zGem; mpeg1.1:EGFP double-positive cells in mpeg1.1:EGFP-positive cells is very small, suggesting that almost all microglial precursors are in G1 phase.

Embryonic microglial precursor migration into the retina depends on blood vessels

The zebrafish retina receives its blood supply from two blood vessel systems, intraocular hyaloid blood vessels encapsulating the lens (Hartsock et al., 2014) and superficial choroidal blood vessels (Kaufman et al., 2015). Developing hyaloid blood vessels start to enter the space between the lens and retina through the ventral fissure at 18–20 hpf. Loop formation occurs around the lens at 24–28 hpf, and a branched hyaloid network forms after 35 hpf (Hartsock et al., 2014). Our live imaging showed that microglial precursors enter the optic cup through the choroid fissure and remain temporarily in the vitreous space between the lens and the retina before they infiltrate the neural retina (Figure 1—figure supplement 2). Furthermore, microglial precursors start to enter the optic cup after loop formation of hyaloid blood vessels is completed, suggesting a guiding role of blood vessels in microglial precursor colonization of the optic cup. To confirm whether microglial precursors entering the ocular space are associated with developing hyaloid blood vessels, we conducted time-lapse imaging of Tg[kdrl:EGFP; mfap4:tdTomato-CAAX] transgenic embryos, which visualizes endothelial cells of blood vessels (Jin et al., 2005) and ocular microglial precursors, respectively. The first microglial precursor was always associated with ocular hyaloid blood vessels around 30 hpf (Figure 2A) and moved along blood vessel surfaces (Video 2), so it is very likely that microglial precursors use blood vessels as a scaffold to enter the vitreous space between the lens and the neural retina. Microglial precursors move along hyaloid blood vessels in the ventral fissure, gradually leave vessel surfaces, and invade the neural retina through the basement membrane (Figure 2B, Figure 2—figure supplement 1, and Video 3).

Figure 2 with 3 supplements see all
Microglial precursors migrate into the retina along blood vessels.

(A) Live confocal images of Tg[kdrl:EGFP; mfap4:tdTomato-CAAX] retinas at 30 hpf. Microglial precursors and blood vessels are visualized using fluorescence of mfap4tdTomato-CAAX (magenta) and kdrl:EGFP (green), respectively. Higher magnification image of a dotted square in the left panel is shown in the right panel. The first microglial precursor (arrow) approaches along developing hyaloid blood vessels near the lens through the choroid fissure. Arrowheads indicate peripheral macrophages outside the optic cup. Scale bar: 30 μm. (B) Time-lapse 3D snapshots of Tg[kdrl:EGFP; mfap4:tdTomato-CAAX] eyes for around 3.5 hr after 32 hpf. Ocular microglial precursors and peripheral macrophages outside the optic cup are indicated as yellow- and magenta-colored, surface-rendered objects, respectively, which were prepared from the original scanning image (Figure 2—figure supplement 1). Ocular blood vessels are visualized in green. Microglia associated with hyaloid blood vessels around the lens (white arrows) gradually increase and infiltrate neurogenic retinal tissue (Video 3). Scale bar: 30 μm. (C) Live 3D images of eyes of Tg[kdrl:EGFP; mfap4:tdTomato-CAAX] embryos injected with standard MO and tnnt2a MO. kdrl:EGFP-positive blood vessels (green) are thinner in tnnt2a morphants. Scale bar: 50 μm. (D) Histogram of the number of intraocular microglial precursors in embryos injected with standard MO and tnnt2a MO. Bars and lines indicate means ± SD. ***p < 0.001.

Video 2
Live imaging of Tg[kdrl:EGFP; mfap4:tdTomato-CAAX] embryo at 30 hpf.

mfap4:tdTomato-CAAX-positive cells indicate microglial precursors (magenta), whereas kdrl:EGFP-positive cells indicate endothelial cells of blood vessels (green). Microglial precursors are moving on the surface of a developing superficial ocular blood vessel, suggesting that blood vessels act as scaffolds for migration of microglial precursors.

Video 3
Live imaging of Tg[kdrl:EGFP; mfap4:tdTomato-CAAX] embryos from 32 to 36 hpf.

mfap4:tdTomato-CAAX-positive cells indicate microglial precursors (magenta), whereas kdrl:EGFP-positive cells indicate endothelial cells of blood vessels (green). Microglial precursors use blood vessels as scaffolds to migrate into the ocular space, and gradually invade the neural retina. Surface rendering indicates amoeboid microglial precursors, which are attached to the hyaloid loop around the lens and infiltrate the neural retina.

Troponin T2A (tnnt2a; silent heart) is specifically expressed in heart and is essential for heart contraction (Sehnert et al., 2002). In zebrafish brain and mouse retina, hemodynamics drive blood vessel pruning, and loss of blood circulation causes blood vessel regression (Chen et al., 2012; Lobov et al., 2011; Yashiro et al., 2007). To examine whether the entry of microglial precursors into retina is altered upon blood vessel regression, we blocked blood circulation by injecting morpholino antisense oligos against tnnt2a (tnnt2a MO). When blood circulation is inhibited, ocular hyaloid blood vessels do not develop fully and microglial precursors are less likely to be associated with these thin blood vessels (Figure 2C). The number of ocular microglial precursors was significantly reduced at 36 hpf (Figure 2D), showing that microglial colonization of the optic cup depends upon normal development of the blood vessel network. This is in contrast to the case of microglial colonization of zebrafish midbrain and optic tectum, which is independent of the blood vessel network (Xu et al., 2016). Indeed, we confirmed that the number of microglial precursors in the optic tectum was not significantly different between tnnt2a morphants and standard MO-injected embryos at 72 hpf, although microglial precursor colonization of the optic tectum was enhanced in tnnt2a morphants at 48 hpf (Figure 2—figure supplement 2).

Recent studies indicate that microglia facilitate ocular blood vessel development (Checchin et al., 2006; Fantin et al., 2010; Rymo et al., 2011), and that macrophages initiate a cell-death program in endothelial cells for blood vessel regression in developing mouse retina (Lang and Bishop, 1993; Lobov et al., 2005). However, we eliminated microglial precursors with morpholino antisense oligos against pu.1 (pu.1-MO) or interferon regulatory factor 8 (irf8) mutation (irf8 gene knockdown causes apoptosis of pu.1-positive myeloid cells) (Shiau et al., 2015), and confirmed that microglial precursor elimination did not affect hyaloid blood vessel formation in zebrafish at least by 48 hpf (Figure 2—figure supplement 3).

Microglial precursors infiltrate the neural retina preferentially through the differentiating neurogenic area

In zebrafish, retinal neurogenesis occurs at the ventronasal retina adjacent to the optic stalk at 25 hpf and propagates into the entire region of the neural retina at 33 hpf (Masai et al., 2000). Microglial precursors start to migrate from the vitreous space into the neural retina after 42 hpf, when the earliest differentiating retinal neurons, RGCs, start to form the IPL (Mumm et al., 2006). To examine the role of retinal neurogenesis and RGC differentiation in microglia precursor infiltration of the neural retina, we used double transgenic lines, Tg[EF1α: mCherry-zGem; mpeg1.1:EGFP], which enable us to examine the relationship between microglial precursor migration and retinal progenitor cells (Mochizuki et al., 2014). Live imaging of Tg[EF1α: mCherry-zGem; mpeg1.1:EGFP] retinas at 42 and 48 hpf clearly showed that microglial precursors avoid mCherry-zGem-positive proliferating regions and are preferentially positioned in the region of mCherry-zGem-negative post-mitotic cells (Figure 3A–B, Figure 3—figure supplement 1). The fraction of microglial precursors that infiltrated mCherry-zGem-positive proliferating regions was 7.37 % at 42 hpf and 6.13 % at 48 hpf (Figure 3C), suggesting that >90% of microglial precursors infiltrate the retina through the mCherry-zGem-negative post-mitotic cell region. We also used another transgenic line Tg[ath5:EGFP; mfap4:tdTomato-CAAX]. In the Tg[ath5:EGFP] line, EGFP starts to be expressed in G2 phase of the final neurogenic cell division of retinal progenitor cells and is inherited by their daughter cells, which are negative for BrdU incorporation (Poggi et al., 2005; Yamaguchi et al., 2010), suggesting that ath5:EGFP specifically marks early differentiating retinal neurons. We conducted live imaging of Tg[ath5:EGFP; mfap4:tdTomato-CAAX] retinas at 36, 42, 48 hpf, and found that infiltration of mfap4-positive microglia preferentially occurs in the ath5:EGFP-positive region (Figure 3D). These data suggest that microglial precursors infiltrate the neural retina preferentially through the neurogenic area, raising the possibility that the neurogenic retinal region acts as a gateway through which microglial precursors move from the vitreous space into the neural retina.

Figure 3 with 3 supplements see all
Microglial precursors infiltrate the retina through the neurogenic area.

(A) Schematic drawing of confocal scanning planes (superficial, middle, and deep layers) in the optic cup shown in (B) and (D). (B) Live images of Tg[EF1α:mCherry-zGem; mpeg1.1:EGFP] retinas at 42 hpf (upper panels) and 48 hpf (lower panels). Two levels of confocal scanning planes are indicated as superficial (a’, a’’) and deep positions (c’, c’’). mpeg1.1:EGFP positive microglial precursors avoid mCherry-zGem positive proliferating retinal cell area. Scale bar: 50 μm. (C) Histogram of the fraction of microglial precursors associated with the mCherry-zGem-positive area (black) and the mCherry-zGem-negative area (grey). The fraction of microglial precursors associated with the mCherry-zGem-positive area is only 7.37 % at 42 hpf and 6.13 % at 48 hpf. Thus, more than 90 % of microglial precursors are located in the mCherry-zGem-negative retinal area. (D) Live images of Tg[ath5:EGFP; mfap4:tdTomato-CAAX] retinas at 36 (upper panels), 42 (middle panels) and 48 hpf (bottom panels). Three confocal scanning plane levels are indicated as superficial (a’-a”’), middle (b’-b”’), and deep (c-c”’). Dotted circles indicate the outline of the optic cup. The right-most column images indicate higher magnification images shown in the square of left panels. mfap4-positive microglia (magenta, arrows) are closely associated with ath5-positive neurogenic cells (green). Scale bar: 50 μm, except the right-most column images (Scale bar: 15 μm).

Colonization of the optic tectum by microglial precursors depends on neuronal apoptosis in zebrafish (Casano et al., 2016; Xu et al., 2016). Therefore, it is still possible that microglial precursors preferentially infiltrate the neural retina through the neurogenic region, because of neuronal apoptosis. We inhibited retinal apoptosis by injecting morpholino antisense oligos against p53 (p53 MO) and confirmed that p53 MO effectively suppresses retinal apoptosis at 24 and 36 hpf (Figure 3—figure supplement 2). However, the number of microglial precursors did not differ between p53 morphant retinas and standard-MO-injected retinas at 48 hpf (Figure 3—figure supplement 3A-B), whereas the number of microglial precursors was significantly decreased in p53 morphant optic tectum compared with standard-MO-injected optic tectum at 96 hpf (Figure 3—figure supplement 3C-D). Thus, in contrast to microglial colonization of the optic tectum, neuronal apoptosis is not the major cue for microglial precursor colonization of the retina, at least prior to 54 hpf.

Neurogenesis acts as a gateway for microglial precursors to enter the retina

To confirm the possibility that the neurogenic retinal region functions as a gateway for microglial precursors to infiltrate the retina, we examined whether microglial precursor migration into the retina is compromised when retinal neurogenesis is affected. Previously, we found that histone genesis slowed in zebrafish stem loop binding protein 1 (slbp1) mutants, leading to severe delays in retinal neurogenesis (Imai et al., 2014). Our bulk RNAseq analysis confirmed that retinal neurogenesis and subsequent neuronal differentiation were markedly delayed in zebrafish slbp1 mutants (Figure 4—figure supplement 1), such that ath5 expression spread into the entire slbp1 mutant retina only at 48 hpf, an event that occurs in wild-type retina at 33 hpf (Imai et al., 2014). We combined slbp1 mutants with transgenic lines Tg[ath5:EGFP; mfap4: tdTomato-CAAX] and examined the number of ocular mfap4:tdTomato-CAAX-positive microglial precursors (Figure 4A, Figure 4—figure supplements 2A and 3). In 48-hpf slbp1 mutant retinas, the number of ocular microglial precursors was 4.67 ± 2.42 (Figure 4A and B), which is similar to the number in wild-type retinas at 32 hpf (Figure 1B), whereas the number of ocular microglial precursors in wild-type siblings was 17.60 ± 5.13 at 48 hpf (Figure 4A and B). To confirm whether the slbp1 mutation interferes with genesis of early macrophages, we examined peripheral mfap4+ cells in the tail/trunk region of slbp1 mutants and wild-type sibling embryos. There was no significant difference in mfap4+ cells between slbp1 mutants and wild-type siblings in the trunk/tail region (Figure 4C and D), indicating that the slbp1 mutation does not influence early macrophage specification in zebrafish embryos. Although inhibition of retinal apoptosis by p53 MO does not influence microglial precursor colonization of the retina (Figure 3—figure supplement 3A-B ), we examined the level of retinal apoptosis in slbp1 mutants. TUNEL revealed that apoptosis was increased in slbp1 mutant retinas compared with wild-type sibling retinas (Figure 4—figure supplement 4). These data exclude the possibility that decreased retinal apoptosis affects microglial precursor colonization of the retina in slbp1 mutants, and again confirm that neuronal apoptosis is not the major cue for microglial precursor colonization of the retina.

Figure 4 with 8 supplements see all
Microglial precursor infiltration into the retina depends on retinal neurogenesis.

(A) Live 3D images of wild-type and slbp1 mutant retinas with Tg[mfap4:tdTomato-CAAX; ath5:EGFP] at 49 hpf. Only mfap4:tdTomato-CAAX-positive ocular microglial precursors and peripheral macrophages are shown as surface-rendered objects. Original images are shown in Figure 4—figure supplement 2A. Scale bar: 30 μm. (B) Histogram of numbers of ocular microglial precursors in slbp1 mutants and wild-type siblings. mfap4-positive microglial precursors are significantly fewer in slbp1 mutants. Bars and lines indicate means ± SD. ***p < 0.001. (C) Live 3D images of wild-type and slbp1 mutant trunk with Tg[mfap4:tdTomato-CAAX; ath5:EGFP] at 49 hpf. Scale bar: 70 μm. (D) Histogram of numbers of trunk macrophages in slbp1 mutants and wild-type siblings. There is no significant difference in mfap4-positive macrophage number in trunks of slbp1 mutants. Bars and lines indicate means ± SD. (E) Live 3D images of retinas of Tg[rx1:gal4-VP16; mfap4:tdTomato-CAAX] embryos injected with one DNA construct encoding UAS:EGFP (left) or two DNA constructs encoding UAS:EGFP; UAS:myc-tagged NICD (right) at 44 hpf. Only mfap4:tdTomato-CAAX-positive ocular microglial precursors and peripheral macrophages are shown as surface-rendered objects. Original images are shown in Figure 4—figure supplement 2B. Scale bar: 30 μm. (F) Histogram of numbers of ocular microglial precursors in rx1:gal4-VP16; UAS:EGFP expressed and rx1:gal4-VP16; UAS:EGFP; UAS:myc-NICD expressed wild-type retinas. mfap4-positive microglia are significantly decreased in myc-NICD expressed retinas, compared with non-injection control and EGFP expressed control retinas. Bars and lines indicate means ± SD. *P < 0.05, ***P < 0.001. (G) Live 3D images of standard MO- and ath5 MO-injected retinas of Tg[mfap4:tdTomato-CAAX; ath5:EGFP] embryos at 49 hpf. Only mfap4:tdTomato-CAAX-positive ocular microglial precursors and peripheral macrophages are shown as surface-rendered objects. Original images are shown in Figure 4—figure supplement 2C. Scale bar: 30 μm. (H) Histogram of numbers of ocular microglial precursors in standard MO and ath5 MO-injected wild-type retinas. mfap4-positive microglial precursors are significantly less numerous in ath5 morphant retinas. Bars and lines indicate means ± SD. *p < 0.05.

