DNA damage independent inhibition of NF-κB transcription by anthracyclines

  1. Angelo Ferreira Chora
  2. Dora Pedroso
  3. Eleni Kyriakou
  4. Nadja Pejanovic
  5. Henrique Colaço
  6. Raffaella Gozzelino
  7. André Barros
  8. Katharina Willmann
  9. Tiago Velho
  10. Catarina F Moita
  11. Isa Santos
  12. Pedro Pereira
  13. Silvia Carvalho
  14. Filipa Batalha Martins
  15. João A Ferreira
  16. Sérgio Fernandes de Almeida
  17. Vladimir Benes
  18. Josef Anrather
  19. Sebastian Weis
  20. Miguel P Soares
  21. Arie Geerlof
  22. Jacques Neefjes
  23. Michael Sattler
  24. Ana C Messias  Is a corresponding author
  25. Ana Neves-Costa  Is a corresponding author
  26. Luis Ferreira Moita  Is a corresponding author
  1. Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Portugal
  2. Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Portugal
  3. Institute of Structural Biology, Molecular Targets and Therapeutics Center, Helmholtz Zentrum München, Germany
  4. Bavarian NMR Centre, Department of Bioscience, School of Natural Sciences, Technical University of Munich, Germany
  5. NOVA Medical School (NMS), Portugal
  6. Centro Hospitalar Lisboa Norte - Hospital de Santa Maria, EPE, Avenida Professor Egas Moniz, Portugal
  7. Serviço de Cirurgia, Centro Hospitalar de Setúbal, Portugal
  8. EMBL Genomics Core Facilities, Germany
  9. Feil Family Brain and Mind Research Institute, Weill Cornell Medicine, United States
  10. Institute for Infectious Disease and Infection Control, Friedrich-Schiller University, Germany
  11. Department of Anesthesiology and Intensive Care Medicine, Jena University Hospital, Friedrich-Schiller University, Germany
  12. Leibniz Institute for Natural Product Research and Infection Biology, Hans Knöll Institute (HKI), Germany
  13. Inflammation Laboratory, Instituto Gulbenkian de Ciência, Portugal
  14. Department of Cell and Chemical Biology, LUMC, Netherlands
  15. Instituto de Histologia e Biologia do Desenvolvimento, Faculdade de Medicina da Universidade de Lisboa, Portugal

Abstract

Anthracyclines are among the most used and effective anticancer drugs. Their activity has been attributed to DNA double-strand breaks resulting from topoisomerase II poisoning and to eviction of histones from select sites in the genome. Here, we show that the extensively used anthracyclines Doxorubicin, Daunorubicin, and Epirubicin decrease the transcription of nuclear factor kappa B (NF-κB)-dependent gene targets, but not interferon-responsive genes in primary mouse (Mus musculus) macrophages. Using an NMR-based structural approach, we demonstrate that anthracyclines disturb the complexes formed between the NF-κB subunit RelA and its DNA-binding sites. The anthracycline variants Aclarubicin, Doxorubicinone, and the newly developed Dimethyl-doxorubicin, which share anticancer properties with the other anthracyclines but do not induce DNA damage, also suppressed inflammation, thus uncoupling DNA damage from the effects on inflammation. These findings have implications for anticancer therapy and for the development of novel anti-inflammatory drugs with limited side effects for life-threatening conditions such as sepsis.

Editor's evaluation

This is an interesting study with several implications for anti-cancer therapy, both systemic and local. This study contributes additional very important cancer cell-specific NF-κB inhibition information which is required for improving anticancer efficacy and reducing systemic toxicity. The conceptual significance is that anthracyclines prevent the induction of pro-inflammatory genes in macrophages without inducing or involving DNA damage response. Confirmation of this mechanism in vivo will help the future development of more efficacious anthracycline drugs specifically optimized for this mechanism without causing major side effects.

https://doi.org/10.7554/eLife.77443.sa0

Introduction

In innate immune cells, including macrophages, the recognition of microbial-associated molecular patterns and non-microbial molecules by specialized germline-encoded pattern recognition receptors activates the transcription of a large number of pro-inflammatory genes (Medzhitov and Horng, 2009). The nuclear factor kappa B (NF-κB) family of transcription factors, comprising p65/RelA, RelB, c-Rel, p100, and p105, plays a prominent role in regulating inflammatory gene induction while preventing cytotoxicity (Hayden and Ghosh, 2008).

The most abundant member of the NF-κB family, RelA, is retained in the cytoplasm by the inhibitor protein IκBα. In response to a variety of stimuli, IκBα phosphorylation and subsequent proteasomal degradation frees RelA for nuclear translocation and DNA binding (Chen and Greene, 2004; Ghosh and Baltimore, 1990). RelA-dependent IκBα re-synthesis is required for RelA nuclear eviction and the timely termination of NF-κB-dependent transcription (Sun et al., 1993; Beg and Baldwin, 1993). NF-κB sustained activity can perpetuate inflammation and contribute to the pathogenesis of many chronic conditions (Baldwin, 2001).

Anthracyclines, mostly Doxorubicin, have been used for many decades against a wide variety of cancers (reviewed in Hande, 1998). These anticancer drugs target topoisomerase II (TopoII), thereby inducing DNA damage, including DNA double-strand breaks (Tewey et al., 1984). The stabilization of the otherwise transient TopoII–DNA complex by anthracyclines activates DNA damage responses (DDRs) and ultimately senescence or programmed cell death by apoptosis (Nitiss, 2009; Eom et al., 2005). Other biological activities of anthracyclines with potential clinical impact include DNA intercalation, helicase inhibition, and free radical formation (Hande, 1998). More recently, anthracyclines were shown to evict histones from discrete chromosomal regions and to contribute to apoptosis in a TopoII-independent manner (Pang et al., 2013; Yang et al., 2013).

We have previously shown that anthracyclines induce disease tolerance to infection in vivo. In mouse models of sepsis, low doses of anthracyclines, such as Epirubicin, led to less severe disease and decreased mortality independently of circulating and organ pathogen load (Figueiredo et al., 2013). We further found that ATM (Ataxia Telangiectasia Mutated), a master DNA damage sensor (Maréchal and Zou, 2013), is required for Epirubicin-mediated disease tolerance (Figueiredo et al., 2013). In breast cancer cells, Epirubicin was already known to activate ATM (Millour et al., 2011). In addition to roles in DDRs, ATM participates in a complex network of signaling pathways that intersect with NF-κB (Huang et al., 2010; Piret et al., 1999; Li et al., 2001; Wu et al., 2006). One central finding in Epirubicin-treated septic animals, which we also observed in the monocytic cell line THP-1 challenged with pro-inflammatory stimuli, was the strong suppression of cytokine secretion (Figueiredo et al., 2013). The mechanism whereby anthracyclines limit cytokine production remains unstudied (Neves-Costa and Moita, 2017) but a recent report has reproduced this finding in human macrophages (Köse-Vogel et al., 2019). Here, we investigate how low doses of anthracyclines regulate the pro-inflammatory transcriptional program in primary mouse macrophages and ask whether the DNA damaging activities of anthracyclines are required for the transcriptional downregulation of cytokines and other pro-inflammatory mediators.

Results

Cytokine secretion and DNA damage

We investigated the role of DDRs in cytokine downregulation induced by anthracyclines (Figueiredo et al., 2013). We started by measuring cytokine concentrations in conditioned media in response to Epirubicin (Epi) upon activation of WT and Atm-deficient bone marrow-derived mouse macrophages (BMDMs) with pro-inflammatory stimuli. We observed that WT and Atm−/− BMDMs secreted comparable amounts of inflammatory cytokines (Figure 1—figure supplement 1A). Pre-treatment of BMDMs with Epi downregulated cytokines following E. coli challenge independently of ATM, with Epi leading to a dose-dependent decrease in TNF (Tumor Necrosis Factor), IL12, IL6, and Cxcl10 production not only in WT, but also in Atm−/− macrophages (Figure 1A). Sporadically, Atm−/− cells may show different levels of cytokine secretion relative to WT for some Epi doses, but the difference is small in magnitude (Figure 1A). We then tested cytokine secretion in the presence of the ATM inhibitor Ku-55933 and again observed that ATM is dispensable for the effect of Epi in limiting TNF and IL12 secretion (Figure 1B). Cytotoxicity due to Epi treatments was not observed at the doses used (Figure 1—figure supplement 1B).

Figure 1 with 2 supplements see all
Anthracyclines regulate cytokine secretion independently of ATM in bone marrow-derived macrophages following E. coli challenge.

(A) Cytokine secretion of TNF, IL12, IL6, and Cxcl10 was quantified by ELISA following E. coli challenge in the presence of various doses of Epirubicin (Epi) in WT and Atm/− macrophages. (B) Secretion of TNF and IL12 was quantified in macrophages treated with various doses of Epi and the ATM inhibitor KU-55933. (C) H2AX phosphorylation was quantified by ELISA in Epi-treated macrophages, normalized to total H2AX and shown as relative fluorescence intensities (RFU). (D) Schematic representation of the molecular structures of the anthracyclines Epi, Aclarubicin (Acla), Doxorubicin (Doxo), and Doxorubicinone (Doxo-none). (E) H2AX phosphorylation was quantified in the presence of Doxo, Acla, and Doxo-none. (F) TNF secretion was quantified in the presence of Doxo, Acla, and Doxo-none. (G, H) H2AX phosphorylation and TNF secretion were quantified in macrophages treated with Etoposide (Eto) and Dimethyl-doxorubicin (diMe-Doxo) following E. coli challenge. The assays show arithmetic means and standard deviations of technical replicates from one representative animal of at least three independent animals tested. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

As cytokine downregulation by Epi was independent of ATM, we hypothesized that the DDR was not required for the effects of Epi on cytokine suppression. Using the alkaline comet assay to detect strand breaks, we observed that DNA damage caused by Epi was time- and dose dependent (Figure 1—figure supplement 1C). We then quantified the DNA damage using phosphorylation of histone H2AX at Ser139 (γH2AX) as a surrogate marker. In BMDMs, DNA damage was strongly induced by Epi in the range of concentrations that modulated cytokine production (Figure 1C) and was comparable to that of Etoposide (Eto), another well-studied TopoII inhibitor that causes DNA breaks and induces ATM-mediated DDRs (Figure 1—figure supplement 1D; Caporossi et al., 1993; Banáth and Olive, 2003). γH2AX levels also showed that the inflammatory challenge did not induce significant extra DNA damage in the conditions used (Figure 1—figure supplement 1E). The lack of interdependency between DNA damage and cytokine modulation was then assessed for other anthracyclines. These drugs all share a tetracycline ring decorated with one or multiple amino sugars (Figure 1D) and their activities range from failing to induce DNA breaks to being potent inducers of double-strand breaks (Pang et al., 2013). Eto is not a member of the anthracycline class but inhibits TopoII like Doxo and Epi. We quantified the DNA damage induced by the different anthracyclines in BMDMs and observed that whereas Epi and the closely related Doxorubicin (Doxo) led to a dose-dependent increase inγH2AX signal, Aclarubicin (Acla) and Doxorubicinone (Doxo-none) did not induce significant damage (Figure 1C, E). The comet assay further established that DNA damage caused by Acla is comparable to the basal damage in untreated cells, in sharp contrast with the highly damaging effects of Epi and Eto (Figure 1—figure supplement 1F). Acla and Doxo-none were then tested for their ability to regulate cytokines. Acla was very strong at downregulating all the cytokines tested at concentrations without significant toxicity (Figure 1—figure supplement 2A–E). Whereas downregulation of TNF and IL12 was a common property of the anthracyclines tested, Doxo-none was less potent than Epi, Doxo, and Acla (Figure 1F and compare with Figure 1A). Doxo-none differs from the other anthracyclines for not inducing DNA breaks nor histone eviction (Qiao et al., 2020). To further uncouple the DDR from cytokine modulation by anthracyclines we tested whether Eto and a variant of Doxo, Dimethyl-doxorubicin (diMe-Doxo), could also downregulate cytokines. diMe-Doxo was made incapable of causing DNA damage while leaving histone eviction (Qiao et al., 2020). Figure 1G, H shows that TNF was not downregulated by Eto but was by diMe-Doxo. In line with this observation, none of the anthracyclines tested regulated cytokine production differently in Atm−/− BMDMs or in the presence of the ATM inhibitor (Figure 1—figure supplement 2F–I). Therefore, structural damage to DNA alone is unlikely to explain the observed effect of anthracyclines on cytokine secretion. Instead, the control of cytokine secretion upon inflammatory challenges is likely to be more associated with the histone eviction activity of the anthracyclines.

