Apelin signaling dependent endocardial protrusions promote cardiac trabeculation in zebrafish

  1. Jialing Qi
  2. Annegret Rittershaus
  3. Rashmi Priya
  4. Shivani Mansingh
  5. Didier YR Stainier  Is a corresponding author
  6. Christian SM Helker  Is a corresponding author
  1. Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Germany


During cardiac development, endocardial cells (EdCs) produce growth factors to promote myocardial morphogenesis and growth. In particular, EdCs produce neuregulin which is required for ventricular cardiomyocytes (CMs) to seed the multicellular ridges known as trabeculae. Defects in neuregulin signaling, or in endocardial sprouting toward CMs, cause hypotrabeculation. However, the mechanisms underlying endocardial sprouting remain largely unknown. Here, we first show by live imaging in zebrafish embryos that EdCs interact with CMs via dynamic membrane protrusions. After touching CMs, these protrusions remain in close contact with their target despite the vigorous cardiac contractions. Loss of the CM-derived peptide Apelin, or of the Apelin receptor, which is expressed in EdCs, leads to reduced endocardial sprouting and hypotrabeculation. Mechanistically, neuregulin signaling requires endocardial protrusions to induce extracellular signal-regulated kinase (Erk) activity in CMs and trigger their delamination. Altogether, these data show that Apelin signaling-dependent endocardial protrusions modulate CM behavior during trabeculation.

Editor's evaluation

This first formal dissection of endocardial protrusions in zebrafish hearts describes how they anchor to cardiomyocytes, and how they participate in signaling pathways involved in trabeculation. The work combines elegant zebrafish reporters and high-quality imaging, as well as mutant lines and pathway inhibitors to provide key findings of how mutual regulation between the myocardium and the endocardium contribute to understanding of mechanisms underlying organ development. This manuscript is of broad interest to readers who study cardiogenesis and developmental biology.



To meet the needs of the growing embryo, the vertebrate heart has to undergo a series of complex morphogenetic events to transform from a linear tube into a mature organ. During cardiac trabeculation, CMs in the outer curvature of the ventricles delaminate toward the lumen to form multicellular sponge-like projections, called trabeculae (Sedmera and Thomas, 1996; Sedmera et al., 2000; Stankunas et al., 2008; Liu et al., 2010; Peshkovsky et al., 2011; Staudt et al., 2014). Cardiac trabeculae are crucial to achieve increased contractility as well as for the formation of the conduction system. Trabeculation defects are often associated with left ventricular noncompaction (Oechslin et al., 2000; Stöllberger and Finsterer, 2004), embryonic heart failure, and lethality (Gassmann et al., 1995; Lee et al., 1995; Lai et al., 2010; Liu et al., 2010; Rasouli and Stainier, 2017).

In zebrafish, as in other vertebrates, the early embryonic heart consists of two cell layers, the myocardium and the endocardium, separated by a specialized extracellular matrix called the cardiac jelly (CJ) (Stainier and Fishman, 1992; Brutsaert et al., 1996). Recently, it has been shown that endocardial cells (EdCs), similar to blood endothelial cells (ECs), form sprouts, and that these sprouts are mostly oriented toward the myocardium (Del Monte-Nieto et al., 2018). During sprouting angiogenesis, ECs first extend filopodia to sense the microenvironment for growth factors, then they migrate into avascular areas and form new blood vessels (Gerhardt et al., 2003). Due to its similarity to sprouting angiogenesis, the sprouting of EdCs has been termed endocardial sprouting. However, whether endocardial sprouting is regulated by the same signaling pathways as sprouting angiogenesis is not known.

Multiple signaling pathways have been implicated in cardiac trabeculation, including neuregulin (Nrg)/ErbB signaling. Mouse and zebrafish embryos lacking the endocardium-derived ligand Nrg or the ErbB receptor, which is expressed by the myocardium, fail to form trabeculae (Gassmann et al., 1995; Lee et al., 1995; Meyer and Birchmeier, 1995; Lai et al., 2010; Liu et al., 2010; Rasouli and Stainier, 2017). Furthermore, endocardial Notch signaling (Grego-Bessa et al., 2007; D’Amato et al., 2016; Del Monte-Nieto et al., 2018), angiopoietin 1/Tie2 signaling (Suri et al., 1996; Tachibana et al., 2005; Qu et al., 2019), and semaphorin 3E/plexinD1 signaling (Sandireddy et al., 2019) are required for cardiac trabeculation in mouse. Of note, genetic deletion of the relevant receptors in the endocardium results in attenuated endocardial sprouting (Qu et al., 2019) and trabeculation defects (Grego-Bessa et al., 2007; D’Amato et al., 2016; Del Monte-Nieto et al., 2018; Qu et al., 2019; Sandireddy et al., 2019).

Cells communicate by a variety of mechanisms including paracrine and contact-dependent signaling. More recently, a novel mechanism of cell communication by active transport of signaling molecules through filopodia-like actin-rich membrane protrusions, also known as cytonemes, has been shown in different models including Drosophila (Ramírez-Weber and Kornberg, 1999; Roy et al., 2011; Huang et al., 2019), chick (Sanders et al., 2013), zebrafish (Stanganello et al., 2015), and mouse (Fierro-González et al., 2013). Like filopodia, cytonemes depend on actin polymerization by various effector proteins including formins, profilin, and IRSp53, a substrate for the insulin receptor (Rottner et al., 2017).

In this study, we take advantage of the zebrafish model, as its transparency allows single-cell resolution and high-speed imaging of the beating heart, to analyze endocardial-myocardial communication during embryogenesis. By investigating apelin (apln) mutants, we found that endocardial protrusion formation is controlled by Apln signaling. We also observed by in vivo imaging that endocardial protrusions promote cardiac trabeculation by modulating Nrg/ErbB/Erk signaling. Altogether, our results provide new insights into the role of endocardial protrusions during cardiac trabeculation.


Endocardial-myocardial interactions in zebrafish

The early embryonic heart in vertebrates is composed of two cell types: EdCs and myocardial cells (Figure 1A–D). In order to analyze possible interactions between the endocardial and myocardial cells in zebrafish, we genetically labeled the actin cytoskeleton of the EdCs using the TgBAC(cdh5:Gal4ff) and Tg(UAS:LIFEACT-GFP) lines, and the membrane of myocardial cells with mCherry using the Tg(myl7:mCherry-CAAX) line. We observed endocardial protrusions extending toward the myocardium at 24 (Figure 1A–A’’) and 48 (Figure 1B–B’’, Figure 1—figure supplement 1A) hours post-fertilization (hpf). Of note, we observed more endocardial protrusions in the ventricle than in the atrium at 48, 60, and 72 hpf (Figure 1—figure supplement 1B). Subsequently, these ventricular endocardial protrusions formed anchor points with the myocardium, and to be consistent with similar observations in mouse (Del Monte-Nieto et al., 2018) we will refer to them as touchdowns (Figure 1B–B’’). Notably, these touchdowns are stable even during cardiac contractions (Figure 1E–H, Figure 1—video 1). Starting at around 60 hpf, cardiomyocytes (CMs) delaminate from the compact layer toward the lumen to seed the trabecular layer (Figure 1C, C’ and C’’’’), as reported before (Liu et al., 2010; Peshkovsky et al., 2011; Staudt et al., 2014; Priya et al., 2020). At this stage, we observed that endocardial protrusions appear to extend along, and sometimes around, the delaminating CMs (Figure 1C’’ and C’’’, Figure 1—video 2). Next, trabecular CMs start to assemble into trabeculae, ‘finger-like’ multicellular projections, starting at 72 hpf (Figure 1D, D’ and D’’’’). At this stage, we observed that endocardial protrusions can also be detected in close proximity to trabecular CMs (Figure 1D’’ and D’’’, Figure 1—video 3). Cardiac trabeculae are mostly present in the outer curvature of the ventricle at early developmental stages in zebrafish (Liu et al., 2010). Interestingly, we observed a spatial correlation between endocardial protrusions and trabeculation. At 48 hpf, endocardial protrusions are mostly located in the outer curvature of the ventricle (Figure 1—figure supplement 1C, F). At 60 and 72 hpf, respectively, 79% and 83% of all endocardial protrusions in the ventricle are located in the outer curvature (Figure 1—figure supplement 1D-F); 69% of all endocardial protrusions in the outer curvature are close to delaminating CMs at 60 hpf, and 91% of all endocardial protrusions in the outer curvature are close to trabecular CMs at 72 hpf (Figure 1—figure supplement 1D, E, G). Moreover, 98% of delaminating CMs and 93% of trabecular CMs are in close proximity to endocardial protrusions at 60 and 72 hpf, respectively (Figure 1—figure supplement 1D, E, H). Together these data lead us to speculate that endocardial protrusions play a role during endocardium-myocardium interactions.