Mouse brain cortex colonization by microglia depends on the Cxcl12a-CxcR4 signaling axis (Arnò et al., 2014). We previously reported that cxcl12a expression is absent in the optic stalk of zebrafish slbp1 mutants (Imai et al., 2014). To exclude the possibility that the absence of cxcl12a expression in the optic stalk affects microglial colonization of the retina in zebrafish slbp1 mutants, we examined zebrafish cxcl12a morphants. Injection of cxcl12a-MO at 500 μM, which effectively induces RGC axon trajectory defects reported in zebrafish odysseys mutants carrying mutations in cxcl12a receptor, cxcr4b (Li et al., 2005), did not affect the number of ocular microglial precursors (Figure 4—figure supplement 5). Thus, Cxcl12a-CxcR4 signaling is not involved in microglial colonization defects in slbp1 mutants. We also confirmed that elimination of microglial precursors with pu.1 MO did not affect the rate of retinal neurogenesis or cell differentiation by 72 hpf (Figure 4—figure supplement 6).

We previously showed that overexpression of Notch1 intracellular domain (NICD) suppresses retinal neurogenesis in zebrafish (Yamaguchi et al., 2005). We confirmed that overexpression of NICD suppresses retinal neurogenesis in zebrafish by injecting a DNA expression construct encoding UAS:myc-NICD (Scheer and Campos-Ortega, 1999) into Tg[hsp:gal4; ath5:EGFP] double transgenic embryos (Figure 4—figure supplement 7). Next, we examined whether microglial precursor infiltration of the retina is compromised in retinas overexpressing NICD. We established a zebrafish transgenic line, Tg[rx1:gal4-VP16], which expresses Gal4-VP16 under control of a retinal progenitor-specific promoter rx1 (Chuang et al., 1999), and then injected two DNA expression constructs encoding UAS:EGFP (Köster and Fraser, 2001) and UAS:myc-NICD into Tg[rx1:gal4-VP16; mfap4:tdTomato-CAAX] double-transgenic embryos. Embryos injected with only the DNA construct of UAS:EGFP served as a positive control. We selected embryos in which EGFP was expressed in most retinal cells at 24 hpf and used them for further analysis. The number of ocular microglial precursors was significantly reduced in embryos overexpressing NICD and EGFP, compared with control embryos overexpressing EGFP, at 44 hpf (Figure 4E and F, Figure 4—figure supplements 2B and 3). These data support the possibility that the retinal neurogenic region functions as a gateway for microglia to infiltrate the retina.

The blockade of retinal neurogenesis delays differentiation of the first-born retinal cell-type, RGCs. To examine whether blockade of RGC differentiation affects microglial precursor colonization of the neural retina, we applied an antisense morpholino against ath5 (known as atoh7) (ath5 MO). As with the zebrafish ath5 mutant, lakritz (Kay et al., 2001), RGC differentiation was specifically inhibited in ath5 morphant retinas (Figure 4—figure supplement 8A, B). In ath5 morphants, the timing of the first appearance of microglial precursors in the ocular vitreous space was not altered, but the number of ocular microglial precursors was significantly decreased at 49 hpf (Figure 4G and H, and Figure 4—figure supplements 2C and 3 and 8 C), suggesting that RGC differentiation or RGC-mediated IPL formation is required for microglial precursor infiltration into the neural retina.

Microglial precursors preferentially associate with neurogenic retinal columns

To determine whether microglia precursors have greater affinity for differentiating neurons than for retinal progenitor cells, we carried out two sets of experiments. First, we conducted cell transplant experiments using a wild-type donor line and an slbp1 mutant recipient line carrying Tg[mfap4:tdTomato-CAAX]. Wild-type donor cells were transplanted into slbp1 mutant recipient embryos at the blastula stage. We selected slbp1 mutant and wild-type sibling embryos in which wild-type, donor retinal cell columns were introduced in a mosaic manner at 48 hpf (Figure 5A). Host microglial precursors and donor retinal cells were visualized with mfap4:tdTomato-CAAX and Alexa-488 Dextran, respectively. In slbp1 mutant host retinas, microglial precursors were likely to be associated with donor wild-type retinal columns more frequently than in wild-type host retinas (Figure 5B). To analyze these data statistically, we compared eyes in which wild-type donors were transplanted into wild-type hosts with those in which wild-type donors were transplanted into slbp1 mutant hosts (Figure 5—figure supplement 1A-B). The fraction of microglial precursors associated with donor wild-type retinal columns in total ocular microglial precursors was significantly higher in slbp1 mutant host retinas than in wild-type sibling host retinas at 48 hpf (Figure 5C), suggesting that microglial precursors are more attracted by wild-type donor neurogenic retinal columns than surrounding slbp1 mutant proliferative retinal cells. Since the fraction of microglial precursors associated with donor retinal columns in total microglial precursors may depend on the number of donor retinal columns incorporated into host retinas, we next estimated trapping efficiency of microglial precursors per donor column by dividing the fraction of microglial precursors associated with donor columns with the transplanted donor column number in each eye (Figure 5—figure supplement 1B). Trapping efficiency of microglial precursors per donor column was significantly higher in slbp1 mutant host retinas than in wild-type sibling host retinas (Figure 5D), suggesting that microglial precursors are preferentially associated with donor-derived wild-type retinal cells than with host-derived slbp1 mutant retinal cells.

Figure 5 with 1 supplement see all
Microglial precursors are preferentially associated with neurogenic retinal columns.

(A) Schematic drawing of cell transplantation experiments. Wild-type donor embryos are labeled with Alexa-448-dextran and transplanted into slbp1 mutant recipient embryos at blastula stage. In slbp1 mutant recipient embryos, transplanted wild-type donor cells form retinal cell columns. The host slbp1 mutant line is combined with Tg[mfap4:tdTomato-CAAX], to investigate whether mfap4-positive microglial precursors (magenta) infiltrate the neural retina preferentially through Alexa-448-dextran-labeled, wild-type donor columns (green) in slbp1 mutant recipient embryos. (B) Live images of slbp1 mutant retinas with transplanted wild-type donor retinal cell columns at 48 hpf. Donor wild-type retinal cell columns are labeled with Alexa-488 dextran (green). Host microglial precursors are visualized with the transgene Tg[mfap4:tdTomato-CAAX] (magenta). Dotted circles indicate the outline of the optic cup. Many microglial precursors are associated with wild-type donor retinal columns in slbp1 mutant host retinas (right panel), compared with wild-type sibling host retinas (left panel). Scale bar: 30 μm (C) The fraction of mfap4-positive microglial precursors associated with donor transplanted retinal cell columns versus the total number of microglial precursors in the optic cup. The average fraction of mfap4-positive cells associated with donor retinal cell columns is significantly higher in slbp1 mutant host retinas than in wild-type host retinas. Bars and lines indicate means ± SD. *p < 0.05. (D) The trapping efficiency of mfap4-positive microglial precursors per donor column. The average trapping efficiency is significantly higher in slbp1 mutant host retinas than in wild-type host retinas, suggesting higher affinity of microglial precursors for neurogenic retinal cells. Bars and lines indicate means ± SD. **p < 0.01. (E) Schematic drawing of mosaic expression of NICD in retinas. A mixture of UAS:EGFP and UAS-myc-NICD plasmids was injected into fertilized eggs of the Tg[hsp:gal4; mfap4:tdTomato] transgenic line, which were treated by heat shock at 18 and 30 hpf. At 48 hpf, embryos were fixed to prepare serial retinal sections for imaging analysis. (F) Confocal scanning of retinal sections of Tg[hsp:gal4; mfap4:tdTomato] transgenic embryos injected with plasmids encoding UAS:EGFP or UAS:EGFP+ UAS:myc-NICD. Scale bar: 30 μm. (G) The fraction of mfap4-positive microglial precursors associated with EGFP-expressing retinal cell columns versus the total number of microglial precursors in the optic cup. The average fraction of mfap4-positive cells associated with EGFP-positive retinal columns is significantly lower in retinas injected with UAS:EGFP+ UAS:myc-NICD than with only UAS:EGFP control. Bars and lines indicate means ± SD. ***p < 0.005. (H) The trapping efficiency of mfap4-positive microglial precursors per EGFP-expressing retinal cell columns. The average trapping efficiency is significantly lower in retinas injected with UAS:EGFP+ UAS:myc-NICD than with only UAS:EGFP control, suggesting less affinity of microglial precursors for proliferative NICD-expressing retinal cells. Bars and lines indicate means ± SD. *p < 0.05.

Second, we injected two DNA constructs encoding UAS:EGFP and UAS:mycNICD into Tg[hsp:gal4; mfap4:tdTomato-CAAX] double-transgenic wild-type embryos. Two rounds of heat-shock treatment at 18 and 30 hpf induced expression of NICD and EGFP in a mosaic manner in the retina (Figure 5E). We examined the fraction of mfap4:tdTomato-CAAX-positive microglial precursors associated with EGFP-expressing retinal columns in the total number of mfap4:tdTomato-CAAX-positive microglial precursors (Figure 5F). This fraction was significantly lower in retinas overexpressing NICD and EGFP than in control retinas overexpressing only EGFP (Figure 5G, Figure 5—figure supplement 1C). We also confirmed that trapping efficiency of mfap4:tdTomato-CAAX-positive microglial precursors per EGFP-positive retinal column was significantly lower in retinas overexpressing NICD and EGFP than in retinas overexpressing only EGFP (Figure 5H, Figure 5—figure supplement 1C). Thus, microglial precursors are less attracted by retinal columns in which neurogenesis is arrested. Taken together, these data suggest that microglial precursors preferentially associate with neurogenic retinal columns as opposed to proliferative retinal columns.

IL34 is involved in microglial precursor colonization of the retina

Recently, it was reported that microglial colonization of zebrafish brain, including retina, depends on CSF-R, and that one of the CSF-R ligands, IL34, dominates this process (Wu et al., 2018). In adult mouse retina, RGCs express IL34, which attracts one subset of microglia and retains them around the IPL niche (O’Koren et al., 2019). First, we confirmed that retinal cell differentiation proceeds normally until 72 hpf in zebrafish il34 mutants, although pyknotic nuclei were stochastically observed in RGC and amacrine cell layers (Figure 6—figure supplement 1). Next, we examined microglial precursor colonization of the retina. The number of ocular microglial precursors was significantly lower in il34 homozygous mutants than in wild-type siblings at 34 hpf (Figure 6—figure supplement 2) and 48 hpf (Figure 6A and B). Thus, consistent with the previous report (Wu et al., 2018), IL34 is required for microglial precursor colonization of the retina in zebrafish. However, il34 mRNA expression is comparable in slbp1 mutant heads and wild-type sibling heads at 48 hpf (Figure 6—figure supplement 3), suggesting that il34 mRNA expression is not linked to retinal neurogenesis. Since the number of ocular microglial precursors in il34 homozygous mutants was zero at 34 hpf (Figure 6—figure supplement 2) and no more than two, if any, at 48 hpf (Figure 6B), it is likely that Csf1r-il34 signaling promotes microglial precursor movement from yolk to the optic cup upstream of the blood-vessel-mediated guidance mechanism (Figure 6C).

Figure 6 with 3 supplements see all
IL34 is required for colonization of the optic cup by microglial precursors.

(A) Confocal 3D scanning of 48 hpf wild-type, il34 heterozygous and homozygous mutant retinas carrying the Tg[mfap4:tdTomato-CAAX] transgene. At 48 hpf, iridophores start to differentiate around the optic cup, which causes a noise signal (magenta) in confocal scanning. Using the surface-rendering tool of Imaris software (Bitplane), we eliminated iridophore-derived noise and extracted mfap4:tdTomato-CAAX signals from ocular microglial precursors (green) (see the legend of Figure 4—figure supplement 3). Scale bar: 50 μm. (B) Histogram of numbers of ocular microglial precursors in wild-type, il34 heterozygous and homozygous mutant retinas at 48 hpf. The number of ocular microglial precursors is almost zero, and very few, if any (one or two), in il34 homozygous mutants, indicating that ocular microglial precursors are significantly reduced in il34 homozygous mutants. The number of ocular microglial precursors is mildly reduced in il34 heterozygous mutants, but does not differ significantly from that of wild-type siblings. Bars and lines indicate means ± SD. ***p < 0.005. (C) A possible model of the guidance mechanism of microglial precursor into zebrafish retina. IL34 is involved in movement of microglial precursors toward the brain. Microglial precursors continue into the optic cup along blood vessels, and subsequently infiltrate the neural retina through the neurogenic area.

Discussion

In zebrafish, primitive microglia originate from the RBI, which is a hematopoietic tissue equivalent to mouse yolk sac, whereas definitive microglia are generated from hematopoietic stem cells that are specified in the VDA (Ferrero et al., 2018; Xu et al., 2015). Primitive and definitive waves of hematopoiesis generate embryonic and adult microglia, respectively. Using zebrafish as an animal model, several groups investigated microglial colonization from the periphery into developing brain, especially the optic tectum, which is part of the midbrain (Casano et al., 2016; Herbomel et al., 2001; Svahn et al., 2013; Wu et al., 2018; Xu et al., 2016). Colonization of the optic tectum by microglial precursors depends on neuronal apoptosis, probably through attraction by an apoptotic cell-secreted phospholipid, lysophosphatidylcholine (LPC) (Casano et al., 2016; Xu et al., 2016). In addition, microglial colonization of brain is CSF receptor-dependent (Herbomel et al., 2001; Wu et al., 2018). In mice, microglial colonization of brain requires functional blood circulation (Ginhoux et al., 2010). However, in zebrafish, microglial colonization of the optic tectum is independent of blood circulation (Xu et al., 2016). A series of elegant studies revealed the molecular network that promotes microglial colonization of the midbrain. However, it remains to be seen whether this mechanism fully explains colonization of other brain regions by microglial precursors. In this study, we focused on zebrafish retina and investigated the mechanism that regulates migration of embryonic microglial precursors into developing retina.

We first conducted live imaging of zebrafish microglial precursors from 24 to 54 hpf. Microglial precursors progressively increase in number during embryonic development. Interestingly, almost all microglial precursors enter the optic cup through the choroid fissure. However, peripheral macrophages located in the mesenchymal region between the eye and the brain did not enter the optic cup across the ciliary marginal zone. This may be consistent with the observation that these peripheral macrophages never enter the retina following rod cell death (White et al., 2017), suggesting a functional difference between peripheral macrophages and ocular microglia. Next, we found that the majority of ocular microglial precursors do not undergo S phase and are probably in G1 phase. Thus, the increase of ocular microglial precursors is due to migration from outside the eye. In developing mouse retina, microglial precursors appear from the vitreous area near the optic disk at E11.5, progressively increase in number, and then infiltrate the neural retina. These retinal microglia were also negative for a proliferative marker, Ki67 (Santos et al., 2008), suggesting that mouse embryonic retinal microglia are also non-proliferative.