Anthracyclines negatively regulate the transcription of NF-κB target genes

Before dissecting the molecular mechanisms of cytokine downregulation by anthracyclines, we investigated the in vivo effects of the administration of these drugs in a model of septic shock. To this end, we co-administered Epi or Acla to mice that were challenged with E. coli. We found that the circulating levels of TNF were significantly decreased in mice treated with either Epi or Acla for 8 hr following the initial challenge (Figure 2A), suggesting physiological relevance for our findings. We then investigated the effects of anthracyclines on transcription and their dependence on DNA damage. We performed RNA sequencing (RNA-seq) in BMDMs pre-treated with either Epi or Acla and challenged thereafter with lipopolysaccharide (LPS; Figure 2—figure supplement 1A). By comparing mRNA levels of untreated with those of 4 hr LPS-treated BMDMs, we detected strong induction of pro-inflammatory gene expression, in line with the well-described patterns of transcriptional regulation in response to this TLR4 agonist (Figure 2B, lane 1). Differential expression analysis revealed 455 genes at least fivefold upregulated in LPS-treated BMDMs compared with untreated, whereas only 75 genes were downregulated to the same extent (Figure 2—figure supplement 1B). The transcriptomes also pointed to specific gene expression signatures by Epi and Acla, partly overlapping but not identical, both in unstimulated BMDMs (Figure 2B, lanes 2 and 3) and in the presence of LPS (Figure 2B, lanes 4 and 5). This could be due to different genomic location preferences between these drugs, as shown for Acla versus Daunorubicin (Dauno; Pang et al., 2015). As anticipated from the cytokine secretion results, repression of target genes by Acla was stronger than by Epi (Figure 2B, compare lanes 4 and 5). Functional enrichment analysis showed that both Epi and Acla repress cytokine production, among other effector functions of macrophages (Figure 2—source data 1). The fact that both Epi and Acla regulate inflammatory gene expression also supports a DNA damage-independent mechanism. Quantitative RT-PCR corroborated the downregulation of Tnf, Il12, Il6, and Cxcl10 by both Epi and Acla (Figure 2—figure supplement 1C), and also of a broader subset of pro-inflammatory mediators, including Nfkbia, the gene encoding the RelA inhibitor IκBα (Figure 2C). We then searched for promoter motifs in repressed genes (Chang and Nevins, 2006) and, not surprisingly, we detected an NF-κB signature shared by genes mutually downregulated by Epi and Acla. We extended the RT-PCR analysis to other TLR4-induced transcriptional programs, namely IRF-dependent interferon transcription (Kawai and Akira, 2007). IRF3-dependent Ifnb1 transcription was strongly induced by E. coli as expected, but not downregulated by Epi or Acla (Figure 2D). In agreement, IFNβ secretion was also not suppressed by the anthracyclines tested (Figure 2—figure supplement 1D). Ifna1 and Ifna4 transcription, typically mediated by virally induced receptors such as TLRs7/9, was not induced, nor was the expression of these genes further downregulated by Epi or Acla (Figure 2—figure supplement 1E). In combination, these results indicate that anthracyclines do not compromise the overall cellular transcription. Instead, the transcriptional profiles point to a negative effect of Epi and Acla specifically on NF-κB-regulated gene expression. This is compatible with previous observations that the anthracyclines Doxo and Dauno repress TNF-induced NF-κB transactivation in cancer cells (Campbell et al., 2004; Ho et al., 2005).

Figure 2 with 2 supplements see all
Anthracyclines lower circulating TNF levels in an in vivo model of sepsis and downregulate nuclear factor kappa B (NF-κB)-dependent transcription.

(A) TNF concentrations in serum 8 hr post E. coli challenge in mice treated with phosphate-buffered saline (PBS, n = 7), Epirubicin (Epi, n = 9), or Aclarubicin (Acla, n = 8). (B) RNA sequencing (RNA-seq) in macrophages stimulated with lipopolysaccharide (LPS) for 4 hr and treated with Epi or Acla. (C) Gene expression was quantified by quantitative RT-PCR in macrophages following E. coli challenge and treated with various doses of Epi and Acla; results were normalized to expression in untreated conditions (UT). (D) Gene expression of Ifnb1 was quantified as in C. (E) Analysis of Tnf mRNA stability in macrophages treated with 2 µM of Epi for 1 hr or left untreated; Actinomycin D was added 2 hr after E. coli stimulation. (F) Luciferase quantification of a κB reporter in HEK293 cells treated with 2 µM of Epi, Doxo, and Acla in the absence or presence of a vector overexpressing RelA. C–E show arithmetic means and standard deviations of technical replicates from one representative animal of at least three independent animals tested. F shows one representative experiment of two independently performed assays. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Figure 2—source data 1

Functional analysis of the RNA sequencing (RNA-seq) data.

DAVID functional analysis of the RNA-seq data in macrophages stimulated with lipopolysaccharide (LPS) for 4 hr showing representative clusters of genes downregulated by Epirubicin (Epi) and Aclarubicin (Acla).

https://cdn.elifesciences.org/articles/77443/elife-77443-fig2-data1-v2.docx

To test whether anthracyclines affect mRNA stability of pro-inflammatory genes, we treated BMDMs with actinomycin D (ActD) 2 hr after E. coli stimulation in the presence or absence of Epi and measured the rate of mRNA decay. We did not observe significant differences in the half-lives of Tnf mRNAs between non-treated and Epi-exposed BMDMs (Figure 2E). The effect of anthracyclines on NF-κB-dependent gene expression is therefore likely to be caused by changes in transcription and not due to regulation of mRNA stability.

To further address transcriptional regulation by anthracyclines, we used a κB luciferase reporter assay in HEK293 cells. We started by testing whether RelA is required for reporter induction in these cells following inflammatory stimulation and for that we decided to knock out RelA (Figure 2—figure supplement 2A, B). Not surprisingly, RelA KO compromised cell viability and therefore these cells were only used immediately after CRISPR/Cas9 editing (Figure 2—figure supplement 2C). As expected, reporter expression was induced several times in CRISPR control cells after stimulation with TNF (Figure 2—figure supplement 2D). However, the expression in RelA KO was very similar to the basal expression of the reporter without any stimulus (Figure 2—figure supplement 2D), which suggested that RelA is critical for luciferase expression. We also tested the requirement of RelA for endogenous gene expression and observed that, similar to the reporter, induction of the TNF gene is largely dependent on RelA (Figure 2—figure supplement 2E). Our observations are compatible with RelA being the main factor required for NF-κB-mediated pro-inflammatory transcription and therefore we tested whether Epi, Doxo, and Acla were able to regulate reporter expression induced by RelA overexpression. We co-transfected the reporter together with a vector expressing full-length RelA and observed considerable induction of luciferase (Figure 2F), which was markedly inhibited by the anthracyclines Epi, Doxo, and Acla (Figure 2F). From our observations, anthracyclines are expected to target RelA directly or indirectly.

Epirubicin affects NF-κB subcellular localization

NF-κB nuclear translocation is required for DNA binding and initiation of transcription (Ghosh and Baltimore, 1990). We therefore asked whether the downregulation of NF-κB targets by anthracyclines was due to impaired RelA nuclear translocation. We observed that RelA nuclear levels in untreated BMDMs rapidly increased following inflammatory challenge and RelA slowly relocated overtime, being mostly cytoplasmic 4 h after stimulation (Figure 3A, control panel). In BMDMs exposed to Epi, RelA translocated to the nucleus upon E. coli challenge, but despite decreased NF-κB-dependent gene expression, RelA remained nuclear at all time points analyzed (Figure 3A, Epi panel). Proteolytic degradation and re-synthesis of the NF-κB inhibitor IκBα are a central mechanism controlling the subcellular localization of NF-κB factors (Ghosh and Baltimore, 1990; Sun et al., 1993; Beg and Baldwin, 1993). From our mRNA analysis, we expected Epi to affect IκBα (Figure 2C), and therefore we tested the effects of Epi on IκBα protein throughout time. As extensively reported, IκBα was degraded and protein levels restored to initial values within 60 min in non-treated BMDM. In contrast, Epi pre-treatment profoundly diminished IκBα cellular levels throughout the time course (Figure 3B), as anticipated from our previous results. Reduced stimulus-induced IκBα synthesis had already been reported to promote nuclear localization of RelA, an effect not associated with increased NF-κB transcriptional activity (Hochrainer et al., 2007).

Figure 3 with 1 supplement see all
Anthracyclines affect RelA subcellular localization and compromise RelA binding to NFKBIA and TNF promoters, but not to IFNB1 promoter.

Reporter assays suggest that the RelA domain targeted by Epirubicin is the REL-homology domain (RHD). (A) RelA immunolocalization in macrophages challenged with E. coli for 4 hr and left untreated (control) or treated with 2 µM of Epirubicin (Epi); scale bar = 20 μm. (B) IκBα degradation kinetics in macrophages following E. coli challenge in the absence or presence of 2 µM of Epi for 1 hr at the time of E. coli challenge and using total RelA levels as loading control. (C) Macrophages were either left untreated (top panel) or treated with Epi (bottom panel) and challenged with E. coli for the indicated times in the presence of the proteasome inhibitor MG132 (10 μM) or its vehicle DMSO; IκBα degradation was assessed using total RelA as loading control. (D) Macrophages were challenged with lipopolysaccharide (LPS), treated with 2 µM of Epi or Aclarubicin (Acla) and an anti-RelA antibody was used to immunoprecipitate the associated chromatin, from where the promoter sequences of NFKBIA, TNF, and IFNB1 were amplified. (E) HEK293 cells were challenged with TNF, treated with 2 µM of Epi or Acla and an anti-PolII antibody was used to immunoprecipitate the associated chromatin, from where the promoter sequence of NFKBIA promoter was amplified. (F) HEK293 cells were transiently transfected with a κB-luciferase reporter alone or in conjunction with full-length RelA or RelA (2-320)-VP16 or TET-RelA (268-551) and cells were left untreated or treated with 2 µM of Epi for 16 hr. A–C show one representative experiment using macrophages from at least three independent animals tested; D and E show arithmetic means and standard deviations of technical replicates from one representative experiment of at least four independently performed assays; F shows arithmetic means and standard deviations of technical replicates from one representative experiment of two independently performed assays. *p < 0.05; **p < 0.01; ***p < 0.001.

A role for Doxo in proteasome activation has been proposed (Liu et al., 2008). To test if increased proteasome-dependent degradation by anthracyclines also contributes to low IκBα levels, we examined IκBα degradation kinetics upon inhibition of the proteasome. While blockage of proteasome activity by MG-132 increased IκBα protein levels upon de novo synthesis following E. coli challenge (Figure 3C, upper panel), IκBαin cells pre-exposed to Epi never recovered (Figure 3C, lower panel). It is therefore unlikely that IκBα regulation by Epi is due to any role for the anthracyclines in proteasomal activity. Our data suggest that anthracyclines are capable of breaking the critical negative feedback loop that maintains the cellular responsiveness to subsequent inflammatory stimuli due to their role in repressing NFKBIA mRNA expression.