Figure 1 with 4 supplements see all
Stages of endocardial-myocardial interactions during zebrafish heart development.

(A-D) Confocal projection images of the heart of Tg(myl7:mCherry-CAAX); Tg(cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP) zebrafish at 24 (A), 48 (B), 60 (C) and 72 (D) hpf. (A-A’’) Endocardial protrusions (arrows) towards the myocardium at 24 hpf. (B-B’’) Endocardial protrusions (arrows) and touchdowns (asterisks) with the myocardium at 48 hpf. (C-C’’’) Endocardial protrusions (arrows) during CM delamination (arrowheads) at 60 hpf. (C’’’) 3D surface rendering of the area in the yellow box in C’. (D-D’’’) Endocardial protrusions (arrows) during trabecular assembly and expansion (arrowheads) at 72 hpf. (D’’’) 3D surface rendering of the area in the yellow box in D’. (A’’’’-D’’’’) Schematics of endocardial protrusions, endocardial touchdowns, CM delamination, and trabecular expansion. Black asterisks indicate delaminating CMs; purple asterisks indicate trabeculae. (E-H) Still images from a spinning disc time-lapse movie of a 48 hpf Tg(myl7:mCherry-CAAX); Tg(cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP) heart; white asterisks indicate endocardial touchdowns; numbers in the bottom right corner refer to seconds. All images are ventral views, anterior to the top. V, ventricle; A, atrium.

Genetically blocking endocardial protrusion formation reduces myocardial trabeculation

Since we observed a correlation between the presence of endocardial protrusions and myocardial trabeculation, we next aimed to examine the function of endocardial protrusions during cardiac morphogenesis. To this aim, we generated a transgenic line, Tg(UAS: irsp53dn-p2a-RFP), to specifically block protrusion formation in the endothelium. IRSp53 regulates the actin cytoskeleton to enable cells to form different types of membrane extensions (Nakagawa et al., 2003; Millard et al., 2005; Scita et al., 2008). By crossing the Tg(UAS: irsp53dn-p2a-RFP) line to the TgBAC(cdh5:Gal4ff) line to overexpress Irsp53dn specifically in ECs, we observed a 70% reduction in the number of endocardial protrusions at 48 hpf (Figure 2A, B and E), while their distribution appeared mostly unaffected (Figure 2A, B and F). To test the hypothesis that endocardial protrusions modulate myocardial trabeculation, we analyzed embryos overexpressing irsp53dn in their ECs in a CM membrane line (Tg(myl7:BFP-CAAX)). Upon irsp53dn overexpression in ECs, we detected fewer endocardial touchdowns (Figure 2A and B), as well as a reduction in cardiac trabeculation (Figure 2C, D, G and G’). In order to identify a possible effect of endocardial protrusions on CM proliferation, we overexpressed irsp53dn in the endothelium in the context of the Tg(myl7:mVenus-gmnn) reporter to visualize cycling CMs. Compared with controls, endothelial overexpression of irsp53dn led to significantly fewer mVenus-Gmnn+ CMs in the ventricle (Figure 2H and I).

Blocking endocardial protrusion formation reduces cardiac trabeculation.

(A–D) Confocal projection images of the heart of Tg(myl7:BFP-CAAX); Tg(cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP);±Tg(UAS:irsp53dn-p2a-tagRFP) zebrafish at 48 (A–B) and 72 (C–D) hours post-fertilization (hpf). (A–B) Endocardial protrusions (white arrows) and touchdowns (white asterisks) are reduced in embryos with endothelial overexpression of irsp53dn. (C–D) Cardiac trabeculation (arrowheads) is reduced in larvae with endothelial overexpression of irsp53dn; (C’D) 3D rendering. (E) Quantification of the number of endocardial protrusions in wild-type and in embryos with endothelial overexpression of irsp53dn at 48 hpf. (F-F’) Illustration of the division of the 48 hpf ventricle into four regions (F). Distribution and average number of endocardial protrusions in different regions of mid-sagittal sections of the ventricle from 48 hpf wild-type and irsp53dn embryos (F’). (G–G’) Illustration of the division of the 72 hpf ventricle into the outer and inner curvature (G). Quantification of the percentage of trabecular cardiomyocytes (CMs) in the outer curvature of wild-type and irsp53dn larvae at 72 hpf (G’). (H–H’) 72 hpf larvae with endothelial overexpression of irsp53dn display a reduced number of myl7:mVenus-Gmnn+ CMs (yellow arrows) in their ventricle. (I) Quantification of the number of mVenus-Gmnn+ CMs in the ventricle of wild-type and irsp53dn larvae at 72 hpf. All images are ventral views, anterior to the top. V, ventricle; A, atrium. Data in graphs expressed as mean ± SEM.

Apelin signaling positively regulates endocardial protrusion formation and myocardial trabeculation

We have recently found that Apelin signaling regulates endothelial filopodia formation during angiogenesis in the zebrafish trunk (Helker et al., 2020). Therefore, we hypothesized that Apelin signaling also regulates endocardial protrusion formation. In order to visualize the expression of apln and aplnrb at single-cell resolution in the heart, we examined the TgBAC(apln:EGFP) reporter line (Helker et al., 2020) and generated a novel Tg(aplnrb:VenusPEST) reporter line. We detected apln:EGFP expression in the myocardium at 48 and 72 hpf (Figure 3A and B). Furthermore, we detected aplnrb:VenusPEST expression in the endocardium at 48 and 72 hpf (Figure 3C and D). These results suggest that apln is expressed in the myocardium while aplnrb is expressed in EdCs. Based on these results, we hypothesized that Apelin signaling plays a role during endocardium-myocardium interactions.

Expression pattern of Apelin signaling pathway components.

(A–D) Confocal projection images of the heart of TgBAC(apln:EGFP); Tg(myl7:MKATE-CAAX) (A, B) and TgBAC(aplnrb:VenusPEST); Tg(kdrl:HsHRAS-mCherry) (C, D) zebrafish at 48 (A, C) and 72 (B, D) hours post-fertilization (hpf). (A’–’D’) Maximum intensity projections. (A–B) TgBAC(apln:EGFP) expression is detectable in the myocardium at 48 (A) and 72 (B) hpf. (C–D) TgBAC(aplnrb:VenusPEST) expression is detectable in the endocardium with higher expression in the ventricular endocardium at 48 (C) and 72 (D) hpf. All images are ventral views, anterior to the top. V, ventricle; A, atrium.

To test this hypothesis, we used mutants for aplnra (Helker et al., 2015), aplnrb (Helker et al., 2015), apln (Helker et al., 2015), and apela (Chng et al., 2013). Since apela mutants fail to form a heart (Chng et al., 2013), we did not analyze them. While most aplnrb mutants fail to form a heart (D’Amico et al., 2007; Zeng et al., 2007), a low number of them do. By analyzing aplnrb mutants that do form a heart, we observed that they exhibit a reduced number of endocardial protrusions at 48 hpf (Figure 4—figure supplement 1A, B) and a reduced number of trabeculae at 72 hpf (Figure 4—figure supplement 1C, D). In wild-type embryos, the CJ between the endocardium and myocardium in the outer curvature of the ventricle appears to be mostly degraded at 72 hpf (Figure 4—figure supplement 1C); however, the CJ in aplnrb mutants appears to be thicker at this stage (Figure 4—figure supplement 1D). In addition, aplnra mutants also exhibit a reduced number of trabeculae at 72 hpf (Figure 4—figure supplement 1E and F). We further observed that apln mutants exhibit a significantly lower number of endocardial protrusions at 24 and 48 hpf (Figure 4A–D–). In line with fewer endocardial protrusions, apln mutants also exhibit a reduced number of endocardial touchdowns at 48 hpf (Figure 4C and D), and a reduced number of trabeculae at 72 hpf (Figure 4E, F and J). Altogether, these results indicate that Apelin signaling regulates endocardial protrusion formation and myocardial trabeculation.

Figure 4 with 6 supplements see all
Loss of Apelin signaling leads to reduced endocardial protrusion and reduced myocardial trabeculation.

