A novel live-cell imaging assay reveals regulation of endosome maturation

  1. Maria Podinovskaia
  2. Cristina Prescianotto-Baschong
  3. Dominik P Buser
  4. Anne Spang  Is a corresponding author
  1. Biozentrum, University of Basel, Switzerland

Abstract

Cell-cell communication is an essential process in life, with endosomes acting as key organelles for regulating uptake and secretion of signaling molecules. Endocytosed material is accepted by the sorting endosome where it either is sorted for recycling or remains in the endosome as it matures to be degraded in the lysosome. Investigation of the endosome maturation process has been hampered by the small size and rapid movement of endosomes in most cellular systems. Here, we report an easy versatile live-cell imaging assay to monitor endosome maturation kinetics, which can be applied to a variety of mammalian cell types. Acute ionophore treatment led to enlarged early endosomal compartments that matured into late endosomes and fused with lysosomes to form endolysosomes. Rab5-to-Rab7 conversion and PI(3)P formation and turn over were recapitulated with this assay and could be observed with a standard widefield microscope. We used this approach to show that Snx1 and Rab11-positive recycling endosome recruitment occurred throughout endosome maturation and was uncoupled from Rab conversion. In contrast, efficient endosomal acidification was dependent on Rab conversion. The assay provides a powerful tool to further unravel various aspects of endosome maturation.

Editor's evaluation

The manuscript describes and validates a method for observing endosome dynamics in living cells. The approach may open the door to mechanistic studies of endosome maturation.

https://doi.org/10.7554/eLife.70982.sa0

Introduction

Endosomes are central organelles in orchestrating cell interactions with the extracellular environment, whether by regulating the composition of signaling molecules at the plasma membrane or by facilitating uptake and digestion of certain nutrients or degrading toxic or no longer needed material. Their wide range of functions is accomplished through a sequential and highly regulated process known as endosome maturation (Huotari and Helenius, 2011; Podinovskaia and Spang, 2018; Spang, 2016). Early endosomes accept incoming cargo from the endocytic vesicles and undergo extensive sorting to package selected cargo into recycling vesicles for the return to the cell surface or to the Golgi, whereas membrane cargo destined for removal is internalised into intraluminal vesicles (ILVs) for its subsequent degradation in endolysosomes. As these sorting endosomes mature into late endosomes, now mainly containing cargo destined for degradation, they no longer accept cargo from the cell surface and acquire properties necessary for their interaction with lysosomes. Upon fusion with lysosomes, late endosomes form endolysosomes, whose highly acidic and hydrolytic milieu facilitates degradation of the remaining cargo and regeneration of the lysosome (Guerra and Bucci, 2016). Throughout this maturation process, the Golgi apparatus supports the endosomal activities by supplying components essential for the progression of endosome maturation, such as proton pump subunits, lysosomal hydrolases, and factors necessary for selective recruitment of GTPases to the endosome (McDermott and Kim, 2015; Nagano et al., 2019).

As endosomes complete their sorting tasks and mature, they undergo extensive changes to their properties to aid their divergent functions. The selective recruitment of GTPases, Rab5 and Rab7 to early and late endosomes, respectively, ensures specificity of interaction with other organelles, such as endocytic vesicles and other early endosomes for Rab5-positive endosomes, and lysosomes for Rab7-positive endosomes (Balderhaar and Ungermann, 2013; Solinger and Spang, 2013). The process of displacement of Rab5 at early endosomes by Rab7 at late endosomes is defined as Rab conversion (Poteryaev et al., 2010; Rink et al., 2005). Additionally, early endosomes contain the signalling lipid PI(3)P, which is further phosphorylated to PI(3,5)P2 in late endosomes (Hsu et al., 2015). These lipids serve as organelle identity molecules, facilitating recruitment of components, such as sorting and tethering factors, necessary for endosomal function (Schink et al., 2013). Endosomal acidification is another essential change that must take place for endosomes to mature, with pH ~6.5, 5.5 and 4.5 characterising early endosomes, late endosomes and lysosomes, respectively (Casey et al., 2010). These changes in GTPase recruitment, PIP composition and acidification status, among others, must be tightly coordinated to ensure unidirectional and aligned adjustments to endosome identity and purpose for the endocytic system to operate properly. However, coordination of such processes during endosome maturation is poorly understood.

A major setback in understanding the kinetics of endosome maturation is lack of experimental systems, which would allow us to monitor endosomes at individual endosome level over prolonged periods of time. The small size of the endosomes and their rapid movement within the cell makes it impractical to track maturing endosomes as they rapidly, within seconds or minutes, move out of field of focus or get lost among other vesicles in the dense perinuclear space. Phagosomes have provided a unique way of studying certain aspects of endosome maturation, allowing for uniform size and synchronisation (Naufer et al., 2018; Podinovskaia et al., 2013). However, these are a specialised subset of endosomes that are involved in minimal amount of sorting and proceed rapidly through endosome maturation, and therefore are not suitable for defining kinetics of classic endosome maturation. Given the present lack of suitable approaches to study endosome maturation, enlarging endosomes might offer a solution to observing individual endosomes over time.

We found that acute nigericin treatment followed by washout led to the formation of enlarged Rab5 positive endosomes that undergo Rab5-to-Rab7 conversion with anticipated kinetics in different cell lines. Other hallmarks of endosome maturation such as PI(3)P, SNX1 and Rab11 recruitment, cargo recycling, and acidification likewise occurred. Finally, matured late endosomes fused with lysosomes, resulting in functional endolysosomes. Our minimally invasive assay provides an inexpensive and robust way to evaluate relative kinetics of key mediators of endosome maturation at individual endosome level. This assay does not require any specialized equipment, and maturation is detected with the ease of a conventional widefield microscope. We used this assay to investigate whether Rab conversion is coordinated with the recruitment of Rab11 recycling compartments and endosomal acidification. We found that interactions between the Rab11 compartment and the maturing endosome did not strongly correlate with Rab conversion. Fusing GalT to ratiometric pHlemon (Burgstaller et al., 2019) (GalT-pHlemon) allowed us to follow the degradation pathway to the lysosome and to demonstrate that acidification is slowed down when Rab conversion is blocked, suggesting that Rab conversion is required for efficient acidification during endosome maturation.

Results

Short nigericin treatment induces enlarged endosomes that undergo Rab conversion

Endosomes are highly dynamic and motile organelles and, given their small size and frequently indistinct and changing shape, are highly uncooperative to monitoring over extended periods of time by microscopy. The ability to follow dynamic events, such as Rab conversion, at individual endosome level is pivotal for unravelling the mechanisms of endosome maturation. Therefore, we sought a minimally invasive way to enlarge endosomes to make them more distinct and traceable over time. We discovered that a 20 min nigericin treatment of HeLa cells, stably expressing mApple-Rab5 and GFP-Rab7, followed by washout led to the formation of enlarged Rab5- and Rab7-positive endosomes (Figure 1A). Nigericin is an ionophore known to reversibly permeabilise membranes to protons and K+ ions. Indeed, the short nigericin treatment disrupted the intracellular pH gradient, which re-established within 20 min of washout as visualised by Lysotracker accumulation in treated cells (Figure 1B). The presence of the enlarged Rab5-positive endosomes was often transient but could also last for longer times, whereas enlarged Rab7-positive endosomes persisted until complete recovery of Rab5 and Rab7 morphology by 20 hr (Figure 1A). We hypothesised that the enlarged Rab5-positive early endosomes mature to Rab7-positive late endosomes. Therefore, we followed individual endosomes at 1 min intervals, starting from enlarged spherical compartments devoid of either Rab5 or Rab7, and we could indeed observe transient recruitment of Rab5 and its subsequent displacement by Rab7 (Figure 1C, Figure 1—video 1), consistent with previous descriptions of Rab conversion events (Del Conte-Zerial et al., 2008; Poteryaev et al., 2010; Skjeldal et al., 2021). These Rab conversion events could be initiated as early as 10 min after nigericin washout (Figure 1—figure supplement 1). Hence, acute nigericin treatment leads to enlarged compartments that are capable of recruiting Rab5 and undergoing Rab conversion.

Figure 1 with 6 supplements see all
Rab conversion and completion of endolysosomal stages of endosome maturation can be observed in enlarged endosomes, induced with short nigericin treatment.

Nigericin was added to HeLa cells at 10 μM for 20 min and washed away, and cells were imaged by time-lapse microscopy. Recovery times are specified relative to removal of nigericin. (A,C,D) Cells stably expressing mApple-Rab5 and GFP-Rab7. (A) Images to show enlarged Rab5- (white arrows) and Rab7- (magenta arrows) positive compartments and return to normal morphology by 20 hr. (B) Lysotracker Red (LTR) was added to cells before, during and following nigericin treatment. Images show rapid re-accumulation of Lysotracker in treated cells (bottom row). Untreated cells were tracked in parallel (upper row). (C) The enlarged endosome was selected to show Rab5 recruitment, Rab conversion and endolysosomal maturation. (D) Example of homotypic fusion of two Rab5-positive endosome and subsequent Rab5 removal/weak Rab7 recruitment. (E) Cells stably expressing mApple-Rab7 were imaged in the presence of Lysotracker Green. An enlarged Rab7-positive endosome was selected to show accumulation of Lysotracker concomitant with the loss of spherical shape and a reduction in size of the maturing endolysome. (C–E) Scale bar = 2 μm. Time-lapse videos of the endosomes in (C–E) at 1 min interval are available in Figure 1—video 1, Figure 1—video 2, Figure 1—video 3, respectively.

We frequently found that Rab5 recruitment was initiated after a Rab5-positive endocytic vesicle or endosome was touching or fusing with an enlarged compartment (Figure 1C; Figure 1—figure supplement 1B), suggesting either kiss-and-run or fusion with a Rab5-positive structure drove Rab5 recruitment. We also observed homotypic Rab5 endosomal fusions, a hallmark of early endosomes, indicating that the enlarged Rab5-positive structures behaved as bona fide early endosomes (Figure 1D, Figure 1—video 2). Following Rab conversion, the spherical Rab7-positive endosomes persisted over a range of several minutes to several hours and remained Lysotracker-negative, with lysosomes seen as Lysotracker-positive puncta circling around the endosomes (Figure 1E, Figure 1—video 3). Once the endosome acidified sufficiently to accumulate Lysotracker, it lost its spherical shape and became smaller until no longer detectable (Figure 1C and E, Figure 1—video 3), which we interpret as endolysosome-to-lysosome maturation. Fusion of the enlarged endosomes with Dextran-AF488-loaded lysosomes was apparent through accumulation of Dextran-AF488 in the enlarged endosomes (Figure 1—figure supplement 1C). Thus, acute nigericin treatment could induce the formation of large early endosomes, which could be observed to mature into late endosomes, and subsequently fuse with lysosomes and undergo endolysosome-to-lysosome maturation. This acute treatment may provide the basis of a powerful assay that could be employed to follow individual maturing endosomes.

How common is this phenomenon of the enlarged endosome induction by acute pharmaceutical treatment? First, we checked whether acute treatment with another ionophore, monensin, or the weak base NH4Cl, which perturbs the pH gradient, would have a similar effect. Indeed, we observed transient Rab5 recruitment and the more extended Rab7 recruitment at the enlarged endosomes of NH4Cl pre-treated cells, and likewise, gradual Rab7 recruitment following acute monensin treatment (Figure 1—figure supplement 2). Therefore, interfering with ion homeostasis and membrane potential appear to solicit a similar stress response as nigericin, resulting in formation of enlarged endosomes. Second, we investigated whether this effect was cell line specific or more generally applicable. We tested the epithelial cell line HEK293, the fibroblast-like cell line COS1 and the neuronal line Neuro2A. In all three cell lines, we could observe enlarged endosomes that were either Rab5 or Rab7 positive (Figure 1—figure supplement 3). Therefore, enlarged endosome induction is not restricted to nigericin treatment of HeLa cells but rather is applicable to a wide range of experimental systems.

TGN membranes transition into endosomes after acute nigericin treatment

Short nigericin treatment led to enlarged endosomes, however, they did not start out as Rab5-positive entities (Figure 1C). Therefore, we investigated the origin of the membranes for these compartments. Electron microscopy images revealed that the enlarged compartments originate at the trans face of the Golgi (Figure 2A), in line with previous reports of ionophore treatment leading to the swelling of the trans-Golgi leaflet (Ledger et al., 1980; Morré et al., 1983; Tartakoff and Vassalli, 1977). We ruled out contribution from the autophagy pathway by staining mApple-Rab7 expressing cells with LC3b antibody and showing no detectable autophagy induction or LC3b presence at the enlarged endosomes at 60 min post nigericin treatment (Figure 2—figure supplement 1A). To determine whether the swollen TGN membranes would enter the endosomal pathway, we performed immuno-electron microscopy with HeLa cells stably expressing trans-Golgi marker GalT-GFP after acute nigericin treatment. The micrographs demonstrate the presence of GalT in the enlarged trans-Golgi network (TGN) compartments and in ILVs of multivesicular bodies at later time points (Figure 2B). Therefore, the membranes that acquire Rab5 and convert to Rab7-positive endosomes are probably derived from the TGN. This swelling of the TGN is likely a transient response to the acute stress because after 48 hr the Golgi had recovered from the treatment (Figure 2C). Consistent with this notion, we occasionally observed swollen Golgi leaflets also in untreated cells signifying a process that occurs naturally in the cell, which we are uniquely amplifying with acute perturbation (Figure 2A). Indeed, the cells continued to grow and divide (Figure 2—figure supplement 1B), and after an initial slow start, the nigericin-treated cells recover their doubling rate within 24 hr (Figure 2—figure supplement 1C). In line with previous reports (Merion and Sly, 1983; Vladutiu, 1984), our findings indicate that short nigericin treatment induces reversible changes and has minimal impact on cell health.

Figure 2 with 1 supplement see all
Nigericin-induced enlarged compartments originate at the Golgi and contain trans-Golgi marker GalT, later found in ILVs, with most enlarged compartments resolved by 48 hr.

Nigericin was added to HeLa cells for 20 min and washed away, and cells were processed for electron microscopy (A–C), imaged by time-lapse microscopy (D) or harvested for counting (E) at specified times after the wash. (A) Cells stained with osmium tetroxide and potassium hexacyanoferrate reveal large spherical compartments (cyan arrows) originating at the trans-face of the Golgi (magenta arrows) in nigericin-treated cells and, occasionally, in untreated cells. (B,C) Cells stably expressing GalT-GFP were stained with anti-GFP and 12 nM Gold-conjugated secondary antibody to reveal GalT-GFP at the Golgi (magenta arrows), the limiting membrane of the enlarged compartments (cyan arrows) as well as in ILVs of the enlarged MVBs at later time points (yellow arrows).