Another interesting finding is that entry of microglial precursors into the optic cup through the choroid fissure depends on ocular blood vessels. We observed that migrating microglial precursors are closely associated with hyaloid blood vessels after loop formation. These microglial precursors pass along these vessels, which traverse the choroid fissure and surround the posterior region of the lens. Furthermore, the number of ocular microglial precursors was reduced when blood circulation was blocked. Since inhibition of blood circulation compromises the structural integrity of blood vessels in zebrafish, we conclude that ocular blood vessel formation is required for microglial precursor entry into the optic cup through the choroid fissure. One possibility is that blood vessels function as a path upon which microglial precursors enter the optic cup. Membrane proteins or extracellular matrix proteins on blood endothelial cells may facilitate the association of microglial precursors with blood vessel surfaces. Alternatively, substances that attract microglial precursors may be released from hyaloid blood endothelial cells. Previous studies on human and murine microglia demonstrated that microglial colonization of the retina takes place prior to retinal vascularization, and that microglia facilitate ocular blood vessel development (Checchin et al., 2006; Fantin et al., 2010; Rymo et al., 2011). Macrophages initiate endothelial cell death for blood vessel regression in developing mouse retina (Lang and Bishop, 1993; Lobov et al., 2005). However, in contrast to mammals, elimination of microglia by pu.1 MO or irf8 mutation did not affect ocular blood vessel formation in zebrafish, suggesting that microglia do not regulate ocular blood vessel formation in zebrafish. Interestingly, classic histological studies on mouse retinas showed that early emerging ocular microglia are associated with the hyaloid artery (Hume et al., 1983; Santos et al., 2008), which is located in the vitreous area and regresses in later stages before retinal vasculature formation (Ito and Yoshioka, 1999). Thus, further investigation will be necessary to determine whether the hyaloid artery guides microglial precursors into the optic cup in vertebrate species such as mice. In zebrafish, colonization of the optic tectum by microglia is independent of blood circulation (Xu et al., 2016). We confirmed that the number of microglia in the optic tectum did not differ between tnnt2a morphants and control embryos at 72 hpf; however, microglial colonization of the optic tectum was enhanced and microglial shape was round rather ramified in tnnt2a morphants at 48 hpf. Further study will be necessary to clarify the role of blood circulation in microglial colonization of the optic tectum.

After 42 hpf, microglial precursors detach from hyaloid blood vessels and start to infiltrate the neural retina. Interestingly, we found that more than 90 % of microglial precursors enter the neural retina through the neurogenic area. Indeed, the number of microglial precursors is reduced in slbp1 mutant retinas and NICD-overexpressing retinas, in both of which retinal neurogenesis is severely delayed. Furthermore, we conducted two sets of experiments: the first was cell transplantation from wild-type donor cells into slbp1 mutant host retinas, which introduced neurogenic wild-type retinal cell columns in proliferative slbp1 mutant retinas, and the second was overexpression of NICD in wild-type retina, which introduced proliferative retinal cell columns in neurogenic retinas. Consistently, in both cases, microglial precursors were preferentially associated with neurogenic retinal cell columns. Thus, neurogenesis is required for infiltration of microglial precursors into the neural retina after 42 hpf. We observed that the number of microglial precursors is diminished in ath5 morphant retinas, suggesting that RGCs are required for infiltration of microglial precursors into the neural retina. There are at least three possible mechanisms for this infiltration. First, the basal region of retinal progenitor cells may function as a physical barrier that inhibits microglial precursor infiltration of the neural retina. Second, microglial precursors may be attracted to surfaces of differentiating retinal neurons or RGCs. Third, differentiating retinal neurons or RGCs may release a specific attractant for microglia. There are several candidate molecules that suggest the third possibility. In adult mice, RGCs express IL34, which attracts microglia and retains them around the IPL niche (O’Koren et al., 2019). Indeed, microglial colonization of zebrafish brain depends on CSF-R, and one of the CSF-R ligands, IL34, dominates this process (Wu et al., 2018). We confirmed that microglial precursor colonization of retina is severely affected in il34 mutants. However, il34 mRNA expression is comparable in slbp1 mutants and their wild-type siblings, suggesting that IL34 is not linked to neurogenesis-mediated microglial precursor infiltration. Rather, the number of ocular microglial precursors in il34 mutants was almost zero at 34 and 48 hpf, so it is very likely that Csf1r-il34 signaling initiates microglial precursor movement from yolk toward brain and retina, followed by blood vessel- and neurogenesis-mediated guidance.

It was reported that apoptosis attracts microglia in zebrafish developing brain (Casano et al., 2016; Xu et al., 2016). However, microglial precursor colonization of the retina is normal in zebrafish p53 morphants, suggesting that apoptosis does not promote microglial precursor colonization of the retina. Why are microglial precursors insensitive to retinal apoptosis? We found that apoptosis is enhanced in zebrafish slbp1 mutant retinas, in which microglial precursor colonization is severely affected due to a delay of retinal neurogenesis. It is likely that spontaneous apoptotic cells fail to be eliminated because of the reduced number of microglial precursors in slbp1 mutant retinas; however, interestingly, these increased dead cells did not promote microglial precursor infiltration into slbp1 mutant retinas, suggesting that neurogenesis primarily opens the gate through which microglial precursors enter the neural retina. Since retinal neurogenesis normally occurs from 24 to 48 hpf in zebrafish, microglial precursors could not be attracted by apoptosis without the infiltration path opened by neurogenesis before 48 hpf. Further studies will be necessary to unveil the molecular mechanism underlying microglial infiltration into neural retina.

In summary, there are three mechanisms for microglial colonization of developing zebrafish retina (Figure 6C). IL34-CSF-R signaling initiates microglial precursor movement from yolk toward brain and retina. Microglial precursors further use ocular hyaloid blood vessels as a pathway to enter the optic cup and then infiltrate the neural retina preferentially through the neurogenic region. In the future, it remains to identify molecules involved in blood-vessel- and neurogenesis-mediated guidance mechanisms, and to assess whether these mechanisms are used for microglial colonization of other brain regions in other vertebrate species.

Materials and methods

Fish strains

Request a detailed protocol

Zebrafish (Danio rerio) were maintained using standard procedures (Westerfield, 1993). RIKEN wako (RW) was used as a wild-type strain for mutagenesis (Masai et al., 2003). slbp1rw440 (Imai et al., 2014), irf8st96 (Shiau et al., 2015) and il34hkz11 (Wu et al., 2018) were used. Transgenic lines Tg[ath5:EGFP]rw021 were used to monitor ath5 gene expression (Masai et al., 2005). Tg[EF1α:mCherry-zGem]oki011 (Mochizuki et al., 2014) was used for visualization of cell-cycle phases. Tg[mfap4:tdTomato-CAAX]oki058 and Tg[mpeg1.1:EGFP]oki053 were used to visualize microglial precursors. Tg[kdrl:EGFP]s843Tg was employed to visualize blood vessels (Jin et al., 2005). Tg[hsp:gal4]kca4 (Scheer et al., 2002) and Tg[rx1:gal4-VP16]oki065 were used for UAS-mediated expression of target genes. For confocal scanning, embryos were incubated with 0.003 % phenyltiourea (PTU) (Nacalai tesque, 27429–22) to prevent melanophore pigmentation. The zebrafish pigmentation mutant, roy orbison (roy) (D’Agati et al., 2017) was used to remove iridophores.

Establishment of Tg[mpeg1.1:EGFP] and Tg[mfap4:tdTomato-CAAX] transgenic lines

Request a detailed protocol

The DNA construct encoding mpeg1.1:EGFP was kindly provided by Dr. Graham Lieschke and we are indebted to Dr. David Tobin for the construct encoding mfap4:tdTomato-CAAX. These DNA constructs were injected into fertilized eggs with Tol2 transposase mRNA, to establish transgenic lines, Tg[mpeg1.1:EGFP] and Tg[mfap4:tdTomato-CAAX] in our lab.

Histology

Request a detailed protocol

Plastic sectioning and immunolabeling of cryosections were carried out as previously described (Masai et al., 2003). Anti-GFP (Themo Fisher Scientific, A11122), anti-myc-tag (Invitrogen, R950-25), zn5 (Oregon Monoclonal Bank) and zpr1 (Oregon Monoclonal Bank) antibodies were used at 1:200; 1:250, 1:100, and 1:100 dilutions, respectively. For detection of BrdU incorporation, BrdU (Nacalai, tesque, 05650–95) was applied to 52-hpf embryos, chased for 2 hr at 28.5 °C and fixed with 4 % paraformaldehyde (PFA). Labeling of retinal sections with anti-BrdU antibody (BioRad, MCA2060) was carried out as previously described (Yamaguchi et al., 2005). TUNEL was performed using an In Situ Cell Death Detection Kit (Roche, 11684795910). Bodipy-ceramide (Thermo Fisher Scientific, B22650) was applied to visualize retinal layers as previously described (Masai et al., 2003). Nuclear staining was performed using 1 nM TOPRO3 (Thermo Fisher Scientific, T3605).

Morpholino

Request a detailed protocol

Morpholino antisense oligos were designed as shown below.

Morpholino antisense oligos were injected into fertilized eggs at 500 µM for tnnt2a MO and cxcl12a MO; 250 µM for ath5 MO and pu.1 MO and 100 µM for p53 MO. The same concentration was used for Standard MO in each MO experiment.

Cell transplantation

Request a detailed protocol

Cell transplantation was performed as previously described (Masai et al., 2003). Wild-type zygotes were injected with Alexa-488 dextran (Thermo Fisher Scientific, D22910) and used for donor embryos. slbp1 mutant embryos carrying Tg[mfap4:tdTomato-CAAX] were used as host embryos. Host embryos carrying donor retinal cells were selected by observing Alexa 488 fluorescence at 24 hpf. slbp1 mutant and wild-type sibling embryos were sorted based on the slbp1 mutant morphological phenotype at 48 hpf and used for live imaging. After confocal images were obtained, the number of ocular mfap4-positive microglial precursors associated with Alexa-488 dextran-labeled donor transplanted retinal columns was counted. The fraction of ocular mfap4-positive microglial precursors associated with donor transplanted retinal columns in total ocular microglial precursors was calculated. The trapping efficiency of ocular mfap4-positive microglial precursors per transplanted donor retinal column was calculated using the total number of donor transplanted retinal columns in the retina. Detailed information on each transplanted eye is shown in Figure 5—figure supplement 1A-B.

Live imaging and analyses

Request a detailed protocol

Transgene lines Tg[mpeg1.1:EGFP] or Tg[mfap4:tdTomato-CAAX], and Tg[kdrl:EGFP], were used for time-lapse imaging of microglial precursors and blood vessels. 3D confocal images were obtained using a confocal LSM, LSM710 (Zeiss) or an FV3000RS (Olympus), and analyzed using ImageJ (2.0.0-rc-69/1.52 p) and Imaris software (ver.9.1.2 Bitplane). The DNA construct encoding Ptf1a:EGFP was used for visualizing amacrine cells or their progenitors (Jusuf and Harris, 2009).

RNA extraction

Request a detailed protocol

Heads of 48 hpf wild-type sibling and slbp1 mutant embryos were dissected and transferred to 100 μL Sepasol (Nacalai tesque, 09379) on ice. Heads were then homogenized using a hand homogenizer (~20 pulses). Twenty μL CHCl3 were then added to samples and mixed gently. After centrifugation at 15,000 g for 15 min, the aqueous phase was collected and mixed with 100 μL isopropanol. One μL of RNase-free glycogen (Nacalai tesque 11170–11, 20 mg/mL) was added to all samples to increase the yield. After incubating at room temperature for 10 min, samples were centrifuged at 15,000 g at 4 °C for 15 min. Supernatant was removed and the pellet was washed three times with 500 μL of 75 % ethanol and centrifuged at 8000 g at 4 °C. The pellet was then resuspended in a desired amount of nuclease-free water and stored at –80 °C. RNA concentration and purity of samples were determined using a Nanodrop.

RNA sequencing and analysis

Request a detailed protocol

RNA samples with RIN >7 were subjected to paired-end sequencing using an Illumina HiSeq4000. First, a quality check was performed using FastQC and read trimming was done with Trimomatic (Bolger et al., 2014). PRINSEQ lite (Schmieder and Edwards, 2011) was used for PolyA trimming and quality filtering. Trimmed sequences were then mapped to the zebrafish reference genome (GRCz11) using hisat2.1.0 (Kim et al., 2019) and mapped reads are counted using featureCounts (Liao et al., 2014). With the R package, EdgeR (Robinson et al., 2010), differentially expressed genes with Log2FC > |2| and FDR values < 0.01 were extracted. EnhancedVolcano package (Blighe et al., 2018) was used to draw volcano plots. A heat map was generated with the pheatmap package (Kolde, 2019).

Evaluation of Il34 mRNA expression by semi-quantitative PCR

Request a detailed protocol

Extracted RNA from 48-hpf wild-type sibling and slbp1 mutant heads was used to prepare cDNA, using ReverTra Ace qPCR RT master mix with gDNA remover (Toyobo, FSQ-301). The expression level of il34 mRNA was evaluated with quantitative PCR using the primers below. mRNA of cytoplasmic actin β2, namely actb2 (ZFIN), was used for normalization.

  • Forward primer for il34 mRNA: 5’-TGGTCCAGTCCGAATGCT-3’.

  • Reserve primer for il34 mRNA: 5’-GCTGCACTACTGCACACTGG-3’.

  • Forward primer for actb2 mRNA: 5’-TGTCTTCCCATCCATCGTG-3’.

  • Reserve primer for actb2 mRNA: 5’-TGTCTTCCCATCCATCGTG-3’.

Mosaic expression of NICD in retinal cells using Tg[rx1:gal4-VP16] and Tg[hsp:gal4] transgenic lines

Request a detailed protocol

The DNA fragment that covers a 2892 bp genomic region upstream from the start codon of rx1 cDNA (Chuang et al., 1999), was amplified by PCR and inserted between XhoI and BamHI sites of the Tol2 base expression vector, pT2AL200R150G (Urasaki et al., 2006). Next, DNA fragments encoding gal4-VP16 (Köster and Fraser, 2001) were further inserted between BamHI and ClaI sites of pT2AL200R150G to fuse the rx1 promoter. The plasmid was injected with Tol2 transposase mRNA into fertilized eggs of the UAS:EGFP transgenic line to establish a transgenic line, Tg[rx1:gal4-VP16]oki065. A mixture of plasmids of UAS:EGFP (Köster and Fraser, 2001) and UAS:myc-NICD (Scheer and Campos-Ortega, 1999) (each 10 ng/μL) were injected into fertilized eggs of the Tg[mfap4:tdTomato-CAAX; rx1:gal4-VP16] or Tg[mfap4:tdTomato-CAAX; hsp:gal4] transgenic line. In the case of the Tg[mfap4:tdTomato-CAAX; hsp:gal4] transgenic line, two rounds of heat shock at 37 °C for 1 hr were applied at 18 and 30 hpf. Embryos expressing EGFP in the optic cup were selected at 24 hpf, fixed with PFA at 48 hpf and used to prepare serial retinal sections for imaging analysis. After confocal images were obtained, the number of ocular mfap4-positive microglial precursors associated with EGFP-expressing columns was counted. The fraction of ocular mfap4-positive microglial precursors associated with EGFP-expressing columns in total microglial precursors was calculated and the trapping efficiency of ocular mfap4-positive microglial precursors per EGFP-expressing column was calculated using the total number of EGFP-expressing columns in the retina. Detailed information on each injected eye is shown in Figure 5—figure supplement 1C. To confirm that NICD inhibits retinal neurogenesis, UAS:myc-NICD or UAS:mCherry (each 10 ng/μL) was injected into zebrafish transgenic embryos Tg[ath5:EGFP; hsp:gal4]. Three rounds of heat shock at 37 °C for 1 hr were applied at 18, 24, and 30 hpf. Embryos were fixed at 36 hpf and labeled with anti-myc tag antibody to visualize myc-NICD expressing retinal cells with Alexa-543-conjugated secondary antibody. Whole retinas were used for confocal scanning with an FV3000RS (Olympus). Controls were UAS:mCherry-injected samples and used directly for live confocal scanning. Confocal 3D retinal images were used to count the number of ath5:EGFP-positive and negative retinal columns in myc-NICD or mCherry expressing retinal columns from five independent embryos.