(A–F) Confocal projection images of the heart of Tg(cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP) zebrafish at 24 hours post-fertilization (hpf) (A–B) and of the heart of Tg(myl7:mCherry-CAAX); Tg (cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP) (C–F) zebrafish at 48 (C–D) and 72 (E–F) hpf. Maximum intensity projections (A–B) and mid-sagittal sections (C–F). (A) Endocardial protrusions (arrows) in apln+/+ embryos at 24 hpf. (B) The number of endocardial protrusions (arrows) is reduced in apln-/- siblings at 24 hpf. (C–D) The numbers of endocardial protrusions (arrows) and touchdowns (white asterisks) are reduced in apln-/- embryos (D) at 48 hpf compared with apln+/+ siblings (C). (E–F) apln-/- larvae (F) exhibit reduced trabeculation (arrowheads) and thicker cardiac jelly (CJ) (yellow asterisks) at 72 hpf compared with apln+/+ siblings (E). (G–H) Quantification of the number of endocardial protrusions in the ventricle of apln+/+ and apln-/- siblings at 24 (G) and 48 (H) hpf. (I) Distribution and average number of endocardial protrusions in different regions of mid-sagittal sections of the ventricle from 48 hpf apln+/+ and apln-/- siblings. (J) Quantification of the percentage of trabecular cardiomyocytes (CMs) in the outer curvature of apln+/+ and apln-/- siblings at 72 hpf. (K–K’) Maximum intensity projections. apln-/- larvae (K’) exhibit a thicker CJ at 72 hpf compared with apln+/+ siblings (K). (L) Quantification of the CJ volume in the outer curvature of apln+/+ and apln-/- siblings at 72 hpf. All images are ventral views, anterior to the top. V, ventricle; A, atrium; +/+, apln+/+; -/-, apln-/-. Data in graphs expressed as mean ± SEM.

To further examine the function of Apelin-dependent endocardial protrusions during cardiac trabeculation, we next analyzed CM proliferation in apln mutants using EdU labeling. Homozygous apln mutants exhibit a significantly decreased number of EdU+ CMs in their ventricle compared with apln+/+ siblings (Figure 4—figure supplement 2). In addition, apln mutants also display a significantly thicker CJ compared with apln+/+ siblings at 72 hpf (Figure 4C–F, K and L). However, we did not observe any obvious defects in sarcomere formation (Figure 4—figure supplement 3A and B), heart rate, ejection fraction, or blood circulation in apln mutants (Figure 4—figure supplement 3C and D; Figure 4—videos 1–2), indicating that the myocardial trabeculation phenotype is caused by the endocardial protrusion defect and is not secondary to cardiac dysfunction.

Notch signaling negatively regulates endothelial sprouting and protrusion formation in several vascular beds (Hellström et al., 2007; Leslie et al., 2007; Siekmann and Lawson, 2007; Suchting et al., 2007). In order to determine whether Notch signaling also regulates endocardial protrusion formation, we treated embryos with the γ-secretase inhibitor RO4929097 and observed a decrease in Notch reporter expression in the endocardium (Figure 4—figure supplement 4A and B) as well as an increased number of endocardial protrusions in the ventricle (Figure 4—figure supplement 4E, F, and H). However, and in line with the touchdown reduction phenotype in Notch-deficient mice, we observed a reduction in endocardial touchdowns in Notch inhibitor treated zebrafish larvae at 48 hpf (Figure 4—figure supplement 4C, D, and G).

Altogether, these results indicate that myocardial derived Apelin promotes endocardial protrusion formation while Notch signaling inhibits it. Furthermore, Apelin signaling is required for cardiac trabeculation, possibly via the formation of endocardial protrusions.

The function of endocardial Nrg2a in trabeculation requires endocardial protrusions

Nrg-ErbB signaling is indispensable for cardiac trabeculation in mouse and zebrafish (Gassmann et al., 1995; Lee et al., 1995; Meyer and Birchmeier, 1995; Lai et al., 2010; Liu et al., 2010; Peshkovsky et al., 2011; Rasouli and Stainier, 2017). To determine whether endocardial protrusions are required for Nrg-ErbB signaling, we first overexpressed nrg2a in the endothelium using the Tg(fli1a:nrg2a-p2a-tdTomato) line (Rasouli and Stainier, 2017). Overexpression of nrg2a in the endothelium results in hypertrabeculation as well as a multilayered myocardium (Figure 5A, B and E–G; Figure 5—figure supplement 1A and B). Strikingly, overexpressing nrg2a in the endothelium while blocking endocardial protrusion formation by endothelial overexpression of irsp53dn is not sufficient to restore cardiac trabeculation or induce CM multilayering (Figure 5C-C' and E-G). In line with these results, overexpressing nrg2a in the endothelium of homozygous apln mutants is not sufficient to restore cardiac trabeculation or induce CM multilayering (Figure 5D-D' and E-G). Importantly, we did not detect a change in the expression levels of nrg2a in apln mutant hearts at 48 hpf (Figure 5—figure supplement 1C). Taken together, these data indicate that endocardial protrusions are required for Nrg-ErbB signaling during cardiac trabeculation.

Figure 5 with 1 supplement see all
Endocardial protrusions are necessary for nrg2a function.

(A–D) Confocal projection images of the heart of Tg(myl7:HsHRAS-EGFP) larvae at 72 hours post-fertilization (hpf). (A–B) Overexpression of nrg2a in the endothelium (B) leads to an increased number of trabeculae (arrowheads) and the multilayering of cardiomyocytes (CMs) (brackets) compared with wild-type (A). (C) Larvae with endothelial overexpression of nrg2a and irsp53dn exhibit a reduced number of trabeculae (arrowheads) and of multilayered CMs (brackets) compared with larvae with endothelial overexpression of nrg2a alone (B). (D) apln mutant larvae with endothelial overexpression of nrg2a exhibit a reduced number of trabeculae (arrowheads) and of multilayered CMs (brackets) compared with wild-type larvae with endothelial overexpression of nrg2a (B). (E) Quantification of the number of trabeculae. (F) Quantification of the number of trabecular CMs. (G) Quantification of the number of multilayered CMs in the ventricle. Brackets indicate multilayered CMs. All images are ventral views, anterior to the top. V, ventricle. Data in graphs expressed as mean ± SEM.

Genetically blocking endocardial protrusion formation attenuates Erk signaling in cardiomyocytes

An important molecule in the Nrg/ErbB signaling pathway is the extracellular signal-regulated kinase Erk (Lai et al., 2010). In order to visualize Erk activity in CMs in living zebrafish, as a readout of ErbB signaling, we generated novel reporter lines (Tg(myl7:ERK-KTR-Clover-p2a-H2B-tagBFP) and Tg(myl7:ERK-KTR-Clover-p2a-H2B-mScarlet)) that use the kinase translocation reporter (KTR) technology (Regot et al., 2014; de la Cova et al., 2017). When Erk is inactive, the KTR is unphosphorylated and Clover can be detected in the nucleus; in contrast, when Erk is active, the KTR is phosphorylated and Clover can be detected in the cytoplasm (de la Cova et al., 2017). We observed that most ventricular CMs in wild-type larvae display active Erk signaling with cytoplasmic Clover expression (Figure 6A). Treating embryos expressing the reporter with a MEK inhibitor led to an increased number of ventricular CMs with nuclear Clover expression (i.e., inactive Erk signaling) indicating that the reporter is functional (Figure 6—figure supplement 1). Next, we treated embryos expressing the reporter with an ErbB2 inhibitor and found an increased number of ventricular CMs with nuclear Clover expression (Figure 6B). To determine whether endocardial protrusions modulate myocardial Erk signaling activity, we genetically blocked endocardial protrusion formation via endothelial overexpression of irsp53dn and observed more ventricular CMs with nuclear Clover expression (Figure 6C and E) compared with control (Figure 6A and E), indicating more ventricular CMs with inactive Erk signaling. In line with these results, we observed more ventricular CMs with inactive Erk signaling in homozygous apln mutants (Figure 6D and E) compared with apln+/+ siblings (Figure 6A and E). Altogether, these observations indicate that Apelin signaling-dependent endocardial protrusions promote Nrg/ErbB/Erk signaling in CMs.

Figure 6 with 2 supplements see all
Blocking endocardial protrusion formation reduces myocardial extracellular signal-regulated kinase (Erk) signaling activity.