To corroborate our results, we monitored HeLa cells stably expressing GalT-GFP by fluorescence microscopy following acute nigericin treatment. Even in cells without nigericin treatment, a portion of GalT-GFP entered the endosomal pathway, as it was present in Rab5 positive vesicles (Figure 3A). Following nigericin treatment, Golgi vesiculation was observed within 15 min of nigericin washout (Figure 3B, Figure 3—video 1). We observed similar Golgi vesiculation when we used monensin as ionophore (Figure 2—figure supplement 1D). A large fraction of these vesicles would adopt early endosomal identity because individual GalT-positive structures acquired Rab5 over time (Figure 3B), as also observed by immuno-electron microscopy (Figure 3C). Moreover, similar to the transiently transfected GalT-GFP, endogenous GalT persisted in the endosomes (Figure 3D), consistent with the observations of its subsequent internalisation into ILVs (Figure 2B and 11D), and Golgi morphology was fully recovered within 48 hr (Figure 2—figure supplement 1E). The contribution of cargo from the endocytic pathway to the enlarged compartments was evidenced by the addition of Dextran-AF488 for 20 min to the cell medium of nigericin-treated cells and its detection in the Rab5-positive enlarged endosomes already within 8 min of Dextran-AF488 washout (Figure 3—figure supplement 1). These Rab5-positive, Dextran-containing endosomes can also undergo Rab conversion and acquire Rab7, retaining the Dextran as they mature to endolysosomes (Figure 3—figure supplement 1B). Moreover, to demonstrate that the enlarged Rab5-positive endosomes can also acquire plasma membrane cargo, we labeled surface Transferrin receptor (TfR-GFP) with mCherry-tagged anti-GFP nanobody and found that it could reach BFP-Rab5 positive enlarged endosomes (Figure 3—figure supplement 2). Taken together, our findings suggest that acute nigericin treatment leads to enlarged Golgi-derived compartments that are able to acquire early endosomal identity, take up endocytic cargo and mature into late endosomes. Thereby, acute nigericin treatment provides us with a means to generate functionally competent enlarged endosomes that can be monitored at individual endosome level by widefield microscopy over extended periods of time to define the kinetics of a wide range of mediators of endosome maturation.

Figure 3 with 3 supplements see all
Short nigericin treatment leads to trans-Golgi vesiculation and subsequent acquisition of Rab5.

(A) Images of untreated HeLa cells stably expressing mApple-Rab5 and transiently expressing GalT-GFP. Arrows point to puncta positive for both markers. (B–D) Nigericin was added to HeLa cells for 20 min and washed away, and cells were imaged by time-lapse microscopy (B), processed for electron microscopy (C) or for immunofluorescence (D) at specified times after the wash. (B,C) HeLa cells stably expressing GalT-GFP and transiently transfected with mApple-Rab5. (B) Representative kinetic of Golgi vesiculation post nigericin treatment as visualised with GalT-GFP. The selected vesiculated compartment (arrow), initially negative for Rab5 subsequently becomes positive for both markers. A time-lapse video of the endosome at 2 min interval is available in Figure 3—video 1. (C) Immuno-EM image of a cell at 2 hr post recovery, with 12 nm Gold-labelled GFP (green arrows) and 5 nm Gold-labelled mApple (red arrows) present at the enlarged compartments. Scale bar = 500 nm. (D) Images of cells stained with anti-GalT to reveal endogenous GalT presence at the enlarged compartments.

Rab conversion occurs with anticipated kinetics on enlarged endosomes

Having established a novel assay to study endosome maturation, we used it first to revisit the kinetics of Rab conversion. The formation of enlarged early endosomes was asynchronous and therefore we imaged over several hours without significant loss of fluorescence signal. We captured many events of Rab conversion for further analysis and signal quantification. Endosomes that were initially negative for Rab5 and acquired Rab5 during the time course were chosen for analysis. For quantification purposes, we measured the mean fluorescence intensity of the rim of the enlarged endosome at all time points when the endosome was detectable (Figure 4A). Following transient Rab5 recruitment, all selected endosomes underwent Rab conversion. Initially, Rab5 was recruited uniformly to the rim of the endosome, but could segregate also into distinct domains, before becoming completely displaced by Rab7 (Figure 4B, Figure 4—figure supplement 1). Consistent with previous findings, Rab5 levels dropped when Rab7 reached about 50 % of its maximal level (Figure 4B–D; Del Conte-Zerial et al., 2008; Poteryaev et al., 2010; van der Schaar et al., 2008). Moreover, Rab conversion was completed within 4 min after its initiation, which is similar to previously reported observations (Del Conte-Zerial et al., 2008; Poteryaev et al., 2010; Rink et al., 2005). Once Rab5 was fully removed, Rab7 plateaued off showing stable presence at the late endosome (Figure 4D; Figure 4—figure supplement 1B). Occasionally, Rab5 produced multiple peaks, with Rab7 plateauing off after the latest Rab5 peak (Figure 4—figure supplement 1C and D). Such Rab5 behavior may indicate the reversible nature of endosome maturation and existence of checkpoints to ensure alignment of parallel processes. Our results closely agree with Rab conversion kinetics in other systems and further refine Rab conversion kinetics in human cells. Empowered by this strict sequential kinetics of Rab5 and Rab7 in maturing endosomes, we next explored the kinetics of other mediators of endosome maturation relative to either Rab5 or Rab7 recruitment, using the maximum peak of Rab5 or the 50 % of the maximal fluorescence intensity of Rab7 as reference point for Rab conversion.

Figure 4 with 1 supplement see all
Enlarged endosomes recruit Rab5 and undergo Rab conversion with anticipated kinetics.

(A) Scheme to show experimental flow, starting with transfection of cells of choice with selected markers, followed by short nigericin treatment, and time-lapse microscopy during the recovery phase, with subsequent quantification of mean fluorescence intensity (MFI) of the chosen markers at the rim of the enlarged endosomes, and the resulting kinetic plots of background-subtracted MFI normalised for maximum and minimum values over the entire time course of the endosome. Since endosome maturation is asynchronous, relative time is calculated by using Rab5 peak as a reference for Rab conversion and set to t = 0. The plot shown in the scheme represents the kinetic of the images in Figure 1C (marker one as Rab5 and marker two as Rab7).(B,C,D) HeLa cells, stably expressing mApple-Rab5 and GFP-Rab7 were treated for 20 min with nigericin, washed and imaged over a 3 hr period.(B) Time-lapse images of a representative endosome to show transient Rab5 recruitment and its subsequent displacement by Rab7. (C) Corresponding graph of MFI of Rab5 and Rab7 at the rim of the endosome in (B) during and around the time of Rab conversion. Numerical data for all analyzed endosomes is available in Figure 4—source data 1. (D) Averaged Rab5 and Rab7 kinetics of 27 endosomes. Error bars represent standard deviation. Representative graph of three independent experiments.

Figure 4—source data 1

Quantification of Rab5 and Rab7 recruitment at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig4-data1-v1.xlsx

PI(3)P levels peak concomitantly with Rab5 levels

Driving early endosome identity, Rab5 recruits the PI(3)P kinase VPS34 and forms a positive feedback loop with PI(3)P (Zerial and McBride, 2001). Coincidence detection of PI(3)P levels and the Rab5GEF Rabex5 by the Rab7 GEF Mon1/CCZ1 was proposed to drive Rab conversion and endosome maturation (Poteryaev et al., 2010) and subsequently trigger the formation of PI(3,5)P2 (Compton et al., 2016; Dove et al., 2009). We analyzed cells expressing mApple-Rab5 and the PI(3)P marker GFP-2xFYVE, which reports on PI(3)P formation. As expected, Rab5 and GFP-FYVE appeared concomitantly on enlarged early endosomes (Figure 5; Figure 5—video 1). However, after Rab5 peaked, we observed a slight delay in the disappearance of GFP-FYVE (Figure 5B and C; Figure 5—figure supplement 1), suggesting that the onset of PI(3)P conversion to either PI or PI(3,5)P2 occurs with some delay. Nevertheless, our data are consistent with a tight temporal and spatial regulation of PI(3)P levels on endosomes during maturation.

Figure 5 with 2 supplements see all
PI(3)P is recruited to endosomes concomitantly with Rab5.

HeLa cells, stably expressing mApple-Rab5 and transiently transfected with the PI(3)P marker, GFP-FYVE, were treated for 20 min with nigericin, washed and imaged over 3 hr, as described in Figure 4A. (A) Time-lapse images of a representative endosome to show transient Rab5 recruitment accompanied by PI(3)P. A time-lapse video of the endosome at 1 min interval is available in Figure 5—video 1. (B) Corresponding graph of normalised mean fluorescence intensity of Rab5 and FYVE at the rim of the endosome in (A) over the time the endosome was detectable. (C) Averaged Rab5 and PI(3)P kinetics of 19 endosomes. Error bars represent standard deviation. Representative graph of three independent experiments. Numerical data for all analyzed endosomes is available in Figure 5—source data 1.

Figure 5—source data 1

Quantification of Rab5 and PI(3)P recruitment at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig5-data1-v1.xlsx

Snx1 recruitment is initiated with Rab5 recruitment and can persist during Rab7 stages

A major property of endosomes is their ability to undergo extensive sorting, to recycle components back to the cell surface and to the Golgi and to internalise membrane cargo destined for ILV-mediated degradation. Our electron microscopy data provides evidence that the nigericin-induced enlarged endosomes are capable of ILV formation and internalisation of the GalT marker (Figure 2B). Additionally, the presence of Snx1-GFP in transient punctate microdomains or tubular protrusions at the enlarged endosomes suggests active sorting from the endosome to the plasma membrane and the Golgi (Figure 6A). To determine whether the Snx1-mediated sorting is coordinated with Rab conversion, we analyzed cells co-expressing Snx1-GFP and mApple-Rab5 (Figure 6A), and recorded the presence of Snx1 at the enlarged endosomes as they acquired and removed Rab5. Snx1 assembly on endosomes occurred concomitantly with Rab5 recruitment (Figure 6A–C; Figure 6—video 1; Figure 6—figure supplement 1 A and B), pointing to a potential coordination. Snx1 assembly at the endosomes was highly dynamic, forming one or multiple domains at a time (Figure 6—figure supplement 1 C). We observed weak correlation of Snx1 and Rab5 localization in discrete domains on early endosomes (Figure 6D and E). Moreover, Snx1 levels either declined during Rab conversion or persisted for a while. Our data indicate that Snx1 recruitment on early endosomes occurs simultaneously with Rab5, but that Snx1 microdomains could either co-exist with or exist independently of Rab5 (Cezanne et al., 2020; Gullapalli et al., 2004; Mari et al., 2008; Simonetti et al., 2017; Spang, 2021). This suggests that although Rab5 may promote Snx1 recruitment, presumably through PI3P (Zhong et al., 2005), it is not essential for its maintenance or dynamics at endosomes.

Figure 6 with 2 supplements see all
Snx1 subdomain formation at the endosomes initiates with Rab5 recruitment and peaks during Rab conversion stages.

HeLa cells, stably expressing mApple-Rab5 and transiently transfected with Snx1-GFP, were treated for 20 min with nigericin, washed and imaged over 3 hr, as described in Figure 4A. (A) Time-lapse images of a representative endosome to show Snx1 subdomain formation relative to Rab5 recruitment. A time-lapse video of the endosome at 1 min interval is available in Figure 6—video 1. (B) Corresponding graph of normalised mean fluorescence intensity (MFI) of Rab5 and Snx1 at the rim of the endosome in (A) over the time the endosome was detectable. (C) Averaged Rab5 and Snx1 kinetics of 12 endosomes. Error bars represent standard deviation. Representative graph of three independent experiments. Numerical data for all analyzed endosomes is available in Figure 6—source data 1. (D) Images of Rab5 and Snx1 at an enlarged endosome and a corresponding line profile of normalised fluorescence intensity along the rim to show co-existence as well as independence of subdomains of the two markers. Scale bar = 2 μm. (E) Correlation plot of normalised fluorescence intensity of Rab5 and Snx1 as measured in (D) for 14 endosomes for a total of 118 time points, and a corresponding regression line. Pearson’s correlation r = 0.43. Pooled data from two independent experiments. Numerical data for all analyzed endosomes is available in Figure 6—source data 2.

Figure 6—source data 1

Quantification of Rab5 and Snx1 recruitment at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig6-data1-v1.xlsx
Figure 6—source data 2

Quantification of Rab5 and Snx1 subdomains at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig6-data2-v1.xlsx

To corroborate the apparent lack of strict coordination between Rab5 removal and Snx1 persistence at the endosomes, we co-expressed Snx1-GFP and mApple-Rab7 (Figure 7A, Figure 7—video 1). Consistent with Snx1 presence during the Rab5 phase, Snx1 recruitment peaked during early stages of Rab7 recruitment, when the endosome is expected to be Rab5-positive (Figure 7B–D). In about one third of all Rab7-positive endosomes analysed, Snx1 recruitment was transient and was no longer present after Rab7 peaked or levelled off to indicate completed Rab conversion (Figure 7B and E). In another third of analysed endosomes, Snx1 initially displayed the same kinetics, but was recruited back again to the late Rab7-positive endosome (Figure 7C and F), suggesting that Rab5 may be dispensable for Snx1 recruitment to late endosomes. In the remaining subset of endosomes, Snx1 peaked and persisted throughout endosome maturation (Figure 7D and G). Since the back-recruitment of Snx1 to the Rab7-positive endosomes occurred at asynchronous times after Rab conversion, the dip in the Snx1 signal is lost during averaging (compare Figure 7C with D and F with G) and highlights the utility of this assay for its ability to track individual endosomes to collect information that might otherwise be undetectable. Analysis of Rab7 and Snx1 domains at the endosome again revealed weak correlation of Rab7 and Snx1 domains (Figure 6—figure supplement 1D and E). Taken together, our data suggest that sorting into recycling pathways is most likely initiated very early on endosomes but can also persist on late endosomes, indicating a continuous process independent of Rab conversion.

Figure 7 with 1 supplement see all
Snx1 subdomain formation at the endosomes initiates with Rab5 recruitment, peaks during Rab conversion stages and continues in late endosomes.

HeLa cells, stably expressing mApple-Rab7 and transiently transfected with Snx1-GFP, were treated for 20 min with nigericin, washed and imaged over 3 hr, as described in Figure 4A. (A) Time-lapse images of a representative endosome to show Snx1 subdomain formation relative to Rab7 recruitment. A time-lapse video of the endosome at 1 min interval is available in Figure 7—video 1. (B) Corresponding graph of MFI of Rab7 and Snx1 at the rim of the endosome in (A) over the time the endosome was detectable, to show Snx1 peaking during Rab conversion. (C,D) Additional graphs of MFI of Rab7 and Snx1 at the rim of endosomes to show the second Snx1 peak (C) or continuing Snx1 presence (D). (E,F,G) Averaged Rab7 and Snx1 kinetics binned into the three patterns of Snx1 recruitment as observed in (B,C,D), representing 19, 21, and 20 endosomes for the single peak, double peak and continuing presence of Snx1, respectively. Error bars represent standard deviation. Three independent experiments were performed, and data pooled. Numerical data for all analyzed endosomes is available in Figure 7—source data 1.

Figure 7—source data 1

Quantification of Rab7 and Snx1 recruitment at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig7-data1-v1.xlsx

Interaction of early and late endosomes with Rab11 proceeds independently of Rab5 or Rab7

To further support our hypothesis that sorting can occur continuously from early to late endosomes, we examined the behaviour of a key component of the recycling pathway to the plasma membrane, Rab11. If our hypothesis were correct, we would expect Rab11 to show a similar behaviour as Snx1. Therefore, we investigated the dynamics of GFP-Rab11 in relation to Rab5 or Rab7-positive endosomes. Rab11 docks on the tubular part of maturing/sorting endosomes and promotes the recycling of cargo to the plasma membrane (Solinger et al., 2020; van Weering et al., 2012). Surprisingly, Rab11-positive vesicles contacted early endosomes even before strong Rab5 recruitment (Figure 8A–C; Figure 8—video 1; Figure 8—video 2). Rab11 vesicles also contacted Rab5-positive endosomes. This contact between Rab11 vesicles and enlarged endosomes was not incidental because Rab11 vesicles probed and sometimes circled around the enlarged endosomes for various times before, during, and after Rab5 recruitment (Figure 8A, Figure 8—videos 2 and 3), almost reminiscent to the kiss-and-run of Rab11 endosomes on sorting endosomes (Solinger et al., 2020). The Rab11 domains on Rab5 endosomes appeared to be independent of each other (Figure 8D; Figure 8—figure supplement 1A and B). Moreover, Rab11 interaction with endosomes appeared not only to be independent of Rab5 but also of Rab7, or Rab conversion as it continued throughout endosome maturation (Figure 8E–H; Figure 8—video 4; Figure 8—figure supplement 1C). Thus, our data indicate that, similar to sorting, Rab11 recruitment to endosomes appears to be largely decoupled from Rab conversion.