Epirubicin and Aclarubicin regulate NF-κB binding to its targets

We further investigated by chromatin immunoprecipitation (ChIP) how anthracyclines suppress NF-κB-dependent pro-inflammatory programs. Firstly, we established that the effects of anthracyclines in BMDMs could be replicated in HEK293 cells without affecting cell viability (Figure 3—figure supplement 1A–C). ChIP was then performed at the promoter of selected NF-κB target genes in HEK293 cells. We observed that RelA binding following inflammatory activation was weakened by pre-treatment with Epi and Acla, ranging from a small reduction in binding to statistically significant impairments (Figure 3D, TNF and NFKBIA promoters). In contrast, binding of RelA to the IFNB1 promoter was not affected (Figure 3D, right). Recruitment of RNA PolII to promoters of NF-κB target genes, including NFKBIA, was also compromised by Epi and in a more pronounced and statistically significant way, by Acla (Figure 3E). These results are consistent with previous observations that Doxo treatment strongly reduced the association between RelA and DNA, which was proposed to be a consequence of defective post-transcriptional modifications in NF-κB subunits (Ho et al., 2005). Furthermore, Doxo is also responsible for the reduced recruitment of at least one other transcription factor, HIF-1α, to its targets (Tanaka et al., 2012).

RelA consists of a REL-homology domain (RHD) and a transactivation domain (TAD, Figure 3—figure supplement 1D). The RHD includes the DNA-binding domain (DBD), the dimerization domain (DD), and the nuclear localization sequence (NLS) (Toledano et al., 1993). We asked which RelA domain is targeted by Epi. For that, two different chimeric DNA constructs were tested: (1) RelA RHD fused to a TAD derived from the Herpes simplex virus VP16 protein (RelA (2-320)-VP16); and (2) DBD from the bacterial tetracycline repressor (TET) fused to the RelA TAD (TET-RelA (286-551)) (Anrather et al., 1999). As observed for full-length RelA (Figure 2F), Epi significantly inhibited the transcriptional activity of RelA (2-320)-VP16, as quantified in HEK293 cells transiently co-transfected with the κB luciferase reporter (Figure 3F). However, Epi failed to inhibit the transcriptional activity of both TET-RelA (286-551) and TET fused to VP16 (TET-VP16) construct, as observed using a tetracycline operon luciferase (tet°-luc) reporter (Figure 3F). These results suggest that Epi compromises RelA transcriptional activity by targeting the RHD. Since Epi does not affect the TAD, this result points to a mechanism of action different from NF-κB regulation by Doxo and Dauno in cancer cells (Campbell et al., 2004).

Epirubicin and Aclarubicin bind to a κB-33 promoter sequence

To understand how anthracyclines affect binding of NF-κB to its targets, we used NMR and biophysical experiments. We tested a 14-mer DNA sequence (5′-CTGGAAATTTCCAG-3′) derived from the NF-κB-33 promoter (Chen et al., 2000; Chen et al., 1998). As expected, we detected binding of Epi and Acla to the DNA duplex by NMR spectroscopy, with dramatic changes in the imino region of the DNA after the addition of the drugs (Figure 4A, B [black and red spectra], region 11–14 ppm) suggesting that the anthracyclines disturb the Watson–Crick hydrogen bonds in the double helix. Using isothermal titration calorimetry (ITC), we determined that two molecules of Epi or Acla bind to the DNA duplex with equilibrium dissociation constants (KD) of 11.4 and 11.7 μM, respectively (Table 1 and Figure 4—figure supplement 1A, B), indicating that Acla and Epi bind to the κB-33-derived DNA sequence with similar affinity. The affinity of Acla to different DNA molecules has been reported to be in the low nM to low µM range (Furusawa et al., 2016; Skovsgaard, 1987; Utsuno and Tsuboi, 1997), while Doxo, which differs from Epi in the stereochemistry of the 4′-OH group, binds to DNA in the nM range (Katenkamp et al., 1983). Most of the anthracyclines have a preference for GC- or TG-rich sequences, with the aglycon chromophore of the anthracyclines intercalating at a pyrimidine–purine step, and the sugar part interacting with the DNA minor groove (Chaires, 2015; Frederick et al., 1990; Temperini et al., 2003). The NF-κB-33 DNA oligonucleotide used in our assays contained two 5′-TG-3′ motifs suggesting that two molecules of anthracyclines can bind to it. When we used size-exclusion chromatography (SEC) coupled with static light scattering (SLS) of RelA incubated with DNA and excess anthracyclines, an increase in the molecular weight (MW) of the DNA was observed, further pointing to binding of anthracyclines to DNA. However, due to their small MW, it was difficult to establish an accurate stoichiometry, and ITC proved to be more reliable, as discussed above (Figure 4—figure supplement 2 and Figure 4—source data 1).

Figure 4 with 3 supplements see all
Characterization of the binding of anthracyclines to NF-κB-33 promoter DNA sequence and their effect on RelA–DNA complex as assessed by following the DNA imino protons by NMR.

1D 1H spectrum (top) and zoom of the cross peaks of the imino protons with the deoxyribose in a 2D 1H, 1H-NOESY (bottom) of a 100 μΜ 14-mer duplex DNA solution and subsequent addition of (A) 500 μΜ Epirubicin (Epi, red) and 50 μΜ 2H, 15N-RelA19-291 dimer (blue), (B) 500 μΜ Aclarubicin (Acla, red) and 50 μΜ 2H, 15N-RelA19-291 dimer (blue), (C) 50 μΜ 2H, 15N-RelA19-291 dimer (red) and 500 μΜ Epi (blue), and (D) 2H, 15N-RelA19-291 dimer (red) and 500 μΜ Acla (blue). Experiments were recorded at 800 MHz and 10°C in 100 mM d11-Tris–HCl pH 7.5, 75 mM NaCl, 5 mM d10-DTT, and 10% D2O.

Figure 4—source data 1

Molecular weight values of RelA19-291, κB-33 DNA, κB-33 DNA + Epirubicin (Epi), and κB-33 DNA + Aclarubicin (Acla) using SEC in combination with static light scattering (SLS).

https://cdn.elifesciences.org/articles/77443/elife-77443-fig4-data1-v2.docx
Table 1
Summary of the data obtained by isothermal titration calorimetry (ITC).

The ligand (or titrant) was titrated to the analyte (or titrand) in the cell, for example Epi to DNA. The measured thermodynamic properties were: KD, dissociation constant; N, stoichiometry of the titrant; ΔH, enthalpy change; and ΔS, entropy change. T is the measurement temperature.

KD (μM)NΔH (kJ/mol)TΔS (kJ/mol)
Epi to DNA11.3 ± 4.61.83 ± 0.14−14.1 ± 2.2−14.2
Acla to DNA11.7 ± 2.02.13 ± 0.07−38.4 ± 2.010.3
DNA to RelA0.23 ± 0.030.90 ± 0.0140.7 ± 0.9−78.6
(DNA + Epi) to RelA1.9 ± 0.170.88 ± 0.0459.4 ± 3.0−92.1
DNA to (RelA + Epi)0.98 ± 0.120.81 ± 0.01−305 ± 9271
DNA to (RelA + Acla)0.74 ± 0.320.91 ± 0.07−335 ± 40300
Epi to RelAND. Too weak.
Acla to RelAND. Too weak.

RelA RHD binds tightly to NF-κB-33

The crystal structure of RelA RHD in complex with a 18-mer DNA segment derived from the κB-33 promoter revealed that the double-stranded DNA mainly contacts the interface between the DD and the DBD, with one of the protein monomers recognizing the 5′-GGAA-3′ site, and the other the 5′-GAAA-3′ site (Figure 4—figure supplement 3A; Chen et al., 1998). Using NMR spectroscopy, we confirmed binding of the 14-mer DNA to RelA RHD containing the DD and DBD domains (residues 19–291, Figure 4C, D [black and red spectra], Figure 4—figure supplement 3B). As expected, the DNA thymine and guanine iminos remained detectable upon RelA addition but underwent line broadening consistent with the DNA maintaining its double helix structure upon protein binding (Figure 4C, D [black and red spectra]); at the same time, addition of DNA to RelA caused chemical shift perturbations and line broadening of backbone amides on the DNA-binding site (Figure 4—figure supplement 3B). In addition, titration of DNA to RelA by ITC revealed strong binding, with an affinity of 230 nM (Table 1 and Figure 4—figure supplement 1C). This value is very similar to the reported value of 256 nM obtained with a murine RHD construct and a 18-mer DNA using fluorescence polarization (Chen et al., 2000). Notably, the DNA–protein interaction is endothermic, that is enthalpically unfavorable and thus entropy driven. By combining SEC and SLS experiments, we confirmed that both the protein and the DNA form dimers (Figure 4—figure supplement 2A, B and Figure 4—source data 1) but protein–DNA complexes were not observed, possibly due to a very fast off-rate (Bergqvist et al., 2009).

Epirubicin and Aclarubicin disturb RelA-κB-33 binding

We then studied the effect of Epi and Acla on RelA–DNA binding by NMR, by following the effect either on the DNA or on the protein. Binding of RelA to the DNA did not substantially affect the DNA double helix as judged by DNA imino protons in thymine and guanine bases, as their intensity and chemical shifts were not substantially changed (Figure 4C, D; black and red spectra). However, subsequent addition of anthracyclines clearly altered the Watson–Crick base-paring even when bound to RelA (Figure 4C, D; blue spectra). In contrast, titration of DNA with anthracyclines caused severe line broadening of the DNA base imino groups, which was maintained upon RelA addition (Figure 4A, B). As the anthracyclines are expected to bind to the TG base pairs in the κB sequence located at the ends of the double helix (Figure 5A), the DNA helix, though distorted, is still able to bind to RelA.

Figure 5 with 5 supplements see all
The RelA REL-homology domains (RHDs) of Epi and Acla are shown in a complex with the κB-33 promoter.

Epirubicin (Epi) and Aclarubicin (Acla) are capable of disturbing RelA–DNA binding as assessed by NMR chemical shift changes. (A) Crystal structure of RelA RHD, containing the DNA-binding domain (DBD) and the dimerization domain (DD), in complex with κB-33 promoter DNA target (PDB code 1RAM). The RelA DBD and DD are represented as cartoon in cyan and yellow, respectively, whereas the DNA in olive green and pink. DNA highlighted in pink corresponds to the two half sites recognized by each RelA monomer. DNA-binding residues are depicted in red, whereas the amino acid residues that shift after addition of Epi (A, left) and Acla (A, right) are depicted in blue. (B) Superposition of 2D 1H,15N NMR correlation spectra of 100 μΜ 2H, 15N-RelA19-291-free dimer (black), and in the presence of 100 μΜ κB-33 14-mer DNA duplex (red) and upon additional presence of 500 μΜ Epi (green, left) or 500 μΜ Acla (green, right). All spectra were recorded at 800 MHz, 20°C, 16 scans.

Protein-based titration experiments to determine how RelA binding to DNA is affected by anthracyclines were performed in two ways: (1) RelA was first titrated with DNA and then with anthracyclines and (2) RelA was initially titrated with anthracyclines and then with DNA. Addition of anthracyclines to RelA titrated with DNA caused chemical shift perturbations and line-broadening beyond detection of some backbone resonances consistent with Epi and Acla perturbing the RelA–DNA complex but not disrupting it (Figure 5B, compare green and red spectra) as the final spectra (green) do not resemble the free RelA spectrum (black). The RelA residues affected by the addition of the anthracyclines largely coincide with the DNA-binding region. Amino acid residues in RelA–DNA complex particularly affected by Epi were 50R, 56K, 62K, 78T, 79K, 88H, 89E, 119Q, 129A, and 157V in the DBD and 192A, 245H, 250I, and 268V in the DD (Figure 5A, left). Addition of Acla to RelA–DNA complexes caused precipitation of the protein, which made measurements difficult. Yet, residues 88H, 119Q, 129A, and 186N in the DBD and 245H in the DD could be analyzed and were altered (Figure 5A, right). Furthermore, addition of Epi to the RelA–DNA complex caused NMR chemical shift changes for some backbone amide signals in RelA (268V, 250I, and 50R) toward an unbound state (Figure 5B, left zoom-in), an effect that was not observed upon Acla addition (Figure 5B, right zoom-in). Because the final spectra are not identical (compare green spectra in Figure 5B), Epi and Acla are expected to have different effects on the RelA–DNA complex. Differences in binding likely reflect the distinct chemical moieties involved, particularly because Acla contains three sugar rings while Epi contains one. In fact, studies showed that the sugar moieties of the anthracyclines bind to the minor groove of the DNA (Temperini et al., 2003; Chaires, 2015; Frederick et al., 1990). This may be compatible with the 3D structure of RelA-κB-33 (PDB code 1RAM, Figure 5A, Figure 4—figure supplement 3A), with the TG sequences at the end of the DNA duplex and with the accessible minor groove being able to accommodate the anthracycline sugars and in close vicinity of DD. Indeed, our results suggest that Epi and Acla bind to RelA through their sugar parts (Figure 5—figure supplement 1). Notably, addition of Epi to RelA followed by addition of DNA led to different spectra (Figure 5—figure supplement 2A, compare red and green spectra), suggesting that the final complexes are slightly different. In the case of Acla spectra (Figure 5—figure supplement 2B, compare red and green spectra), the interpretation is compromised because addition of Acla to RelA leads to protein precipitation, and the final spectrum obtained after DNA addition (green) is therefore much weaker than its counterpart (red).