Evaluation of microglial precursor colonization of the retina in Il34 mutants

Request a detailed protocol

The il34hkz11 allele (Wu et al., 2018) was combined with the Tg[mfap4:tdTomato] transgenic line and used for analysis. Embryos were generated by pair-wise crosses between heterozygous mutant male and female fish, and maintained with N-phenyl thiourea (PTU)-containing water to prevent melanophore pigmentation. Whole retinas of 19 embryo at 34 hpf and 29 embryos at 48 hpf were scanned with confocal microscopy, using an LSM710 (Zeiss) or an FV3000RS (Olympus). Embryos were fixed with 4 % PFA and used for genotyping. A DNA fragment containing the 4-base deletion mutation of the il34hkz11 allele was amplified by PCR and sequenced to determine genotypes. Primers used for PCR amplification and sequencing are below.

  • Forward primer for PCR: 5’-TGCAATTAAACAGCCAATGTG-3’.

  • Reverse primer for PCR: 5’-CTGAGTCACAGCCCTCAAATC-3’.

  • Forward primer for sequencing: 5’-CCATTTGTTTTTACCTGACCAAA-3’.

  • Reverse primer for sequencing: 5’-GCTAATTGGTGTGGGACGTT-3’.

Using the surface rendering tool of Imaris software (Bitplane, ver.9.1.2), we eliminated signals of iridophore-derived noise or peripheral macrophages around the optic cup and extracted only ocular microglial precursors. The number of ocular microglial precursors was counted in each retina and compared between genotypes.

Statistical analysis

Request a detailed protocol

Statistical analyses were performed using GraphPad Prism version 8.2.1. Statistical significance was determined using two-tailed unpaired Student’s t-tests for Figure 1G; Figure 2D; Figure 4B,D,H; Figure 5C,D,G,H; Figure 1—figure supplement 2; Figure 2—figure supplement 2B; Figure 3—figure supplement 3B-D; Figure 4—figure supplement 4B; Figure 4—figure supplement 5D; Figure 6—figure supplement 3, Tukey’s multiple comparison test for Figure 4F; Figure 6B; Figure 6—figure supplement 2B, and Bonferroni’s multiple comparison test for Figure 3—figure supplement 2B. Chi square tests were used for Figure 4—figure supplement 7C. Detailed information on each dataset is provided in Excel files in Raw data.

Appendix 1

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (zebrafish, Danio rerio)Okinawa wild typePMID:28196805
Strain, strain background (zebrafish, Danio rerio)RIKEN wild typePMID:12702661ZFIN: ZDB-
GENO-070802–4
https://shigen.nig.ac.jp/zebra/
Genetic reagent (zebrafish, Danio rerio)slbp1rw440PMID:25106852ZFIN: ZDB-ALT-150115–5
Genetic reagent (zebrafish, Danio rerio)irf8st96PMID:25615614ZFIN: ZDB-ALT-150504–8Dr. William Talbot (Stanford University)
Genetic reagent (zebrafish, Danio rerio)il34hkz11PMID:30205037ZFIN: ZDB-ALT-181210–3Dr. Zilong Wen (The Hong Kong University of Science and Technology)
Genetic reagent (zebrafish, Danio rerio)Roy orbisonPMID:28760346ZFIN: ZDB-
ALT-980203–444
Genetic reagent (zebrafish, Danio rerio)Tg[ath5:EGFP] rw021PMID:12702661ZFIN: ZDB-ALT-050627–2
Genetic reagent (zebrafish, Danio rerio)Tg[EF1a:mCherry
-zGem] oki011
PMID:25260917ZFIN: ZDB-ALT-150128–2
Genetic reagent (zebrafish, Danio rerio)Tg[mpeg1
.1:EGFP] oki053
This paperSee “Materials and Methods”
Genetic reagent (zebrafish, Danio rerio)Tg[mfap4
:tdTomato] oki083
This paperSee “Materials and Methods”
Genetic reagent (zebrafish, Danio rerio)Tg[kdrl:EGFP] s843TgPMID:16251212ZFIN: ZDB-ALT-050916–14ZIRC
Genetic reagent (zebrafish, Danio rerio)Tg[hsp:gal4]kca4PMID:11850174ZFIN: ZDB-ALT-020918–6Reugels/Campos-Ortega lab (Köln University)
Genetic reagent (zebrafish, Danio rerio)Tg[rx1:gal4-VP16]oki065This paperSee “Materials and Methods”
Antibodyzn5 (mouse monoclonal)ZIRCZFIN: ZDB-ATB-081002–19IHC (1:100)
Antibodyzpr1 (mouse monoclonal)ZIRCZFIN: ZDB-ATB-081002–43IHC (1:100)
AntibodyAnti-GFP (rabbit polyclonal)Thermo Fisher ScientificCat# A11122IHC (1:200)
AntibodyAnti-myc tag (mouse monoclonal)InvitrogenCat# R950-25IHC (1:250)
AntibodyAnti-BrdU (rat monoclonal)BioRadCat# MCA2060Monoclonal (BU1/75(ICR1))IHC (1:200)
Recombinant DNA reagentpT2AL200R150G(plasmid)PMID:16959904Dr. Koichi Kawakami(Institute of Genetics)
Recombinant DNA reagentUAS:EGFP(plasmid)PMID:1133649910 ng/μL for injection
Recombinant DNA reagentUAS:mCherry(plasmid)This paper10 ng/μL for injection
Recombinant DNA reagentUAS:myc-NICD(plasmid)PMID:10072782Reugels/Campos-Ortega lab (Köln University)10 ng/μL for injection
Recombinant DNA reagentPtf1a:EGFP(plasmid)PMID:19732413Dr. Francesco Argenton (University of Padova)10 ng/μL for injection
Sequence-based reagenttnnt2a MOPMID:11967535Morpholino antisense oligos5’-CATGTTTGCTCTGATCTGACACGCA-3’Use at 500 μM
Sequence-based reagentp53 MOPMID:12477391Morpholino antisense oligos5’-GCGCCATTGCTTTGCAAGAATTG-3’Use at 100 μM
Sequence-based reagentcxcl12a MOPMID:15716407Morpholino antisense oligos5’-ACTTTGAGATCCATGTTTGCAGTG-3’Use at 500 μM
Sequence-based reagentpu.1 MOPMID:15621533Morpholino antisense oligos5’-GATATACTGATACTCCATTGGTGGT-3’Use at 250 μM
Sequence-based reagentath5 MOThis paperMorpholino antisense oligos5’-TTCATGGCTCTTCAAAAAAGTCTCC-3’Use at 250 μM
Sequence-based reagentstandard MOotherMorpholino antisense oligos5’-CCTCTTACCTCAGTTACAATTTATA-3’Use at the same concentration for each MO experiments
Sequence-based reagentil34 qPCR primer forwardThis paperPCR primers5’- TGGTCCAGTCCGAATGCT-3’
Sequence-based reagentil34 qPCR primer reverseThis paperPCR primers5’- GCTGCACTACTGCACACTGG –3’
Sequence-based reagentactb2 qPCR primer forwardThis paperPCR primers5’- TGTCTTCCCATCCATCGTG –3’
Sequence-based reagentactb2 qPCR primer reverseThis paperPCR primers5’- TGTCTTCCCATCCATCGTG-3’
Sequence-based reagentil34 genotyping primer forwardThis paperPCR primers5’-TGCAATTAAACAGCCAATGTG-3’
Sequence-based reagentil34 genotyping primer reverseThis paperPCR primers5’-CTGAGTCACAGCCCTCAAATC-3’
Sequence-based reagentil34 sequencing primer forwardThis paperPCR primers5’-CCATTTGTTTTTACCTGACCAAA-3’
Sequence-based reagentil34 g sequencing primer reverseThis paperPCR primers5’-GCTAATTGGTGTGGGACGTT-3’
Commercial assay or kitIn Situ Cell Death Detection Kit, FluoresceinRocheCat# 11684795910
Commercial assay or kitSepasol-RNA/Super GNacalai tesqueCat# 09379
Commercial assay or kitReverTra Ace︎ aPCR master mix with gDNA removerToyoboCat# FSQ-301
Chemical compound, drugBrdUNacalai tesqueCat# 05650–95
Chemical compound, drugBodipy ceramideThermo Fisher ScientificCat# B22650
Chemical compound, drugTO-PRO–3 Iodide (642/661)Thermo Fisher ScientificCat# T3605
Chemical compound, drugN-Phenyl thiourea (PTU)Nacalai tesqueCat# 27429–22
Chemical compound, drugDextran, Alexia Flour-488Thermo Fisher ScientificCat# D22910
Software, algorithmGraphPad PrismGraphPad SoftwareVer 8.2.1https://www.graphpad.com/scientific-software/prism/
Software, algorithmIMARISBitplaneVer 9.1.2http://www.bitplane.com/imaris; RRID: SCR_007370
Software, algorithmImage-JNIH2.0.0-rc-69/1.52 p
Software, algorithmTrimomaticPMID:24695404v0.39http://www.usadellab.org/cms/?page=trimmomatic
Software, algorithmPRINSEQ litePMID:21278185v0.20.4http://prinseq.sourceforge.net/
Software, algorithmHISAT2PMID:25751142v2.1.0https://github.com/DaehwanKimLab/hisat2
Software, algorithmfeatureCountsPMID:24227677Packaged ub Subread v1.5.2http://subread.sourceforge.net/
Software, algorithmEdgeRPMID:19910308v3.13https://bioconductor.org/packages/release/bioc/html/edgeR.html
Software, algorithmEnhancedVolcano packageBlighe et al., 2018v1.6.0https://github.com/kevinblighe/EnhancedVolcano
Software, algorithmpheatmap packageotherv1.10.12https://cran.r-project.org/web/packages/pheatmap/index.html

Data availability

Raw RNA-seq dataset of slbp1 mutant and wild-type sibling is available at Gene Expression Omnibus (GSE144517).

The following data sets were generated
    1. Nishtha R
    2. Ichiro M
    (2020) NCBI Gene Expression Omnibus
    ID GSE144517. Comparsion of transcriptome between slbp1 mutant and wildtype sibling.

References

    1. Boya J
    2. Calvo J
    3. Prado A
    (1979)
    The origin of microglial cells
    Journal of Anatomy 129:177–186.
  1. Book
    1. Westerfield M
    (1993)
    The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish
    University of Oregon Press.
    1. Xu J
    2. Du L
    3. Wen Z
    (2012) Myelopoiesis during zebrafish early development
    Journal of Genetics and Genomics = Yi Chuan Xue Bao 39:435–442.
    https://doi.org/10.1016/j.jgg.2012.06.005

Decision letter

  1. Beth Stevens
    Reviewing Editor; Boston Children's Hospital, United States
  2. Richard M White
    Senior Editor; Memorial Sloan Kettering Cancer Center, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for choosing to send your work, "Mechanisms underlying microglial colonization of developing neural retina in zebrafish", for consideration at eLife. Your article has been reviewed by 2 peer reviewers and the evaluation has been overseen by a Senior Editor and a Reviewing Editor. Although the work is of interest, we regret to inform you that the findings at this stage are too preliminary for further consideration at eLife.

The authors address an important question and gap in knowledge on how microglia colonize the mammalian retina. The findings are interesting, however the findings do not support their main conclusion that microglia enter the retina through a neurogenic niche. A major weakness is the manipulations used to disrupt the neurogenic niche are global and thus it is not clear whether or how microglia and/or other tissues are impacted by these manipulations. The study lacks some key controls making several experiments difficult to interpret. Moreover, the tools and markers used to label macrophages and microglia (including proliferating microglia) need more characterization and validation. There were several other specific concerns as outlined below.

Reviewer #2:

Summary:

The authors use the zebrafish model to understand how microglia colonize the retina. Through time lapse imaging experiments the authors show that microglia enter the retinal space through hyaloid blood vessels. These microglia do not express zGEM, a proxy for proliferating cells. Once in the blood vessels, myeloid precursors enter into the retina. The entrance of these microglia occurs in areas of the retina that are not undergoing active proliferation. The authors claim that such results indicate neurogenic properties then drive colonization. Using multiple approaches to disrupt retinal neurogenesis, the authors show that microglia colonization can be disrupted. Overall, the paper presents interesting and important concepts on how microglia colonize the retina. A basic understanding and characterization of microglia retinal colonization is needed. However, some of the conclusions in the work are overstated based on the current data. In particular, the supporting data and manipulations to disrupt the neurogenic niche are performed globally, leaving the possibility that the manipulations could also be altering microglia directly or indirectly through other tissues. A number of conclusions are drawn from experiments that did not provide an effect. Such interpretations need strong positive controls, of which are missing from the current manuscript. The conclusions stated in the paper will need additional experiments. The manuscript could be vastly improved through revision; please consider these comments for improving the paper.

1. The authors use the term microglial precursors often but use markers that also label macrophages and microglia. How do the authors define microglial precursors and can they provide definitive data to show that these cells produce bonafide microglia. It is important to connect the precursor with the mature population. In other words, can the mpeg1.1:egfp cells in the retina be marked with bonafide microglia markers (such as apoe, lcp1, 4c4, tmem119, p2yr12). Are they clearing some sort of debris in the system that is expected of mature microglia, like for example in Figure 3D a", which clearly shows a cell with vacuoles. Varying morphology or phagocytosis may indicate an altered microglia, which is less consistent with a precursor population and more consistent with a microglia. Without this data, the cells can only be called myeloid precursors/progenitors.

Similarly, in the discussion, the authors note that "peripheral macrophages located.." but the data presented does not support the conclusion that macrophages vs microglia vs. microglia precursors can be distinguished. This is a critical point for the conclusions the authors present. By the authors definition, a mpeg+ cell outside the retina is a macrophage. But they also define a mpeg+ cell outside the retina as a microglial precursor. It is not clear how the authors can distinguish between these two cell-types. This is important in their quantifications as they manipulate different genes.

2. There are several controls that are important for the study. Please see the list below for revision.

Has zGem been established in zebrafish to label proliferating microglia. A positive control that indicates proliferating mpeg1.1+ cells can be detected with zGem is critical for this analysis.

Is there a positive control that can be quantified to indicate zGem is actually measuring dividing cells. For example, can mpeg+ cells in the periphery be scored?

On page 10, line 214 the authors make a bold claim that the ath5 morpholino data indicates microglia utilize the neurogenic region. However, it is possible that the ath5 MO also disrupts more than the neurogenic niche.

The experiments in the slbp1 background do not rule out the possibility that slbp1 could directly impact microglia precursor cells. Could the authors begin to rule this out by determining if microglia express slbp1?

Without detecting Il34 protein levels in overexpression experiment it is not clear whether the protein is even expressed or secreted. Do the authors have a positive control that the overexpression construct is in fact overexpressing Il34 and that it is secreted. Alternatively, do they have a positive control that the construct could induce a phenotype suggesting the construct is functional.

Morpholino experiments are used throughout the paper but clear controls for these morpholinos are not stated, cited or performed. Please refer to Stainier et al. 2017 paper to consider additional controls.

3. The authors claim that apoptosis is unlikely to be involved but further experiments are needed to definitely rule out that possibility.

Can the authors test the hypothesis of apoptosis by measuring levels of apoptosis during the time of colonization.

Can the authors demonstrate that the tp53 morpholino blocked apoptosis.

4. The main conclusion of the paper states that microglia enter the retina through a neurogenic niche. Through a series of mutants and drug treatments, the neurogeneic niche is altered. Unfortunately, all the manipulations to the neurogenic niche are global and thus it remains a possibility that microglia, microglia precursors and/or other tissues are also impacted by these manipulations. Although the mosaic experiments begin to address this concern, there is no measurement of the microglia from slbp1 mutant animals. Either additional experiments need to be included to directly rule out the possibility that microglia themselves are impacted or the conclusions of the paper need to be significantly restated.

The HDAC1/2 experiments are particularly difficult to interpret. HDAC1/2 inhibition also impairs microglial development and results in decreased cell number and altered morphology (Datta et al., 2018 Immunity). Prenatal ablation of Hdac1 and Hdac2 caused spontaneous microglia impairment, including blockage of proliferation and enhanced apoptosis while postnatal deletion was largely compatible with microglial viability and function. Cell specific manipulation of HDAC would need to be completed to ensure microglia are not impacted by HDAC dysfunction.