Figure 8 with 5 supplements see all
Rab11 interacts with the maturing endosome independently of Rab5 or Rab7.

HeLa cells, stably expressing mApple-Rab5 (A–D) or mApple-Rab7 (E–H) and transiently transfected with GFP-Rab11, were treated for 20 min with nigericin, washed and imaged over 3 h, as described in Figure 4A. (A,E) Time-lapse images of a representative endosome to show continuous Rab11 interaction with the maturing endosome relative to Rab5 (A) or Rab7 (E) recruitment. Time-lapse videos of the endosomes in (A,E) at 1 min interval are available in Figure 8—videos 1 and 4. Additional videos of endosomes at 2 s interval to show Rab11 circling around the enlarged Rab5 positive compartments are available in Figure 8—videos 2 and 3. (B,F) Corresponding graphs of normalised mean fluorescence intensity of Rab5 (B) or Rab7 (F) and Rab11 at the rim of the endosome in (A) or (E), respectively, over the time the endosome was detectable. (C,G) Averaged Rab5 (C) or Rab7 (G) and Snx1 kinetics of 16 and 15 endosomes, respectively. Error bars represent standard deviation. Representative graphs each of three independent experiments. Numerical data for all analyzed endosomes is available in Figure 8—source data 1 and Figure 8—source data 3. (D,H) Images of Rab5 (D) or Rab7 (H) and Rab11 at an enlarged endosome and corresponding line profiles of normalized fluorescence intensity along the rim to show co-existence as well as independence of subdomains of Rab11 and the two markers. Scale bar = 2 μm. Numerical data for analyzed endosomes is available in Figure 8—source data 2 and Figure 8—source data 4.

Figure 8—source data 1

Quantification of Rab5 and Rab11 recruitment at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig8-data1-v1.xlsx
Figure 8—source data 2

Quantification of Rab5 and Rab11 subdomains at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig8-data2-v1.xlsx
Figure 8—source data 3

Quantification of Rab7 and Rab11 recruitment at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig8-data3-v1.xlsx
Figure 8—source data 4

Quantification of Rab7 and Rab11 subdomains at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig8-data4-v1.xlsx

Cargo is selectively recycled from enlarged endosomes

The ability of the enlarged endosomes to recruit mediators of recycling, Snx1 and Rab11 vesicles, suggests that our assay can recapitulate recycling pathways. To further probe this possibility, we monitored the fate of three cargoes: TfR-GFP for recycling to the plasma membrane, cation-dependent mannose-6-phosphate receptor (GFP-CDMPR) for recycling to the TGN and GalT-GFP, which we have shown above to remain in the endosome to be transported to the lysosome. All three cargoes were observed on Rab5-positive endosomes (Figure 9; Figure 9—figure supplement 1). While the levels of the recycling cargoes TfR-GFP and GFP-CDMPR promptly decreased at the maturing enlarged endosomes, GalT-GFP levels remained almost constant (Figure 9; Figure 9—videos 13). We cannot exclude that some of the GalT-GFP is recycled to the TGN and that some GalT-GFP arrives from the TGN to the enlarged endosomes. Nevertheless, the GalT-GFP kinetics are very distinct to that of CDMPR, which is removed from the endosomes shortly before or during Rab5 recruitment (Figure 9E and H). Additionally, we also observed CDMPR recruitment to the enlarged endosomes, suggesting that both retrograde and anterograde pathways are functional in these endosomes (Figure 9—figure supplement 1). Of note, TfR kinetics were unique in revealing the transient TfR acquisition at the enlarged Rab5-positive endosomes, reflecting the observations that the majority of TfR arrives to the endosome from the plasma membrane (Figure 3—figure supplement 2). This is followed by removal, and presumed recycling back to the plasma membrane, of the TfR from the endosome at the time of Rab conversion (Figure 9D and G). The unique patterns of the three cargoes at the enlarged endosomes indicate that it might be possible to probe distinct cargo transport properties with our assay. Taken together, our data provide strong evidence that the enlarged endosomes are capable of receiving cargo from the plasma membrane and the TGN and can promptly remove it for recycling back to their respective origins.

Figure 9 with 4 supplements see all
Selective cargo recycling takes place in enlarged Rab5-positive endosomes.

HeLa cells, stably expressing mApple-Rab5 and transiently transfected with the cargos TfR-GFP (A,D,G), GFP-CDMPR (B,E,H) or GalT-GFP (C,F,I), were treated for 20 min with nigericin, washed and imaged over 3 hr, as described in Figure 4A. (A–C) Time-lapse images of representative endosomes to show cargo acquisition and removal relative to Rab5 recruitment. Time-lapse videos of the endosomes in (A,D,G) at 1 min interval are available in Figure 9—video 1, Figure 9—video 2, and Figure 9—video 3, respectively. (D–F) Corresponding graphs of MFI of Rab5 and specified cargo at the endosome in (A,B,C), respectively, over the time the endosome was detectable, to show prompt removal of TfR and CDMPR, and GalT remaining unchanged. (G–I) Averaged Rab5 and specified cargo acquisition and removal, representing 24, 24, and 17 endosomes, respectively. Error bars represent standard deviation. Three independent experiments were performed. Numerical data for all analyzed endosomes is available in Figure 9—source data 1, Figure 9—source data 2, and Figure 9—source data 3.

Figure 9—source data 1

Quantification of acquisition and removal of TfR to and from endosomes in relation to Rab5.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig9-data1-v1.xlsx
Figure 9—source data 2

Quantification of acquisition and removal of CDMPR to and from endosomes in relation to Rab5.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig9-data2-v1.xlsx
Figure 9—source data 3

Quantification of acquisition and removal of GalT to and from endosomes in relation to Rab5.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig9-data3-v1.xlsx

GalT-pHlemon is a reliable reporter for pH measurements along the endocytic pathway

Both, Rab conversion and acidification are essential for endosome maturation but how the two are coordinated is poorly understood. To follow endosomal acidification at individual endosome level, we have tested several available endosomal pH sensors, such as mApple-Lamp1-pHluorin and NHE6-pHluorin2 (Ma et al., 2017); however, we found that these sensors were predominantly retained in the ER following transient transfection in our system. We exchanged the pHluorin tag on Lamp1 and NHE6 with the recently developed pH-responsive ratiometric probe, pHlemon (Burgstaller et al., 2019), but this did not improve the export from the ER. Therefore, we replaced the GFP of the GalT-GFP construct with pHlemon. Since GalT was present at the Golgi-derived enlarged compartments, and later in Rab5-positive endosomes and ILVs (Figures 2B and 3B–C), we hypothesised that the sensor anchored to GalT will illuminate the entire endosome maturation pathway, from early endosomes to endolysosomes. The pHlemon probe consists of yellow and mTurquoise2 fluorescent proteins in tandem, with eYFP reducing and mTurquoise2 slightly increasing fluorescence upon acidification in a reversible manner (Burgstaller et al., 2019). Untreated cells expressing the GalT-pHlemon sensor displayed a characteristic Golgi-ribbon appearance in both YFP and CFP channels as well as punctate appearance of CFP signal alone, indicative of highly acidified lysosomes or endolysosomes (Figure 10A). To confirm the identity of the CFP puncta, we labelled GalT-pHlemon expressing cells with lysotracker. When we detected signal only in the CFP but not in the YFP channel, those structures were mostly positive for lysotracker (Figure 10B). Thus, a fraction of GalT-pHlemon might enter the endosomal degradation pathway even under normal growth conditions. Indeed, in mApple-Rab5-expressing cells, we occasionally observed GalT-pHemon in Rab5-positive endosomes, suggesting the transient GalT-pHlemon trafficking through early endosomes to lysotracker-positive endolysosomes and lysosomes (Figure 10C). We could reliably detect YFP/CFP ratios over the pH 4.0–7.5 range (Figure 10D, Figure 10—figure supplement 1A), allowing for accurate pH measurements of the entire endolysosomal pathway. Our sensor designated pH 6.2 for the Golgi-ribbon structures and pH 4.0–5.7 for the lysosomes and endolysosomes, as detected by the CFP puncta, in untreated cells (Figure 10E). Most importantly, our sensor located to the nigericin-induced enlarged endosomes and indicated a pH range between 5.5 and 6.6 at 50 min washout, reflective of the different stages of maturation (Figure 10E and F, Figure 10—video 1). Therefore, GalT-pHlemon is a useful tool to read-out pH in the endosomal system. The enlarged endosomes indeed undergo fusion with lysosomes, as visualized by the CFP puncta circling around the enlarged endosome and passing the entire CFP content to it (Figure 10—figure supplement 1B; Figure 10—video 2). The resulting endolysosomes shrink over time and increase in CFP signal intensity as they are anticipated to regenerate the lysosome. This makes the GalT-pHlemon sensor particularly useful for illuminating the entire endolysosomal pathway and monitoring its pH.

Figure 10 with 3 supplements see all
GalT-pHlemon sensor detects endosomal acidification.

HeLa cells were transiently transfected with the ratiometric pH sensor, GalT-pHlemon. (C,F) Cells were stably expressing mApple-Rab5. (B) Cells were incubated with Lysotracker Red (LTR) for 20 min prior to imaging. (A) Images of a representative cell to show Golgi-ribbon distribution of GalT-pHlemon in both YFP and CFP channels as well as cytosolic CFP-filled puncta in CFP channel only, representing highly acidified organelles. (B,C) Images to show CFP puncta mostly positive for LTR (B, arrows) and occasionally positive for Rab5 (C, arrows). (D) Graph to show robust response of GalT-pHlemon sensor to pH 4.5–7.0 range as displayed by YFP/CFP ratio measurements in cells incubated with calibration buffers of specified pH values. Numerical data for all analysed Golgi ROIs is available in Figure 10—source data 1. (E) YFP/CFP measurements of GalT-pHlemon in the Golgi ribbon, endo-/lysosomes (cytosolic CFP puncta), as well as in the enlarged endosomes post 20 min nigericin treatment and 100 min recovery. Numerical data for all analysed organelle ROIs is available in Figure 10—source data 2. (F) Cells were treated with nigericin, washed and imaged over 3 hr. Images show GalT-pHlemon sensor localising to the enlarged transiently Rab5-positive endosome and changing YFP and CFP intensity consistent with endosomal acidification. A time-lapse video of the endosome at 1 min interval is available in Figure 10—video 1.

Figure 10—source data 1

Quantification of GalT-pHlemon signal in cells in calibration buffers of known pH.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig10-data1-v1.xlsx
Figure 10—source data 2

Quantification of GalT-pHlemon signal in Golgi ribbon, endo-/lysosomal puncta, and enlarged endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig10-data2-v1.xlsx

Endosomal acidification is most pronounced during Rab conversion

Equipped with a sensor locating to endosomes and responding to endosomal pH changes, we investigated the kinetics of endosomal acidification relative to Rab5 and Rab7 recruitment, using cells transiently transfected with mApple-Rab5 and GalT-pHlemon, as well as cells stably expressing mApple-Rab7 and transiently transfected with GalT-pHlemon. The nigericin-induced enlarged endosomes showed a dramatic decrease in YFP signal, which always coincided with Rab5-positive stages of endosome maturation (Figure 11A–C, Figure 11—video 1) and with early phases of Rab7 recruitment (Figure 11D–F, Figure 11—video 2). Ratiometric quantifications of intraluminal YFP and CFP signals revealed relatively stable YFP/CFP ratio prior to Rab5 recruitment, followed by a sharp decrease during Rab5 recruitment and Rab conversion, and stabilisation of a new, lower YFP/CFP ratio in Rab7-positive endosomes (Figure 11B, C, E and F). Conversion of YFP/CFP ratios to pH values indicates an average pH of 6.6 in early endosomes prior to Rab5 recruitment and a final pH of 5.7 in Rab7 endosomes. Our data indicate that the biggest pH drop occurs concomitantly with the recruitment of Rab7, pointing to a regulation of acidification during endosome maturation.

Figure 11 with 2 supplements see all
GalT-pHlemon sensor detects endosomal acidification, which correlates with Rab conversion.

HeLa cells, transiently expressing mApple-Rab5 (A–C) or stably expressing mApple-Rab7 (D–F) and transiently transfected with GalT-pHlemon, were treated for 20 min with nigericin, washed and imaged over 3 hr, as described in Figure 4A. (A,D) Time-lapse images of a representative endosome to show association of Rab conversion with acidification, as detected by the decrease in the YFP signal and relatively constant CFP at the rim. Time-lapse videos of the endosomes at 85 s interval are available in Figure 11—videos 1 and 2. (B,E) Corresponding graphs of normalised MFI of Rab5 (B) or Rab7 (E) at the rim and lumenal YFP/CFP ratio of GalT-pHlemon signal of the endosomes in (A) or (D), respectively, during and around the time of Rab conversion. (C,F) Averaged Rab5 (C) or Rab7 (F) and GalT-pH kinetics of 19 and 18 endosomes, respectively. Error bars represent standard deviation. Pooled data from two independent experiments. Numerical data for all analysed endosomes is available in Figure 11—source data 1 and Figure 11—source data 2.

Figure 11—source data 1

Quantification of Rab5 recruitment and GalT-pHlemon signal at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig11-data1-v1.xlsx
Figure 11—source data 2

Quantification of Rab7 recruitment and GalT-pHlemon signal at endosomes.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig11-data2-v1.xlsx

Impaired Rab conversion is associated with slower endosomal acidification

If endosomal acidification is dependent on the progression of endosome maturation, then blocking endosome maturation by impairing Rab conversion should undermine acidification. To block Rab conversion, we knocked out the Ccz1, a subunit of the Rab7GEF, which has been shown to promote Rab conversion (Figure 12—figure supplement 1A; Nordmann et al., 2010; Poteryaev et al., 2010; van den Boomen et al., 2020). Ccz1 depletion abolished Rab7 recruitment to, and Rab5 removal from, the nigericin-induced enlarged endosomes (Figure 12A, Figure 12—videos 13). Ccz1-deficient Rab5-positive endosomes could engage in homotypic fusion and interact with Rab5-positive enlarged compartments but did not mature to classical endolysosomes (Figure 12—figure supplement 1B; Figure 1C; Figure 12A). These perturbations could be efficiently rescued by expression of wild-type Ccz1 in Ccz1 knock-out cell lines (Figure 12A; Figure 12—videos 13). To ensure that in rescue experiments we selected for analysis only the cells expressing Ccz1, and not untransfected cells, we appended a far-red fluorophore mNeptune2 via the T2A peptide linker to Ccz1, resulting in expression of the two separate proteins in the transfected cells (Figure 12—figure supplement 2A). The mNeptune2 was tagged with NLS, targeting it to the nucleus, to minimise interference with the mApple signal at the endosomes (Figure 12—figure supplement 2B). Hence, we have generated Ccz1 knock-out cell lines that showed impaired Rab conversion and could be efficiently rescued with the Ccz1 rescue construct.

Figure 12 with 5 supplements see all
Ccz1 KO disrupts Rab conversion and delays endosomal acidification.