To further explore how anthracyclines affect the RelA–DNA complex we performed ITC competition experiments. The binding affinities of DNA to a pre-formed complex of RelA with Epi (980 nM) or Acla (740 nM) were weaker than the binding affinities of the DNA to the protein alone (230 nM) (Table 1). Moreover, the thermodynamic features of the interaction were different: binding of DNA to RelA is entropy driven and endothermic (positive ΔH), while binding of DNA to RelA incubated with anthracyclines is enthalpy driven and exothermic (negative ΔH). Surprisingly, when DNA with a twofold excess of Epi was titrated to the protein, the binding affinity decreased dramatically from a KD of 230 to 1900 nM but the reaction is similarly endothermic (Table 1). This suggests that when the anthracyclines–DNA complex is formed, binding to RelA is mainly affected.

We also tested a potential direct binding between anthracyclines and RelA. We did not observe any binding by ITC, likely because this method is not suitable for very weak interactions (Table 1). We did not observe significant RelA backbone amide changes after the addition of anthracyclines in 2D-TROSY NMR protein spectra, indicating that Epi and Acla bind very weakly to the protein (Figure 5—figure supplement 3). Binding to RelA, though weak, is mediated through the sugar part of the anthracyclines, as observed in saturation transfer difference (STD) experiments (Figure 5—figure supplement 1A, B). In agreement, Doxo-none, which lacks the sugar moiety, did not bind to RelA (Figure 5—figure supplement 1C).

Discussion

We have studied the effect of anthracyclines on NF-κB controlled inflammatory responses. At very low concentrations, this anticancer family of drugs suppressed the production of pro-inflammatory signals in mouse macrophages. Using biophysical methods and NMR we found that anthracyclines directly inhibit the binding of the NF-κB family member RelA to the DNA in a manner that contributes to the resolution of inflammation. Taking advantage of a series of dedicated anthracycline variants with defined activities, we dissociated the DNA damaging from the histone eviction activities, therefore uncoupling the anti-inflammatory effect from the classical DDR.

Despite the general notion that anthracyclines induce NF-κB-dependent anti-apoptotic gene expression when used as chemotherapeutic drugs (Wang et al., 1996; Arlt et al., 2001; Janssens et al., 2005; Van Antwerp et al., 1996; Wu et al., 1996), Doxo and Dauno have also been described as repressors of NF-κB activity (Campbell et al., 2004; Ho et al., 2005). The outcomes of anthracycline treatments are likely dependent on cell- and tumor type. Using transcriptomics in macrophages, we found that only a very small proportion of inflammation-driven genes were upregulated by either Epi or Acla while none of the anti-apoptotic factors tested, including cellular inhibitor of apoptosis proteins (cIAPs), were affected. Instead, we detected downregulation of a broad range of NF-κB-induced genes in Epi- or Acla-treated macrophages. Even if the affinity of the binding to κB sites is not directly linked to transcriptional activity (Mulero et al., 2017) our results showed that Epi- and Acla treatments reduced the binding of RelA and of PolII to κB sites upon pro-inflammatory stimulation, which implies a novel role for the anthracyclines in counteracting NF-κB activity.

Because Epi is protective in sepsis through ATM-mediated signaling (Figueiredo et al., 2013), and due to the genotoxicity of this class of drugs, we asked whether cytokine regulation by anthracyclines depended on the induction of DDRs. We observed that pro-inflammatory gene expression orchestrated by NF-κB was still downregulated by Acla, Doxo-none, and the newly developed diMe-Doxo, a group of anthracyclines that do not cause DNA damage in the concentrations used. Furthermore, cytokine suppression by anthracyclines was observed when we used an ATM inhibitor and Atm−/− BMDMs, indicating independence from the DDR. Finally, other DNA damaging drugs such as Eto did not modulate cytokine production. Together, these observations suggested that regulation of NF-κB-dependent transcription by anthracyclines does not rely on the induction of DNA damage. Whereas anthracyclines are believed to work in cancer because of the induction of DNA double-strand breaks, anthracyclines that lack DNA damaging activity, such as Acla, are also effective in the treatment of acute myeloid leukemia (Qiao et al., 2020). Clearly, other activities, such as chromatin damage caused by histone eviction, contribute to the anti-tumor role of the anthracyclines (Pang et al., 2013; Yang et al., 2013). It is likely that regulation of NF-κB also proves to be important for the therapeutic efficacy of these drugs.

But can we understand how anthracyclines control NF-κB? Both Epi and Acla interacted with DNA bases within the κB motif, probably intercalating between the TG bases, which disturbed the complexes between RelA and its DNA-binding sites (models of these interactions are depicted in Figure 5—figure supplement 4 and Figure 5—figure supplement 5). The anthracyclines sugars also interact weakly with RelA, promoting the formation of a ternary complex between anthracyclines, DNA and RelA. The RelA residues targeted by Epi and Acla localized within the RHD, which corroborated the reporter assays. Whereas Epi and Acla perturbed the binding of RelA to DNA differently, the structural results did not explain why Acla is the strongest regulator of NF-κB-dependent transcription. The extra sugars in Acla may be responsible for the stronger interactions but it will be important to do a careful dissection of the structural features contributing to the efficient Acla-mediated NF-κB transcriptional suppression. Not surprisingly, Doxo-none – that lacks the sugar moiety – did not bind to RelA and was a weaker modulator of TNF transcription when compared with Epi, Doxo, and Acla. However, diMe-Doxo, with a sugar moiety that resembles both Epi (contains only one sugar) and Acla (the amine group is dimethylated), was also weaker than the classical anthracyclines at regulating the genes tested. We are currently investigating its RelA and DNA-binding properties to uncover potential new rules affecting complex formation. In cells, the engagement of RelA and other NF-κB factors with κB sites is highly dynamic and regulated by chromatin organization and other nuclear factors (Mulero et al., 2017). It will also be important to explore promoter-specific effects.

To conclude, we showed that the control of inflammatory responses by anthracyclines does not require their DNA damage effects. The novel role in NF-κB suppression, although with different efficacies, is common to all anthracyclines tested independently of DNA damage capabilities. We thus uncovered a new mechanism of action for the anthracycline class of anti-cancer drugs that can inform applications in situations of uncontrolled inflammatory responses, such as sepsis. Limiting pro-inflammatory gene expression through NF-κB modulation may have been an overlooked aspect of Epi, Doxo, and Acla with a fundamental role in the clinical success of these drugs. Future therapeutic strategies are expected to focus on anthracyclines without DNA damaging activities, in an attempt to overcome the severe side effects of these drugs. Indeed, diMe-Doxo and Acla, both lacking DNA damage activity, are not cardiotoxic and do not induce second tumors (Qiao et al., 2020). These could therefore be more suitable for controlling sepsis and other inflammatory responses. Importantly, low doses seem to be sufficient to prompt this regulatory effect.

Methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (male Mus musculus)C57BL/6JInstituto Gulbenkian de CiênciaJAX:000664
Strain, strain background (male Mus musculus, background C57BL/6J)Atm−/−Borghesani et al., 2000 doi:10.1073/pnas.97.7.3336From Frederick W. Alt (Harvard Medical School, Boston, MA, USA)
Cell line (Homo sapiens)HEK293ATCCCRL-1573
Cell line (Homo sapiens)THP-1TCCTIB-202
AntibodyAnti-RelA (rabbit polyclonal)Santa Cruzsc-3721:2000
AntibodyAnti-RNAPolII
(mouse monoclonal)
Santa Cruzsc-177981:1000
AntibodyAnti-IκBα (rabbit polyclonal)Santa Cruzsc-3711:2000
AntibodyAnti-β-actin (mouse monoclonal)Santa Cruzsc-586731:4000
Peptide, recombinant proteinLipopolysaccharide (LPS) from E. coli 055:B5Santa Cruzsc-221855B
Peptide, recombinant proteinHuman TNF-alphaPeprotech300-01A
Commercial assay or kitAlamarBlue Cell Viability ReagentInvitrogenDAL1100
Commercial assay or kitRNeasy Mini KitQiagen50974106
Commercial assay or kitTaq Universal SYBR Green SupermixBio-Rad1725125
Commercial assay or kitSuperscript IIInvitrogen18064014
Commercial assay or kitLipofectamine 3000 Transfection ReagentInvitrogenL3000-001
Commercial assay or kitLuciferase Assay SystemPromegaPROME1500
Commercial assay or kitMouse TNF-α ELISA MAX StandardBioLegend430902
Commercial assay or kitMouse IL-6 ELISA MAX StandardBioLegend431302
Commercial assay or kitMouse IL-12(p40) ELISA MAX StandardBioLegend431602
Commercial assay or kitLEGEND MAX Mouse IFN-β ELISA KitBioLegend439407
Commercial assay or kitMouse CXCL10 DuoSet ELISAR&D SystemsDY466
Commercial assay or kitHuman/Mouse/Rat Phospho-Histone H2AXR&D SystemsKCB2288
Commercial assay or kitCometAssay Kit 25 × 2 well slidesTrevigen4250-050K
Chemical compound, drugEpirubicinTarget Mol282T0125
Chemical compound, drugAclarubicinFOCUS Biomolecules21910-1099
Chemical compound, drugDoxorubicinFOCUS Biomolecules21910-2130
Chemical compound, drugEtoposideSigma-AldrichE1383
Chemical compound, drugDMSOSigma-AldrichD2650
Chemical compound, drugKU-55933Sigma-AldrichSML1109
Chemical compound, drugMG-132Sigma-AldrichM7449
Chemical compound, drugActinomycin DSigma-AldrichA9415
Chemical compound, drugD-(+)-Glucose solutionSigma-AldrichG8769
Chemical compound, drugcOmplete, EDTA-freeRoche11873580001
Chemical compound, drugDL-Dithiothreitol-d10CortecnetCD4035P1
Chemical compound, drugDimethylsulfoxide D6EurisotopD010
Chemical compound, drugTris-D11CortecnetCD4035P1
OtherNi-NTA AgaroseQiagen30210Purification resin
OtherHiLoad 16/600 SuperdexMerckGE28-9893-33Purification resin
OtherSuperdex 200 10/300 GLMerckGE17-5175-01Purification resin
OtherRPMI 1640 Medium, no glutamineLife Technologies31870-025Component of cell culture media
OtherDMEM, high glucose, pyruvateLife Technologies41966-052Component of cell culture media
OtherFetal bovine serum (FBS)Life Technologies10500-064Component of cell culture media
OtherPenicillin–streptomycinLife Technologies15140-122Component of cell culture media
OtherSodium pyruvateLife Technologies11360-039Component of cell culture media
OtherL-GlutamineLife Technologies25030-024Component of cell culture media
OtherNon-essential aminoacids solutionLife Technologies11140-035Component of cell culture media
OtherHEPES bufferLife Technologies15630-056Component of cell culture media
Other2-MercaptoethanolLife Technologies31350-010Component of cell culture media

Resources availability

Information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contacts.