5. The mosaic experiments begin to address the cell-autonomy of the mutant backgrounds. This is a clever approach and I commend the authors for the brilliant experiment. However, it is not clear why certain comparisons were made to make the conclusions the authors made. Or it is possible that the mosaic experiment is confusing as written. Should not the comparison be between microglia associated with mutant cells vs wt cells in wt host retina or mutant cells vs wt cell in a mutant host retina. The wt to wt cell transplantation is more a control to determine if the transplants themselves cause retinal or microglia defects.

Reviewer #3:

Ranawat and Masai reports on characterizing the cellular mechanism by which microglia colonize the retina in zebrafish. This is an interesting and novel topic as there has not been a formal investigation of retinal microglia colonization in zebrafish or other vertebrate models, and would provide important insights into possible distinction, if any, between retinal versus brain microglia. The authors attempt to examine whether the same cellular mechanisms that mediate brain microglial colonization are the same for retinal microglia in zebrafish. However, many of the conclusions are coming from insufficient evidence or contain significant flaws, as discussed below. One of the major issues is that the authors attempt to make claims on several mechanistic features distinguishing retinal microglia from tectal brain microglia during colonization into the CNS, but the data either are missing important controls, or analysis is incomplete and remains quite equivocal.

1) The authors concluded that retinal microglial migration into retina depends on blood vessel network. Their primary argument was that tnnt2 morpholino-mediated blockage of blood flow disrupted blood vessel development, and thereby prevented retinal microglial colonization. However, this analysis still contains critical gaps (see a), and the alternate explanation that a lack of blood flow could prevent microglial colonization, which in turn disrupt blood vessel formation remains equally likely but not sufficiently addressed. They used pu.1 morpholino as a means for removal of myeloid cells (including microglia), but necessary control characterizations are lacking (see b).

a) Although colonization may begin earlier in the retina than in the tectum, analysis of whether blood flow/blood vessel is required should be verified at 3-4 dpf when colonization of both retinal and tectal microglia is abundant. In the same embryos when blood flow is blocked, both retina and brain microglia should be examined. This way the difference claimed by the authors that in fact retinal microglia are different from tectal microglia that they require blood flow/vessel could be clearly examined simultaneously to make a clear conclusion. Because of its small size at these stages, most studies of zebrafish microglia already image both retina and brain in whole mount, but the retinal microglia just have not been specifically analyzed, so there is no good reason for the authors not to examine both locations especially if they are making strong points about their differences. A priori, however, the gross level phenotypes of tectal microglia seem to align with retinal microglia based on papers already published about microglia mutants (including il34, irf8 etc).

b) The effectiveness of pu.1 mo to fully ablate macrophages was not demonstrated and in fact the panels shown in Figure 2 supp 1 indicate at best a partial ablation of myeloid cells in pu.1 morphants as many fluorescently red tagged macrophages were detectable. Since morpholino injections are transient, varying levels of pu.1 knockdown are expected, only individual embryos showing complete absence of macrophages should be used for analysis. Complementary experiments should be done using macrophage-lacking mutants such as irf8 mutants (this will address any caveat from transient/mosaic knockdown by morpholino) to confirm a lack of a macrophage role in retinal vessel development. Appropriate validation is critical for making correct interpretations, especially in light of the negative data and also previous work in mice implicating microglia for retinal vessel development.

2) Data as shown in Figure 1-supp3 lead to questions of whether "dividing" microglial cells were reliably quantified. The lateral view is at low resolution in a thick section of the retina-the example does not show any convincing example of a single microglial cell that is also BrdU+. Please analyze at higher cellular resolution and show a magnified example of a proliferative microglial cell. The concern is that the counting is over-represented than the actual number dividing which looks like zero in the A panels example. There seems to be far fewer if any dividing microglial cell.

3) The authors claim a second feature relating to not requiring signals from apoptotic neurons that sets apart retinal from tectal microglia in zebrafish, but the evidence is weak. Based on studies of others, microglia have been shown to colonize the tectum in part by signals coming from apoptotic neurons in the brain in zebrafish. This current study only transiently inhibits global cell death using an antisense morpholino against tp53. At the minimum, the authors need to show that (1) this tp53 MO injection does indeed eliminate retinal/brain apoptosis during development, (2) that at later stages 3-5 dpf using tp53 morpholino (assuming they confirm its efficacy in inhibiting neuronal apoptosis), if their conclusion is correct, the results should show normal presence of retinal microglia but an absence of tectal microglia, and (3) slbp1 mutants do not have less apoptotic neurons to explain for a reduced microglial colonization in the retina.

4) Histone deacetylase 1 (HDAC1) is expected to function in a variety of cell type. The use of its chemical inhibitor TSA broadly, and the global hdac1 mutant raise question as to whether hdac1 itself has a function in macrophages to affect their ability to migrate or differentiate into microglia? Figure 4-supp3 shows some punctate macrophage reporter patterns. The authors need to address this.

5) Whether a morpholino has been published previously or not, efficacy for all morpholinos should be verified either at least phenotypically (if previously published), or by both molecular and phenotypic means (if new and yet unpublished) to substantiate that the reagent works as intended in the researcher's own laboratory operations. This includes the cxcl12a morpholino.

6) The interpretation that il34/csf1r pathway is not involved in retinal microglial colonization as it is for tectal brain microglia in zebrafish is surprising, because recent analyses of microglia in zebrafish il34 mutants indicate a significant reduction (based on data from these work there is reduction also in retina, but the retinal population was not formally analyzed) (Kuil et al., 2019 DMM; Wu et al., 2018 Dev Cell). The evidence on which the authors have made this conclusion is rather weak and possibly flawed. First of all, gene expressions on whole body for il34 distinguishing WT vs slbp1 mutant and that csf1r not being detected in a single cell analysis of microglial precursors cannot form a strong argument that this pathway is not involved as csf1r may just be lowly expressed and global expression may not be informative. The authors must analyze the il34 mutants to examine whether retinal microglia colonize or not in parallel with the tectal microglia. The only functional experiment they use is an rx1:il34 overexpression in the eye which was not sufficient to increase macrophage colonization-however the caveat is that this overexpression is mosaic and whether functional il34 proteins are getting produced is not known.

7) Finally, more data points are required to formulate a reliable conclusion that microglia have a preference for differentiated retinal neurons and less with progenitors using the chimeric host-donor transplantation. There is a big differential in number of neural columns transplanted in mutants (more donor cells 3-7 columns in mutant hosts, than the 2-4 columns in control wt host group), which can misleadingly show an increased association of microglia with mature columns just because there are more columns in the slbp1 mutants. More Ns to establish equivalent range of donor transplantation (especially larger numbers in the wt group), and also the reciprocal test of putting donor mutant columns into WT host, will provide the needed comprehensive test of this concept using chimeras.

8) The use of slbp1 mutants being only interpreted as a neurogenesis mutant can be problematic as this gene slbp1 (stem-loop binding protein binds to 3'end histone mRNAs) regulates degradation of histone proteins and replication-dependent synthesis and can have broad effects similar to the issue with hdac1 mutants. Complementary method to create neuron-specific disruption of neurogenesis would be ideal to substantiate the concept that the differentiation status of retinal neurons strongly affect colonization of microglia in the retina.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Mechanisms underlying microglial colonization of developing neural retina in zebrafish" for further consideration by eLife. Your revised article has been reviewed by 3 peer reviewers and the evaluation has been overseen by Richard White (Senior Editor) and a Reviewing Editor.

Overall, the authors have done a thorough and comprehensive job of addressing the points raised by the initial peer review and added additional controls and significant new data. This has particularly strengthened the conclusion that microglia colonization of retina is linked to neurogenesis, which is the central new finding of this study. However, there are a few remaining (minor) concerns that need to be addressed as summarized below by reviewers 1 and 3. In addition, there are few areas in the manuscript that overstate the conclusions based on the data reported in the manuscript. Please consider modifying the following conclusions it is not feasible to address experimentally in a timely manner.

– The origin and characterization of the macrophage population(s) in the retina. For example, please state clearly their definition of microglia early in the results (In this manuscript, we define microglia as…").

– The spatiotemporal role and relationship of IL34, microglia colonization and neurogenesis as raised by reviewer 1. These concerns can be addressed by adding experiments or modifying the current conclusions.

Reviewer #1:

Please consider the following suggestions for the paper.

– The authors should use other markers to verify that the cell populations of interest are microglial precursors. Using only macrophage markers may not encapsulate the heterogeneity of embryonic microglia in the zebrafish. Can the authors analyze other markers for microglia to demonstrate their identity? While they cite papers referencing apoeb, the data in the manuscript demonstrate microglia in different CNS regions have distinct properties. There are several reagents like antibodies against 4C4, or L-plastin or in situ hybridization of microglia genes like apoeb, or p2ry12 that could be used, as done in other zebrafish microglia manuscripts.

– The systemic inhibition of circulation is a concern because the manipulation is a global perturbation that impacts heart contraction. The data supporting the reliance of migrating microglial precursors on vasculature would be more convincing if the authors specifically inhibited the vasculature that they propose is utilized for microglia colonization. This concern is heightened by the observation that the animals in the tnnt2aMO look very unhealthy.

– There are a few areas in the manuscript that overstate the conclusions based on the data reported in the manuscript. Please consider modifying the following conclusions in the manuscript:

– The authors summarize their findings with a schematic in figure 6. The model states a stepwise process to microglia colonization of the retina, but the data reported in the manuscript support a more continuous process of microglia colonization. Further, the first step in the model is IL34-mediated migration to the brain, but the data reported in the manuscript only shows a reduction of microglia in the retina without follow up experiments to address when in the process microglia are disrupted in IL34 mutant animals. Please consider revising the model so that it is more consistent with the conclusions in the paper.

– The comment "it is very likely that csf1r-il34 signaling promotes…" overstates the conclusion one can draw from the reported data. It would be more accurate to state that it is involved in colonization. Otherwise, the authors should assess the step wise process of colonization when IL34 is perturbed.

– The authors utilize the NICD manipulation to test whether neurogenesis is required for microglia colonization of the retina. This is a clever approach to altering neurogenesis. With this experiment, it is possible that the Notch pathway is directly impacting microglia colonization. Please consider modifying the sentence line 379-380 "Thus microglial precursors are less attracted…in which neurogenesis was arrested." to add a disclaimer that the direct role of Notch signaling cannot be ruled out.

Reviewer #2:

In this study Ranawat and Masai investigate the routes by which microglia colonize the zebrafish retina. The authors show that, after migrating to the eye and entering through hyaloid vessels, microglial precursors are recruited into the retina by neural progenitors exiting the cell cycle. Using three different genetic models of delayed retinal neurogenesis (ath5 morphants, slbp1 mutants, and overexpression of notch intracellualar domain), they show a delay in microglial entry into the retina when neurogenesis is suppressed. Further, in genetic chimeric retinas, microglia preferentially associate with neurogenic radial clones rather than clones of neurogenically-impaired cells.

Overall, this study is very interesting and contributes several new findings that will be of broad interest. These include: (1) the observation that mechanisms for microglial colonization differ between brain and retina; and (2) a holistic overview of multiple cellular and molecular mechanisms that guide microglial precursors from the site of their birth into the neural retina. A minor weakness is that the authors have not identified even a hint of the molecular cues that might explain the ability of newborn neurons to recruit microglial entry into the retina. Nevertheless, given the other strengths of this paper and its contributions, I do not think this weakness is a particularly severe one.

I have no concerns with the data or their interpretation. It is my impression that the authors have done a thorough and comprehensive job of addressing the points raised by the initial peer review. The authors are to be commended on a compelling and clearly-written study.

Reviewer #3:

In this study, the authors investigate microglia colonization of the retina in zebrafish. Some of their observations confirm work from previous studies. They first carefully show that there is almost no proliferation of microglial precursors, which was previously shown in mouse retina (Santos et al., 2008) but not in zebrafish. They make the sound conclusion that microglia precursors migrate in to colonize the retina. They clearly show that neuronal apoptosis is not the major cue for microglial precursor colonization of the retina as it is for tectum, although this was previously documented in zebrafish by Wu et al., 2018 (which they gloss over in the manuscript). They also show that Csf1r-il34 signaling is important for microglia colonization of retina, although this was also shown by Wu et al. 2018 (again glossed over). Due to almost complete failure of microglia precursors to populate they eye in IL34 mutants, they argue that Csf1r-il34 signaling promotes microglial precursor movement from yolk to the optic cup upstream of the blood vessel-mediated guidance mechanism. However, it remains unclear which cell populations express IL34 developmentally to attract microglia precursors to the eye and at what stages this occurs. So their observations regarding the role of Csf1r-il34 signaling do not advance much beyond what is shown by Wu et al., 2018.

They also make some new observations. They convincingly show that entry of microglial precursors into the optic cup through the choroid fissure depends on ocular blood vessels. Most interestingly, they show using three different manipulations that delaying retinal neurogenesis reduces microglial precursor colonization of the retina. They further show using elegant transplant studies that microglia precursors have greater affinity for differentiating neurons than for retinal progenitor cells. These experiments are carefully done and convincing. The mechanisms underlying this process are unclear since RGC differentiation begins at 27hpf, but microglia precursors don't enter until after 42hpf. They rule out IL34 as the signal since it is not altered in their slbp1 mutants (which show delayed neurogenesis and delayed microglia colonization). So the main new conclusion is that microglia colonization of retina depends upon ocular blood vessels and is linked to neurogenesis. These findings are interesting and important.

The authors have thoughtfully responded to prior comments from reviewers and added additional controls and significant new data. This has particularly strengthened the conclusion that microglia colonization of retina is linked to neurogenesis, which is the central new finding of this study. However, the mechanisms underlying this process remain undefined.

https://doi.org/10.7554/eLife.70550.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Reviewer #2:

1. The authors use the term microglial precursors often but use markers that also label macrophages and microglia. How do the authors define microglial precursors and can they provide definitive data to show that these cells produce bonafide microglia. It is important to connect the precursor with the mature population. In other words, can the mpeg1.1:egfp cells in the retina be marked with bonafide microglia markers (such as apoe, lcp1, 4c4, tmem119, p2yr12). Are they clearing some sort of debris in the system that is expected of mature microglia, like for example in Figure 3D a", which clearly shows a cell with vacuoles. Varying morphology or phagocytosis may indicate an altered microglia, which is less consistent with a precursor population and more consistent with a microglia. Without this data, the cells can only be called myeloid precursors/progenitors.

Similarly, in the discussion, the authors note that "peripheral macrophages located.." but the data presented does not support the conclusion that macrophages vs microglia vs. microglia precursors can be distinguished. This is a critical point for the conclusions the authors present. By the authors definition, a mpeg+ cell outside the retina is a macrophage. But they also define a mpeg+ cell outside the retina as a microglial precursor. It is not clear how the authors can distinguish between these two cell-types. This is important in their quantifications as they manipulate different genes.

In zebrafish, early macrophages are generated from myeloid cells originating in the rostral blood island (RBI) around 11 hpf and colonize the brain and retina by 55 hpf (Xu et al., 2015). At around 60 hpf, these brain and retina-colonized macrophages undergo a phenotypic transition, which indicates expression of mature microglial markers such as apolipoprotein E (apoE) and phagocytic behavior toward dead cells (Herbomel et al., 2001). Importantly, early macrophages outside the brain never express apoE (Herbomel et al., 2001), suggesting that only brain and retina-resident macrophages give rise to microglia. Thus, early macrophages colonizing the brain and retina by 60 hpf are generally accepted as microglial precursors in zebrafish. Herein, we refer to mpeg1.1:EGFP+ and mfap4:tdTMTCAAX+ cells in the brain and retina at 60 hpf as microglial precursors. It is also appropriate to refer to mpeg1.1:EGFP+ and mfap4:tdTMT-CAAX+ cells outside the retina and brain as macrophages, although these macrophages may have the potential to differentiate into microglial precursors after they enter the brain and retina. We have added this definition of microglial precursors, microglia, and macrophages to the first paragraph of the Results section (page 6, line 165-173).