(A–D) Maximum intensity projections of confocal images of the heart of Tg(myl7:ERK-KTR-Clover-p2a-H2B-tagBFP/mScarlet) larvae at 72 hours post-fertilization (hpf). (A) Visualization of Erk activity by a cardiomyocyte (CM)-specific ERK-kinase translocation reporter (KTR) reporter. Nuclear Clover expression (arrows) indicates CMs with inactive Erk signaling. (B) Larvae treated with an ErbB2 inhibitor exhibit an increased number of CMs with inactive Erk signaling (arrows) compared with control larvae (A). (C) Larvae with endothelial overexpression of irsp53dn exhibit an increased number of CMs with inactive Erk signaling (arrows) compared with control larvae (A). (D) apln mutant larvae exhibit an increased number of CMs with inactive Erk signaling (arrows) compared with apln+/+ siblings. (E) Quantification of the percentage of ventricular CMs with nuclear Clover expression. All images are ventral views, anterior to the top. V, ventricle. Data in graphs expressed as mean ± SEM.


Endocardial protrusions are required for trabeculation

Cardiac trabeculation is initiated, at least in zebrafish, by individual CMs delaminating from the myocardial monolayer and protruding into the lumen (Liu et al., 2010; Peshkovsky et al., 2011; Staudt et al., 2014; Jiménez-Amilburu et al., 2016; Priya et al., 2020). In contrast, the myocardium in mouse is multilayered at the onset of trabeculation. Several studies have reported that the endocardium plays an important role during cardiac trabeculation (Grego-Bessa et al., 2007; Lai et al., 2010; D’Amato et al., 2016; Rasouli and Stainier, 2017; Del Monte-Nieto et al., 2018; Qu et al., 2019). Furthermore, it has recently been shown that EdCs, similar to ECs, undergo sprouting (Del Monte-Nieto et al., 2018). However, in comparison with endothelial sprouting, little is known about the morphogenetic events underlying endocardial sprouting and their effect on cardiac morphogenesis including trabeculation.

In mouse, endocardial sprouting and touchdown formation occur early during cardiac trabeculation (Del Monte-Nieto et al., 2018). These observations are in line with our data in zebrafish, suggesting that the morphogenetic events of cardiac trabeculation are evolutionarily conserved. However, endocardial sprouts in mouse appear to be cellular (Del Monte-Nieto et al., 2018), whereas endocardial protrusions in zebrafish appear more similar to filopodia, although these differences may be due to the fact that fixed tissue was used for the mouse work compared with live tissue for the zebrafish work. CM delamination and trabeculation occur in the outer curvature of the ventricle (Liu et al., 2010; Jiménez-Amilburu et al., 2016; Rasouli and Stainier, 2017). Consistent with these observations, we find that endocardial protrusions are mostly located in the outer curvature of the ventricle and extend along delaminating CMs as well as trabecular CMs. The temporal and spatial correlation between the emergence and location of endocardial protrusions and CM delamination therefore suggests a role for endocardial protrusions in cardiac trabeculation.

Molecular regulators of endocardial sprouting

During sprouting angiogenesis, so-called tip cells lead the new sprouts (Gerhardt, 2008). Tip cells dynamically extend filopodia to identify growth factors in their environment (Gerhardt, 2008). Apelin and Notch signaling have been previously identified as regulators of endothelial filopodia formation (Hellström et al., 2007; Suchting et al., 2007; Helker et al., 2020). In contrast, the pathways regulating endocardial sprouting are largely unknown. Only Tie2 signaling has been identified to date as a regulator of endocardial sprouting, and Tie2-deficient mice exhibit fewer endocardial touchdowns (Qu et al., 2019). We have recently shown that Apelin signaling regulates filopodia formation during sprouting angiogenesis in the trunk (Helker et al., 2020). In line with these published observations, we now show that Apelin regulates endocardial filopodia formation and endocardial sprouting (Figure 6—figure supplement 2), revealing a conserved role for Apelin signaling during endothelial and endocardial sprouting.

Consistent with the negative regulation of sprouting angiogenesis by Notch signaling in ECs (Hellström et al., 2007; Leslie et al., 2007; Siekmann and Lawson, 2007; Suchting et al., 2007), we found that Notch signaling also negatively regulates endocardial protrusion formation. Interestingly, inhibition of Notch signaling also leads to an increased number of delaminated CMs and trabeculae, although Notch signaling may also affect CM behavior cell autonomously (Han et al., 2016; Priya et al., 2020).

Endocardium-myocardium communication is essential for trabeculation

Cell communication between the endocardial and myocardial cells is required for cardiac trabeculation (Gassmann et al., 1995; Lee et al., 1995; Meyer and Birchmeier, 1995; Lai et al., 2010; Liu et al., 2010; Rasouli and Stainier, 2017; Gunawan et al., 2021). Several studies have shown that endocardial-derived Nrg is required to activate ErbB receptor complexes on CMs (Gassmann et al., 1995; Meyer and Birchmeier, 1995; Grego-Bessa et al., 2007; Rasouli and Stainier, 2017). In zebrafish, nrg2a, which is expressed in the developing endocardium, is required for trabeculation (Rasouli and Stainier, 2017), and nrg2a overexpression in the endothelium results in an increased number of trabeculae and trabecular CMs (Figure 5), indicating that endocardial nrg2a is necessary and sufficient for trabeculation. Notably, blocking endocardial protrusion formation compromises the function of endocardial nrg2a during trabeculation, suggesting that endocardial protrusions are required for nrg2a function during trabeculation. The membrane-bound form of Nrg2a has a molecular weight of 55 kD, and after cleavage, the presumed secreted form has a molecular weight of 22 kD. In contrast, the most active form of Apelin is 13 amino acids long, with a molecular weight of 1.52 kD. Therefore, it is possible that due to its small size, Apelin is able to diffuse through the CJ, while Nrg2a needs to be transported by endocardial protrusions toward the myocardium.

Like other receptor tyrosine kinases, ErbB receptors activate multiple signaling cascades, including the MAPK cascade, upon ligand stimulation, leading to the phosphorylation of ERK1/2 (Sweeney et al., 2001; Wee and Wang, 2017). Accordingly, attenuated ERK phosphorylation is observed in CMs in Nrg1/ErbB signaling-deficient mice (Lai et al., 2010). By analyzing a novel reporter of Erk activity in CMs, we observed that the inhibition of endocardial protrusion formation, as well as the genetic inactivation of Apelin signaling, leads to attenuated Erk phosphorylation in CMs. Altogether, these data suggest that Apelin signaling-dependent endocardial protrusions modulate ErbB signaling in CMs (Figure 6—figure supplement 2).

It has recently been shown that EC filopodia modulate neurogenesis by affecting progenitor cell proliferation in the developing brain of mice and zebrafish (Di Marco et al., 2020; Taberner et al., 2020). Of interest, ErbB signaling is also known for its function within the nervous system (Buonanno and Fischbach, 2001). Thus, one might speculate that Nrg/ErbB signaling also plays a role during the modulation of neurogenesis by endothelial filopodia. Several studies have reported cell-to-cell communication by cytonemes in different animal models (Ramírez-Weber and Kornberg, 1999; Holzer et al., 2012; Luz et al., 2014; Pröls et al., 2015). Whether endocardial protrusions qualify as cytonemes needs further analysis. However, our data indicate that Apelin-dependent endocardial protrusions are required for the communication between endocardial and myocardial cells via Nrg/ErbB signaling (Figure 6—figure supplement 2).