HeLa cell lines with wild-type (WT) Ccz1 and knocked-out Ccz1 (KO) were transiently transfected with mApple-Rab5 and either GFP-Rab7 (A) or GalT-pHlemon (B–D). Ccz1 expression plasmid was co-transfected for 72 hr for rescue experiments. Nigericin was added to cells for 20 min and washed away, and cells were imaged by time-lapse microscopy, as described in Figure 4A. (A) Time-lapse images of representative endosomes to show absence of Rab7 recruitment and lack of Rab5 displacement in KO cells, compared to the expected Rab conversion in WT and rescue cells. Scale bar = 1 μm. Time-lapse videos of the endosomes at 1 min interval are available in Figure 12—videos 13 for WT, KO and rescue, respectively. (B) Graphs of normalised mean fluorescence intensity of Rab5 and YFP/CFP ratio of the endosomal GalT-pHlemon signal in representative endosomes during and around the time of Rab conversion / Rab5 peak, in WT, KO and rescue cells. (C,D) Averaged kinetics of Rab5 recruitment (C) and corresponding GalT-pHlemon YFP/CFP ratios (D) for WT, KO and rescue cells, in 54, 54, and 56 endosomes, respectively. Error bars represent SEM. Pooled data from three independent experiments using different Ccz1 clones. Numerical data for all analysed endosomes is available in Figure 12—source data 1.

Figure 12—source data 1

Quantification of Rab5 recruitment and GalT-pHlemon signal at endosomes in Ccz1 WT, KO and rescue cells.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig12-data1-v1.xlsx

To test our hypothesis that impaired Rab conversion compromises endosomal acidification, we expressed mApple-Rab5 and GalT-pHlemon in Ccz1 KO and control cells, and monitored the YFP/CFP ratio kinetics of the pH sensor on Rab5-positive endosomes (Figure 12—figure supplement 1B). While in the control and Ccz1 rescue cells, acidification occurred with similar kinetics as observed above (Figure 11B and C), in Ccz1 KO cells the acidification was strongly delayed (Figure 12B–D). Nevertheless, acidification occurred eventually after a long delay in Ccz1 KO cells. In line with this conclusion, Ccz1 KO cells have grossly enlarged CFP-filled puncta and compartments, reflective of their enlarged lysosomes and acidified hybrid compartments as also observed with Lysotracker staining of Rab5-positive compartments (Figure 13A; Figure 13—figure supplement 1). The CFP-positive compartments in untreated cells showed no differences in pH between Ccz1-replete and Ccz1-deficient cells, ranging from pH 5.7 to pH 4.0, indicative of endolysosomes and lysosomes, respectively (Figure 13A and B). Furthermore, following disruption of pH by nigericin treatment and washout, wild-type cells restored their lysosomal pH, while Ccz1 KO cells displayed a wide range of pH in pHlemon-filled compartments, ranging from pH 6.4 to pH 4.0 (Figure 13C and D). Taken together, our data suggest that Rab conversion is driving efficient endosomal acidification.

Figure 13 with 1 supplement see all
Lysosomes of Ccz1 knockout cells can acidify to the same extent as wild-type cells, with some delay.

HeLa cell lines with wild-type (WT) Ccz1 and knocked-out Ccz1 (KO) were transiently transfected with GalT-pHlemon. Ccz1 expression plasmid was co-transfected for 72 hr for rescue experiments. WT, KO and rescue cells were left untreated. (A,B) or treated with 20 min nigericin followed by 50 min recovery (C,D). (A) Images of cells showing Golgi and highly acidified organelles as visualised with GalT-pHlemon. Acidified organelles appear as puncta in WT and rescue cells and as larger round CFP-filled compartments in KO cells. Scale bar = 10 μm. (C) Images of cells pre-treated with nigericin have dispersed trans-Golgi and re-acidified organelles as in (A). Scale bar = 10 μm. (B,D) Corresponding measurements of YFP/CFP ratio of the GalT-pHlemon sensor in the acidified organelles. Numerical data for all analysed endosomes is available in Figure 13—source data 1 and Figure 13—source data 2.

Figure 13—source data 1

Quantification of GalT-pHlemon signal in endo-/lysosomal puncta in Ccz1 WT, KO and rescue cells.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig13-data1-v1.xlsx
Figure 13—source data 2

Quantification of GalT-pHlemon signal in endo-/lysosomal puncta in Ccz1 WT, KO and rescue cells post nigericin treatment.

https://cdn.elifesciences.org/articles/70982/elife-70982-fig13-data2-v1.xlsx

Discussion

Despite the pivotal importance of endosomal transport for cell survival and communication, tissue organization and development in all eukaryotic cells, endosomes largely escape precise temporal and spatial observations because of their small size and mobility. Several approaches using enlarged endosomes with low motility have successfully been used in the past; however, these were restricted to a particular cell type and organism or a limited subset of endosomes (Poteryaev et al., 2010; Skjeldal et al., 2021; van Weering et al., 2012). We report here an easy, reliable, and inexpensive method to enlarge endosomes in a variety of different cell types and follow them over their entire lifetime – from initial formation and subsequent maturation to endolysosome formation and lysosome maturation. Importantly, our acute nigericin treatment takes advantage of the natural, physiological cellular stress response and does not cause any autophagy induction, lysosomal damage, cell death, or growth retardation. Moreover, this assay does not require any special equipment; a standard fluorescence microscope equipped with commonly used filters and a camera are sufficient. We validated our assay by comparing our measured parameters of endosome maturation with published data. Most importantly, Rab5-to-Rab7 conversion progressed with previously published kinetics (Poteryaev et al., 2010; Rink et al., 2005; Skjeldal et al., 2021; van der Schaar et al., 2008). In addition, PI(3)P was produced on Rab5 endosomes at about the same rate, in which Rab5 levels increased, consistent with the positive feedback loop between Rab5 and the PI(3)P kinase Vps34 (Zerial and McBride, 2001). While the PI(3)P levels coincided with the Rab5 peak, we observed a short delay in decrease of the GFP-FYVE. This finding is consistent with a previous report, which described C. elegans Rab7GEF recruitment to PI(3)P-rich endosomes (Poteryaev et al., 2010) to drive Rab conversion. Additionally, Vps34 removal and subsequent PI(3)P turnover is dependent on low luminal pH as characteristic of late endosomes (Naufer et al., 2018; Podinovskaia et al., 2013). It is conceivable that the slight delay in reducing PI(3)P levels might provide directionality during Rab conversion. Thus, our assay faithfully recapitulates endosome maturation as described in other model systems.

Similar to treatment with other ionophores, nigericin treatment results in swelling of the outer leaflets of the trans Golgi network (Tartakoff and Vassalli, 1977). We assume that at least a fraction of the swollen TGN will be shed into the endosomal system as a part of the stress response and to attain homeostasis. We surmise that the shed TGN membranes can fuse with Rab5 endocytic structures and then acquire early endosomal identity. Indeed, we frequently observed that the enlarged compartments interact with and fuse with Rab5 endosomes. We cannot exclude other principal or contributing mechanisms such as recruitment of cytoplasmic Rab5 directly onto the membrane, which would be equally competent in promoting the transition to early endosomes.

We used the established assay to determine whether there is a strict coordination between recycling to the plasma membrane and Rab conversion. There is evidence in the literature that recycling to the plasma membrane only happens from Rab5 compartments or from Rab5 and Rab7 hybrid compartments (van Weering et al., 2012). Our data suggest that recycling from the endosome can happen throughout the lifetime of an endosome, as reflected by the presence of Snx1 and Rab11 vesicles at the maturing endosome. We observed that Snx1 was recruited simultaneously with Rab5 probably mediated through its PX domain (Peter et al., 2004), consistent with the reported coordination between the two proteins (van Weering et al., 2012). The PX domain recognises PI(3)P, which is recruited concomitantly with Rab5 to maturing endosomes. However, even though in about one third of the endosomes, there seemed to be temporal coordination between Snx1 and Rab5 removal from the endosome, sorting persisted in the remaining Rab7-positive endosomes. In addition, we did not observe any spatial coordination on the endosomal membrane as the SNX1 and Rab5 or Rab7 domains appeared to move independently. Moreover, Rab11 contacted maturing endosomes irrespective of whether they were Rab5 or Rab7 positive. The type of Rab11 endosome interaction with the maturing endosomes appeared reminiscent of the FERARI-dependent kiss-and-run that we recently reported (Solinger et al., 2020). Therefore, our data suggest that the onset of recycling is coordinated with the arrival of Rab5, at least for Snx1, but the process itself is independent of Rab conversion, as previously suggested (Rojas et al., 2008). Consistently, we have shown previously that when Rab conversion is blocked, Rab11 localization and Rab11-dependent recycling are not affected in C. elegans oocytes (Poteryaev et al., 2010; Poteryaev et al., 2007).

Although acidification of endosomes is required for endosome maturation (Podinovskaia and Spang, 2018), how this process is regulated remains poorly understood. Since Rab conversion is a major driver of endosome maturation, we asked whether Rab conversion regulates endosomal acidification. Unfortunately, all pH sensor probes we tried turned out not to be useful because they were mostly stuck in the ER. While in neurons, in which the probes have mainly been applied, this might be less of an issue, in our system this has prevented any meaningful analysis. We, hence, developed a new probe based on the ratiometric pHlemon and GalT, which localises to Golgi but enters also the endolysosomal pathway. With this new probe, we showed that Rab conversion is required for efficient acidification. Over extended times, acidification of endosomes still occurred in absence of Rab conversion and we speculate that this acidification can help drive fusion with lysosomes. Moreover, this effect may explain why a sand-1 mutant in C. elegans, knockdown of Mon1a and b, or a Ccz1 KO in mammalian cells is not lethal (Poteryaev et al., 2010; Poteryaev et al., 2007). How Rab conversion promotes a drop in pH, we can only speculate at this point. It is possible that the activity of the V-ATPase is upregulated during Rab conversion, driven by Rab7 effectors such as RILP (Bucci et al., 2000; De Luca and Bucci, 2014; De Luca et al., 2014), and is accompanied by the arrest in interactions with less acidified endocytic vesicles. It is also conceivable that there is a simple regulatory loop such as phosphorylation and dephosphorylation of V-ATPase subunits, however, the potential kinase or phosphatase regulators remain to be identified. Additionally, proton channels such as Nhe6 have been reported to finetune endosomal pH, and their role in endosome acidification kinetics remains to be explored. Finally, multiple factors are known to interact with the V-ATPase; their role in controlling the acidification during Rab conversion remains to be established.

In conclusion, we have developed and validated a straightforward live-cell imaging assay and used it to define kinetics and regulation of mediators of endosomal maturation. Using this assay, we established that Rab11 recycling endosomes interact with the endosomes irrespective of their stage of maturation, and that, in contrast, Rab conversion and endosome acidification are strongly coordinated. This assay will be invaluable for addressing outstanding questions relating to the regulation and potential coordination of processes during endosome maturation. Given its applicability to different cell types, it may also be useful in establishing cell-type-specific differences in the regulation of endosomal transport. The assay has been designed to make it accessible and applicable in most cell biology laboratories and proved to be a powerful tool to further our understanding of endosome biology.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
cell line (Homo sapiens)HeLa CCL2ATCCRRID:CVCL_0030
cell line (Homo sapiens)HeLa KyotoATCCRRID:CVCL_1922
cell line (Homo sapiens)Neuro-2aATCCRRID:CVCL_0470
cell line (Homo sapiens)HEK293ATCCRRID:CVCL_6910
cell line (monkey)Cos-1ATCCRRID:CVCL_023
antibodyanti-GFP (Rabbit polyclonal)AbcamRRID:AB_305564IEM(1:100)
antibodyanti-LC3b (Rabbit polyclonal)Cell Signalling TechnologyRRID:AB_2137707IF(1:400)
antibodyanti-GalT (Rabbit polyclonal)SigmaRRID:AB_1078254IF(1:50)
antibodyanti-mCherry (Goat polyclonal)St John’s laboratorySTJ140001IEM(1:100)
antibodyanti-myc (Mouse monoclonal, 9E10)SigmaRRID:AB_2533008WB(1:2000)
antibodyanti-rabbit coupled to 10 nm Gold (Goat, IgG)BB InternationalRRID:AB_2715527IEM (1:100)
antibodyanti-mouse coupled to 5 nm Gold (Goat, IgG)BB InternationalRRID:AB_1769168IEM (1:100)
antibodyanti-rabbit coupled to 5 nm Gold (Donkey, IgG)Jackson Immuno ResearchRRID:AB_2340610IEM (1:100)
antibodyanti-goat (Mouse, IgG)Jackson Immuno ResearchRRID:AB_2339054IEM (1:100)
recombinant DNA reagentmApple-Rab5a (Plasmid)RRID:Addgene_54944
recombinant DNA reagentmApple-Rab7a (Plasmid)RRID:Addgene_54945
recombinant DNA reagentGalT-mCherry (Plasmid)RRID:Addgene_55052
recombinant DNA reagentmNeptune2-C1 (Plasmid)RRID:Addgene_54836
recombinant DNA reagentmApple-Lamp1-pHluorin (Plasmid)RRID:Addgene_54918
recombinant DNA reagentGFP-Rab11a (Plasmid)RRID:Addgene_12674
recombinant DNA reagentEGFP-2xFYVE (Plasmid)RRID:Addgene_140047
recombinant DNA reagentLamp1-GFP (Plasmid)RRID:Addgene_34831
recombinant DNA reagentpSpCas9(BB)–2A-GFP (pX458) (Plasmid)RRID:Addgene_48138
recombinant DNA reagentpSpCas9(BB)–2A-puro (pX459) (Plasmid)RRID:Addgene_48139
recombinant DNA reagentSnx1-turboGFP (Plasmid)OrigeneOrigene # RG201844
recombinant DNA reagentCcz1-myc (Plasmid)OrigeneOrigene # RC222195
recombinant DNA reagentmTagBFP2-Rab5 (Plasmid)RRID:Addgene_55322
recombinant DNA reagentmCherry-tagged anti-GFP (VHH) (Plasmid)RRID:Addgene_109421

Cell culture

Request a detailed protocol

HeLa CCL2, HeLa Kyoto-α, HEK293 and Neuro2A cells were grown at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, Sigma-Aldrich) supplemented with 10% fetal calf serum (FCS, Biowest), 2 mM L-Glutamine, 1 mM Sodium Pyruvate, and 1 x Penicillin and Streptomycin (all from Sigma). Cos-1 cells were grown in low-glucose DMEM supplemented as above. All cell lines were a kind gift of Dr Martin Spiess, with their identities authenticated by STR analysis by Microsynth AG (Balgach, Switzerland), except Cos-1, the identity of which was validated by morphology analysis. All cell lines were confirmed to be mycoplasma-negative by PCR.

For transient cell transfections, cells were plated into 6-well plates to reach 70 % confluency the following day and transfected with 0.5 µg plasmid DNA complexed with Helix-IN transfection reagent (OZ Biosciences). Cells were used in imaging assays at 48 hr post transfection. For the Ccz1 rescue experiments, given the larger size of the plasmid, 2 µg plasmid DNA was used, and cells were transfected for 72 hr.

For cell growth assays, cells were plated into 12-well plates at 10,000 cells per well. The following day, a sample was taken for counting (0 hr time point), and the remaining cells were incubated in complete medium with or without nigericin for 20 min, washed, incubated for specified time periods and collected for counting. Both conditions were reaching 90 % confluency by 72 hr. Three wells were measured per condition. Doubling time was calculating using the formula

t1-t2*log2logc2c1

where c1 and c2 are cell counts for two consecutive time points t1 and t2.