2. There are several controls that are important for the study. Please see the list below for revision.

Has zGem been established in zebrafish to label proliferating microglia. A positive control that indicates proliferating mpeg1.1+ cells can be detected with zGem is critical for this analysis.

Is there a positive control that can be quantified to indicate zGem is actually measuring dividing cells. For example, can mpeg+ cells in the periphery be scored?

First, we confirmed the presence of mCherry-zGem and mpeg1.1:EGFP double-positive cells in peripheral tissues and found that more than 60 % of mpeg1.1:EGFP-positive cells expressed mCherryzGem, suggesting that this Tg[EF1a:mCherry-zGem] system functions as an indicator of cell cycle phases in early zebrafish macrophages. Furthermore, to confirm that a majority of ocular microglial precursors do not undergo S phase, by labeling of retinal sections with anti-BrdU antibody, we confirmed that more than 80% of mpeg1.1:EGFP+ cells did not incorporate BrdU at 48 hpf, suggesting that microglial precursor colonization of the retina depends mostly on cell migration from outside the optic cup, rather than on precursor cell proliferation. We have added these results to Figure 1—figure supplement 3 and 4 as new data.

On page 10, line 214 the authors make a bold claim that the ath5 morpholino data indicates microglia utilize the neurogenic region. However, it is possible that the ath5 MO also disrupts more than the neurogenic niche.

The aim of the ath5 morpholino experiment was to investigate the possibility that infiltration of microglial precursors into the neural retina depends on RGC differentiation or RGC-mediated circuit formation. In the original and revised manuscripts, we showed that microglial precursors infiltrate the neural retina preferentially through the neurogenic region, and that microglial precursor infiltration of the neural retina depends on retinal neurogenesis, suggesting that retinal neurogenesis functions as a gateway. However, since a blockade of retinal neurogenesis delays retinal cell differentiation and subsequent neural circuit formation, it is possible that differentiation of the first-born retinal cell-type, RGCs, is required for infiltration of microglial precursors into the neural retina.

We previously showed that ath5 starts to be expressed in G2 phase of retinal progenitor cells just prior to their final neurogenic cell division, and then ath5 expression is inherited by their daughter cells (Poggi et al., 2005, J. Cell Biol., 171, 991-999.; Yamaguchi et al., 2010, Mech Dev 127, 247-264.). Although ath5 is thought to be expressed in all retinal neurogenic lineages, only RGCs fail to differentiate in the zebrafish ath5 mutant, lakritz (Kay et al., 2001). We also confirmed that RGC differentiation is compromised in ath5 morphant retinas (Figure 4—figure supplement 8AB). Thus, ath5 morphants provide a good platform for us to investigate whether RGC differentiation is required for microglial precursor infiltration into the neural retina. We found that ocular microglial precursors were significantly reduced in number in ath5 morphant retinas. So, defects in RGC differentiation affect microglial precursor infiltration of the neural retina. We currently consider it likely that RGC differentiation or RGC-mediated IPL formation is required for proper timing of microglial precursor infiltration of the neural retina. We have revised the description on ath5 morphant data (page 12, line 461- page 13, line 523) to clarify this possibility.

The experiments in the slbp1 background do not rule out the possibility that slbp1 could directly impact microglia precursor cells. Could the authors begin to rule this out by determining if microglia express slbp1?

We agree with reviewer 2 that it is possible that the slbp1 mutation may impact behavior of microglial precursor cells. Slbp1 binds to the stem loop structure of 3’-untranslated region of histone mRNA and promotes translation of histone mRNA. Thus, Slbp1 is a key enzyme of histone genesis. In slbp1 mutants, histone mRNAs are abnormally polyadenylated, and the conventional translation mechanism for poly-adenylated mRNAs rescues histone mRNA translation. However, this conventional translation mechanism does not fully ensure histone genesis in highly proliferating cells such as retinal progenitor cells, so cell-cycle progression becomes slow in slbp1 mutant retinas (Imai et al., 2014 Dev Biol 394, 94-109.). On the other hand, we did not observe any defects in the number of mfap4+ cells in slbp1 mutant embryos, except the reduction of ocular microglial precursors (see Figure 4CD). Since a majority of microglial precursors do not undergo S phase, we think that the conventional translation mechanism may be enough to support microglial precursor proliferation in slbp1 mutants.

To confirm our conclusion on neurogenesis-mediated infiltration of microglial precursors into the retina, we have added the data on NICD overexpression in zebrafish retina, which reduced ocular microglial precursors. Please see our response to reviewer 2’s comment 4.

Without detecting Il34 protein levels in overexpression experiment it is not clear whether the protein is even expressed or secreted. Do the authors have a positive control that the overexpression construct is in fact overexpressing Il34 and that it is secreted. Alternatively, do they have a positive control that the construct could induce a phenotype suggesting the construct is functional.

We agree with reviewer 2’s concern regarding the data about IL34 overexpression. Unfortunately, we do not have a good antibody that immunohistochemically recognizes zebrafish IL34. Furthermore, il34 mRNA is very difficult to detect by in situ hybridization. To evaluate whether IL34 is involved in microglial precursor infiltration of the retina, we gave up this overexpression experiment, but we investigated the number of ocular microglial precursors in zebrafish il34 mutants. We found that the number of ocular microglial precursors was severely reduced. Very few microglial precursors (from 0 to 2 cells) are associated with blood vessels in il34 mutant eyes at 48 hpf. These data suggest that IL34 is required for microglial precursor colonization of the retina in zebrafish. Since almost no microglial precursors enter the optic cup, it is very likely that IL34 promotes guidance of microglial precursors from the yolk to the retina, upstream of blood vessel-mediated entry of microglial precursors into the optic cup and neurogenesis-mediated infiltration of microglial precursors into the neural retina. We have added these new data in new Figure 6AB and have revised our conclusion as follows: There are three steps for microglial colonization of the retina: In the first, IL34 attracts microglial precursors and promotes their migration into the brain and eye. In the second step, blood vessels guide microglial precursors to enter the optic cup. In the third step, retinal neurogenesis enables microglial precursors to infiltrate the neural retina. This conclusive summary is also provided in new Figure 6C.

Morpholino experiments are used throughout the paper but clear controls for these morpholinos are not stated, cited or performed. Please refer to Stainier et al. 2017 paper to consider additional controls.

We apologize for having failed to include the description of standard MO in the Materials and methods section. We have added the information on sequence and concentration of standard MO.

In this study, we used 5 morpholinos: tnnt2a MO, p53 MO, cxcl12a MO, pu.1 MO, and ath5 MO. All of these MOs, except ath5 MO, were previously reported. However, to evaluate whether each MO concentration is enough to knock down target gene translation, we confirmed that each MO induced expected phenotypic defects, as shown below. We have added these data to the supplementary figures below. tnnt2a MO: thinner blood vessels shown in Figure 2C and Figure 2—figure supplement 2A.

p53 MO: Reduction of apoptosis shown in Figure 3—figure supplement 2. cxcl12a MO: Misrouted trajectory of retinal axons shown in Figure 4—figure supplement 5AB. pu.1 MO: No microglial precursors shown in Figure 2—figure supplement 3AB. ath5 MO: No RGC differentiation shown in Figure 4—figure supplement 8.

3. The authors claim that apoptosis is unlikely to be involved but further experiments are needed to definitely rule out that possibility.

Can the authors test the hypothesis of apoptosis by measuring levels of apoptosis during the time of colonization.

Can the authors demonstrate that the tp53 morpholino blocked apoptosis.

We confirmed that p53 MO significantly suppressed apoptosis in zebrafish retina at 24 and 36 hpf. At 48 hpf, the apoptotic level was lower than that of 24 and 36 hpf in wild-type retina, so there was no statistical difference in apoptotic cell number between Standard MO injected retinas and p53 MO injected retinas. We have added these data to Figure 3—figure supplement 2AB.

In addition, we investigated colonization of microglial precursors in retina at 48 hpf and optic tectum at 96 hpf in zebrafish, and confirmed that microglial precursor colonization of the retina was not changed in p53 morphants; however, microglial colonization of the optic tectum was affected in p53 morphants. These data suggest that colonization of the optic tectum depends on apoptosis, which is consistent with previous reports. On the other hand, colonization of the retina is independent of apoptosis. We have added these data to Figure 3—figure supplement 3.

4. The main conclusion of the paper states that microglia enter the retina through a neurogenic niche. Through a series of mutants and drug treatments, the neurogeneic niche is altered. Unfortunately, all the manipulations to the neurogenic niche are global and thus it remains a possibility that microglia, microglia precursors and/or other tissues are also impacted by these manipulations. Although the mosaic experiments begin to address this concern, there is no measurement of the microglia from slbp1 mutant animals. Either additional experiments need to be included to directly rule out the possibility that microglia themselves are impacted or the conclusions of the paper need to be significantly restated.

We previously reported that Notch1 intracellular domain (NICD) suppresses retinal neurogenesis in zebrafish (Yamaguchi et al., 2005). To inhibit retinal neurogenesis more directly without perturbation of microglial precursor functions, we overexpressed NICD in retinal cells and examined ocular microglial colonization of the retina. First we confirmed that overexpression of NICD significantly suppresses retinal neurogenesis in zebrafish by injecting a DNA expression construct encoding UAS: myc-tagged NICD into Tg[hs:gal4; ath5:EGFP] double transgenic embryos (Figure 4—figure supplement 7).

Next, we established a zebrafish transgenic line, Tg[rx1:gal4-VP16], in which gal4-VP16 is expressed under control of the rx1 promoter, which drives mRNA expression in retinal progenitor cells. Then, we injected a mixture of two DNA expression constructs encoding UAS:myc-tagged NICD and UAS:EGFP into Tg[rx1:gal4-VP16; mfap4:tdTMT-CAAX] embryos. We selected embryos in which EGFP was expressed in most retinal cells at 24 hpf, and used them to investigate the number of ocular microglial precursors. We found that the number of ocular microglial precursors was significantly decreased in retinas overexpressing NICD, compared with retinas expressing only EGFP. Since the rx1 promoter does not drive NICD expression in microglial precursors, these data suggest microglial colonization of the neural retina depends on retinal neurogenesis. We have added these new data to Figure 4EF.

In addition, we performed more sparse mosaic expression of NICD in wild-type retinas by injection of a DNA construct encoding UAS:EGFP or a mixture of UAS:myc-NICD and UAS:EGFP into Tg[hsp:gal4: mfap4:tdTMT-CAAX] transgenic embryos. A fraction of microglial precursors associated with EGFP-positive columns was lower in UAS:myc-NICD+UAS:EGFP expression than in only UAS:EGFP expression. Trapping efficiency of microglial precursors in each EGFP-positive column was also lower in UAS:myc-NICD+UAS:EGFP expression than in only UAS:EGFP expression. We have added these data to Figure 5EFGH.

Taken together, these data strongly suggest that retinal neurogenesis drives microglial precursors to infiltrate the retina.

The HDAC1/2 experiments are particularly difficult to interpret. HDAC1/2 inhibition also impairs microglial development and results in decreased cell number and altered morphology (Datta et al., 2018 Immunity). Prenatal ablation of Hdac1 and Hdac2 caused spontaneous microglia impairment, including blockage of proliferation and enhanced apoptosis while postnatal deletion was largely compatible with microglial viability and function. Cell specific manipulation of HDAC would need to be completed to ensure microglia are not impacted by HDAC dysfunction.

We agree with reviewer 2’s concern regarding HDAC1 mutant data. We have deleted these results from our manuscript.

5. The mosaic experiments begin to address the cell-autonomy of the mutant backgrounds. This is a clever approach and I commend the authors for the brilliant experiment. However, it is not clear why certain comparisons were made to make the conclusions the authors made. Or it is possible that the mosaic experiment is confusing as written. Should not the comparison be between microglia associated with mutant cells vs wt cells in wt host retina or mutant cells vs wt cell in a mutant host retina. The wt to wt cell transplantation is more a control to determine if the transplants themselves cause retinal or microglia defects.

We previously showed that in chimeric retinas consisting of wild-type and slbp mutant cells, slbp1 mutant retinal columns showed a delay of neurogenesis and maintained a proliferative state, whereas wild-type retinal columns show a normal temporal program of retinal neurogenesis and neuronal differentiation (Figure 3 and 6 of “Imai et al., (2014) Dev. Biol., 394, 94-109.”). Thus, we investigated the extent to which wild-type donor retinal cells attract microglial precursors in slbp mutant retinas by competing with slbp mutant host retinal cells. In this case, a simple control is transplantation of wildtype donor cells into wild-type host retinas. It is ideal to investigate the rate of association of microglial precursors with donor retinal columns under similar conditions with the total number of host microglial precursors per eye and the total number of transplanted donor columns per eye.

In the revised manuscript, we presented all this information plus the number of microglial precursors associated with transplanted retinal columns for each sample: 5 samples of wt-> wt and 3 samples of wt -> mut in Figure 5—figure supplement 1. The total number of host microglial precursors at 48 hpf was n=19.6 for wt-> wt and n=7.7 for wt-> mut, which is consistent with data shown in Figure 4AB. The total number of transplanted donor columns is n=5.6 for wt-> wt and n=4.7 for wt-> mut. Thus, we believe that comparison of the fraction of microglial precursors associated with donor retinal columns between wt -> wt and wt -> mut was done appropriately to evaluate trapping efficiency for donor retinal cells to host microglial precursors.

Furthermore, we added another chimeric retina experiment by introducing retinal columns expressing NICD in wild-type retinas. In this case, we introduced a small number of (NICD-expressing) proliferative columns in wild-type neurogenic retinas, which is contrast to the transplantation experiment from wild-type donor cells into slbp mutant host retinas. We obtained consistent data, which support the idea that retinal neurogenic columns are more attractive to microglial precursors than proliferative progenitor columns. These data have been added to Figure 5E-H.

Reviewer #3:

Ranawat and Masai reports on characterizing the cellular mechanism by which microglia colonize the retina in zebrafish. This is an interesting and novel topic as there has not been a formal investigation of retinal microglia colonization in zebrafish or other vertebrate models, and would provide important insights into possible distinction, if any, between retinal versus brain microglia. The authors attempt to examine whether the same cellular mechanisms that mediate brain microglial colonization are the same for retinal microglia in zebrafish. However, many of the conclusions are coming from insufficient evidence or contain significant flaws, as discussed below. One of the major issues is that the authors attempt to make claims on several mechanistic features distinguishing retinal microglia from tectal brain microglia during colonization into the CNS, but the data either are missing important controls, or analysis is incomplete and remains quite equivocal.

1) The authors concluded that retinal microglial migration into retina depends on blood vessel network. Their primary argument was that tnnt2 morpholino-mediated blockage of blood flow disrupted blood vessel development, and thereby prevented retinal microglial colonization. However, this analysis still contains critical gaps (see a), and the alternate explanation that a lack of blood flow could prevent microglial colonization, which in turn disrupt blood vessel formation remains equally likely but not sufficiently addressed. They used pu.1 morpholino as a means for removal of myeloid cells (including microglia), but necessary control characterizations are lacking (see b).

a) Although colonization may begin earlier in the retina than in the tectum, analysis of whether blood flow/blood vessel is required should be verified at 3-4 dpf when colonization of both retinal and tectal microglia is abundant. In the same embryos when blood flow is blocked, both retina and brain microglia should be examined. This way the difference claimed by the authors that in fact retinal microglia are different from tectal microglia that they require blood flow/vessel could be clearly examined simultaneously to make a clear conclusion. Because of its small size at these stages, most studies of zebrafish microglia already image both retina and brain in whole mount, but the retinal microglia just have not been specifically analyzed, so there is no good reason for the authors not to examine both locations especially if they are making strong points about their differences. A priori, however, the gross level phenotypes of tectal microglia seem to align with retinal microglia based on papers already published about microglia mutants (including il34, irf8 etc).