Mice

All animal studies were performed in accordance with Portuguese regulations and approved by the Instituto Gulbenkian de Ciência ethics committee and DGAV. Atm−/− (Borghesani et al., 2000) and C57BL/6J control mice (JAX:000664, bred at IGC) were bred and maintained under specific pathogen-free conditions at the Instituto Gulbenkian de Ciência with 12 hr light/12 hr dark cycle, humidity 50–60%, ambient temperature 22 ± 2°C and food and water ad libitum. Male mice of 8–12 weeks old were used in the experiments and, following sample size calculation, age-matched mice were randomly assigned to experimental groups.

Primary cell cultures

For the generation of bone marrow-derived macrophages, total bone marrow cells were flushed from femurs and tibiae, counted and seeded (3 × 106 cells/ml) in RPMI 1640 supplemented with 10% (vol/vol) fetal bovine serum (FBS), 0.2% (vol/vol) penicillin–streptomycin, 1% (vol/vol) sodium pyruvate, 1% (vol/vol) L-glutamine, 1% (vol/vol) non-essential aminoacids, 1% (vol/vol) HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid) buffer and 0.05 mM of 2-Mercaptoethanol (all Gibco, Life Technologies) supplemented with 30% conditioned medium from mouse macrophage colony-stimulating factor-producing L929 cells. On day 7, adherent BMDM cells were collected, counted, reseeded in 96-well plates (5 × 104/well) and treated and/or challenged as indicated. HEK293 cells were obtained from ATCC and cultured in DMEM (Dulbecco's Modified Eagle Medium) supplemented with 10% (vol/vol) FBS and 1% (vol/vol) penicillin–streptomycin (all Gibco, Life Technologies). Cells were cultured in a humidified atmosphere containing 5% CO2.

Main reagents

Epirubicin, Aclarubicin, Doxorubicin, Daunorubicin, Doxorubicinone, and Dimethyl-doxorubicin were dissolved in phosphate-buffered saline (PBS) at 1 mg/ml, stored at −80°C and used at the indicated final concentrations. Anthracyclines were from various commercial sources except for Dimethyl-doxorubicin, a gift from Jacques Nefjees. Etoposide (Sigma-Aldrich) was dissolved in DMSO and used at indicated final concentrations. MG-132 (Sigma-Aldrich) was dissolved in DMSO and used at a final concentration of 10 µM. ATM inhibitor KU-55933 (Sigma-Aldrich) was dissolved in DMSO and used at a final concentration of 5 µM. Human recombinant TNF (PeproTech) was dissolved in RPMI and used at a final concentration of 10 ng/ml for the indicated times. Actinomycin D (ActD, Sigma-Aldrich) was dissolved in DMSO and used at a final concentration of 5 μg/ml for the indicated times. LPS (from E. coli 055:B5, Santa Cruz) was dissolved in RPMI and used at a final concentration of 100 ng/ml. PFA (Paraformaldehyde)-fixed E. coli were prepared as before (Moura-Alves et al., 2011) in house and added to the medium at a ratio of 20 bacteria per cell. AlamarBlue cell viability assay (Invitrogen) was used to determine cell viability according to the manufacturer’s instructions.

E. coli-induced sepsis model

This model has been described in detail before (Colaço et al., 2021). Briefly, a starter culture from a single E. coli colony was grown overnight at 37°C with agitation in Luria-Bertani broth (LB). The following morning, the culture was diluted 1:50 in LB and incubated for 2.5 hr until late exponential phase was reached (OD600 nm = 0.8–1.0). The culture was then centrifuged at 4400 × g for 5 min at room temperature, washed and resuspended in PBS to OD600 nm = 4.5–5.0, corresponding to 1–2 × 109 CFU/ml. This bacterial suspension was immediately injected intraperitoneally (200 μl/mouse) in mice using a 27G-needle, always in the morning. Epirubicin or Aclarubicin were dissolved in PBS and injected intraperitoneally (200 μl/mouse) at 0.5 and 0.73 μg/g body weight, respectively, at the time of infection. Mice were sacrificed at 8 hr by CO2 inhalation and blood was collected by cardiac puncture. Serum was collected after centrifuging the blood at 1600 × g for 5 min.

Cytokine production measurement

Mouse sera and cell culture supernatants were collected at indicated time points and TNF, Cxcl10, IL6, IL-12p40, and IFNβ production quantified using ELISA kits (BioLegend and R&D Systems) according to the manufacturer’s instructions. qRT-PCR.

Total RNA was isolated from BMDM using the RNeasy Mini Kit (Qiagen) and reverse transcribed with Superscript II reverse transcriptase (Invitrogen) using oligo(dT)12–18 primers. Specific RNA specimens were quantified by PCR reaction using SYBRgreen Supermix (Bio-Rad) on the QuantStudio7 Flex real-time PCR system (Applied Biosystems). Cycling parameters were as follows: 95°C for 10 min, followed by 40 cycles of PCR reactions at 95°C for 30 s and 60°C for 1 min. The relative expression levels of the genes assayed were calculated using the comparative cycle threshold Ct (ΔΔCt) method. Initially, the Ct value of each gene was normalized to the corresponding Ct value of Gapdh for the same sample to obtain the relative threshold cycle (ΔCt). The ΔCts were then transformed into relative expression by calculating 2−ΔCt. Each sample was then normalized to the average of the control sample for the same gene (ΔΔCt). The ΔΔCt of the samples assayed was expressed as relative fold change. Primer sequences can be found in Appendix 1.

RNA-seq and data analysis

Total RNA was extracted as described above and quality was assessed using the AATI Fragment Analyzer. Samples with RNA Quality Number (RQN) >8 and clearly defined 28S and 18S peaks were further used for preparation of mRNA libraries, which were pooled and sequenced (75 bp, single end) using NextSeq500. The quality of the sequences was assessed using FASTQC and MultiQC before the alignment (Ewels et al., 2016). Sequences were aligned against the Mus musculus genome version 89, with the annotation file for the genome version 89, both from Ensembl. The alignment was done with STAR (Dobin et al., 2013), using the default parameters and including the GeneCounts option. The files from GeneCounts were imported to R (version 3.5.1), taking into account the strandness associated with the sequencing protocol. DESeq2 (version 1.22.1) (Love et al., 2014) was used for the downstream analysis. Heatmaps were created with data normalized from raw counts through Regularized Log Transformation (rlog) (Love et al., 2014). The log2FC was shrunk using the ‘ashr’ (Adaptive SHrinkage) package (Stephens, 2017) and genes were considered differentially expressed when the p value was below 0.05 after adjusting using false discovery rate. Gene Information was obtained from org.Mm.eg.db. Functional clustering was performed using the DAVID Gene Functional Classification Tool (https://david.ncifcrf.gov). The RNA-seq datasets and scripts generated during this study are available on GitHub: https://github.com/andrebolerbarros/Chora_etal_2022/, (copy archived at swh:1:rev:d86a4302612c313875b919e3897bec15310b6895; Barros, 2022).

KO studies

We performed CRISPR/Cas9-mediated KOs of the NF-κB subunit RelA in HEK293 cells (ATCC catalog number CRL-1573; cells were regularly tested for mycoplasma with a PCR-based detection assay). We used commercially available double nickase plasmids from Santa Cruz: RelA nickase plamid sc-400004-NIC-2; and scrambled control RNA sequence sc-437281. The double nickase plasmids consist of a pair of plasmids each encoding a D10A mutated Cas9 nuclease and a target-specific 20 nt guide RNA (gRNA). Plasmid transfection was performed as described below using the amounts of DNA specified by Santa Cruz. The resulting population was tested (at week 1 of KO) for RelA protein expression and RNA levels. The primary antibody used for WB detection was anti RelA antibody sc-372 (Santa Cruz) at 1:2000 dilution (the same antibody used in immunofluorescence below). The primers used in qRT-PCR were: for RELA, forward primer ATGTGGAGATCATTGAGCAGC and reverse primer CCTGGTCCTGTGTAGCCATT; for GAPDH, forward primer GAGTCAACGGATTTGGTCGT and reverse primer TTGATTTTGGAGGGATCTCG; and for TNF, forward primer CCGAGTGACAAGCCTGTAGC and reverse primer GAGGACCTGGGAGTAGATGAG.

Antibodies used in western blot and immunofluorescence

The following antibodies were used for the specific detection of: IκBα, polyclonal sc-371, Santa Cruz, used at dilution 1:500 in WB; RelA, polyclonal sc-372, Santa Cruz, used at dilution 1:100 (IF); and β-actin monoclonal (2Q1055) sc-58673, Santa Cruz, used at dilution 1:500 (WB). Primary antibodies were detected using HRP-conjugated secondary antibodies (Cell Signaling).

Transient transfection and reporter assay

N-terminal Myc-tagged RelA, RelA (2-320)/VP16, TET/RelA (268-551), and TET/VP16 expression vectors, the NF-κB firefly luciferase reporter construct, and the tetracycline operon (tet°) firefly luciferase reporter (tet°-luc), were previously described (Anrather et al., 1999). The κB sequences in the κB-luciferase reporter are: 5′-TGCTGGGAAACTTTC-3′ and 5′-TGCTGGGAATTCCTC-3′, closely matching the originally described consensus motif GGGRNYYYCC (in which R is a purine, Y is a pyrimidine, and N is any nucleotide, Chen et al., 1998). The promoter sequences in this vector are from a porcine adhesion molecule (E-selectin or ELAM1, expressed on the surface of activated endothelial cells). In addition to the two RelA consensus-like sequences, there is a third sequence believed to work as an enhancer. The pSV-β-galactosidase reporter consists of the lacZ gene from E. coli under the control of the SV40 early promoter and enhancer. Transient transfections using HEK293 cells (same cells as described above) were performed with the lipofectamine 3000 transfection reagent (Invitrogen). Twenty-four hours after transfection, cells were either pre-exposed to Epirubicin for 1 hr prior to TNF stimulation or treated with Epirubicin for 16 hr in the RelA overexpression assays. After incubation, cells were lysed and firefly luciferase and β-galactosidase activity were measured using the Luciferase Assay System (Promega) and Galacto-Ligh System (Invitrogen), respectively, following the manufacturer’s instructions.

Chromatin immunoprecipitation

ChIP was performed on HEK293 cells as previously described (de Almeida et al., 2011). Antibodies against RelA (sc-372, Santa Cruz) and RNAPolII (sc-899, Santa Cruz) were used for immunoprecipitation.

Comet assay

Comet assay was performed in THP-1 cells (ATCC catalog number TIB-202) using the CometAssay Kit 25 × 2 well slides (Trevigen catalog number 4250-050K). A step-by-step protocol detailing the exact procedures and all the materials used is available online from Protocol Exchange (Alkaline Comet Assay using the monocytic cell line THP-1, https://doi.org/10.21203/rs.2.11936/v2).

phosphoH2AX quantification

Phosphorylation of histone H2AX at serine 139 was quantified by cell-based ELISA using the kit Human/Mouse/Rat Phospho-Histone H2AX (R&D catalog number KCB2288) according to the manufacturer’s instructions.

Quantification and statistical analysis

Data are expressed as mean values ± standard deviation. Mann–Whitney test was used for pairwise comparisons and two-way analysis of variance with Tukey test was used for multiple comparisons. Statistical analysis was performed with GraphPad Prism 6.0 (GraphPad Software). The number of subjects used in each experiment is defined in figure legends. The following symbols were used in figures to indicate statistical significance: *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Purification of recombinant RHD RelA

A human RelA construct (residues 19–291) was prepared by subcloning into pETM11 vector, which contains an N-terminal His6-tag and a TEV protease cleavage site. The new construct contains the N-terminal DBD (residues 19–191) and the C-terminal DD (residues 192–291). The plasmids were transformed into E. coli strain BL21 (DE3) cells and cultured overnight at 20°C in LB media supplemented with 100 µg/ml kanamycin.