DNA constructs mApple-Rab5a, mApple-Rab7a, GalT-mCherry, mNeptune2-C1 and mApple-Lamp1-pHluorin plasmids were a gift from Michael Davidson (Addgene # 55944, 54945, 55052, 54836, 54918). GFP-Rab11a was a gift from Richard Pagano (Addgene # 12674) (Choudhury et al., 2002). EGFP-2xFYVE was a gift from Harald Stenmark (Addgene # 140047) (Gillooly et al., 2000). Lamp1-GFP was a gift from Esteban Dell’Angelica (Addgene #34831) (Falcón-Pérez et al., 2005). pSpCas9(BB)–2A-GFP (pX458) and pSpCas9(BB)–2A-puro (pX459) were a gift from Feng Zhang (Addgene #48,138 and #48139) (Ran et al., 2013). Snx1-turboGFP and Ccz1-myc were from Origene (#RG201844 and RC222195). mTagBFP2-Rab5 was a kind gift of Michael Davidson (Addgene #55322) (Subach et al., 2011). mTagBFP2-Rab7 was generated by replacing Rab5 in mTagBFP2-Rab5a with Rab7 from mApple-Rab7 (Addgene #54945) using BamHI and XhoI restriction sites. The mCherry-tagged anti-GFP (VHH) nanobody plasmid has been previously described (Addgene #109421) (Buser et al., 2018). GFP-Rab7a was generated by substituting mApple in the Rab7a plasmid with GFP from GFP-Rab11a using NheI and XhoI restriction sites. pQCXIP-TfR-EGFP and pQCXIP-EGFP-CDMPR have previously been described (Buser et al., 2018).

For stable GalT-GFP cell line generation, a sequence encoding GalT-EGFP (B4GALT1 ORF minus the catalytic moiety) was generously provided by Jennifer Lippincott-Schwartz (Howard Hughes Medical Institute, Ashburn, VA). GalT-EGFP was amplified using primers with restriction site overhangs for NotI and PacI, and subcloned into the Retro-X Q vector pQCXIP (Takara Bio). The GalT-EGFP plasmid for transient transfections was generated from GalT-mCherry plasmid and the EGFP insert from LAMP1-EGFP, using NEBuilder HiFi Assembly cloning kit (New England Biolabs, NEB) with the primers designed by the NEBuilder Assembly Tool (Supplementary file 1) following manufacturer’s instructions.

For Ccz1 rescue experiments, the myc tag was removed from the Ccz1-myc plasmid using NEB site-directed mutagenesis (SDM) kit (NEB) following manufacturer’s instructions and primers selected using NEBaseChanger tool (Supplementary file 1). Nuclear localisation sequence (NLS) was cloned at the N terminal of mNeptune2 using NEB SDM kit with the mNeptune2-C1 plasmid following manufacturer’s instructions and primers listed in Supplementary file 1. To generate NLS-mNeptune2-T2A-ccz1 and NLS-mNeptune2-T2A-ccz1-myc, primers were designed with NEBuilder Assembly Tool (NEB) as listed in Supplementary file 1 to generate PCR products from NLS-mNeptune2, pSpCas9(BB)–2A-GFP and ccz1 plasmids. Purified PCR products for NLS-mNeptune2 and T2A peptide were ligated together using forward primer for mNeptune2 and reverse primer for T2A in a PCR reaction with 5 cycles at 50 °C and 25 cycles at 63.7 °C (i.e. the annealing temperature of the two primers). Purified NLS-mNeptune2-T2A and ccz1 backbone PCR products were assembled together using NEBuilder HiFi Assembly cloning kit (NEB).

For the pH sensor constructs, we used pHlemon, which consists of mTurquoise2 and EYFP in tandem with a 21 bp linker in between (Burgstaller et al., 2019). Separate constructs for mTurquoise2+ half-the-linker and half-the-linker+ EYFP were synthesized by Twist Bioscience (Supplementary file 1). The two sequences were cloned separately into pCR Blunt II-Topo vectors (Invitrogen). For the GalT-pHlemon plasmid, primers were designed with NEBuilder Assembly Tool (Supplementary file 1) to generate PCR products for the mTurquoise2 and EYFP as well as the GalT backbone without the tag from GalT-mCherry plasmid. Purified PCR products were assembled together using NEBuilder HiFi Assembly cloning kit.

Fluorescent cell line generation

Request a detailed protocol

To generate GalT-EGFP stable cell lines, Phoenix Ampho packaging cells (from the Nolan lab, Stanford University) were grown in complete medium supplemented with 1 mM sodium pyruvate and transfected with pQCXIP-GalT-EGFP using FuGENE HD (Promega) to produce viral particles. The viral supernatant was harvested after 48–72 hr, passed through a 0.45 µm filter, supplemented with 15 µg/ml polybrene, and added to target HeLa-α cells. The next day, complete medium with 1.5 µg/ml puromycin was added. Following selection, cells were subjected to cell sorting on a FACSAria III (BD Biosciences) to obtain a cell pool with homogenous expression levels. HeLa-α-GalT-EGFP were maintained in complete medium supplemented with 1.5 µg/ml puromycin at 37 °C in 5 % CO2.

Stable expression of mApple-Rab5 in HeLa cells was achieved by transfection of HeLa CCL2 cells with the mApple-Rab5a plasmid and three rounds of bulk-sorting by FACS at 15, 33 and 61 days post transfection. The cell line stably expressing mApple-Rab7a were generated as previously described (Wu et al., 2020). Briefly, HeLa CCL2 cells were transfected with the mApple-Rab7a plasmid, FACS-sorted for mApple-positive cells at 20 days and into 96-well plates 15 days later for clonal expansion. To generate the cell line with stable expression of both, mApple-Rab5 and GFP-Rab7, stably-expressing mApple-Rab5 cells were transfected with GFP-Rab7 and FACS-sorted at 7 days post transfection for a bulk population of mApple-positive and GFP-positive cells and, a further 11 days later, into 96-well plates for clonal expansion. The doubly-positive colonies were bulk-sorted once again 50 days later to remove cells that were no longer expressing either marker.

CRISPR-Cas9 knock-out of Ccz1

Request a detailed protocol

Ccz1 has a homolog, Ccz1b, which differs by four nucleotides and is identical in amino acid sequence. Guide RNAs (gRNA) were designed to target both genes simultaneously. The CRISPR strategy was described previously (Ran et al., 2013; Solinger et al., 2020). Briefly, based on gRNAs targeting the first and last exons of Ccz1, two double-stranded oligonucleotide sequences were cloned one each into the two plasmids, Px458 (GFP) and Px459 (Puro) and transfected into HeLa CCL2 cells. Plasmids without the inserts were used as controls. After 24 hr of transfection, cells underwent 24 hr selection with puromycin, followed by single-cell FACS sorting of GFP-positive cells for clonal expansion. Clones showing >90% reduction in Ccz1 expression were used for evaluation of endosome maturation. Three different ccz1-deficient (KO) clones and three different control clones (WT) were used in experiments to obtain the three biological replicates.

Live cell imaging

Request a detailed protocol

Cells were plated into 8-well imaging chambers (Miltenyi) the day before imaging to reach 50–70% confluency on the day of imaging. Just prior to imaging, cell medium was replaced with pre-warmed imaging buffer (5 mM Dextrose, 1 mM CaCl2, 2.7 mM KCl, 0.5 mM MgCl2 in PBS supplemented with 10 % FCS and Penicillin and Streptomycin). Where specified, cells were treated with 10 µM Nigericin (AdipoGen, 10 mM stock in Ethanol) or 5 µM Monensin (Sigma, 50 mM stock in Ethanol) or 10 mM ammonium chloride prior or during imaging. Where specified, 100 nM Lysotracker Green (Molecular Probes, 1 mM stock in DMSO) or 10 nM Lysotracker Red in imaging buffer was added 20 min prior to imaging. For live cell imaging of HEK293, Neuro-2A and Cos-1 cells, imaging chambers were pre-coated with poly-L-lysine to enhance attachment of these three cell types.

Cells were imaged at 37°C using an inverted Axio Observer microscope (Zeiss) with a Plan Apochromat N 63×/1.40 oil DIC M27 objective and a Photometrics Prime 95B camera. Filters with standard specifications for CFP, GFP, YFP, dsRed and APC were used to image mTurquoise2, GFP, YFP, mApple and mNeptune2, respectively. To minimise overexpression artifacts, cells were selected for imaging that expressed minimal amount of each fluorescent marker that was sufficient to produce good quality signal. For time-lapse experiments, to monitor endosome maturation kinetics, cells were treated with nigericin for 20 min, washed four times in imaging buffer and imaging chamber mounted onto an automated microscope stage. Several fields of view (FOV) were selected for imaging per condition. The microscope was programmed to image all FOVs sequentially and repeat the imaging at 1–2 min intervals. The obtained images corresponded to the recovery time between 40 min and 190 min post nigericin treatment. For experiments comparing Ccz1 WT to KO clones, with and without rescue, all four conditions were imaged in a single time-lapse experiment. All experiments were performed three times on different days.

For co-localisation studies of GalT-GFP or GalT-pHlemon with mApple-Rab5 or Lysotracker Red, imaging buffer was replaced with cold PBS to slow down endosome movements, and cells were imaged immediately. Z-stack images were deconvolved using Huygens deconvolution online software tool.

For endolysosomal labelling, 0.5 mg/mL Dextran-AF488 (10,000 MW, Molecular Probes, 10 mg/mL stock in water) was pulsed into cells for 4 hr and chased for 1.5 hr into lysosomes. For endosomal dextran labelling, 2.5 mg/mL Dextran-AF488 or 1 mg/mL Dextran-AF647 was pulsed into cells for 20 min post nigericin treatment (20 min nigericin, followed by 60–75 min washout) and subsequently washed away for imaging within the following 10 min and at 1 min intervals thereafter.

To visualize endocytosis and trafficking of surface transferrin receptor, TfR-EGFP-expressing cells were treated with mCherry-tagged nanobodies against GFP to tag the plasma membrane TfR-EGFP. Nanobodies were produced as previously reported (Buser et al., 2018). Briefly, the nanobody plasmid was transformed into Rosetta DE3 cells and the nanobody expressed at 16 °C overnight with 1 mM IPTG induction. Lysates were purified on a His GraviTrap column, desalted on PD-10 columns and concentrated to 5 mg/mL. HeLa cells were transiently co-transfected with mTagBFP2-Rab5 and TfR-EGFP, to mark early endosomes and early and recycling endosomes, respectively. Cells were transferred to 8-well imaging chambers the day before imaging. Enlarged endosomes were induced following 20 min treatment with 10 μM nigericin and 110 min washout in imaging buffer. mCherry-anti-GFP nanobody was added at 5 μg/mL final concentration to label TfR-EGFP at the plasma membrane. Cells were imaged shortly before and immediately after nanobody addition. Time-lapse images were taken every 1 min for 25 min to capture the uptake of nanobody-labeled surface-derived TfR into the cell, using BFP, GFP and TxRed (excitation 562/20, emission 624/20) filter cubes.

Single endosome analysis and quantification

Request a detailed protocol

Using the time-lapse images, endosomes were selected for analysis with the following criteria. For mApple-Rab5 expressing cells, endosomes initially devoid of Rab5 and later acquiring and subsequently losing Rab5 were identified. For mApple-Rab7 expressing cells, endosomes initially devoid of Rab7 and subsequently acquiring Rab7 and stabilising its expression were identified. This ensured that the entire Rab conversion event was captured in the kinetic.

To quantify the recruitment of markers to the endosome, an oval selection tool in Fiji was used to draw a circular region-of-interest (ROI) closely following the rim of the endosome in the channel for the most visible marker or by predicting the location of the rim if cases where the enlarged endosome was negative for both markers and appeared as a dark circle (Figure 4A). For less circular endosomes and endolysosomes, the ROI was adjusted using the elliptical or a free-hand selection tool. ROIs were adjusted for every time point where the rim of the endosome could be unambiguously identified. Mean fluorescence intensity (MFI) of a two-pixel wide rim at the ROI was recorded in all channels. A larger two-pixel wide rim three pixels away from the endosome was generated with a macro based on the original ROI, and MFI was calculated as a measure of background for each time point (Figure 4A). We found that adjusting the MFI at the rim of endosome for this background MFI minimised noise and produced data reflective of visual assessment of marker presence at the endosome. For intraluminal pHlemon measurements, the circular ROI at the rim of the endosome was reduced by one pixel and the total MFI of the reduced ROI was calculated in both YFP and CFP channels. A ROI in a field where no cells were present was measured to obtain background values. This approach was found to produce pH measurements as accurate as the modified rim measurements, in which select pixels were removed to exclude interference from the highly acidified vesicles interacting with the enlarged endosome. For the subdomain measurements, two-pixel thick segmented lines with spline fit were drawn around the full perimeter of the endosome starting at the top, and histogram measurements were obtained of fluorescence intensity along the length of the line.

Endosomal recruitment marker measurements were background-subtracted and adjusted for the minimum and maximum values of the entire measured kinetic, to represent a range from 0 to 1. The pHlemon measurements were kept as background-adjusted YFP/CFP ratios. For averaging, kinetics were aligned for Rab5 peak or for Rab7 at 50 % of its final maximum value, representing the point of Rab conversion (Figure 4C–D). At least 10–20 endosomes from at least 3–10 cells were used in analysis and each experiment was repeated at least three times. Means, standard deviations, SEM, Pearson’s correlation and linear regression were calculated in GraphPad Prism.

pH calibrations

Request a detailed protocol

GalT-pHlemon images provided us with pH-responsive YFP/CFP ratio measurements. To convert YFP/CFP ratios to pH values, GalT-pHlemon expressing cells were incubated in buffers of known pH containing 5 µM Nigericin, 50 µM Monensin and 100 nM Concanamycin A (Sigma, 100 µM stock in DMSO) to disrupt intracellular proton gradients. The buffers consisted of 138 mM NaCl, 5 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 10 mM Glucose, 10 mM HEPES (for pH 5.5–9.0) or 10 mM MES (for pH 4.0–5.0), and pH was adjusted with NaOH or HCl. Images were taken at 15 min after adding the buffers to the cells. Golgi ribbon structures were selected with a segmented line tool in Fiji, and MFI was calculated in both channels and subtracted for background measured in a field devoid of cells. The equation for the line of best fit was generated in GraphPad Prism based on log(dose) response curve with variable slope, where log(dose) is pH and response is YFP/CFP values (sigmoidal four-parameter dose-response curve; Figure 10—figure supplement 1A).

Electron microscopy

Request a detailed protocol

HeLa CCL2 cells were grown in 10 cm dishes, treated for 20 min with nigericin and left to recover. At specified times, cells were fixed in DMEM containing 2.5 % glutaraldehyde and 3 % formaldehyde for 2 hr at room temperature. Cells were washed with PBS and cell membranes stained with 2 % osmium tetroxide and 1 % potassium hexacyanoferrate in H2O for 1 hr at 4 °C. Following a wash with water, cells were further stained for proteins and nucleic acids with 2 % uranyl acetate in H2O overnight at 4 °C. Samples were subsequently dehydrated in acetone/H2O in stepwise increases in acetone concentration of 20%, 50%, 70%, 90 % and 3 × 100 %. The samples were infiltrated with 50 % epon embedding medium in acetone for 1 hr at room temperature, and subsequently with 100 % epon resin overnight. Next day, fresh epon resin was added and samples were polymerised for 24 hr at 60 °C. Sections of 60–70 nm were collected on carbon-coated Formvar-Ni-grids and were viewed with a Phillips CM100 electron microscope.