In accordance with reviewer 3’ suggestion, we examined microglial colonization of the optic tectum at 48hpf and 72 hpf. The number of mfap4+ cells in the optic tectum was ~5 at 48 hpf and increased to ~30 at 72 hpf in standard MO-injected control embryos, indicating progressive increase of tectal microglia in wild-type embryos during the period from 48 hpf to 72 hpf. On the other hand, the number of mfap4+ cells in the optic tectum was ~15 and significantly higher in tnnt2a-MO-injected embryos than in standard MO-injected control embryos at 48 hpf. In addition, tectal mfap4+ cells in tnnt2a morphants at this stage (48 hpf) displayed a round shape, which is reminiscent of a phagocytic activation state. We suspect that apoptosis may be increased in the optic tectum of tnnt2a morphants, attracting more microglia into the optic tectum at 48 hpf. However, the number of mfap4+ cells in the optic tectum was not drastically increased in tnnt2a morphants from 48 hpf to 72 hpf, so the number of tectal mfap4+ cells is not significantly different from that of standard MO-injected control embryos at 72 hpf, as reported previously. Thus, the number of mfap4+ cells in the optic tectum is eventually similar in standard MO-injected control embryos and tnnt2a-MO-injected embryos at 72 hpf. Although our tnnt2a-MO data are consistent with the previous report, we think that the situation may be more complex and differs from the previous report, which concluded that microglial colonization of the optic tectum does not depend on blood vessel function in zebrafish. We have added these observations to Figure 2 —figure supplement 2. These data support our conclusion that microglial precursor colonization of the retina depends on blood vessels at 48 hpf, in contrast to the optic tectum at 3 dpf.

b) The effectiveness of pu.1 mo to fully ablate macrophages was not demonstrated and in fact the panels shown in Figure 2 supp 1 indicate at best a partial ablation of myeloid cells in pu.1 morphants as many fluorescently red tagged macrophages were detectable. Since morpholino injections are transient, varying levels of pu.1 knockdown are expected, only individual embryos showing complete absence of macrophages should be used for analysis. Complementary experiments should be done using macrophage-lacking mutants such as irf8 mutants (this will address any caveat from transient/mosaic knockdown by morpholino) to confirm a lack of a macrophage role in retinal vessel development. Appropriate validation is critical for making correct interpretations, especially in light of the negative data and also previous work in mice implicating microglia for retinal vessel development.

We apologize that our preparation of Figure 2—figure supplement 1 in the original manuscript was not good enough. Patchy dotted magenta signals surrounding the optic cup in pu.1 morphants were caused by noise caused by reflection of iridophore pigments, which start to appear after 48 hpf. Furthermore, we did not clearly indicate the ocular microglial precursors in standard MO-injected retinas, because mfap4 fluorescent signals in the current 3D images contain both ocular microglial precursors as well as peripheral macrophages located in mesenchymal area between the optic cup and the diencephalon. Thus, we re-examined 3D scanning of pu.1 morphants and extracted only ocular microglial precursors using the Imaris software surface rendering tool, and we confirmed that there are no ocular microglial precursors in pu.1 morphant embryos. We have replaced the previous figure with new scanning image data in new Figure 2—figure supplement 3AB. Furthermore, in accordance with reviewer 3’s suggestion, we examined blood vessel formation in irf8 mutant retinas, and confirmed that ocular blood vessel formation is normal in irf8 mutants. We have added these data to new Figure 2—figure supplement 3CD.

2) Data as shown in Figure 1-supp3 lead to questions of whether "dividing" microglial cells were reliably quantified. The lateral view is at low resolution in a thick section of the retina-the example does not show any convincing example of a single microglial cell that is also BrdU+. Please analyze at higher cellular resolution and show a magnified example of a proliferative microglial cell. The concern is that the counting is over-represented than the actual number dividing which looks like zero in the A panels example. There seems to be far fewer if any dividing microglial cell.

In accordance with the reviewer’s suggestion, we conducted BrdU labeling of retinal sections of mpeg1.1:EGFP transgenic embryos, and confirmed that the fraction of BrdU+; mpeg1.1:EGFP+ cells among total mpeg1.1:EGFP+ cells is less than 20% on average, suggesting that more than 80% of microglial precursors do not undergo S phase. We have revised the BrdU data and it is shown in Figure 1—figure supplement 4BCD.

3) The authors claim a second feature relating to not requiring signals from apoptotic neurons that sets apart retinal from tectal microglia in zebrafish, but the evidence is weak. Based on studies of others, microglia have been shown to colonize the tectum in part by signals coming from apoptotic neurons in the brain in zebrafish. This current study only transiently inhibits global cell death using an antisense morpholino against tp53. At the minimum, the authors need to show that (1) this tp53 MO injection does indeed eliminate retinal/brain apoptosis during development, (2) that at later stages 3-5 dpf using tp53 morpholino (assuming they confirm its efficacy in inhibiting neuronal apoptosis), if their conclusion is correct, the results should show normal presence of retinal microglia but an absence of tectal microglia, and (3) slbp1 mutants do not have less apoptotic neurons to explain for a reduced microglial colonization in the retina.

We appreciate this suggestion. A similar concern was raised by reviewer 2, in suggestion (3).

In accordance with reviewer 3’s suggestion, we examined efficiency of p53 MO to inhibit apoptosis in the retina at 24, 36, and 48 hpf. We confirmed that p53 MO significantly suppressed apoptosis in zebrafish retina at 24 and 36 hpf. At 48 hpf, the apoptotic level was lower than that at 24 and 36 hpf in wild-type retina, so there was no statistical difference in apoptotic cell number between Standard MO-injected retinas and p53 MO-injected retinas. We have added these data in Figure 3—figure supplement 2AB.

Furthermore, we investigated colonization of microglial precursors into tectum at 96 hpf in zebrafish. Although microglial precursor colonization of the retina was not changed in p53 morphants, microglial colonization of the optic tectum was affected in p53 morphants. These data suggest that colonization of the optic tectum depends on apoptosis, which is consistent with previous reports. On the other hand, colonization of the retina is independent of apoptosis. We have added these data to Figure 3—figure supplement 3.

We are grateful for this suggestion to investigate apoptosis in slbp mutants. We employed TUNEL in wild-type and slbp mutant retinas at 48 hpf. We found that apoptotic cells were significantly increased in slbp mutant retinas. These data exclude the possibility that decreased retinal apoptosis affects microglial precursor colonization of the retina in slbp mutants, and again confirmed that neuronal apoptosis is not a major cue for microglial precursor colonization of the retina in zebrafish. We have added these data to Figure 4—figure supplement 4.

From these observations, we consider it likely that retinal neurogenesis is delayed in slbp mutants -> microglial precursor infiltration is compromised -> naturally occurring apoptotic cells fail to be eliminated because of the reduced number of microglial precursors in slbp mutant retinas; however, interestingly, these increased dead cells do not promote microglial precursor infiltration into slbp mutant retinas, suggesting that neurogenesis primarily opens the gate through which microglial precursors enter the retina. Since retinal neurogenesis normally occurs from 24 to 48 hpf in zebrafish, microglial precursors could not be attracted by apoptosis without the infiltration path opened by retinal neurogenesis before 48 hpf. This interpretation could explain why microglial precursors approaching towards the retina before 48 hpf are insensitive to apoptosis. We have added this idea to the discussion.

4) Histone deacetylase 1 (HDAC1) is expected to function in a variety of cell type. The use of its chemical inhibitor TSA broadly, and the global hdac1 mutant raise question as to whether hdac1 itself has a function in macrophages to affect their ability to migrate or differentiate into microglia? Figure 4-supp3 shows some punctate macrophage reporter patterns. The authors need to address this.

A similar concern was raised by reviewer 2, in suggestion (4).

We agree with reviewer 3, so we have deleted the HDAC data from our manuscript.

5) Whether a morpholino has been published previously or not, efficacy for all morpholinos should be verified either at least phenotypically (if previously published), or by both molecular and phenotypic means (if new and yet unpublished) to substantiate that the reagent works as intended in the researcher's own laboratory operations. This includes the cxcl12a morpholino.

In this study, we used 5 morpholinos: tnnt2a MO, p53 MO, cxcl12a MO, pu.1 MO, and ath5 MO. All MOs except ath5 have been previously reported. However, to evaluate whether each MO concentration is sufficient to knock down target gene translation, we confirmed that each MO induced the expected phenotypic defects. We have added these data to the supplementary figures below.

tnnt2a MO: thinner blood vessels shown in Figure 2C and Figure 2—figure supplement 2A.

p53 MO: Reduction of apoptosis shown in Figure 3—figure supplement 2. cxcl12a MO: Misrouted trajectory of retinal axons shown in Figure 4—figure supplement 5AB. pu.1 MO: No microglial precursors shown in Figure 2—figure supplement 3AB. ath5 MO: No RGC differentiation shown in Figure 4—figure supplement 8.

6) The interpretation that il34/csf1r pathway is not involved in retinal microglial colonization as it is for tectal brain microglia in zebrafish is surprising, because recent analyses of microglia in zebrafish il34 mutants indicate a significant reduction (based on data from these work there is reduction also in retina, but the retinal population was not formally analyzed) (Kuil et al., 2019 DMM; Wu et al., 2018 Dev Cell). The evidence on which the authors have made this conclusion is rather weak and possibly flawed. First of all, gene expressions on whole body for il34 distinguishing WT vs slbp1 mutant and that csf1r not being detected in a single cell analysis of microglial precursors cannot form a strong argument that this pathway is not involved as csf1r may just be lowly expressed and global expression may not be informative. The authors must analyze the il34 mutants to examine whether retinal microglia colonize or not in parallel with the tectal microglia. The only functional experiment they use is an rx1:il34 overexpression in the eye which was not sufficient to increase macrophage colonization-however the caveat is that this overexpression is mosaic and whether functional il34 proteins are getting produced is not known.

We appreciate this suggestion. A similar concern was raised by reviewer 2, in suggestion (2).

In accordance with reviewer 3’s suggestion, we investigated the number of ocular microglial precursors in zebrafish il34 mutants. We found that the number of ocular microglial precursors was severely reduced in il34 mutants. Very few microglial precursors (from 0 to 2 cells) are associated with blood vessels in il34 mutant eyes at 48 hpf. These data suggest that IL34 is required for microglial precursor colonization of the retina in zebrafish. Since almost no microglial precursors can enter the optic cup, it is very likely that IL34 helps to guide microglial precursors from the yolk to the retina, upstream of blood vessel-mediated entry of the optic cup and neurogenesis-mediated infiltration of the neural retina. We have added these new data to Figure 6AB and have revised our conclusion: There are three steps for microglial colonization of the retina: In the first step, IL34 attracts microglial precursors and promotes their migration into the brain and eye. In the second step, blood vessels guide microglial precursors to enter the optic cup. In the third step, retinal neurogenesis enables microglial precursors to infiltrate the neural retina. This conclusive summary is also indicated in new Figure 6C.

7) Finally, more data points are required to formulate a reliable conclusion that microglia have a preference for differentiated retinal neurons and less with progenitors using the chimeric host-donor transplantation. There is a big differential in number of neural columns transplanted in mutants (more donor cells 3-7 columns in mutant hosts, than the 2-4 columns in control wt host group), which can misleadingly show an increased association of microglia with mature columns just because there are more columns in the slbp1 mutants. More Ns to establish equivalent range of donor transplantation (especially larger numbers in the wt group), and also the reciprocal test of putting donor mutant columns into WT host, will provide the needed comprehensive test of this concept using chimeras.

A similar concern was raised by reviewer 2, in suggestion (5).

We increased the number of wt->wt transplantation samples to 5. As reviewer 3 mentioned, it is ideal to maintain similar conditions across all samples regarding the total number of host microglial precursors per eye and the total number of transplanted donor columns per eye.

In the revised manuscript, we showed all this information plus the number of microglial precursors associated with transplanted retinal columns for each sample: 5 samples of wt-> wt and 3 samples of wt -> mut in Figure 5—figure supplement 1. The total number of host microglial precursors at 48 hpf was n=19.6 for wt-> wt and n=7.7 for wt-> mut, which is consistent with data shown in Figure 4AB. The total number of transplanted donor columns is n=5.6 for wt-> wt and n=4.7 for wt-> mut, which is not a big difference. Thus, we believe that our comparison of the fraction of microglial precursors associated with donor retinal columns between wt -> wt and wt -> mut was done appropriately to evaluate trapping efficiency for donor retinal cells by host microglial precursors.

8) The use of slbp1 mutants being only interpreted as a neurogenesis mutant can be problematic as this gene slbp1 (stem-loop binding protein binds to 3'end histone mRNAs) regulates degradation of histone proteins and replication-dependent synthesis and can have broad effects similar to the issue with hdac1 mutants. Complementary method to create neuron-specific disruption of neurogenesis would be ideal to substantiate the concept that the differentiation status of retinal neurons strongly affect colonization of microglia in the retina.

We appreciate this suggestion. Reviewer 2 raised a similar concern in suggestion (4).

We previously reported that Notch1 intracellular domain (NICD) suppresses retinal neurogenesis in zebrafish (Yamaguchi et al., 2005). To inhibit retinal neurogenesis more directly, without perturbation of microglial precursor functions, we overexpressed NICD in retinal cells and examined ocular microglial colonization of the retina. First, we confirmed that overexpression of NICD significantly suppresses retinal neurogenesis in zebrafish by injecting a DNA expression construct encoding UAS: myc-tagged NICD into Tg[hs:gal4; ath5:EGFP] double transgenic embryos (Figure 4—figure supplement 7).

Next, we established a zebrafish transgenic line, Tg[rx1:gal4-VP16], in which gal4-VP16 is expressed under the control of the rx1 promoter, which drives mRNA expression in retinal progenitor cells. Then, we injected a mixture of two DNA expression constructs encoding UAS:myc-tagged NICD and UAS:EGFP into Tg[rx1:gal4-VP16; mfap4:tdTMT-CAAX] embryos. We selected embryos in which EGFP was expressed in most retinal cells at 24 hpf, and used them to investigate the number of ocular microglial precursors. We found that the number of ocular microglial precursors was significantly decreased in retinas overexpressing NICD, compared with retinas expressing only EGFP. Since the rx1 promoter does not drive NICD expression in microglial precursors, these data suggest microglial colonization of the neural retina depends on retinal neurogenesis. We have added these new data to Figure 4EF.

In addition, we performed more sparse mosaic expression of NICD in wild-type retinas by injection of DNA construct encoding UAS:EGFP or a mixture of UAS:myc-NICD and UAS:EGFP into Tg[hsp:gal4: mfap4:tdTMT-CAAX] transgenic embryos. A fraction of microglial precursors associated with EGFP-positive columns was lower after UAS:NICD; UAS:EGFP injection than in UAS:EGFP injection only. Trapping efficiency of microglial precursors in each EGFP-positive columns was also lower in UAS:NICD; UAS:EGFP injection than in only UAS:EGFP injection. We have added these data to Figure 5EFGH.

Taken together, these data strongly support the possibility that retinal neurogenesis induces microglial precursors to infiltrate the retina.

[Editors’ note: what follows is the authors’ response to the second round of review.]

Overall, the authors have done a thorough and comprehensive job of addressing the points raised by the initial peer review and added additional controls and significant new data. This has particularly strengthened the conclusion that microglia colonization of retina is linked to neurogenesis, which is the central new finding of this study. However, there are a few remaining (minor) concerns that need to be addressed as summarized below by reviewers 1 and 3. In addition, there are few areas in the manuscript that overstate the conclusions based on the data reported in the manuscript. Please consider modifying the following conclusions it is not feasible to address experimentally in a timely manner.