For the preparation of uniformly labeled 2H (~100%) RHD RelA, 15N (99%)-labeled protein was expressed at 37°C using M9 minimal medium containing 15NH4Cl, [12C]D-d7-glucose(2 g/l) (97% D, Sigma-Aldrich) in 100% D2O. A standard protocol of sequential precultures for better D2O adaptation over a 3-day period was followed to increase the yield of protein expression in 100% D2O. On the first day, a 25-ml preculture in LB medium was prepared and grown overnight at 37°C. The following day, a preculture of 50 ml M9 minimal medium in H2O was inoculated with 1 ml of the overnight LB preculture and grown at 37°C. After some hours, when the preculture reached an optical density at 600 nm (OD600) close to 0.6, it was spun down for 10 min at 3202 × g. The cells were resuspended in 1 ml of M9 medium in 100% D2O and used for the inoculation of 100 ml of M9 medium in 100% D2O, such that the OD600 was 0.1–0.15. This small culture was left overnight at 37°C. The next day, this culture was added to 900 ml of M9 medium in 100% D2O. All cultures in minimal media were induced at OD600 of 0.8 with 0.5 mM of IPTG overnight at 20°C.

After overnight induction, cell pellets were lysed by sonication in lysis buffer (50 mM) Tris–HCl pH 8, 300 mM NaCl, 5 mM imidazole, 5 mM mercaptoethanol, 0.025 mg/ml DNAse I, 0.1 mg/ml lysozyme, 2.5 mM MgSO4, 0.1% NP-40, and 1 pill of protease inhibitor EDTA-free (cOmplete Tablets, Mini EDTA free, Roche) per 30 ml lysate. The cell lysate was centrifuged at 60,000 × g for 30 min at 4°C. After filtration, the His-tagged protein in the supernatant was loaded on an IMAC (Immobilized Metal Affinity Chromatography). The supernatant was applied to Ni-NTA resin (Qiagen) previously equilibrated with 3 column volumes of buffer A (50 mM Tris–HCl pH 8, 300 mM NaCl, 5 mM imidazole, 5 mM mercaptoethanol). Bound protein was washed with 3 column volumes of buffer A and unspecific bound protein was washed away with 3 column volumes of Wash Buffer (50 mM Tris–HCl pH 8, 1 M NaCl, 5 mM imidazole, and 5 mM mercaptoethanol). His6-tagged protein was eluted using elution buffer (50 mM Tris–HCl pH 8, 300 mM NaCl, 300 mM imidazole, and 5 mM mercaptoethanol). The affinity His-tag was removed from the protein by TEV (1:5 protein:TEV ratio) cleavage during dialysis into 50 mM Tris–HCl pH 8, 300 mM NaCl, and 5 mM mercaptoethanol buffer overnight at 4°C. The cleaved tag and TEV protease were removed from the target protein using a second IMAC step in dialysis buffer. The fractions containing RelA were pooled, concentrated and further purified by size-exclusion chromatography (SEC) using a Superdex 75 Hiload 16/60 column (S75, GE Healthcare, Merck). The SEC buffer used was 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, and 5 mM Dithiothreitol (DTT). For the 2H, 15N-labeled RelA, prior to the SEC purification step, 2 M urea were added to the protein sample for 1 hr, in order to enhance the proton chemical exchange. The final yields were 12.5 mg for 2H, 15N RelA and 52 mg for unlabeled RelA per liter of cell culture.

For NMR experiments, all protein samples were exchanged by successive concentration/dilution steps into NMR buffer (100 mM d11-Tris–HCl [Cortecnet] pH 7.5, 75 mM NaCl, and 5 mM d10-DTT [Cortecnet], 90% H2O/10% D2O). The protein concentrations were calculated using the absorption at 280 nm wavelength by using molar extinction coefficients of 17420 M−1 cm−1 for RelA19-291.

NMR spectroscopy

One-dimensional (1D) 1H NMR experiments were recorded using a WATERGATE pulse sequence at 25°C on a Bruker AvanceIII 800 MHz spectrometer equipped with a cryogenic TCI-probehead (1H, 31P, 13C, and 15N) with Z-gradients. 1D 1H experiments were performed using a WATERGATE pulse sequence with 32k time domain and 128 scans in 100 mM d11-Tris–HCl pH 7.5, 75 mM NaCl, 5 mM d10-DTT, and 10% D2O. STD experiments were recorded using an interleaved pulse program with on-resonance protein irradiation at 0.15 ppm for Epirubicin, 0.5 ppm for Aclarubicin, and 0.6 ppm for Doxorubicinone and off-resonance irradiation at −5 ppm with 2 s effective irradiation, using 800 scans and 32k time domain points (600 MHz). Each experiment was performed using 500 μM of compound 10 μM of unlabeled protein. Reference STD experiments without protein were performed at the same conditions, using the same irradiation regions. Spectra were processed using TOPSPIN 3.2 (Bruker Biospin, Rheinstetten, Germany).

NMR-binding studies were performed at 25°C using 100 μM 2H(~100%), 15N-labeled RelA19-291 dimer in a 100 mM d11-Tris–HCl buffer (pH 7.5, 75 mM NaCl, 5 mM d10-DTT, and 10% D2O) by adding compound to a final concentration of 500 and/or 100 μM of duplex-DNA, and monitoring the changes by 1H, 15N TROSY experiments. A reference experiment was performed under the same conditions with the same volume of DMSO-d6 (Eurisotop) as used for the compound titration. Changes in the DNA structure were detected by recording NMR Imino NOESY spectra at 10°C, using 100 μM duplex-DNA, to which compound (Epi and Acla) to a final concentration of 500 and 50 μM 2H(~100%), 15N-labeled RelA19-291 dimer in a 100 mM d11-Tris–HCl buffer (pH 7.5, 75 mM NaCl, 5 mM d10-DTT, and 10% D2O) were added in a different order.

Chemical shift assignment of RelA19-291 was obtained at 950 MHz and 25°C using TROSY versions of 3D HNCACB, HNCA, HN(CO)CA, HN(CA)CO, and HNCO experiments (Sattler et al., 1999, Zhang et al., 1994) on a 200 μΜ 2H(~100%), 13C, 15N-labeled RelA19-291 dimer in 100 mM d11-Tris–HCl buffer (pH 7.5, 75 mM NaCl, 5 mM d10-DTT, and 10% D2O) based on the assignment of three similar constructs of a 15N-labeled, perdeuterated RelA RHR (residues 19–325) in complex with perdeuterated p50 RHR (residues 37–363), a RelA DBD (residues 19–191), and a RelA DD (residues 190–321) in complex with deuterated p50 DD (residues 245–350) (Mukherjee et al., 2016). Assignment of RelA bound to DNA was performed by following the resonances during the DNA titration and confirmed by using a TROSY version of 3D HNCA on a 200 μΜ 2H(~100%), 13C, 15N-labeled RelA19-291 dimer with 100 μM duplex 14-mer DNA in 100 mM d11-Tris–HCl buffer (pH 7.5, 75 mM NaCl, 5 mM d10-DTT, and 10% D2O) obtained at 950 MHz and 25°C. All datasets were processed using NMRPipe (Delaglio et al., 1995) and analyzed with CCPN analysis 2.4.2 (Vranken et al., 2005).

Static light scattering

SLS experiments were performed at 30°C using a Viscotek TDA 305 triple array detector (Malvern Instruments) downstream to an Äkta Purifier (GE Healthcare) equipped with an analytical size-exclusion column (Superdex 75 or 200 10/300 GL, GE Healthcare, Merck) at 4°C. The samples were run in 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, and 5 mM DTT with a concentration of 2 mg/ml for the protein and at ratios of 1:2 protein:DNA and of 1:2:6 protein:DNA:anthracyclines at a flow rate of 0.5 ml/min. The molecular masses of the samples were calculated from the refractive index and right-angle light-scattering signals using Omnisec (Malvern Instruments). The SLS detector was calibrated with a 4 mg/ml bovine serum albumin (BSA) solution with 66.4 kDa for the BSA monomer and a dn/dc value of 0.185 ml/g for all protein samples.

Isothermal titration calorimetry

ITC measurements were carried out at 25°C using a MicroCal PEAQ-ITC (Malvern Instruments Ltd). The titrations were performed in 50 mM HEPES pH 8.0, 100 mM NaCl, and 1 mM mercaptoethanol and 1% DMSO. The calorimetric titration consisted of 19 injections of 1.5 μl of a 125 µM DNA sample, into the reaction cell containing 400 μl of 25 μM RelA or to 25 μM RelA with 200 μM Epirubicin/Aclarubicin, at a stirring speed of 1000 rpm. The heat of dilution was obtained by titrating DNA into the sample cell containing only buffer and this was subsequently subtracted from each experimental titration. For evaluating the effect of Epirubicin bound to DNA on binding to RelA, a calorimetric titration consisted of 19 injections of 1.5 μl of a 125 µM DNA with 250 µM Epirubicin mixture, into the reaction cell containing 400 μl of 25 μM RelA. For the determination of the binding affinity of the compounds to the DNA, a calorimetric titration was performed consisting of 19 injections of 1.5 μl of a 500 µM compound sample, into the reaction cell containing 400 μl of 50 μM DNA. The heat of dilution was obtained by titrating compound into the sample cell containing only buffer and this was subsequently subtracted from each experimental titration. For the determination of the binding affinity of the DNA to the protein, a calorimetric titration was performed consisting of 19 injections of 1.5 μl of a 125 µM DNA sample, into the reaction cell containing 400 μl of 25 μM RelA. The ITC data were analyzed using the MICROCAL PEAQ-ITC analysis software provided by Malvern.

Appendix 1

List of primer sequences (mostly retrieved from https://pga.mgh.harvard.edu/primerbank/).

Mouse primers
GeneForward sequenceReverse sequencePrimer Bank ID
GapdhAACTTTGGCATTGTGGAAGGACACATTGGGGGTAGGAACA6679937a1
IL1bGAAATGCCACCTTTTGACAGTGGGCTTGTCACTCGAATTTTGAGA118130747c1
TnfCTGAACTTCGGGGTGATCGGGGCTTGTCACTCGAATTTTGAGA133892368c2
Cxcl10GTGGCATTCAAGGAGTACCTCTGATGGCCTTCGATTCTGGATT10946576a1
IL6CCAAGAGGTGAGTGCTTCCCCTGTTGTTCAGACTCTCTCCCT26354667a1
IL10GCTGGACAACATACTGCTAACCATTTCCGATAAGGCTTGGCAA291575143c2
Ccl2TTAAAAACCTGGATCGGAACCAAGCATTAGCTTCAGATTTACGGGT6755430a1
Ccl5GCGCTCCTGCATCTGCCTCCCCTTGATGTGGGCACGGGGC7305461a1
Nfkb1CCTGGATGACTCTTGGGAAATCAGCCAGCTGTTTCATGTC6679044a1
Nfkb2GAACAGCCTTGCATCTAGCCTCCGAGTCGCTATCAGAGGT9506921a1
Nfkbia/IkbaTGAAGGACGAGGAGTACGAGCTTCGTGGATGATTGCCAAGTG6754840a1
Ifnb1TGGGTGGAATGAGACTATTGTTGCTCCCACGTCAATCTTTCCTC6754303c3
Ifna1GCCTCGCCCTTTGCTTTACTCTGTGGGTCTCAGGGAGATCADesigned by the authors
Ifna4TGATGAGCTACTACTGGTCAGCGATCTCTTAGCACAAGGATGGC6754294a1

Data availability

RNA-seq raw data of Murine Bone Marrow Derived Macrophages (BMDM's) stimulated with LPS and treated with PBS, Epirubicin and Aclarubicin and its analysis are available at https://github.com/andrebolerbarros/Chora_etal_2022 (copy archived at swh:1:rev:d86a4302612c313875b919e3897bec15310b6895) and https://zenodo.org/record/7389633.