In summary, our work describes how endocardial sprouting is required for Nrg/ErbB signaling during cardiac trabeculation. Furthermore, we identify Apelin signaling as a positive regulator of endocardial sprouting.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent (Danio rerio)TgBAC(apln:EGFP)bns157Helker et al., 2020ZFIN: bns157
Genetic reagent (Danio rerio)TgBAC(cdh5:Gal4ff)mu101Bussmann et al., 2011ZFIN: mu101
Genetic reagent (Danio rerio)Tg(UAS:LIFEACT-GFP)mu271Helker et al., 2013ZFIN: mu271
Genetic reagent (Danio rerio)Tg(fli1a:nrg2a-p2a-tdTomato)bns199Rasouli and Stainier, 2017ZFIN: bns199
Genetic reagent (Danio rerio)Tg(myl7:mCherry-CAAX)bns7Uribe et al., 2018ZFIN: bns7
Genetic reagent (Danio rerio)Tg(myl7:BFP-CAAX)bns193Guerra et al., 2018ZFIN: bns193
Genetic reagent (Danio rerio)Tg(myl7:MKATE-CAAX)sd11Lin et al., 2012ZFIN: sd11
Genetic reagent (Danio rerio)Tg(kdrl:HsHRAS-mCherry)s896Chi et al., 2008ZFIN: s896
Genetic reagent (Danio rerio)Tg(myl7:HRAS-EGFP)s883D’Amico et al., 2007ZFIN: s883
Genetic reagent (Danio rerio)Tg(tp1-MmHbb:EGFP)um14Parsons et al., 2009ZFIN: um14
Genetic reagent (Danio rerio)Tg(myl7:mVenus-gmnn)ncv43TgJiménez-Amilburu et al., 2016ZFIN: ncv43Tg
Genetic reagent (Danio rerio)Tg(UAS: irsp53dn-p2a-tagRFP)bns440This paperbns440See Materials and methods section
Genetic reagent (Danio rerio)TgBAC(aplnrb:VenusPEST)mr13This papermr13See Materials and methods section
Genetic reagent (Danio rerio)Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-tagBFP)This paperSee Materials and methods section
Genetic reagent (Danio rerio)Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-mScarlet)bns565This paperbns565See Materials and methods section
Genetic reagent (Danio rerio)aplnmu267 mutantHelker et al., 2015ZFIN: mu267
Genetic reagent (Danio rerio)aplnrbmu281 mutantHelker et al., 2015ZFIN: mu281
Genetic reagent (Danio rerio)aplnramu296 mutantHelker et al., 2015ZFIN: mu296
AntibodyAlexa Fluor 488 anti-Chicken IgG (H + L) (goat polyclonal)Thermo Fisher ScientificCat# A-11039(1:500)
AntibodyAlexa Fluor 568 anti-Mouse IgG (H + L) (goat polyclonal)Thermo Fisher ScientificCat# A-11004(1:500)
AntibodyAlexa Fluor 647 anti-Rabbit IgG (H + L) (goat polyclonal)Thermo Fisher ScientificCat# A-21244(1:500)
AntibodyAnti-GFP (chicken polyclonal)AvesLabCat#: GFP-1020(1:500)
AntibodyAnti-mCherry (mouse monoclonal)Takara Bio ClontechCat# 632,543(1:500)
Chemical compound, drugAgarose, low gelling temperatureSigmaA9414-25g
Chemical compound, drugEdUThermo Fisher ScientificCat# A10044(1 mM)
Chemical compound, drugErbB2 inhibitor PD168393SigmaCat# PZ0285(10 µM)
Chemical compound, drugMEK inhibitor PD0325901SigmaCat# PZ0162(1 µM)
Chemical compound, drugRO 4929097MedChemExpressCat# HY-11102(1 µM)
OtherDAPISigmaCat# D9542(1 μg/ml)
Commercial assay or kitAlexa Fluor 568 PhalloidinThermo Fisher ScientificCat# A12380(1:100)
Commercial assay or kitClick-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dyeThermo Fisher ScientificCat# C10340
Commercial assay or kitDyNAmo ColorFlash SYBR Green qPCR MixThermo Fisher ScientificCat# F416S
Commercial assay or kitIn-Fusion HD Cloning PlusTakara BioCat# 638,910
Commercial assay or kitMaxima First Strand cDNA kitThermo Fisher ScientificCat# K1641
Commercial assay or kitRNA clean and concentrator-5Zymo ResearchR1016
Software, algorithmFiji Image JSchindelin et al., 2012RRID:SCR_002285
Software, algorithmGraphPad Prism 8GraphPad SoftwareRRID:SCR_002798
Software, algorithmImaris – version 9.6.0BitplaneRRID:SCR_007370
Software, algorithmZEN Digital ImagingZeissRRID:SCR_013672

Zebrafish lines

Request a detailed protocol

All zebrafish housing and husbandry were performed under standard conditions in accordance with institutional (Max Planck Society) and national ethical and animal welfare guidelines approved by the ethics committee for animal experiments at the Regierungspräsidium Darmstadt, Germany, as well as the FELASA guidelines (Aleström et al., 2020). Embryos were staged by hpf at 28.5°C (Kimmel et al., 1995).

Transgenic lines used in the study: TgBAC(apln:EGFP)bns157 (Helker et al., 2020), TgBAC(cdh5:Gal4ff)mu101 (Bussmann et al., 2011), Tg(UAS:LIFEACT-GFP)mu271 (Helker et al., 2013), Tg(fli1a:nrg2a-p2a-tdTomato)bns199 (Rasouli and Stainier, 2017), Tg(myl7:mCherry-CAAX)bns7 (Uribe et al., 2018), Tg(myl7:BFP-CAAX)bns193 (Guerra et al., 2018), Tg(myl7:MKATE-CAAX)sd11 (Lin et al., 2012), Tg(kdrl:HsHRAS-mCherry)s896 (Chi et al., 2008), Tg(myl7:HRAS-EGFP)s883 (D’Amico et al., 2007), Tg(tp1-MmHbb:EGFP)um14 (Parsons et al., 2009), Tg(myl7:mVenus-gmnn)ncv43Tg (Jiménez-Amilburu et al., 2016), Tg(UAS:irsp53dn-p2a-tagRFP)bns440 (this study), TgBAC(aplnrb:VenusPEST)mr13 (this study), Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-tagBFP) (this study, abbreviated as Tg(myl7:ERK-KTR-Clover-p2a-H2B-tagBFP)) and Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-mScarlet)bns565 (this study, abbreviated as Tg(myl7:ERK-KTR-Clover-p2a-H2B-mScarlet)).

Mutant lines used in the study: aplnmu267 (Helker et al., 2015), aplnrbmu281 (Helker et al., 2015), aplnramu296 (Helker et al., 2015).

Generation of transgenic lines

Request a detailed protocol

To generate the Tg(UAS:irsp53dn-p2a-tagRFP) line, a dominant negative form of irsp53 (Millard et al., 2005; Meyen et al., 2015) was amplified by PCR using the primers: forward, 5’- TTCGAATTAGATCTGTCGACCGCCACCATGTCTCGCACCGACGAGGT-3’; reverse, 5’- GTAGCTCCGCTTCCACGCGTCTGTGCAAAGCCTGCCATGC-3’. The amplification was cloned into a 5xUAS-p2a vector upstream of tagRFP.

To generate the aplnrb bacterial artificial chromosome (BAC) construct, we used the BAC clone CH211-102K containing the aplnrb locus. All recombineering steps were performed as described in Bussmann and Schulte-Merker, 2011, with the modifications as described in Helker et al., 2019. The following homology arms were used to generate the targeting PCR product of the Venus-pest_Kan cassette: aplnrb_HA1_GFP_fw: GAGCACATGACAAACAACTTCTCTGTGATCACTTCAAAGATTTTCTTGAAACCATGGTGAGCAAGGGCGAGGAG and aplnrb_HA2_kanR_rev: TCGTCGAAGTAATCTGGGCTATAGTCAGCAGTCATGTTGTCCATGGCATTTTCCAGAAGTAGTGAGGAG. The Kanamycin cassette was removed with a flippase.

To generate the Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-tagBFP) and Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-mScarlet) lines, ERK-KTR-Clover was amplified from addgene plasmid #59150 using forward primer: GCAAAGCAGACAGTGAACAAGCTTGCTAGCCCACCATGAAGGGCCGAAAGCCTCGGG and reverse primer: GTTAGTAGCTCCGCTTCCGTCGACGGCGGCGGTCACGAACTCCAGCAGG. The PCR product was cloned into a Tol2 enabled vector containing p2a and H2B. Of note, no F1 adults were recovered for the Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-tagBFP) line.

All constructs were injected into AB embryos at the one-cell stage (30 pg/embryo) together with Tol2 mRNA (25 pg/embryo) to establish the line.

Live imaging of stopped hearts

Request a detailed protocol

Zebrafish embryos and larvae were mounted in 1.4% low-melt agarose containing 1.6 mg/ml tricaine, to stop the heartbeat, on glass-bottom dishes. The samples were imaged with a Zeiss LSM800 confocal microscope using a 40×/1.1 W objective or a Zeiss LSM880 confocal microscope using a 20×/1.1 W objective.

Live imaging of beating hearts

Request a detailed protocol

Zebrafish embryos were mounted in 0.8% low-melt agarose containing 0.2 mg/ml tricaine on glass-bottom dishes and kept in water containing 0.2 mg/ml tricaine through the experiment. Videos were acquired at 100 frames per second with a Hamamatsu ORCA flash 4.0 sCMOS camera and the image was binned 4 × 4 to achieve a calculated pixel resolution of 0.7 µm (40× objective).