To prepare cells for immunolabeling, HeLa cells stably expressing GalT-GFP were prepared as previously described (Beuret et al., 2017). Sections were stained sequentially with rabbit anti-GFP (1:100; Abcam 6556) and goat anti-rabbit coupled to 10 nm gold particles (BB International). For dual labelling, HeLa cells stably expressing mApple-Rab5 were transiently transfected with GalT-EGFP, prepared for immunolabelling as above, and stained sequentially for GalT-GFP and mApple-Rab5. The sections were blocked with PBST (PBS + 0.05 % Tween20) supplemented with 2 % BSA for 20 min, incubated overnight at 4 °C with anti-GFP (1:100, Abcam), washed five times for 5 min with PBS and incubated for 2 hr at room temperature (RT) with donkey anti-rabbit coupled with 12 nm Gold (Jackson Immuno Research). The wash step was repeated and the single-stained sections were subsequently fixed for 2 min with 1 % glutaraldehyde in PBS, washed with PBS and blocked for 10 min with the blocking solution. Following a 2 hr incubation at RT with anti-mCherry (1:100, St John’s Laboratory STJ140001), the sections were washed with PBS, blocked with PBS supplemented with 2 % fish gelatin (Sigma) for 10 min and incubated with mouse anti-goat (1:100, Jackson Immuno Research) for 90 min. The wash and the 2 % fish gelatin block steps were repeated and the sections were incubated with goat anti-mouse coupled with 5 nm Gold (1:100, BBInternational) for 2 hr. The double-stained sections were washed five times for 5 min with PBS and three times for 2 min with H2O, and subsequently stained for 10 min with 2 % uracyl acetate and 2 min Reynold’s solution.

Immunostaining

Request a detailed protocol

HeLa cells were plated onto coverslips 24 hr prior to 20 min nigericin treatment and recovery. At specified times post nigericin treatment, cells were fixed in 2 % paraformaldehyde, permeabilised with 0.1 % Triton X-100, blocked in PBS containing 2 % BSA and 5 % goat serum, and stained with anti-GalT (1:50, Sigma HPA010807) followed by AF594-conjugated goat anti-rabbit and DAPI. HeLa cells stably expressing mApple-Rab5 were plated onto coverslips 24 hr prior to treatment. Cells were left untreated, treated for 16 hr with bafilomycin (100 nM,Enzo Life Sciences, 100 μM stock in DMSO), or treated with nigericin for 20 min followed by a 60 min washout. Following treatment, cells were fixed for 10 min with methanol at –20 °C, blocked in PBS containing 2 % BSA and 5 % goat serum, and stained with anti-LC3b (1:400, Cell Signaling Technology #3868) followed by AF488-conjugated goat anti-rabbit. Coverslips were mounted onto glass slides with Fluoromount G (Southern Biotech) and sealed with nail polish. Following z-stack image acquisition, images were deconvolved using Huygens deconvolution online software tool.

qRT-PCR

Request a detailed protocol

RNA was extracted and purified from cells using RNeasy kit or using the Trizol-Chloroform extraction and isopropanol precipitation, following manufacturer’s instructions. cDNA was reverse-transcribed using GoScript reverse transcriptase primed with a mix of Oligo(dT)s and random hexamers (Promega). qRT-PCR was performed using GoTaq qPCR master mix (Promega) and primers specific for spanning the intron junction between exons 3 and 4 of ccz1 (ACATTTAGCCCATCAAAACCTGC, CCGAACAACCATGACCATCC). Ccz1 expression was normalized for β-actin expression.

Western blotting and Antibodies

Request a detailed protocol

HeLa cells transiently transfected with NLS-mNeptune2-5-T2A-ccz1-myc were lysed in lysis buffer (1% NP-40, 150 mM NaCl, 50 mM Tris pH8.0, protease inhibitors) and denatured in Laemmli buffer at 65 °C for 5 min. Samples were resolved by SDS-PAGE and transferred onto nitrocellulose membrane. Samples were blocked in milk, stained with anti-myc (1:2,000, Sigma 9E10) and HRP-conjugated anti-mouse, and revealed with WesternBright ECL HRP substrate (Advansta).

Data availability

All data generated during this study are included in the manuscript and supporting files.

References

    1. Morré DJ
    2. Boss WF
    3. Grimes H
    4. Mollenhauer HH
    (1983)
    Kinetics of Golgi apparatus membrane flux following monensin treatment of embryogenic carrot cells
    European Journal of Cell Biology 30:25–32.

Decision letter

  1. Christopher G Burd
    Reviewing Editor; Yale School of Medicine, United States
  2. Vivek Malhotra
    Senior Editor; The Barcelona Institute of Science and Technology, Spain
  3. Christopher G Burd
    Reviewer; Yale School of Medicine, United States
  4. Benjamin S Glick
    Reviewer; The University of Chicago, United States

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "A novel live cell imaging assay reveals regulation of endosome maturation" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Christopher G Burd as Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Vivek Malhotra as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Benjamin S Glick (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

The authors describe a technical innovation that swells endosomes and the terminal compartments of the Golgi of cultured human cells, allowing them to observe the maturation of the dramatically enlarged compartments by fluorescence microscopy. Ionophore treatment is a significant perturbation, but a variety of findings validate that the enlarged endosomes undergo Rab5-to-Rab7 conversion over a time course that is roughly similar to the rate of Rab endosome conversion in unperturbed cells. The results further establish that endosome recruitment of a recycling/retrograde cargo sorting factor, Snx1, is not correlated with the Rab5-to-Rab7 early-to-late conversion process. Endosomes decorated with another regulator of recycling, Rab11, are reported to make transient contact with Rab-negative and Rab5/7-positive endosomes, leading the authors conclude that cargo recycling/retrograde sorting pathways are unaffected by nigericin-induced swelling. In contrast, acidification of the endosome is reported to be linked to Rab5-to-Rab7 conversion. It is further reported that the terminal compartments of the Golgi apparatus, identified by the presence of GalT, are swelled by nigericin and they are observed to fuse with a Rab5-negative endosome which subsequently acquires Rab5, initiating to Rab5-to-Rab7 conversion. Overall, this is a high-quality study that presents a useful tool for observing endosome dynamics in live cells. The approach was used to elucidate several unappreciated aspects of endosome maturation and Golgi-endosome interactions that are intriguing though largely preliminary in significance.

1. A critical concern throughout the manuscript regards extrapolations of endosome protein recruitment as a direct indication of cargo transport to or out of an endosome. No cargo transport assays are included in the study, and the reviewers concluded that important points, described below, are not firmly substantiated.

A) It is asserted that the Rab conversion process under investigation indicates physiological trafficking of endocytosed cargo to the lysosome via endosome maturation. However, cargo trafficking and/or turnover was not examined in the study. One dextran uptake experiment suggested that some dextran-containing compartments become decorated with tagged Rab5, but the prevalence of this could not be ascertained from the presentation and transport to the lysosome was not tested. This could be accomplished by examining endocytosis and subsequent trafficking using a fluorescent cargo (e.g., dextran, LDL).

B) It is asserted that recruitment of tagged Snx1 or Rab11 to the endosome indicates recycling of endocytosed cargo to the plasma membrane. However, trafficking of a recycling cargo protein was not examined. Testing if recycling cargo is exported from the endosome via Snx1-coated tubules or under Rab11 regulation is necessary to support the conclusions regarding export of cargo from the endosome. This is especially important because many of the reporter proteins are tagged with a fluorescent protein and expressed transiently at high level in cells that also express the native proteins. It is also important because presumed changes in the tension of the plasma membrane of rapidly swelled endosomes may affect the formation of carriers of recycling pathways, such as documented for phagosomes during their maturation (Freeman et al., 2020).

It is noted that accurate descriptions of findings are included in the text (e.g., lines 71-72 summarize the findings as "recruitment" rather than cargo trafficking/recycling to the PM), however, equating endosome recruitment of sorting factors with cargo trafficking is the norm throughout the manuscript, including in the Abstract.

2. The conclusion that Rab11+ compartments directly contact Rab5-negative and Rab5/7-positive endosomes is not convincingly supported by the data. The Rab11 fluorescence signals are very complex, with so many puncta present throughout the crowded cytoplasm that specific (i.e., not incidental) contacts between Rab11-decorated endosomes and early endosomes were not (perhaps cannot) distinguished by the approach used. The observations may also be influenced by the expression level of GFP-Rab11. The reviewers considered these conclusions to be preliminary in significance.

3. The conclusion that entire late Golgi compartments are directed into the endosome maturation pathway is poorly supported by the data. This aspect of the study is provocative, yet the reviewers consider this aspect of the study to be preliminary in significance. This finding was not even addressed in the Discussion.

(A) The critical observations are determinations of the localization of GalT-fluorescent fusion proteins in nigericin-treated cells. Residents of trans/TGN Golgi compartments cycle between the Golgi and the endosome. Golgi residents that fail to be sorted into the retrograde pathway continue to the lysosome and are degraded (via the MVB pathway). While the authors' observations might indicate the convergence of the secretory and endosome maturation pathways, other possibilities were not addressed. It may be that the retrograde pathway fails to some degree when late Golgi compartments are swollen (see also point 1), resulting in 'leakage' of GalT fusion proteins to the lysosome. This is especially concerning because most of the experiments employed GalT fusion proteins where the increased expression may saturate retrograde pathways.

(B) The time required acquisition of Rab5 on GalT-positive compartments is long – on the order of 1-2 hours. It is unclear if the observations of swollen late Golgi compartments reveal a physiologically meaningful transition.

4. The conclusion that endosome acidification is linked to Rab5-to-Rab7 conversion is not convincingly supported by the data. The graphical presentations of the data shown in figures 10 C, E, F indicate that acidification was initiated on Rab5-positive endosomes and that the rates of acidification did not change once Rab7 was acquired. On the other hand, the data presented in figures 10B and 11B are suggestive of a temporal correlation between acidification and the acquisition of Rab7. This discrepancy needs to be resolved.

Reviewer #1 (Recommendations for the authors):

I have a few concerns regarding some other points made using the approach.

1. The analyses of rab11, Snx1, and endosome acidification are interesting, though the accuracy of such analyses is not rigorously validated at this stage due to the small size of native endosomes. Hence, it is unclear if the conclusions apply to native endosomes. Related, a recent paper from Sergio Grinstein and colleagues (Freeman et al., 2020) showed that ion transport-driven changes in membrane tension during phagosome maturation (membrane "crenation") are necessary to trigger Snx1, Snx2 and Snx5 recruitment to the phagosome. This may not apply to native endosomes, but the physical principal (ie, 'crenation') is applicable to any membrane compartment, so there is good reason to be concerned about confounding effects due to the swelling of these compartments.

2. I am not convinced that it has been shown that swelled trans/TGN compartments provides the membrane of rab5 and rab7 positive endosomes. Figure 2 shows that a compartment, probably the TGN, is swelled by nigericin and it is argued (lines ~155-162) that the presence of overexpressed (and tagged) GalT-GFP in ILVs of MVBs probably indicates that rab5 and rab7 positive endosomes are derived from the swollen trans Golgi/TGN. Proteins considered to be residents of the trans/TGN compartments cycle between the endosome and the Golgi and Golgi residents that fail to be sorted into the retrograde pathway continue to the lysosome and are degraded (via the MVB pathway). It may be that the retrograde pathway fails to some degree when all of these compartments are swollen (point 1). In my opinion, the paper would be improved by removing this material.

Reviewer #2 (Recommendations for the authors):

(1) The most serious problem is with the data and conclusions related to Rab11 interaction with early endosomes in Figure 8. Unlike the Snx1 data, where association with the early endosomes is fairly convincing, there are simply too many Rab11 puncta in the cell to tell if they are meaningfully interacting with the early endosomes, or if the data simply reflects random collisions of small recycling endosomes with the enlarged early endosomes. To determine if these collisions are functionally significant the authors would need to show data on the transfer of recycling cargo from Rab5 endosomes to Rab11 endosomes during such interactions. Without this I would recommend removing this data from the paper. Along these lines, while the Snx1 data was more convincing, it was overinterpreted as "recycling" or "sorting" even though no cargo was followed. The authors should more carefully word the text, especially the abstract and discussion, to avoid such gross overinterpretation of the Snx1 data.

(2) To really establish this endosome maturation model the authors should establish if the enlarged endosomes contain endocytosed cargo, as opposed to Golgi-derived cargo, and determine how long it takes to acquire such cargo. This could be accomplished using Tf, EGF, or perhaps dextran at early timepoints after nigericin washout.

(3) Figure 7 – It was not convincing that data in panels F and G are different from each other.

(4) Figure 11 – I find the interpretation of panel D confusing. How can we interpret this as connected to Rab conversion when even the labeled compartments at the earliest time point in the czz1 knockout have abnormally high pH, and during the time-course even the last timepoint for czz1 KO is higher than that of the earliest timepoint for WT?

(5) Figure 12 – The criteria used to determine which GalT structures are Golgi or lysosomes seems flawed. Morphology alone is not sufficient to identify the compartments with high accuracy, especially after perturbation. Also, to what extent does GalT-CFP label lysosomes without nigericin treatment?

Reviewer #3 (Recommendations for the authors):

– What is the status of recycling endosomes? These structures must have some relationship to maturing endosomes but the literature is confusing. Rab11 is the traditional marker for recycling endosomes, and the authors describe Rab11 vesicles that "contact" maturing endosomes. How is this pathway envisioned to occur? Does internalized material ever accumulate in Rab11-positive recycling endosomes? It would be useful to bring the earlier work on the FERARI complex into a model that incorporates the current data.

– Do late endosomes fuse completely with lysosomes, or do they typically undergo kiss-and-run fusion as has been described in both mammalian and yeast cells? Some of the images here seem to argue against complete fusion. What are the implications? Specifically, if late endosomes are constantly being generated by maturation but are not consumed by fusion with lysosomes, why doesn't the cell fill up with late endosomes?

– The most striking result is that TGN-derived compartments go on to become Rab5-labeled endosomes, yet this topic is not even mentioned in the Discussion. Do the authors infer that there is a close relationship between the TGN and early endosomes, as has been observed in plant and yeast cells? Or is it more likely that existing Rab5-positive early endosomes become more prominent due to fusion with enlarged TGN-derived compartments?

In Figure 1D, homotypic fusion is readily apparent but I don't see the Rab conversion described in the legend.

The videos are hard to match to the figures. For example, the "Figure 1C supplement 1" video seems to have nothing to do with Figure 1C, and I couldn't find a description of this video.

Figure 5: PI(3)P is presumably generated, not recruited.

https://doi.org/10.7554/eLife.70982.sa1

Author response

Essential revisions:

The authors describe a technical innovation that swells endosomes and the terminal compartments of the Golgi of cultured human cells, allowing them to observe the maturation of the dramatically enlarged compartments by fluorescence microscopy. Ionophore treatment is a significant perturbation, but a variety of findings validate that the enlarged endosomes undergo Rab5-to-Rab7 conversion over a time course that is roughly similar to the rate of Rab endosome conversion in unperturbed cells. The results further establish that endosome recruitment of a recycling/retrograde cargo sorting factor, Snx1, is not correlated with the Rab5-to-Rab7 early-to-late conversion process. Endosomes decorated with another regulator of recycling, Rab11, are reported to make transient contact with Rab-negative and Rab5/7-positive endosomes, leading the authors conclude that cargo recycling/retrograde sorting pathways are unaffected by nigericin-induced swelling. In contrast, acidification of the endosome is reported to be linked to Rab5-to-Rab7 conversion. It is further reported that the terminal compartments of the Golgi apparatus, identified by the presence of GalT, are swelled by nigericin and they are observed to fuse with a Rab5-negative endosome which subsequently acquires Rab5, initiating to Rab5-to-Rab7 conversion. Overall, this is a high-quality study that presents a useful tool for observing endosome dynamics in live cells. The approach was used to elucidate several unappreciated aspects of endosome maturation and Golgi-endosome interactions that are intriguing though largely preliminary in significance.