The following data sets were generated
    1. Barros A
    2. Pedroso D
    3. Neves-Costa A
    4. Moita LF
    (2022) Github
    ID Github. Murine Bone Marrow Derived Macrophages (BMDM's) stimulated with LPS and treated with PBS, Epirubicin and Aclarubicin.
    1. Barros A
    2. Pedroso D
    3. Neves-Costa A
    4. Moita LF
    (2022) Zenodo
    Murine Bone Marrow Derived Macrophages (BMDM's) stimulated with LPS and treated with PBS, Epirubicin and Aclarubicin.
    https://doi.org/10.5281/zenodo.7389633

References

    1. Banáth JP
    2. Olive PL
    (2003)
    Expression of phosphorylated histone H2AX as a surrogate of cell killing by drugs that create DNA double-strand breaks
    Cancer Research 63:4347–4350.

Decision letter

  1. Yousef Abu-Amer
    Reviewing Editor; Washington University Medical Center, United States
  2. Mone Zaidi
    Senior Editor; Icahn School of Medicine at Mount Sinai, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

https://doi.org/10.7554/eLife.77443.sa1

Author response

Abbreviations in this reply:

Epirubicin – Epi

Aclarubicin – Acla

Doxorubicin – Doxo

We thank the reviewers and eLife for the opportunity to revise and improve our manuscript. All three reviewers agreed that the study has several important implications for anticancer therapy and can contribute to the future development of more efficacious anthracycline drugs with less side effects (DNA damage), therefore reducing their systemic toxicity to potentially improving their anticancer efficacy in patients. The reviewers also stressed that the impact of the findings can extend to other inflammation-associated pathologies, including sepsis, where the new mechanism described may help the development of low-toxicity therapies to suppress inflammation. In line with these observations by the reviewers, our group is a leading participant in a recently initiated clinical trial to assess the potential benefits of Epirubicin in the treatment of patients with severe sepsis and septic shock (ClinicalTrials.gov Identifier: NCT05033808).

Whereas Reviewers #1 and #3 were perfectly satisfied with the depth of the results presented regarding the composition of the NF-κB complexes studied and have not suggested additional experimental work, Reviewer#2 requested more data addressing the possibility that other NF-κB family members may be differently targeted by anthracyclines. Despite being a highly studied transcription factor with well-described oncogenic roles, individual functions of NF-κB subunits, including the particular role of RelA/p65 homodimers, has received very limited attention. In addition, comprehensive cell-specific NF-κB inhibiting information is not available, so we were not able to favor a particular NF-κB family member in our study based on any evidence of possible prominent roles in macrophages. Instead, we chose to study RelA/p65 due to its ubiquity and because “p65 is the transcriptionally active component of the NF-κB species that is most abundant and has the broadest function”, as stated in a comprehensive review dedicated to the DNA binding specificities of each of the NF-κB family members (Wan et al., 2009). To address the concerns of Reviewer#2 we performed a vast series of new experiments, as detailed below. Whereas final and conclusive responses to these longstanding problems, some of which have been elusive for the past four decades, are beyond the scope of our original manuscript, we are confident that our work now allows for a better understanding of the contribution of the NF-κB family member RelA to the gene expression programs induced by inflammatory challenge and, consequently, of the effects of anthracyclines on NF-κB-regulated genes. As Reviewer#2 pointed out, our study opens new avenues for the understanding of the intricate physiological attributes of NF-κB.

Finally, the reviewers unanimously pointed out that the studies were well-conducted and that the interpretations and conclusions were supported by the data displayed; moreover, the reviewers considered that the main outcomes of the experiments performed help not only to explain prior results by others, but also add considerable novelty to the NF-κB field by exposing previously unknown molecular mechanisms.

Point by point:

Reviewer 1:

Major comments:

The data are convincing as depicted by the in vivo and in vitro panels in the figures.

Introduction should be more focused on anti-tumoral drugs and the part related to TLRs and NFkB should be shorted. Moreover, the introduction should end with the aim and not with a declaration of results. As suggestion, this part might joined with the first sentence in the discussion part to better introduce the discussion of findings. References are appropriated.

We have followed the Reviewer’s suggestion and considerably shortened the Introduction; we have also moved the final paragraph into the Discussion and now the Introduction’s final sentence includes only the aim of the work.

As Figures are rich of complex data, especially the in vitro ones, the figure legends need to be better introduced with a brief sentence and a note pointing at what of interest.

Each legend of the main figures now starts with a succinct sentence stressing the most relevant findings and a brief mention to the models and experimental approaches used if relevant.

The conclusion part should be shorter.

The conclusion has been considerably edited and is now much shorter; we believe it has improved considerably and is now easier for the readers to focus on the main findings of the work, as well as the possible applications and clinical impact.

Remove figures from discussion, as this part is only related to the discussion of findings.

Done as suggested.

Minor comments:

The “Key resources Table” should be presented as supplemental material and not at beginning of methodology, based on the fact that all reagents and kits have been also described in the text.

A comprehensive key resources table has been includedat the beginning of the Methods section according to the journal’s requirements.

Indeed, the mouse primers table is missing of accession numbers and no amplification protocol as well as the formula used for quantify fold changes have been included.

All accession numbers of the genes (Gene IDs from NCBI) and of the mouse primers (obtained from Primer Bank) can be found in Appendix 1. The protocol for the amplifications and fold change calculations are now included in the methods section .

Moreover, the experimental part needs a better presentation and particularly the declaration of the number of animals used for the in vivo studies and also the number of in vitro tests or replications carried out. More details are necessary for western blot analysis. Please specify the HEK cell line and its specific application in the promoter studies.

We added the following information: 1, the number of animals used in the in vivo experiments has been included in the figure legend; 2, the number of replicates is now stated for each experiment in the corresponding figure legend; and 3, more details are provided in the Methods section for the antibodies used in the WBs, and IF, including the dilutions used. The cells used for the transfections, HEK293, were clearly identified.

Finally, a revision of technical English form should be carried out.

This has been performed by an English native speaker.

Reviewer 2:

Major comments:

1. Anthracycline-dependent, and DNA damage/ATM-independent, inhibition of inflammatory genes in E. coli or LPS stimulated BMDM is generally convincing from dose response studies with sufficient replicates and statistical analyses. However, whether this inhibition in BMDMs (e.g., all the genes shown in Figure 2B) is RelA-dependent or not was not investigated and thus remains unconvincing. LPS stimulation of BMDMs would activate p50/RelA heterodimers and cRel-containing NF-κB complexes but the authors focused only on RelA (RelA homodimer) in the remainder of the investigation. Experimental evidence needs to be provided, such as knockdown or knockout studies, to demonstrate the RelA requirement for anthracycline effects shown in Figure 2B. Moreover, luciferase reporter studies shown in Figure 2F needs to evaluate other NF-κB family members to demonstrate specificity, especially p50+RelA and cRel (+/-p50). If cRel is also affected by anthracycline, the relevance of the rest of the studies, especially NMR studies, focusing on RelA homodimer to the mechanism involved in BMDM becomes highly questionable.

Reviewer#2 pointed out that our work did not clearly establish that the anthracycline-dependent phenotype observed in mouse macrophages is specifically mediated by RelA/p65, namely in limiting cytokine production following pro-inflammatory stimuli. While it is known that Rel proteins are obligate dimers and that LPS is able to activate more than one NF-κB dimer, including RelA/p65 homodimers but also heterodimers formed with other NF-κB factors, the specific contribution of each NF-κB complex to cell responses is not known and has remained elusive for the past decades.

KO studies to test requirement of RelA/p65 for anthracycline effects

In our manuscript, we decided to focus on RelA/p65 because this is a very abundant subunit, ubiquitous, and the most well-studied NF-κB factor. The importance of RelA/p65 is evident in RelA−/− animals, which are embryonic lethal (Geisler et al., 2007). Reviewer#2 requested additional experiments to demonstrate RelA/p65 requirement for the anthracycline effects on transcriptional regulation of pro-inflammatory genes (“Experimental evidence needs to be provided, such as knockdown or knockout studies, to demonstrate the RelA requirement for anthracycline effects shown in Figure 2B.”), and so we decided to perform new experiments. We started by knocking out NF-κB subunits independently in HEK293 cells: RelA/p65, p50 and c-Rel. We did not attempt to perform KOs of these subunits in BMDMs, as we have observed in the past that transfection of these cells, as well as performing viral-mediated nucleic acid delivery, compromises their intrinsic properties, in particular the extent to which pro-inflammatory responses are activated following stimulation by external challenges. In the future we plan to use primary macrophages from KO mouse models instead, which will be the focus of a subsequent manuscript by our laboratory (discussed below). Here, and according to our revision plan, we used CRISPR/Cas9 to knock out the NF-κB factors in HEK293 cells (Author response image 1), which also allowed us to perform reporter gene assays using the same reporter as before to complement the assay in Figure 2F of the manuscript. We did not select individual KO clones after CRISPR/Cas9 because knocking out these subunits is known to compromise cell viability. Therefore, we worked with populations composed of 63 to 75% of KO cells and we were only able to use them immediately after CRISPR/Cas9, as the KO cells tended to die and to be outnumbered by the healthy cells in the population over time (Author response image 1). The protocols and the CRISPR/Cas9 tools are described in the Methods section at the end of this response.

Author response image 1
CRISPR/Cas 9 mediated KOs of NF-κB, subunits in HEK293 cells as described in the methods section of this reply.

The resulting populations were tested, at week one post KO, for RNA levels and protein expression of the different subunits. For one round of deletions that we show as an example, we concluded from our and a quantifications that the KO cells in the population were 71% in the case of RelA/p65, 63% in the case of p50 and 75% in the case of c-Rel (A). The percentage of KO cells in the population tended to decrease overtime, as assessed by RNA (B), and for this were only cultured for short periods following gene editing. These KOs were corroborated at the protein level, as shown by WB (C), except for c-Rel, as the antibody that we had available was only able to detect overexpression of the protein (see Author response image 4) and we were never able to detect the much lower levels of the endogenous c-Rel protein.

We then used the KO cell populations to test the effect of anthracyclines on NF-κB-regulated endogenous gene expression. As reported in Figure 2B of the manuscript for BMDMs, endogenous pro-inflammatory gene expression was also downregulated by Epi in CRISPR controls, as shown by TNF mRNA levels (Author response image 2, compare the two blue arrows). In RelA/p65 KO cells, very low levels of TNF mRNA induction were detected (Author response image 2, red arrow), which strongly suggests that RelA/p65 is required for TNF expression and, therefore, for any modulatory effects on that expression, including the effects of anthracyclines. To further substantiate the RelA/p65 requirement for anthracycline effects, we did not detect any decrease in TNF mRNA expression levels in p50 KO or c-Rel KO cells upon stimulation (Author response image 2, light gray arrows), strongly pointing to RelA/p65-containing NF-κB complexes being the main or sole drivers of TNF transcriptional induction, in our experimental conditions. It is likely that a previously described compensatory effect is responsible for the increased RelA/p65 activity in p50 KO and c-Rel KO cells, which leads to increased induction of TNF mRNA in these cells (Author response image 2, light gray arrows). As a final evidence that RelA/p65 is the NF-κB factor mediating anthracycline effects, we observed that Epi was able to downregulate TNF mRNA expression both in p50 KO and in c-Rel KO cells (Author response image 2, dark gray arrows).

Author response image 2
Effects of epirubicin (Epi) on endogeneous TNF expression as assessed by nRNA levels.

CRISPR/Cas9-mediated KO populations of HEK293 cells (rel/p65 KO, p50 KO, c-Rel KO, and CRISPR control) which generated as shown in Author response image 1 and were either treated with vehicle or with 2µM of Epi for 4 hours. TNF was added to the medium 1 hour after Epi or cells were left out without any stimulus. mRNA levels of TNF were quantified by qRT-PCR in two independent experiments. One representative experiment is shown with averages and standard deviations of technical replicates. Blue, red and grey arrows are discussed in the text.