Inhibitor treatments

Request a detailed protocol

Zebrafish embryos were treated with 1 µM Notch inhibitor RO 4929097 for 24 hr (from 24 to 48 hpf), washed twice with egg water containing 0.1% (w/v) 1-phenyl-2-thiourea (PTU) and mounted in 1.4% low-melt agarose with 1.6 mg/ml tricaine for imaging.

Zebrafish embryos were treated with 1 µM MEK inhibitor PD 0325901 or 10 µM ErbB2 inhibitor PD 168393 from 56 to 72 hpf, washed twice with egg water containing 0.1% (w/v) PTU and mounted in 1.4% low-melt agarose with 1.6 mg/ml tricaine for imaging.

EdU staining

Request a detailed protocol

Zebrafish embryos were treated with 1 mM EdU dissolved in 1% DMSO for 24 hr (from 48 to 72 hpf) or 44 hr (from 28 to 72 hpf) in egg water containing 0.1% (w/v) PTU. After treatment, embryos and larvae were washed twice with egg water containing 0.1% (w/v) PTU, anesthetized with 0.2% (w/v) tricaine for 5 min and fixed in 4% PFA at room temperature for 2 hr. The CLICK-IT reaction for EdU labeling was performed as per manufacturer’s protocol (Invitrogen). Samples were processed for immunostaining with anti-GFP, anti-mCherry, and DAPI using the procedure described below.


Request a detailed protocol

Zebrafish embryos and larvae were collected at different stages and fixed in 4% FPA at room temperature for 2 hr. Next, animals were washed with PBS/1% BSA/1%DMSO/0.5% Triton X-100 (PBDT) and blocked with PBDT/10% goat serum for 1 hr before incubating in primary antibody at 4°C overnight. Samples were washed in PBDT for 30 min × four times and incubated in secondary antibody for 2 hr at room temperature and then incubated with 1 μg/ml DAPI for 10 min and washed with PBS/0.1% Tween.

Primary antibodies used were GFP and mCherry. Phalloidin Alexa Fluor 568 was used to mark F-actin. Secondary antibodies were goat anti-chicken Alexa Fluor 488, goat anti-mouse Alexa Fluor 568, and goat anti-rabbit Alexa Fluor 647.

Image processing

Request a detailed protocol

Confocal data were processed on Imaris x64. Images were prepared using Adobe Photoshop.

Quantification and statistical analysis

Request a detailed protocol

The number of endocardial protrusions at 24 hpf was quantified from maximum intensity projections of the ventricle. The number of endocardial protrusions at 48 hpf was quantified from the mid-sagittal plane of the ventricle. The ratio of trabecular CMs was quantified as previously described (Jiménez-Amilburu et al., 2016). The number of trabeculae in the outer curvature of the ventricle was quantified from the mid-sagittal plane, and delaminating CMs were also counted as trabeculae. The number of trabecular CMs in the outer curvature of the ventricle was quantified from the mid-sagittal plane. The number of multilayered CMs in the outer curvature of the ventricle was also quantified from the mid-sagittal plane. EdU+ and Gmnn+ CMs were quantified in the entire ventricle. To quantify the volume of the CJ, the drawing tool paintbrush in Fiji was used to mark the space between the endocardium and myocardium in the outer curvature of the ventricle, followed by a 3D surface reconstruction by Imaris. Systolic and diastolic ventricular areas were measured to calculate ejection fractions. Sample sizes are indicated in each figure, one dot representing one sample. All quantifications were analyzed by the Student’s t-test (two tailed) and considered significant at p < 0.05. p-Values are indicated in the figures.

Data availability

Figure 2 - Source Data 1, Figure 4 - Source Data 1, Figure 5 - Source Data 1, Figure 6 - Source Data 1, and Supplementary File 1 contain the numerical data used to generate the figures.


    1. Sedmera D
    2. Thomas PS
    (1996) Trabeculation in the embryonic heart
    BioEssays: News and Reviews in Molecular, Cellular and Developmental Biology 18:607.

Decision letter

  1. Victoria L Bautch
    Reviewing Editor; University of North Carolina, Chapel Hill, United States
  2. Edward E Morrisey
    Senior Editor; University of Pennsylvania, United States
  3. Naoki Mochizuki
    Reviewer; National Cerebral and Cardiovascular Center Research Institute, Japan

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Apelin signaling dependent endocardial protrusions promote cardiac trabeculation in zebrafish" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Edward Morrisey as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Naoki Mochizuki (Reviewer #1).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

Note: The recommendations for the authors from reviewers are also provided in full, as several specific corrections and clarifications are requested. Here we summarize the "essential revisions" to be addressed in a revised manuscript:

1) Provide numbers/additional numbers to buttress some of the data (for example: Nrg-OE, quantitative data that protrusions form at the outer curvature of the looped heart to align with chamber specification and trabeculation).

2) Describe exactly how the graphs were assembled, especially the graphs in Figure 5E-G; they appear to have been extensively manipulated manually.

3) Define terms and stages better: distinguish multi-layering from trabeculation clearly and use the terms accordingly; clearly define the steps of trabeculation early on and then interpret the data in light of the step(s) affected.

4) Modify conclusions where data does not strongly support the conclusions, especially in terms of spatial concordance between protrusions and extruding CMs, and modify the Discussion appropriately.

5) Better description of the mutants used and their overall phenotype.

6) Better discussion of Notch which is dealt with superficially, and better discussion of differences between mouse and fish trabeculation.

Reviewer #1 (Recommendations for the authors):


The authors used the transgenic zebrafish lines to show clear images of protrusions from the EdCs and spatiotemporally analyzed them in the transgenic lines: Apln-/-. The importance of protrusions from the EdCs was confirmed by endothelial cell-specific overexpression of dominant-negative form of IRSp53. In addition, to clarify Apln-dependent signaling, the localization of Aplnrb was monitored by the TgBAC(aplnrb:VenusPEST) embryos. Erk activation that might be required for trabeculation was demonstrated in the Tg (myl7:ERK-KTR-Clover-p2a-H2B-tagBFP/mScarlet) larvae. Clear in vivo images followed by statistical analyses support the authors claims well in this paper.

Potential improvements:

1. One might feel difficulty to understand why Nrg2 overexpressed in the endocardium is not enough to activate ErbB on the myocardium and require protrusions that forms anchor points. What do protrusion do for the myocardium? This should be discussed for helping the readers, although the requirement of protrusions is obviously proved by the data. Apln released from the myocardium layer can reach the endocardial layer through cardiac jelly, suggesting that Nrg2a can also reach the myocardium. One thing that might puzzle the readers is how the protrusions modulate Nrg2/ErbB signaling by touching to cardiomyocytes.

2. Are the cardiomyocytes of outer curvature responsive to Apln? According to the data shown in Figure 2F and 2F', distribution of protrusion is dominant in the outer curvature over inner curvature (48 hpf). However, the expression of aplnrb is clearly observed in the inner curvature (Figure 3D', 72 hpf). Therefore, considering the authors' hypothesis, the presence of protrusions might vary during embryogenesis. The protrusion at 72 hpf should be counted as Figure 2F and 2F' to more convincingly demonstrate the relevance of Apln-Aplnrb signaling to protrusions.

Please reconsider the discussion (line 281-288).

3. Similar inconsistency is found in Figure 4I. The number of arrows at region i is more that region ii or region iii in Figure 4C'. This should be reanalyzed to show exact number of protrusions at 48 hpf and 72 hpf.

4. In relation to 1, how are the contacts (touchdowns) kept between protrusions and cardiomyocytes? Are cell-cell adhesion molecules involved in this attachment? How are cytonemes maintained during attachment? This might be interesting to readers because the protrusions are very interesting findings and never detached during contraction.

Reviewer #2 (Recommendations for the authors):

1. I do not think that the authors show quantitative data that protrusions form at the outer curvature of the looped heart to align with chamber specification and trabeculation. I think it would be helpful to show this.

2. Page 3. I think that the claim that endocardial protrusions can be detected in "close proximity" to trabecular CMs is not evident from the data. There is perhaps an issue here that might confuse readers – that is, how trabeculae versus multilayering is defined. I understand from previous literature that the first EMT-like events that lead to extrusion of CMs from the outer layer are considered the first step of trabeculation in the fish heart. Trabecular is more traditionally defined as the formation of CM clusters that assemble and protrude towards the lumen. How then should we distinguish between trabeculation as above and multilayering. I think this is unclear in this manuscript and the terms such as "# of trabecular CMs", "# of trabeculae" and "# of multilayered CMs", as used in the various figures, are not properly defined in the paper. Getting back to the point on page 3, the segmentation and rendering of surfaces in video 2 does not allow clear visualization of individual CMs and I do not think there is sufficient evidence that protrusions track more specifically along the side of delaminating or trabecular CMs. This would need further support.