1. A critical concern throughout the manuscript regards extrapolations of endosome protein recruitment as a direct indication of cargo transport to or out of an endosome. No cargo transport assays are included in the study, and the reviewers concluded that important points, described below, are not firmly substantiated.

A) It is asserted that the Rab conversion process under investigation indicates physiological trafficking of endocytosed cargo to the lysosome via endosome maturation. However, cargo trafficking and/or turnover was not examined in the study. One dextran uptake experiment suggested that some dextran-containing compartments become decorated with tagged Rab5, but the prevalence of this could not be ascertained from the presentation and transport to the lysosome was not tested. This could be accomplished by examining endocytosis and subsequent trafficking using a fluorescent cargo (e.g., dextran, LDL).

To further examine cargo trafficking, we performed additional dextran-Alexa647 uptake assays in mApple-Rab5 and GFP-Rab7 expressing cells. The experiments revealed that dextran-Alexa647 is present in Rab5-positive endocytic vesicles that go on to fuse with Rab5-negative enlarged structures, which subsequently become Rab5 positive. Those Rab5 enlarged endosomes undergo Rab conversion, turn Rab7 positive and form endolysosomes, which mature to lysosomes, still containing the dextran. These data are now included, replacing the shorter dextran-Alexa488/mApple-Rab5 panel (Figure 3, figure supplement 1B).

As for the prevalence of endocytic Dextran-containing compartments, we now include a higher-quality image set, showing Rab5-positive enlarged endosomes, both with and without detectable Dextran-AF488, as well as Dextran-containing Rab5-negative (presumably Rab-converted) endosomes. We cannot really measure prevalence because Dextran endocytosis is too fast to capture its early and highly-synchronized fusion events with the asynchronously-generated and highly-transient Rab5-positive enlarged compartments. (Figure 3, figure supplement 1A).

As a second piece of evidence, we transfected cells with BFP-Rab5 and transferrin receptor tagged to GFP (TfR-GFP). We then added a GFP-nanobody, which was tagged with mCherry, resulting in illumination of surface TfR and its subsequent trafficking. Already within a few minutes after addition of the nanobody, we were able to detect the nanobody together with Rab5 in close proximity of the enlarged endosomes; the presence of the nanobody on the limiting membrane became more obvious after about 15-20 min of the addition. Thus, plasma membrane derived cargo appears to reach the enlarged endosome in a reasonable time frame. Proper quantification over many endosomes as we did for the other experiments proved to be difficult because BFP-Rab5 seems to be less well tolerated by cells compared to the GFP or mApple versions, and only a few cells with a weakly detectable Rab5 expression could be imaged. Further difficulties stem from the short window of opportunity to trace the synchronous uptake of nanobody-tagged surface TfR and its trafficking to the highly-asynchronous and transient Rab5-positive enlarged endosomes. Moreover, the signal for the mCherry-tagged GFP-nanobody was rather weak, limiting the number of endosomes with detectable TfR. Nevertheless, we observed multiple events and two examples are now shown in the manuscript in supplementary information (Figure 3, figure supplement 2). Additionally, we show quantification for TfR-GFP acquisition to and removal from the enlarged endosomes relative to Rab5 recruitment (Figure 9A,D,G). These data show concomitant arrival of Rab5 and TfR to the endosome and prompt removal of TfR as the endosome undergoes Rab conversion.

Taken together, we provide more evidence that cargo from the plasma membrane reaches the enlarged early endosomal structures and that we can recapitulate the lifetime of an endosome from early-to-late to endolysosome to lysosome.

B) It is asserted that recruitment of tagged Snx1 or Rab11 to the endosome indicates recycling of endocytosed cargo to the plasma membrane. However, trafficking of a recycling cargo protein was not examined. Testing if recycling cargo is exported from the endosome via Snx1-coated tubules or under Rab11 regulation is necessary to support the conclusions regarding export of cargo from the endosome. This is especially important because many of the reporter proteins are tagged with a fluorescent protein and expressed transiently at high level in cells that also express the native proteins. It is also important because presumed changes in the tension of the plasma membrane of rapidly swelled endosomes may affect the formation of carriers of recycling pathways, such as documented for phagosomes during their maturation (Freeman et al., 2020).

We agree with the reviewers that we did not show any recycling cargo in the original manuscript. We now used TfR-GFP and mApple-Rab5 to identify the enlarged endosomes, from which TfR would recycle to the plasma membrane. We now include data in the manuscript showing that TfR-GFP is present in enlarged Rab5 positive endosomes and that the TfR-GFP signal gets incorporated into vesicles and goes down over time in the enlarged endosomes, consistent with recycling (Figure 9 A,D,G). Likewise, we used CDMPR-GFP, which recycles to the Golgi and we observed again a reduction of the CDMPR signal in Rab5 positive enlarged endosomes over time and the formation of CDMPR positive vesicles (Figure 9 B,E,H). Importantly, we did not observe the same reduction of the signal (or its packaging into vesicles) for GalT-GFP, which go down the route to the lysosome (Figure 9 C,F,I). Therefore, the reduction in the GFP signal cannot be explained by bleaching and thus we assume that we observe recycling of TfR and CDMPR to the plasma membrane and the Golgi, respectively. Regardless of the recycling pathway or the destination of the recycled cargo, these data indicate that sorting and recycling appear to be functional in the enlarged endosomes. We have not investigated whether TfR or CDMPR is exported away from the endosome via Snx1-coated tubules or Rab11-mediated transport carriers, as this would require triple transfection with BFP-Rab5, which cells do not tolerate well.

To provide evidence for the role of Snx1 or Rab11 in mediating recycling in the enlarged endosomes, we used CRISPR-Cas9 SNX1 and RAB11a KO cell lines. We did not see a strong effect on recycling of TfR-GFP, which might be due to redundancy issues. SNX4 can compensate for SNX1 and presumably Rab11b for Rab11a, and over time the cell lines potentially adapt to the loss of SNX1 and RAB11a, respectively. To have a more acute readout, we knocked down Rab11a and b with siRNAs. Unfortunately, we obtained mixed results as we observed a delay in TfR recycling upon Rab11a+b knockdown in some experiments but not in others. Of course, this might be related to the knockdown efficiency in individual experiments and in the experiments where we observed an effect the efficiency might have been higher. Even though we sometimes observed an effect, we do not feel comfortable putting these data into the manuscript. Since the direct correlation between Rab11/Snx1 and cargo recycling has not been shown, we therefore adjusted the manuscript text accordingly.

As with regards to potential changes in membrane tension and its effect on endosome recycling function, while we cannot exclude that these changes may occur because we did not measure them in our system, we now include data in the manuscript showing that uptake from the plasma membrane works well and that cargo is recycled away from the endosome (TfR and CDMPR data). The crenation, as described in Freeman et al., paper, is driven by changes in osmolarity, which the cells could promptly (within minutes) readjust after experimental intervention. As we allow recovery after the acute nigericin treatment, we predict there to be no big perturbations in osmolarity over the subsequent hours during which we can image cells and observe traffic events. Our assumptions here are supported by the stable endosome size during endosome maturation and the new evidence we provide on the cargo recycling.

It is noted that accurate descriptions of findings are included in the text (e.g., lines 71-72 summarize the findings as "recruitment" rather than cargo trafficking/recycling to the PM), however, equating endosome recruitment of sorting factors with cargo trafficking is the norm throughout the manuscript, including in the Abstract.

We assume that the reviewers mean lines 78-79. We changed the text to reflect that we determine the interaction of Rab11 vesicles with enlarged endosomes as recruitment. Even though we do not mention recycling to the plasma membrane explicitly in the abstract, we changed the wording in the abstract and are more careful throughout the manuscript not to mention any specific cargo recycling, unless warranted.

2. The conclusion that Rab11+ compartments directly contact Rab5-negative and Rab5/7-positive endosomes is not convincingly supported by the data. The Rab11 fluorescence signals are very complex, with so many puncta present throughout the crowded cytoplasm that specific (i.e., not incidental) contacts between Rab11-decorated endosomes and early endosomes were not (perhaps cannot) distinguished by the approach used. The observations may also be influenced by the expression level of GFP-Rab11. The reviewers considered these conclusions to be preliminary in significance.

To address the reviewers’ concern, we took videos in which images were taken in much shorter, 2-sec intervals. These videos show that Rab11 contact directly enlarged Rab5 negative and positive compartments and stay on there for various times, indicating that this interaction is not incidental. These data are now included in the manuscript. (video Figure 8A supplement 2 and 3).

3. The conclusion that entire late Golgi compartments are directed into the endosome maturation pathway is poorly supported by the data. This aspect of the study is provocative, yet the reviewers consider this aspect of the study to be preliminary in significance. This finding was not even addressed in the Discussion.

We apologize for the confusion. We agree with the reviewers that we cannot conclude that the entire late Golgi compartments are directed into the endosome maturation pathway as we can only have a qualitative but not quantitative measure. We changed the text to make this clearer and we now discuss the swelling of the TGN in the discussion. We are actually not the first ones to notice this. Already Tartakoff and Vassalli (J. Exp Med. 1977) reported the TGN swelling/dispersal after ionophore treatment, including nigericin. There were a few studies in the 1980’s and 1990’s (e.g. Vladutiu, BioSci. Report 1984, Merion and Sly, JCB 1983, which we cite in the manuscript), which report the swelling of the outer Golgi leaflet with additional cisternae getting affected with longer treatment, suggesting that our acute treatment would partially preserve the Golgi compartment. Indeed, this partial disruption of the Golgi agrees well with our data that recycling of CDMPR remains functional. Since the Golgi dispersal was well documented in the literature, we did not include this into the discussion. However, upon the reviewers’ suggestion, we now discuss our finding that Golgi compartments can fuel the endocytic pathway.

(A) The critical observations are determinations of the localization of GalT-fluorescent fusion proteins in nigericin-treated cells. Residents of trans/TGN Golgi compartments cycle between the Golgi and the endosome. Golgi residents that fail to be sorted into the retrograde pathway continue to the lysosome and are degraded (via the MVB pathway). While the authors' observations might indicate the convergence of the secretory and endosome maturation pathways, other possibilities were not addressed. It may be that the retrograde pathway fails to some degree when late Golgi compartments are swollen (see also point 1), resulting in 'leakage' of GalT fusion proteins to the lysosome. This is especially concerning because most of the experiments employed GalT fusion proteins where the increased expression may saturate retrograde pathways.

Indeed, we did not address the functionality of the retrograde transport to the TGN after nigericin washout in the original manuscript. The new experiments with the CDMPR described under point 1 would argue that the retrograde transport is functional at least at the level of cargo removal from the enlarged endosome. We can show that CDMPR positive structures bud off from the Rab5 positive enlarged endosomes and that the levels of CDMPR at the enlarged endosome drop over time. Moreover, these endosomes seem to be capable of also accepting CDMPR-containing vesicles. We take this as a strong indication that the Golgi-endosome shuttle is intact after the nigericin washout (Figure 9; Fig9, figure supplement 1).

If overexpression of proteins involved in the Golgi-endosome shuttle resulted in a saturated retrograde pathway, we would see a compromised removal of the overexpressed CDMPR-GFP from the endosome. However, this is not the case. In contrast to GalT constructs, all of the observed endosomes promptly removed CDMPR during or shortly before Rab5 recruitment. Thus, retention at the endosome and failure to recycle back to the Golgi is limited to the GalT fusion proteins.

Although endogenous GalT is rarely observed outside of the Golgi ribbon (Figure 3C), the constructs appear in punctate structures in addition to the Golgi ribbon, which occasionally colocalized with Rab5 and lysosomes (Figure 10B and C, Figure 3A). This suggests that GalT construct trafficking to the endosome is a property of the construct and not nigericin-mediated perturbation of retrograde trafficking. The combination of intact retrograde trafficking and the retention of GalT constructs in endosomes make GalT-pHlemon an excellent tool to study intralumenal pH of endosomes with minimum disruption to endosome function.

(B) The time required acquisition of Rab5 on GalT-positive compartments is long – on the order of 1-2 hours. It is unclear if the observations of swollen late Golgi compartments reveal a physiologically meaningful transition.

We can detect this also at earlier timepoints. We wanted the cells to reestablish the proper pH, and setting up the microscope (we record multiple cells simultaneously) takes some time. To be consistent, we usually start imaging 40 min after washout. We now include a time-lapse image series, in which Rab5 is recruited to an enlarged endosome, which then converts into a Rab7-positive endosome, within 20 min after nigericin washout (Figure 1, figure supplement 1A). Thus, these events happen already very early after nigericin washout and continue for hours. There is no synchronous wave after washout, rather we observe asynchronous events. Additionally, as the Golgi swell up, the early swollen compartments are easy to miss as they are frequently in different focal planes to smaller endosomes. As the cell adjusts to its new physiology, the enlarged compartments rearrange to sit in a single focal plane and are more practical to image en masse. We clarify this in the text.

4. The conclusion that endosome acidification is linked to Rab5-to-Rab7 conversion is not convincingly supported by the data. The graphical presentations of the data shown in figures 10 C, E, F indicate that acidification was initiated on Rab5-positive endosomes and that the rates of acidification did not change once Rab7 was acquired. On the other hand, the data presented in figures 10B and 11B are suggestive of a temporal correlation between acidification and the acquisition of Rab7. This discrepancy needs to be resolved.

We think that the issue might be related to the way the experiments were performed. In Figure 10 (now Figure 11), we used HeLa cells stably expressing either mApple-Rab5 or mApple-Rab7, while in Figure 11 (now Figure 12) Rab5 and Rab7 were transiently expressed in the ccz1 KO cell lines. To be consistent we repeated the experiments shown in Figure 10 (now Figure 11) with transient expression. We generated a new data set, which shows stabilization of pH upon Rab conversion, and now all data are consistent.

Reviewer #1 (Recommendations for the authors):

I have a few concerns regarding some other points made using the approach.

1. The analyses of rab11, Snx1, and endosome acidification are interesting, though the accuracy of such analyses is not rigorously validated at this stage due to the small size of native endosomes. Hence, it is unclear if the conclusions apply to native endosomes. Related, a recent paper from Sergio Grinstein and colleagues (Freeman et al., 2020) showed that ion transport-driven changes in membrane tension during phagosome maturation (membrane "crenation") are necessary to trigger Snx1, Snx2 and Snx5 recruitment to the phagosome. This may not apply to native endosomes, but the physical principal (ie, 'crenation') is applicable to any membrane compartment, so there is good reason to be concerned about confounding effects due to the swelling of these compartments.

Indeed, the Freeman et al., 2020 paper (as well as the Mercier, Lerios et al., 2020 NCB paper) explore the idea of osmotic/ionic pressure (and the associated membrane tension) changes playing a role in sorting and recycling, which could be of relevance to our system where the swollen Golgi likely arise from osmotic/ionic imbalances during nigericin treatment. The swelling in our system is most likely driven by interference to the proton gradient, since the protonophore FCCP inhibited monensin-induced swelling (Boss, Morre and Mollenhauer 1984 Eur J Cell Biol), and we observed a similar effect with V-ATPase inhibitor bafilomycin abolishing nigericin-induced swelling (data not shown). However, unlike the above-mentioned studies, where treatments were continuous, the nigericin treatment in our set up is highly transient and we allow our cells to recover and re-establish pH, thereby minimizing the possibility of any ionic imbalances during the observation phase. The macropinosomes in the Freeman et al., study respond to external ionic/osmotic stimuli within minutes of their addition, strongly suggesting that any ionic imbalances within our system would also be resolved within minutes of nigericin removal. Consistent with this notion, the enlarged endosomes do not rapidly shrink with the recruitment of Snx1, and rather remain stable in size until the endolysosomal stages. The mechanism driving the enlarged endosome shrinkage during endolysosomal stages will be subject of future studies. Although we do not show the functionality of Snx1 directly, we now include the CDMPR and TfR data to show that cargo recycling is functional at the enlarged endosomes. (Figure 9).