– The origin and characterization of the macrophage population(s) in the retina. For example, please state clearly their definition of microglia early in the results (In this manuscript, we define microglia as…").

We have added the following sentences on page 6, lines 130-133:

“In this study, we focus on two macrophage markers, mpeg1.1 and mfap4, and define mpeg1.1; mfap4positive cells inside the optic cup as microglial precursors colonizing the zebrafish retina.”

– The spatiotemporal role and relationship of IL34, microglia colonization and neurogenesis as raised by reviewer 1. These concerns can be addressed by adding experiments or modifying the current conclusions.

We have revised the text and Figure 6C in accordance with referee suggestions. Furthermore, we have examined the number of ocular microglial precursors in wild-type, il34 heterozygous and homozygous mutants at an earlier stage (34 hpf) and confirmed that the number was zero and significantly lower in il34 homozygous mutants than in wild-type and heterozygous mutants. We have added these data in new Figure 6—figure supplement 2. Accordingly, the original Figure 6—figure supplement 2 is renamed Figure 6figure supplement 3.

Reviewer #1:

Please consider the following suggestions for the paper.

– The authors should use other markers to verify that the cell populations of interest are microglial precursors. Using only macrophage markers may not encapsulate the heterogeneity of embryonic microglia in the zebrafish. Can the authors analyze other markers for microglia to demonstrate their identity? While they cite papers referencing apoeb, the data in the manuscript demonstrate microglia in different CNS regions have distinct properties. There are several reagents like antibodies against 4C4, or L-plastin or in situ hybridization of microglia genes like apoeb, or p2ry12 that could be used, as done in other zebrafish microglia manuscripts.

We agree that developing zebrafish larvae have a heterogenous population of microglia. Thus, we used a combination of macrophage/microglia markers mpeg1.1 and mfap4 throughout our study.

However, we understand the referee’s concern as to whether both mpeg1.1 and mfap4 marker-expressing cells represent microglial precursors, mature macroglia, or macrophages in the early stage of embryonic development in zebrafish. To clarify this point, we are currently investigating the state of mfap4:tdTomato-positive cells from 2 – 5 dpf, by scRNA-seq, using zebrafish heads at 2, 3 and 5 dpf. We found that 2 dpf, mpeg1.1 and mfap4-expressing cells form only one cluster. This single cluster expresses both microglial and macrophage markers ccl34b.1 and lygl1, but importantly does not express a mature microglial marker apoeb. Thus, it is very likely that 2 dpf mpeg1.1 and mfap4expressing cells are macrophage/microglial precursors. At 3 dpf, mfap4-expressing cells are separated into 5 clusters. Among them, only two clusters express apoeb, suggesting that mature microglia appear by 3 dpf. Importantly, in these apoeb-positive clusters, the macrophage marker lygl1 expression is downregulated and another microglial marker ccl34b.1 expression is upregulated. On the other hand, lygl1 expression is maintained and ccl34b.1 expression is downregulated in other three apoeb-negative clusters. Thus, fate determination of microglia and macrophage proceeds at 3 dpf. At 5 dpf, cell fate for mature microglia and macrophages is more clearly segregated in mfap4-expressing cells. Thus, our current unpublished data revealed that mpeg1.1/mfap4-expressing cells at 2 dpf are reasonably classified as macrophage/microglial precursors, and a fraction of them differentiate into mature microglia after 3 dpf. Since there is a classic and pioneer work indicating that early macrophages outside the brain never express Apoe (Herbomel et al., 2001), we believe that mpeg1.1/mfap4-positive ocular cells at 2 dpf differentiate into mature microglia after 3 dpf. Thus, in this study, we focus on mpeg1.1/mafap4 cells from 32 to 54 hpf, so we have defined mpeg1.1/mafap4-expressing cells in the optic cup as “microglia precursors” in our manuscript.

Consistent with our scRNA-seq data, labeling with anti-ApoEb antibody or in situ hybridization with apoeb RNA probe does not capture microglia precursors before 2 dpf in zebrafish. Furthermore, 4C4 antibody has not been shown to capture microglia precursors before 2dpf. p2ry12 expression also starts in mpeg1.1/mfap4-positive cells at 3dpf. Thus, none of them are available to detect microglial precursors for our study. However, in accordance with the referee’s suggestion, we examined the number of L-plastin-positive cells at 32 – 54 hpf by in situ hybridization, and confirmed that the number of L-plastin-positive cells is comparable with that of mpeg1.1:EGFP-positive cells shown by live imaging (Figure 1BC), although L-plastin is a pan-leukocyte marker and labels both differentiated neutrophils and macrophages (Meijer et al. (2008) Dev. Comp. Immunol. 32, 36–49.). We have added data regarding ocular L-plastin-positive cell temporal profile in new Figure 1—figure supplement 1.

Accordingly, the original Figure 1—figure supplement 1–4 is renamed “Figure 1—figure supplement 2–5.”

– The systemic inhibition of circulation is a concern because the manipulation is a global perturbation that impacts heart contraction. The data supporting the reliance of migrating microglial precursors on vasculature would be more convincing if the authors specifically inhibited the vasculature that they propose is utilized for microglia colonization. This concern is heightened by the observation that the animals in the tnnt2aMO look very unhealthy.

We applied a few chemical inhibitors such as SU5416, which was reported to inhibit blood vessel formation (Covassin et al., (2006), PNAS 103, 6554-9.; Herbert et al., (2009) Science 9, 294-298.); however, they affected myeloid cell genesis in developing zebrafish larvae, probably because both endothelial cells (blood vessel precursors) and myeloid cells are derived from hemangioblasts (Xiong (2008) Dev Dyn 237, 1218-1231.). So, there is no genetic or chemical tool for specific hyaloid blood ablation. We agree that tnnt2a morphants look unhealthy at 72 hpf, and we already noted in the legend of Figure 2—figure supplement 2AB that microglial colonization of the tectum may be different from previous reports, although the number of mfap4+ cells in the optic tectum is not significantly different between control morphants and tnnt2a morphants at 72 hpf, as reported previously. However, the embryonic condition of tnnt2a morphants is comparable to that of control morphants at 48 hpf (see Figure 2-figiure supplement 2C). Considering the live imaging observation that microglial precursors move into the optic cup along the hyaloid blood vessel, our conclusion that embryonic microglial precursors migrating into the retina depend on blood vessels is convincing.

– There are a few areas in the manuscript that overstate the conclusions based on the data reported in the manuscript. Please consider modifying the following conclusions in the manuscript:

– The authors summarize their findings with a schematic in figure 6. The model states a stepwise process to microglia colonization of the retina, but the data reported in the manuscript support a more continuous process of microglia colonization. Further, the first step in the model is IL34-mediated migration to the brain, but the data reported in the manuscript only shows a reduction of microglia in the retina without follow up experiments to address when in the process microglia are disrupted in IL34 mutant animals. Please consider revising the model so that it is more consistent with the conclusions in the paper.

– The comment "it is very likely that csf1r-il34 signaling promotes…" overstates the conclusion one can draw from the reported data. It would be more accurate to state that it is involved in colonization. Otherwise, the authors should assess the step wise process of colonization when IL34 is perturbed.

We agree with two of the referee’s concerns above. In accordance with his suggestions, we have revised Figure 6C and statements about the model in the Abstract, Discussion and Figure 6C legend, that IL34-mediated movement of microglial precursors into the brain may proceed in parallel or complement blood vessel and neurogenesis-mediated colonization of the retina, instead of stepwise regulation of the three processes.

– The authors utilize the NICD manipulation to test whether neurogenesis is required for microglia colonization of the retina. This is a clever approach to altering neurogenesis. With this experiment, it is possible that the Notch pathway is directly impacting microglia colonization. Please consider modifying the sentence line 379-380 "Thus microglial precursors are less attracted…in which neurogenesis was arrested." to add a disclaimer that the direct role of Notch signaling cannot be ruled out.

We introduced expression of NICD using UAS:NICD combined with Tg[hsp:Gal4] or Tg[rx1:Gal4VP16]. We observed decreased colonization of microglial precursors in retinas expressing NICD by Tg[rx1:Gal4-VP16] (Figure 4EF). Since rx1 promoter drives Gal4-VP16 only in retinal progenitor cells, we can exclude the possibility that Notch signaling directly influences microglial precursors to affect colonization of the retina. In the experiment of Figure 5E-H, hsp promoter may drive NICD expression in microglia. However, in this experiment, we introduced UAS:EGFP together with UAS:NICD to monitor which cells express NICD. We have not observed EGFP expression of mfap4:tdTomato expressing microglial precursors in the images that we analyzed. Thus, we consider it very unlikely that Notch signaling directly influences microglial precursors to affect their colonization of the retina.

So, we would like to keep this conclusive sentence without addition of a disclaimer.

Reviewer #3:

In this study, the authors investigate microglia colonization of the retina in zebrafish. Some of their observations confirm work from previous studies. They first carefully show that there is almost no proliferation of microglial precursors, which was previously shown in mouse retina (Santos et al., 2008) but not in zebrafish. They make the sound conclusion that microglia precursors migrate in to colonize the retina. They clearly show that neuronal apoptosis is not the major cue for microglial precursor colonization of the retina as it is for tectum, although this was previously documented in zebrafish by Wu et al., 2018 (which they gloss over in the manuscript). They also show that Csf1r-il34 signaling is important for microglia colonization of retina, although this was also shown by Wu et al. 2018 (again glossed over). Due to almost complete failure of microglia precursors to populate they eye in IL34 mutants, they argue that Csf1r-il34 signaling promotes microglial precursor movement from yolk to the optic cup upstream of the blood vessel-mediated guidance mechanism. However, it remains unclear which cell populations express IL34 developmentally to attract microglia precursors to the eye and at what stages this occurs. So their observations regarding the role of Csf1r-il34 signaling do not advance much beyond what is shown by Wu et al., 2018.

They also make some new observations. They convincingly show that entry of microglial precursors into the optic cup through the choroid fissure depends on ocular blood vessels. Most interestingly, they show using three different manipulations that delaying retinal neurogenesis reduces microglial precursor colonization of the retina. They further show using elegant transplant studies that microglia precursors have greater affinity for differentiating neurons than for retinal progenitor cells. These experiments are carefully done and convincing. The mechanisms underlying this process are unclear since RGC differentiation begins at 27hpf, but microglia precursors don't enter until after 42hpf. They rule out IL34 as the signal since it is not altered in their slbp1 mutants (which show delayed delayed neurogenesis and delayed microglia colonization). So the main new conclusion is that microglia colonization of retina depends upon ocular blood vessels and is linked to neurogenesis. These findings are interesting and important.

The authors have thoughtfully responded to prior comments from reviewers and added additional controls and significant new data. This has particularly strengthened the conclusion that microglia colonization of retina is linked to neurogenesis, which is the central new finding of this study. However, the mechanisms underlying this process remain undefined.

We appreciate these comments on our studies. Previously, Wu et al., (2018) demonstrated that microglial colonization of the brain, including the retina, depends on CSF-R and a CSF-R ligand, IL34. Following this pioneer work on zebrafish colonization of the brain, we have focused on the retina to investigate the microglial precursor colonization process in more detail. We found that microglial precursors enter the optic cup along the hyaloid blood vessel. Furthermore, surprisingly, microglial precursors infiltrate the neural retina through the neurogenic area, and a blockade of neurogenesis compromises microglial colonization of the retina. Although the mechanism underlying neurogenesis mediated colonization is unknown, we are planning to investigate it as our next project. As per the referee’s suggestion regarding Wu et al., (2018), we have cited their reference in the text.

https://doi.org/10.7554/eLife.70550.sa2

Article and author information

Author details

  1. Nishtha Ranawat

    Developmental Neurobiology Unit, Okinawa Institute of Science and Technology Graduate University, Onna, Japan
    Present address
    Neural Connectivity Development in Physiology and Disease Laboratory, Burke Neurological Institute, White Plains, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Software, Validation, Visualization, Writing – original draft, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-9577-1171
  2. Ichiro Masai

    Developmental Neurobiology Unit, Okinawa Institute of Science and Technology Graduate University, Onna, Japan
    Contribution
    Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review and editing
    For correspondence
    masai@oist.jp
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6626-6595

Funding

Okinawa Institute of Science and Technology Graduate University

  • Ichiro Masai

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Graham Lieschke for DNA constructs encoding mepg1.1:EGFP, David Tobin for DNA constructs encoding mfap4:tdTomato-CAAX, Francesco Argenton for DNA construct encoding Ptf1a:EGFP, William Talbot for zebrafish irf8 mutant line, Zilong Wen for zebrafish il34 mutant line, and José Campos-Ortega for DNA constructs encoding UAS-myc tagged NICD. We also thank lab members, especially Yuko Nishiwaki, Yuki Takeuchi, Yutaka Kojima, Jeff Liner, Mamoru Fujiwara, and Tetsuya Harakuni for supporting experiments. We thank Steven D Aird for editing the manuscript.

Ethics

All zebrafish experiments were performed in accordance with the Animal Care and Use Program of Okinawa Institute of Science and Technology Graduate University (OIST), Japan, which is based on the Guide for the Care and Use of Laboratory Animals by the National Research Council of the National Academies. The OIST animal care facility has been accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC International). All experimental protocols were approved by the OIST Institutional Animal Care and Use Committee.

Senior Editor

  1. Richard M White, Memorial Sloan Kettering Cancer Center, United States

Reviewing Editor

  1. Beth Stevens, Boston Children's Hospital, United States

Publication history

  1. Preprint posted: May 20, 2021 (view preprint)
  2. Received: May 20, 2021
  3. Accepted: November 2, 2021
  4. Version of Record published: December 7, 2021 (version 1)

Copyright

© 2021, Ranawat and Masai

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 632
    Page views
  • 84
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Developmental Biology
    Merlin Lange et al.
    Research Article Updated

    In the past few decades, aquatic animals have become popular model organisms in biology, spurring a growing need for establishing aquatic facilities. Zebrafish are widely studied and relatively easy to culture using commercial systems. However, a challenging aspect of maintaining aquatic facilities is animal feeding, which is both time- and resource-consuming. We have developed an open-source fully automatic daily feeding system, Zebrafish Automatic Feeder (ZAF). ZAF is reliable, provides a standardized amount of food to every tank, is cost-efficient and easy to build. The advanced version, ZAF+, allows for the precise control of food distribution as a function of fish density per tank, and has a user-friendly interface. Both ZAF and ZAF+ are adaptable to any laboratory environment and facilitate the implementation of aquatic colonies. Here, we provide all blueprints and instructions for building the mechanics, electronics, fluidics, as well as to setup the control software and its user-friendly graphical interface. Importantly, the design is modular and can be scaled to meet different user needs. Furthermore, our results show that ZAF and ZAF+ do not adversely affect zebrafish culture, enabling fully automatic feeding for any aquatic facility.

    1. Developmental Biology
    2. Evolutionary Biology
    Yushi Wu et al.
    Research Article

    Gene regulatory networks coordinate the formation of organs and structures that compose the evolving body plans of different organisms. We are using a simple chordate model, the Ciona embryo, to investigate the essential gene regulatory network that orchestrates morphogenesis of the notochord, a structure necessary for the proper development of all chordate embryos. Although numerous transcription factors expressed in the notochord have been identified in different chordates, several of them remain to be positioned within a regulatory framework. Here we focus on Xbp1, a transcription factor expressed during notochord formation in Ciona and other chordates. Through the identification of Xbp1-downstream notochord genes in Ciona, we found evidence of the early co-option of genes involved in the unfolded protein response to the notochord developmental program. We report the regulatory interplay between Xbp1 and Brachyury, and by extending these results to Xenopus, we show that Brachyury and Xbp1 form a cross-regulatory subcircuit of the notochord gene regulatory network that has been consolidated during chordate evolution.