3. Page 3 bottom: I am not sure that 54% of EdU+ CMs being in close proximity to endocardial protrusions can be interpreted in any other way than random distribution of protrusions among CMs (dividing or otherwise). Please modify.

4. Given the points made above, I am unclear by the first sentence of paragraph 2 on page 5 stating "Since we observed a correlation between endocardial protrusions and myocardial trabeculation…"

5. Page 5: experiments to overexpress Irsp53dn in endocardial cells. Experiments were performed at 48 hrs when the interaction between protrusions is complex. If possible, it would be helpful to see data at 24 hrs before endocardial:CM interactions as in Figure 1A and as for Apln mutants in Figure 4.

6. The expression of aplnrb in wholemount embryos shown in Figure 3- figure suppl 1 apparently show higher expression in specific regions at 48hrs. This seems at odds with the expression pattern shown in Figure 3 at 48 hrs. Are the wholemounts useful? Aplnra also shows focal expression in the heart region yet is claimed not to be expressed in heart. For clarity, these sites could be identified?

7. Figure 4 -suppl 1C is not particularly useful since the heart is hardly visible.

8. Page 9: analysis of Aplnrb mutants. More details are needed here about these mutants and whether the general demise of the majority mutants might relate to the cardiac phenotype in the few survivors. Might embryos be delayed, for example? What is the impact of mutation on other vascular beds and how might that impact the cardiac phenotype? Same question applies to Apln mutations and inhibitor treatments. These are global not conditional mutants.

9. The notch reporter does not seem to detect notch expression in CMs as previous reported, which plays a key role in selection of trabeculae and the range of neuregulin signaling.

10. Page 11 and Figure 5 relating to nrg2 over-expression. The phenotype seems marginal in the figure panels B, B' and this is complicated by the lack of clarity around definitions of trabeculation, multilayering etc as noted above. The statistics in Figure 5E for # of trabeculae are marginal and are driven by 3 outliers. Even if there were more multicellular trabecular protrusions, multilayering is proceeding just fine. Is multilayering in over-expressors distinct from the normal trabeculation process? Some clarity needed here. High sample numbers may be needed. Likewise, in nrg2 overexpressing apln mutants, multilayering is advanced, unlike in irsp53 over-expressors. This important section is overall rather weak and the conclusions need better justification. The text refers to Figure 5C-C' and Figure 5D-D' – there are no C', C', D' or D' panels.

11. Discussion. There appear to be key differences between mouse and zebrafish. In particular, endocardial sprouts and touchdowns in mice are cellular, whereas protrusions in zebrafish appear to akin to filopodia. Furthermore, in the early looping heart, the myocardium is multi-layered as sprouting begins. Thus on page 15 it is technically incorrect to say that "In mouse, endocardial sprouting and touchdown formation occur early during cardiac trabeculation.." if we are to consider generally that multilayering is part of trabeculation. I think it would help the reader to be aware of these differences and some considered comments made might be helpful.

12. Likewise, the complexities of notch signaling in zebrafish are relevant and not addressed. If notch function in CMs is important in selecting individual CMs for extrusion from the outer layer, how might endocardial protrusions interact with this process?

13. Schematic model: I think the idea that protrusions have a preferred interaction with extruding CMs does not have strong enough experimental support and it is premature for the figure to reflect that.

14. In graphical figures, such as those in Figure 5 E-G, the graphs appear to have been assembled manually. When blown up, the building blocks of the graph – e.g single or multiple dots – seem to be visible. There are inconsistencies in the shape of dots, the symmetrical or non-symmetrical arrangement of dots, and the thickness and texture of lines showing means and error bars. The authors should assure the reviewers and journal that these are authentic representations of the data and that the statistics have been done appropriately.


Author response

Essential revisions:

1) Provide numbers/additional numbers to buttress some of the data (for example: Nrg-OE, quantitative data that protrusions form at the outer curvature of the looped heart to align with chamber specification and trabeculation).

We thank the reviewers for these valid points.

(1.1) We analyzed more larvae and added the data to Figure 5E.

(1.2) It has been shown that cardiac trabeculation mainly occurs in the outer curvature of the ventricle in zebrafish (Liu et al., 2010; Rasouli and Stainier, 2017). Figures 2F’ and 4I (WT and apln+/+) show that endocardial protrusions are mainly located in the outer curvature of the ventricle at 48 hpf. To strengthen the conclusion that there is a spatial correlation between endocardial protrusion formation and myocardial trabeculation, we analyzed endocardial protrusions at the onset of cardiomyocyte (CM) delamination (60 hpf) as well as at 72 hpf. We found that in the ventricle, 79 % (at 60 hpf) and 83 % (at 72 hpf) of all endocardial protrusions were located in the outer curvature (Figure 1—figure supplement 1D-F). 69 % of all endocardial protrusions in the outer curvature were close to delaminating CMs at 60 hpf, and 91 % of all endocardial protrusions in the outer curvature were close to trabecular CMs at 72 hpf (Figure 1figure supplement 1D, E, and G). Moreover, 98% of delaminating CMs and 93% of trabecular CMs were in close proximity to endocardial protrusions at 60 and 72 hpf, respectively (Figure 1—figure supplement 1D, E, and H). We included these additional data in Figure 1—figure supplement 1C-H.

2) Describe exactly how the graphs were assembled, especially the graphs in Figure 5E-G; they appear to have been extensively manipulated manually.

We thank the reviewers for this valid point. The inappropriate quality of the graphs was due to the transfer of the graphs from prism to illustrator. We have now exported all graphs with high resolution and added them to the figures.

3) Define terms and stages better: distinguish multi-layering from trabeculation clearly and use the terms accordingly; clearly define the steps of trabeculation early on and then interpret the data in light of the step(s) affected.

We thank the reviewers for the helpful suggestion. Trabecular CMs form “finger-like” multicellular protrusions that bulge out from the compact myocardial layer, whereas multi-layered CMs do not form “finger-like” protrusions and stay close to the compact layer. This distinction can be seen in the data from Lai et al., 2018 (see Figure 2C in their article). We added a description of trabecular CMs and multi-layered CMs in the main text and a schematic illustration in Figure 5—figure supplement 1A and B.

4) Modify conclusions where data does not strongly support the conclusions, especially in terms of spatial concordance between protrusions and extruding CMs, and modify the Discussion appropriately.

As mentioned above, we analyzed endocardial protrusions at the onset of cardiomyocyte (CM) delamination (60 hpf) as well as at 72 hpf. We found that 69 % of all endocardial protrusions in the outer curvature were close to delaminating CMs at 60 hpf, and 91 % of all endocardial protrusions in the outer curvature were close to trabecular CMs at 72 hpf (Figure 1—figure supplement 1D, E, and G). Moreover, 98% of delaminating CMs and 93% of trabecular CMs were in close proximity to endocardial protrusions at 60 and 72 hpf, respectively (Figure 1—figure supplement 1D, E, and H).

We included these additional data in Figure 1—figure supplement 1D-H.

5) Better description of the mutants used and their overall phenotype.

We have further examined the morphology of the heart, the heart rate, and the blood circulation in apln mutants compared with their wild-type siblings, and could not detect significant differences. These new data have been included in Figure 4—figure supplement 3C and D, and Figure 4-videos 1-2.

6) Better discussion of Notch which is dealt with superficially, and better discussion of differences between mouse and fish trabeculation.

We thank the reviewers for these valid points.

(1.1) Loss of the Notch receptor in the endothelium leads to endocardial touchdown defects in mouse (Del Monte-Nieto et al., 2018). To investigate whether Notch signaling plays a similar role in zebrafish, we treated zebrafish embryos with a Notch inhibitor and observed a reduction of touchdowns (Figure 4—figure supplement 4C, D and G), in agreement with the mouse data (Del Monte-Nieto et al., 2018). Furthermore, inhibition of Notch signaling resulted in an increased number of endocardial protrusions (Figure 4—figure supplement 4E, F and H). Whether or not inhibition of Notch signaling also leads to more endocardial protrusions in mouse has not been reported, to the best of our knowledge. These new data can be found in Figure 4—figure supplement 4C-D and G.