2. I am not convinced that it has been shown that swelled trans/TGN compartments provides the membrane of rab5 and rab7 positive endosomes. Figure 2 shows that a compartment, probably the TGN, is swelled by nigericin and it is argued (lines ~155-162) that the presence of overexpressed (and tagged) GalT-GFP in ILVs of MVBs probably indicates that rab5 and rab7 positive endosomes are derived from the swollen trans Golgi/TGN. Proteins considered to be residents of the trans/TGN compartments cycle between the endosome and the Golgi and Golgi residents that fail to be sorted into the retrograde pathway continue to the lysosome and are degraded (via the MVB pathway). It may be that the retrograde pathway fails to some degree when all of these compartments are swollen (point 1). In my opinion, the paper would be improved by removing this material.

Indeed, Figure 2 alone is not sufficient to argue that the enlarged endosomes derive from TGN-derived compartments. This is why we back up our hypothesis with Figure 3A, which shows a vesiculated GalT-GFP positive compartment acquire Rab5. To rule out any potential failure of retrograde transport, we now include CDMPR data, which shows prompt removal of CDMPR from the enlarged early endosome (Figure 9B,E,H). We do consider it important to leave these data in the manuscript because they provide also the basis for the use of GalT-pH lemon with which explore endosomal acidification.

Reviewer #2 (Recommendations for the authors):

(1) The most serious problem is with the data and conclusions related to Rab11 interaction with early endosomes in Figure 8. Unlike the Snx1 data, where association with the early endosomes is fairly convincing, there are simply too many Rab11 puncta in the cell to tell if they are meaningfully interacting with the early endosomes, or if the data simply reflects random collisions of small recycling endosomes with the enlarged early endosomes. To determine if these collisions are functionally significant the authors would need to show data on the transfer of recycling cargo from Rab5 endosomes to Rab11 endosomes during such interactions. Without this I would recommend removing this data from the paper. Along these lines, while the Snx1 data was more convincing, it was overinterpreted as "recycling" or "sorting" even though no cargo was followed. The authors should more carefully word the text, especially the abstract and discussion, to avoid such gross overinterpretation of the Snx1 data.

We provide now more evidence for the interaction of Rab11 vesicles with the enlarged endosomes. We made videos with shorter intervals between the individual frames (Video Figure 8A supplement 2 and 3). These data clearly show that this is not an accidental bumping into an endosome but that Rab11 vesicles can circle around endosomes and stay for several minutes.

In addition, we imaged TfR-GFP together with mApple-Rab5. These data show that TfR-GFP positive vesicles bud off from mApple-Rab5 positive endosomes and that the GFP fluorescence intensity goes down over time in enlarged endosomes (Figure 9A). These data are consistent with recycling of TfR to the plasma membrane.

Moreover, CDMPR-GFP, which cycles between the TGN and endosomes was found to be present on Rab5 negative enlarged structure, which then turned Rab5 positive, and subsequently lost the CDMPR signal (Figure 9B). Importantly those endosomes could regain CDMPR, which we interpret as acquisition from the TGN (Figure 9, figure supplement 1). These data may indicate that the TGN-endosome shuttle is intact after nigericin washout.

That the TfR and CDMPR are really transported out of the enlarged endosome is also supported by our finding that GalT-GFP stayed in the enlarged endosome and the signal intensity did not significantly drop (Figure 9C).

The dependency of cargo trafficking on Rab11 and Snx1 could not be shown most likely because of the redundancy of these recycling pathways, with alternative pathways compensating for any deficiency in Rab11a or Snx1 (possibly including Rab11b, Rab25, Snx4, Snx8). Therefore, we followed the advice of the Reviewer 2 to be more careful with the wording in order to avoid overinterpretation of Snx1 and Rab11 data.

Regardless of the recycling pathway or the destination of the recycled cargo, these data show that sorting and recycling appear to be functional in the enlarged endosomes. We have not investigated whether TfR or CDMPR is exported away from the endosome via Snx1-coated tubules or Rab11-mediated transport carriers, as this would require triple transfection with BFP-Rab5, which cells do not tolerate well.

(2) To really establish this endosome maturation model the authors should establish if the enlarged endosomes contain endocytosed cargo, as opposed to Golgi-derived cargo, and determine how long it takes to acquire such cargo. This could be accomplished using Tf, EGF, or perhaps dextran at early timepoints after nigericin washout.

As pointed out above, we show now that TfR-GFP is present in enlarged endosomes and is lost from these endosomes over time (Figure 9A,D,G). Moreover, we performed experiments with dextran-Alexa647 and mCherry-nanobodies directed against GFP to show that endocytosed material from the plasma membrane indeed reached the enlarged endosomes (Figure 3 figure supplement 1 and 2). TfR-GFP recruitment to the Rab5-positive endosome coincided with the recruitment of mCherry-tagged anti-GFP nanobody-labeled surface transferrin, suggesting that most of TfR-GFP at the enlarged endosome did indeed come from the plasma membrane. In contrast, CDMPR-GFP is present at the enlarged compartments prior to Rab5 recruitment and is promptly removed during or shortly before Rab5 recruitment (Figure 9B,E,H). These observations suggest that the maturing endosomes readily accept endocytosed cargo and actively remove Golgi-derived cargo. We observed that endocytosed material reached the enlarged endosomes as they became Rab5 positive (Figure 3, figure supplement 1 and 2).

(3) Figure 7 – It was not convincing that data in panels F and G are different from each other.

We agree with the reviewer that the difference between the data presented in panel F and G is not very big. These panels represent the average of many endosomes and with the averaging the differences from the individual traces get cancelled out. The process is asynchronous and thus in this case the individual traces are more telling than the averaged traces. Nevertheless, we decided to keep the average traces in the manuscript because the highlight the asynchronous nature of the process. We modified the text to make this point clear.

(4) Figure 11 – I find the interpretation of panel D confusing. How can we interpret this as connected to Rab conversion when even the labeled compartments at the earliest time point in the czz1 knockout have abnormally high pH, and during the time-course even the last timepoint for czz1 KO is higher than that of the earliest timepoint for WT?

We agree that the ccz1 KO cells display higher endosomal pH than WT cells throughout the time-course. However, the cells in which we express the rescue plasmid of Ccz1 also have apparently less acidified endosomes, even though Ccz1 can still drive Rab conversion, and the pH dropped at an intermediate rate, when comparing rescued cells to control and ccz1 KO cells. Even in ccz1 KO cells endosomal traffic down the degradation pathway is not completely blocked, similarly to what we observed for sand-1 (-/-) C. elegans and Mon1a/b knockdown in mammalian cells (Poteryaev et al., 2010). Acidification eventually will occur, but it is massively slowed down; the molecular basis of which is still under investigation in our lab. Even in ccz1 KO cells endosomal traffic down the degradation pathway is not completely blocked, similarly to what we observed for sand-1 (-/-) C. elegans and Mon1a/b knockdown in mammalian cells (Poteryaev et al., 2010). Acidification eventually will occur, but it is massively slowed down; the molecular basis of which is still under investigation in our lab.

(5) Figure 12 – The criteria used to determine which GalT structures are Golgi or lysosomes seems flawed. Morphology alone is not sufficient to identify the compartments with high accuracy, especially after perturbation. Also, to what extent does GalT-CFP label lysosomes without nigericin treatment?

To address these issues, we co-labelled cells with lysotracker. GalT-CFP (pHlemon) and lysotracker showed a very high degree of co-localization. These data are included in the manuscript (Figure 10 B).

Reviewer #3 (Recommendations for the authors):

– What is the status of recycling endosomes? These structures must have some relationship to maturing endosomes but the literature is confusing. Rab11 is the traditional marker for recycling endosomes, and the authors describe Rab11 vesicles that "contact" maturing endosomes. How is this pathway envisioned to occur? Does internalized material ever accumulate in Rab11-positive recycling endosomes? It would be useful to bring the earlier work on the FERARI complex into a model that incorporates the current data.

We would predict that the Rab11 vesicles would undergo kiss-and-run on the enlarged endosomes, similarly to what we have described previously. We added a sentence to this effect in the discussion. In fact, we compared Rab11 in control and FERARI KO cells, and it seems as if we indeed see a difference in residence time. However, we consider these experiments and the additional work necessary to make a strong case would be way beyond the scope of this manuscript. Therefore, we included wording in the discussion to integrate our FERARI findings.

– Do late endosomes fuse completely with lysosomes, or do they typically undergo kiss-and-run fusion as has been described in both mammalian and yeast cells? Some of the images here seem to argue against complete fusion. What are the implications? Specifically, if late endosomes are constantly being generated by maturation but are not consumed by fusion with lysosomes, why doesn't the cell fill up with late endosomes?

This is really difficult to distinguish at this point. We think that we observe both events. On one hand we see lysosomes contacting and ‘dancing around’ the enlarged endosomes. On the other hand, we also see them disappearing after contacting endosomes, consistent with a fusion event. At any rate, the enlarged endosomes acidify further and become lysotracker positive. At which point, they will lose their round and becomes smaller over time. In a way the endolysosome matures into a lysosome. We surmise that also membrane recycling will occur, but this is a subject for future studies. We do not observe an accumulation of late endosomes because they turn into endolysosomes and then mature to lysosomes, which then can go on and fuse with late endosomes again. Our data in new Figure 10 figure supplement 1 supports this model.

– The most striking result is that TGN-derived compartments go on to become Rab5-labeled endosomes, yet this topic is not even mentioned in the Discussion. Do the authors infer that there is a close relationship between the TGN and early endosomes, as has been observed in plant and yeast cells? Or is it more likely that existing Rab5-positive early endosomes become more prominent due to fusion with enlarged TGN-derived compartments?

We now included a discussion about TGN-derived compartments becoming Rab5-positive endosomes. We speculate that the Rab5 identity is mostly brought about through fusion with Rab5 positive endocytic structures, as we frequently observe such events. However, we cannot exclude other possible mechanisms such as direct recruitment of Rab5 from the cytoplasm. These alternative or additional mechanisms may just be much harder to recognize and to interpret, especially if occurring in combination.

In Figure 1D, homotypic fusion is readily apparent but I don't see the Rab conversion described in the legend.

We agree with the reviewer that in the particular example Rab conversion is more difficult to detect as the Rab7 signal at the endosome is very weak. However, in Figure 1C this is easy to see. Therefore, we do not refer to panel D anymore when describing Rab conversion. In addition we provide more examples of Rab conversion throughout the manuscript.

The videos are hard to match to the figures. For example, the "Figure 1C supplement 1" video seems to have nothing to do with Figure 1C, and I couldn't find a description of this video.

We apologize for the mistake. This was apparently a mistake introduced by the renaming of all files. We provide now the correct file names. We further integrate the links to all the videos in the figure legends, as the descriptions are identical to the time lapse image series provided in the figures.

Figure 5: PI(3)P is presumably generated, not recruited.

Of course, the reviewer is right. We changed the text accordingly.

https://doi.org/10.7554/eLife.70982.sa2

Article and author information

Author details

  1. Maria Podinovskaia

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Conceptualization, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1351-6340
  2. Cristina Prescianotto-Baschong

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Formal analysis, Investigation, Visualization
    Competing interests
    No competing interests declared
  3. Dominik P Buser

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Resources
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6019-2188
  4. Anne Spang

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Conceptualization, Funding acquisition, Project administration, Supervision, Writing – original draft, Writing - review and editing
    For correspondence
    anne.spang@unibas.ch
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2387-6203

Funding

Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (CRSII3_141956)

  • Anne Spang

Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (310030_197779)

  • Anne Spang

Universität Basel

  • Maria Podinovskaia
  • Cristina Prescianotto-Baschong
  • Dominik Pascal Buser
  • Anne Spang

Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (310030_185127)

  • Cristina Prescianotto-Baschong
  • Anne Spang

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We are grateful for the support provided by the Biozentrum FACS and Imaging core facilities, in particular to Janine Bögli, Stella Stefanova and Laurent Guerard. We thank J Lippincott-Schwartz for the GalT-EGFP plasmid. This work was supported by the Swiss National Science Foundation (CRSII3_141956 and 310030_197779 to AS) and the University of Basel.

Senior Editor

  1. Vivek Malhotra, The Barcelona Institute of Science and Technology, Spain

Reviewing Editor

  1. Christopher G Burd, Yale School of Medicine, United States

Reviewers

  1. Christopher G Burd, Yale School of Medicine, United States
  2. Benjamin S Glick, The University of Chicago, United States

Publication history

  1. Received: June 4, 2021
  2. Preprint posted: June 29, 2021 (view preprint)
  3. Accepted: November 9, 2021
  4. Version of Record published: November 30, 2021 (version 1)

Copyright

© 2021, Podinovskaia et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 2,167
    Page views
  • 349
    Downloads
  • 3
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Maria Podinovskaia
  2. Cristina Prescianotto-Baschong
  3. Dominik P Buser
  4. Anne Spang
(2021)
A novel live-cell imaging assay reveals regulation of endosome maturation
eLife 10:e70982.
https://doi.org/10.7554/eLife.70982

Further reading

    1. Cell Biology
    2. Structural Biology and Molecular Biophysics
    Marion Portes et al.
    Research Article Updated

    Osteoclasts are unique in their capacity to degrade bone tissue. To achieve this process, osteoclasts form a specific structure called the sealing zone, which creates a close contact with bone and confines the release of protons and hydrolases for bone degradation. The sealing zone is composed of actin structures called podosomes nested in a dense actin network. The organization of these actin structures inside the sealing zone at the nano scale is still unknown. Here, we combine cutting-edge microscopy methods to reveal the nanoscale architecture and dynamics of the sealing zone formed by human osteoclasts on bone surface. Random illumination microscopy allowed the identification and live imaging of densely packed actin cores within the sealing zone. A cross-correlation analysis of the fluctuations of actin content at these cores indicates that they are locally synchronized. Further examination shows that the sealing zone is composed of groups of synchronized cores linked by α-actinin1 positive filaments, and encircled by adhesion complexes. Thus, we propose that the confinement of bone degradation mediators is achieved through the coordination of islets of actin cores and not by the global coordination of all podosomal subunits forming the sealing zone.

    1. Cell Biology
    Fangrui Chen et al.
    Research Article

    The major microtubule-organizing center (MTOC) in animal cells, the centrosome, comprises a pair of centrioles surrounded by pericentriolar material (PCM), which nucleates and anchors microtubules. Centrosome assembly depends on PCM binding to centrioles, PCM self-association and dynein-mediated PCM transport, but the self-assembly properties of PCM components in interphase cells are poorly understood. Here, we used experiments and modeling to study centriole-independent features of interphase PCM assembly. We showed that when centrioles are lost due to PLK4 depletion or inhibition, dynein-based transport and self-clustering of PCM proteins are sufficient to form a single compact MTOC, which generates a dense radial microtubule array. Interphase self-assembly of PCM components depends on γ-tubulin, pericentrin, CDK5RAP2 and ninein, but not NEDD1, CEP152 or CEP192. Formation of a compact acentriolar MTOC is inhibited by AKAP450-dependent PCM recruitment to the Golgi or by randomly organized CAMSAP2-stabilized microtubules, which keep PCM mobile and prevent its coalescence. Linking of CAMSAP2 to a minus-end-directed motor leads to the formation of an MTOC, but MTOC compaction requires cooperation with pericentrin-containing self-clustering PCM. Our data reveal that interphase PCM contains a set of components that can self-assemble into a compact structure and organize microtubules, but PCM self-organization is sensitive to motor- and microtubule-based rearrangement.