(1.2) Endocardial sprouts were first reported by Monte-Nieto et al. in mouse (2018). Endocardial sprouts in mouse appear to be cellular (Monte-Nieto et al., 2018; Figure 1A), whereas endocardial protrusions in zebrafish appear more similar to filopodia (Figure 1), although these differences may be due to the fact that fixed tissue was used for the mouse work compared with live tissue for the zebrafish work. In mouse, the myocardium is already multi-layered before endocardial sprouting begins, whereas in zebrafish the myocardium is single-layered when endocardial protrusions appear. These differences between mouse and zebrafish have been added to the discussion.


Scott, I. C., Masri, B., D'amico, L. A., Jin, S. W., Jungblut, B., Wehman, A. M., Baier, H., Audigier, Y. and Stainier, D. Y. 2007. The g protein-coupled receptor agtrl1b regulates early development of myocardial progenitors. Dev Cell, 12, 403-13.

Zeng, X. X., Wilm, T. P., Sepich, D. S. and Solnica-Krezel, L. 2007. Apelin and its receptor control heart field formation during zebrafish gastrulation. Dev Cell, 12, 391-402.

Liu, J., Bressan, M., Hassel, D., Huisken, J., Staudt, D., Kikuchi, K., Poss, K. D., Mikawa, T. and Stainier, D. Y. 2010. A dual role for ErbB2 signaling in cardiac trabeculation. Development, 137, 3867-75.

Han, P., Bloomekatz, J., Ren, J., Zhang, R., Grinstein, J. D., Zhao, L., Burns, C. G., Burns, C. E., Anderson, R. M. and Chi, N. C. 2016. Coordinating cardiomyocyte interactions to direct ventricular chamber morphogenesis. Nature, 534, 700-4.

Rasouli, S. J. and Stainier, D. Y. R. 2017. Regulation of cardiomyocyte behavior in zebrafish trabeculation by Neuregulin 2a signaling. Nat Commun, 8, 15281.

Lai, J. K. H., Collins, M. M., Uribe, V., Jimenez-Amilburu, V., Gunther, S., Maischein, H. M. and Stainier, D. Y. R. 2018. The Hippo pathway effector Wwtr1 regulates cardiac wall maturation in zebrafish. Development, 145.

Del Monte-Nieto, G., Ramialison, M., Adam, A. A. S., Wu, B., Aharonov, A., D'uva, G., Bourke, L. M., Pitulescu, M. E., Chen, H., De La Pompa, J. L., Shou, W., Adams, R. H., Harten, S. K., Tzahor, E., Zhou, B. and Harvey, R. P. 2018. Control of cardiac jelly dynamics by NOTCH1 and NRG1 defines the building plan for trabeculation. Nature, 557, 439-445.

Helker, C. S., Eberlein, J., Wilhelm, K., Sugino, T., Malchow, J., Schuermann, A.,

Baumeister, S., Kwon, H. B., Maischein, H. M., Potente, M., Herzog, W. and Stainier, D.

Y. 2020. Apelin signaling drives vascular endothelial cells toward a pro-angiogenic state. eLife, 9.

Priya, R., Allanki, S., Gentile, A., Mansingh, S., Uribe, V., Maischein, H. M. and Stainier, D. Y. R. 2020. Tension heterogeneity directs form and fate to pattern the myocardial wall. Nature, 588, 130-134.


Article and author information

Author details

  1. Jialing Qi

    Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
    Conceptualization, Data curation, Investigation, Methodology, Project administration, Validation, Visualization, Writing – original draft
    Competing interests
    No competing interests declared
  2. Annegret Rittershaus

    Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
    Present address
    Philipps-University Marburg, Faculty of Biology, Cell Signaling and Dynamics, Marburg, Germany
    Competing interests
    No competing interests declared
  3. Rashmi Priya

    Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
    Present address
    The Francis Crick Institute, Organ Morphodynamics Laboratory, London, United Kingdom
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0510-7515
  4. Shivani Mansingh

    Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
    Present address
    Biozentrum, University of Basel, Basel, Switzerland
    Competing interests
    No competing interests declared
  5. Didier YR Stainier

    Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
    Conceptualization, Funding acquisition, Resources, Software, Supervision, Writing – review and editing
    For correspondence
    Competing interests
    Senior editor, eLife
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0382-0026
  6. Christian SM Helker

    Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany
    Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing – original draft, Writing – review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0427-5338



  • Didier YR Stainier true

Deutsche Forschungsgemeinschaft (SFB834)

  • Didier YR Stainier true
  • Christian SM Helker

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Gisela Thana Hartmann, Sarah Howard, Dr Radhan Ramadass, and all fish facility staff for their technical support; Dr Thomas Juan, Dr Samuel Capon, Dr Jordan Welker, Dr Giulia Boezio, and Yiu Chun Law for critical comments on the manuscript; Dr Stefan Baumeister for the schematic model; and Dr Gonzalo del Monte-Nieto for discussion. Research in the Stainier laboratory is supported in part by the Max Planck Society, the DFG (SFB 834/4) and the Leducq Foundation. Research in the Helker laboratory is supported in part by the DFG (SFB 834/4).


All zebrafish husbandry was performed under standard conditions in accordance with institutional (MPG) and national (German) ethical and animal welfare regulations. All experiments conducted on animals conform to the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes and were approved by the Animal Protection Committee (Tierschutzkommission) of the Regierungspräsidium Darmstadt (Proposal numbers: B2/1017, B2/1041, B2/1138, B2/1218).

Senior Editor

  1. Edward E Morrisey, University of Pennsylvania, United States

Reviewing Editor

  1. Victoria L Bautch, University of North Carolina, Chapel Hill, United States


  1. Naoki Mochizuki, National Cerebral and Cardiovascular Center Research Institute, Japan

Publication history

  1. Received: August 20, 2021
  2. Preprint posted: August 31, 2021 (view preprint)
  3. Accepted: February 25, 2022
  4. Accepted Manuscript published: February 28, 2022 (version 1)
  5. Version of Record published: March 11, 2022 (version 2)


© 2022, Qi et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 815
    Page views
  • 119
  • 0

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jialing Qi
  2. Annegret Rittershaus
  3. Rashmi Priya
  4. Shivani Mansingh
  5. Didier YR Stainier
  6. Christian SM Helker
Apelin signaling dependent endocardial protrusions promote cardiac trabeculation in zebrafish
eLife 11:e73231.

Further reading

    1. Cell Biology
    Desiree Schatton et al.
    Research Article

    Proliferating cells undergo metabolic changes in synchrony with cell cycle progression and cell division. Mitochondria provide fuel, metabolites, and ATP during different phases of the cell cycle, however it is not completely understood how mitochondrial function and the cell cycle are coordinated. CLUH is a post-transcriptional regulator of mRNAs encoding mitochondrial proteins involved in oxidative phosphorylation and several metabolic pathways. Here, we show a role of CLUH in regulating the expression of astrin, which is involved in metaphase to anaphase progression, centrosome integrity, and mTORC1 inhibition. We find that CLUH binds both the SPAG5 mRNA and its product astrin, and controls the synthesis and the stability of the full-length astrin-1 isoform. We show that CLUH interacts with astrin-1 specifically during interphase. Astrin-depleted cells show mTORC1 hyperactivation and enhanced anabolism. On the other hand, cells lacking CLUH show decreased astrin levels and increased mTORC1 signaling, but cannot sustain anaplerotic and anabolic pathways. In absence of CLUH, cells fail to grow during G1, and progress faster through the cell cycle, indicating dysregulated matching of growth, metabolism and cell cycling. Our data reveal a role of CLUH in coupling growth signaling pathways and mitochondrial metabolism with cell cycle progression.

    1. Cell Biology
    Dillon Jevon et al.
    Research Article

    A developing understanding suggests that spatial compartmentalisation in pancreatic β cells is critical in controlling insulin secretion. To investigate the mechanisms, we have developed live-cell sub-cellular imaging methods using the mouse organotypic pancreatic slice. We demonstrate that the organotypic pancreatic slice, when compared with isolated islets, preserves intact β cell structure, and enhances glucose dependent Ca2+ responses and insulin secretion. Using the slice technique, we have discovered the essential role of local activation of integrins and the downstream component, focal adhesion kinase, in regulating β cells. Integrins and focal adhesion kinase are exclusively activated at the β cell capillary interface and using in situ and in vitro models we show their activation both positions presynaptic scaffold proteins, like ELKS and liprin, and regulates glucose dependent Ca2+ responses and insulin secretion. We conclude that focal adhesion kinase orchestrates the final steps of glucose dependent insulin secretion within the restricted domain where β cells contact the islet capillaries.