We also used the KOs of the NF-κB subunits to test reporter gene expression with the same vector as in Figure 2F of the manuscript. In RelA/p65-deficient cells, the kB-luciferase reporter was not substantially induced by TNF, compared with up to 6x induction of luciferase by TNF in CRISPR control cells (Author response image 3). Because of the lack of reporter expression in RelA/p65 KO cells, it was not possible to test the effects of Epi on reporter gene expression in the RelA/p65 KO cell population. We consider this result to be a strong indication that the kB reporter gene inductions reported in the manuscript are largely due to RelA/p65 and therefore anthracyclines require RelA/p65 for their effects in the luciferase reporter assays. As discussed above, a RelA/p65 compensatory effect was detected in p50 KO cells, leading to luciferase levels slightly above control. On the contrary, in c-Rel KO cells the luciferase signal was not as high as in control cells, which suggests that c-Rel is responsible for a small part of reporter induction, although considerably less prominent than the induction by RelA/p65, the main regulator of TNF-induced luciferase expression in this system.

Author response image 3
Effects of NF-κB subunits on reporter gene expression.

HEK293 KO cells (rel/p65 KO, p50 KO, c-Rel KO, and CRISPR control) were stimulated with TNF 4h or 8h and the induction of the luciferase reporter was assessed as fold change over empty vector control.

Specificity assessed by overexpression of NF-κB factors in luciferase reporter assays

The data showed above already started to address the next concern of Reviewer#2, in particular that “luciferase reporter studies shown in Figure 2F need to evaluate other NF-κB family members to demonstrate specificity”. To further investigate this, we co-transfected the NF-κB luciferase reporter (the same vector used in Figure 2F of the manuscript and already used above) together with expression vectors for each of the human full-length NF-κB family members: RelA/p65 (as before, in Figure 2F of the manuscript); p50, and c-Rel (see Methods section at the end of this response). After optimizing the overexpression conditions (Author response image 4 A and B), we tested luciferase induction. We observed that both RelA/p65 alone or double overexpression of RelA/p65 and p50 strongly induced the reporter gene to comparable levels (Author response image 4C and D). As expected, overexpression of p50 homodimers did not induce the luciferase reporter, as this subunit lacks the transactivation domain (TAD) and so it must partner with TAD-containing subunits, such as RelA/p65 or c-Rel, to activate transcription (Figure 4A and C, Hoffmann et al., 2003). We observed that c-Rel overexpression induced transcription only marginally (less than 10x), both alone or in combination with p50 overexpression (Author response image 4A and C). Double overexpression of RelA/p65 and c-Rel was less efficient at transcriptional activation than RelA/p65 overexpression alone (Author response image 4C). Our data seems to corroborate previous observations that c-Rel inhibits pro-inflammatory transcription by RelA/p65 (de Jesus et al., 2020). Because c-Rel homodimers are either weak transcriptional activators or repressors in our system, even without any anthracycline treatment, we excluded the possibility that c-Rel is required for the anthracycline effects reported in the manuscript. Levels of protein overexpression of the NF-κB subunits in the conditions used were assessed by WB (Author response image 5 A-C). Importantly, when RelA/p65 was overexpressed simultaneously with p50, a condition that led to strong induction of the reporter gene as discussed above, we observed that both subunits maintained their overexpression at the protein level (Author response image 5C).

Author response image 4
NF-κB subunits were overexpressed either alone or two subunits were simultaneously overexpressed and the induction of the luciferase reporter was assessed as fold change over empty vector control.

Transfection conditions for reporter and NF-κB subunits were optimised over time (A) and the total amount of transfected DNA was transfected (B) to find the optimal conditions for luciferase signal detection within non-saturating conditions. First, the reporter vector was transfected into HEK293 cells and 24h later the vectors for the overexpressions of the subunits were transacted. Luciferase was read at several time points (eventually we decided to read luciferase signals at 24 hours post transfection, A) and with different amounts of transfected DNA 150 ng of total DNA was chosen as the preferred DNA amount, (B). (C) Both single overexpressions and overexpressions of two subunits simultaneously were performed; overexpression of combinations of two NF-κB subunits aimed at promoting the formation of heterodimers – although we cannot exclude that only homodiners formed in these conditions. (D) We tested luciferase induction after overexpressing combinations of the subunits, D, luciferase induction after the combined overexpression of RelA/p65 and p50 was tested several times in addition to the experiment shown in C; luciferase induction following the double transactions was comparable to the induction by RelA/p65 alone, as shown in three independent experiments, in addition to the experiment in C. Here we show representative assays of at least two independent experiments; I D three independent experiments are shown for comparison. Data refers to averages and standard deviations of technical triplicates.

Author response image 5
NF-κB subunits were overexpressed either alone or two subunits were solved simultaneously over expressed and the protein levels were assessed by WB full stop transfection conditions for reporter and NF-κB subunits were the same as in Author response image 3.

(A) Time courses of protein levels were performed for RelA/p65 and for p50 single transactions and compared with empty vector pcDNA. (B) c-Rel overexpression was also detected in cells 24h post transfection, but this antibody showed strong cross reaction with RelA/p65, and therefore limited tests were performed. (C) Simultaneous overexpression of p65 and p50 subunits did not seem to compromise protein levels of any of them.

The specificity of Epi effects was then tested using the luciferase reporter system in the conditions that induced expression of the reporter: RelA/p65 alone or co-transfected with p50. We observed that Epi inhibited luciferase induction in a dose-dependent way when RelA/p65 overexpression was tested alone but also with the double overexpression of RelA/p65 and p50 (Author response image 6); likely, direct RelA/p65 inhibition by Epi compromises reporter expression driven by RelA/p65 homo- and also heterodimers; it is also possible that Epi is able to inhibit p50 directly when in complex with RelA/p65. Nevertheless, we cannot exclude that only RelA/p65 homodimers were inhibited by Epi and that the RelA/p65-p50 heterodimers formed did not suffer from Epi inhibition and were still able to activate transcription; in this case, and taking into consideration the strong effects of Epi towards inhibition of NF-κB targets that we report in the manuscript, RelA/p65-p50 heterodimers could not account for the majority of the NF-κB complexes in cells.

Author response image 6
RelA/p65 was overexpressed either alone or simultaneously with p50 and the induction of the luciferase reporter was assessed as fold induction over empty vector control after incubation with several concentrations of AP from stock transactions were performed as described in the previous Author response images, Epi or vehicle were added 24h post transfection of the subunits and luciferase signal was read at 16h post Epi.

RNA-seq analysis to further explore specificity

From our KO studies and reporter gene assays described above, we could not establish if Epi is able to regulate c-Rel targets or if p50 is also targeted by Epi when in a complex with RelA/p65. To definitely address the question of whether anthracyclines can also regulate targets of NF-κB independently of RelA, we decided to focus on those genes with expression strongly driven by c-Rel or p50 overexpressions, the most likely endogenous targets of c-Rel and p50-containing NF-κB transcriptional complexes. To identify such genes, we performed RNA-seq in HEK293 cells overexpressing the different subunits alone and also in cells with the combined overexpression of RelA/p65 and p50, as this condition also led to strong transcriptional induction (Author response image 4C). We found that conditions where RelA/p65 was overexpressed, both alone and in combination with p50, let to the most altered transcriptomic profiles when compared with the transcriptomes of controls (Author response image 7, cluster on the right). This observation aligns with the established notion that RelA/p65 is the NF-κB factor that contributes the most to the transcriptional regulation of NF-κB targets, in line with the results discussed above.

Author response image 7
NF-κB subunits were overexpressed either alone or simultaneously and RNA-seq was performed.

Principle Component Analysis (PCA) of the sequencing data was obtained for the following samples: HEK293 cells without any treatment (Cells); TNF stimulated cells (TNF); Epi-treated cells (Epi); TNF-stimulated, Epi-treated cells (EpiTNF); pcDNA (empty vector) -transfected controls (pcDNA); RelA/p65 overexpressing (p65); P50 overexpressing (p50); c-Rel-overexpressing (c-Rel); RelA/p65 on p50 simultaneous transfection (p65p50); Epi-treated pcDNA (empty vector) -transfected controls(EpcDNA); Epi-treated RelA/p65 overexpressing (E65); Epi-treated P50 overexpressing (Ep50); Epi-treated c-rel-overexpressing (c-Rel); and Epi-treated RelA/p65 and P50 simultaneous transfection EP65P50.

A preliminary analysis of the RNA-seq data has uncovered targets of RelA/p65, p50 and c-Rel overexpressions, as shown in the volcano plots of each single overexpression (Author response image 8A-C). We confirmed that NF-κB factors are mostly of gene inducers: 3137 upregulated targets in RelA/p65 overexpression; 1128 upregulated in p50 overexpression; and 1241 upregulate in cRel overexpression. Downregulated genes, either directly or indirectly, were the minority: 416 downregulated targets in RelA/p65 overexpression; 282 downregulated in p50 overexpression; and 570 downregulate in cRel overexpression. The top 50 upregulated genes for each of the overexpressions showed the expected RelA/p65 targets genes and also putative targets of p50 and c-Rel (Author response image 9A). We have analysed the first 200 upregulated genes in the RelA/p65 overexpression and asked which were the most represented GO TERMS regarding the biological process (BP). For that we used the Database for Annotation, Visualization and Integrated Discovery (DAVID) as before in the manuscript (https://david.ncifcrf.gov). The terms are all related to immune responses, as for example chemokine and cytokine signalling and secretion and, which is in line with the known roles for RelA/p65, therefore further validating the relevance of the RNA-seq data (Author response image 9B).

Author response image 8
Volcano plots of the RNA-seq data for the overexpressions of RelA/p65, p50 and cRel.

Volcano plots of the conditions: (A) overexpression of RelA/p65 vs pcDNA; (B) overexpression of p50 vs pcDNA; and (C) overexpression of p50 vs pcDNA. Geenes with log2FoldChange expression above 2 or below -2 were considered to be upregulated or downregulated.

Author response image 9
Most induced genes from the RNA-seq following overexpression of the NF-κB subunits and GO TERMS of the most significantly upregulated RelA/p65 targets.

I list of the 50 most significantly upregulated genes from the RNA-seq for each of the subunits overexpressed when compared with this expression in control P DNA; The lists start with the most significantly induced mRNA in the top of each column the top 200 upregulated mRNAs in RelA/p65 overexpression where analysed with the use of DAVID (https://david.ncifcrf.gov) and the 10 most represented GO TERMS for biological processes (GOTERM_BP) or shown from the most significant at the top.

We are now in the process of compiling a comprehensive list of p50 and c-Rel targets with the help of the Bioinformatics Unit at IGC. This work in progress also aims to discriminate which genes are upregulated by these subunits but are not found to be targets of RelA/p65. A list of genes induced by p50 or by c-Rel but not by RelA/p65 is of particular interest to us, as we intend to thoroughly test whether these genes are also targeted by the anthracyclines. Our ongoing bioinformatics analysis is also exploring the effects of Epi-treatments on p50 and cRel targets, as Epi-treated conditions were included in the RNA-seq experiment. Future results from the genes selected will be similar to the analysis already performed for TNF (Author response image 10): we will be able to compare the expression of each selected p50 and c-Rel target in conditions with and without Epi to see if anthracycline treatments also dowregulate the expression of those genes. Our analysis will then provide a more definitive picture of the extent to which anthracyclines regulate NF-κB targets. Our laboratory will dedicate considerable efforts to these studies, which will only be presented in the future because of the thorough analysis and validation that is required. The exhaustive identification and validation of the NF-κB genes regulated by Epi, with the possibility of recognizing the preferred composition of each NF-κB complex that is being targeted by the anthracyclines for each gene, will considerably expand our knowledge of NF-κB biology, but also of the particularities of locus-specific drug targeting, in particular in inflammation. We consider this to be a very relevant and poorly understood aspect, as anthracyclines are already known to target discrete chromosomal regions in cancer cells to induce histone eviction, and it would be fundamental to explore whether anthracycline recruitment to particular chromatin domains could eventually be related to the presence of distinct NF-κB dimers (references in the manuscript: Pang et al., 2013 and Yang et al., 2013).

Author response image 10
RNA-seq data for the expression of TNF in the different conditions tested, shown as an example of Epirubicin (Epi)-regulated NF-κB target gene.

The mRNA levels corresponding to TNF expression, as obtained by the RNA-seq. Controls were untransfected cells: HEK293 cells without any treatment (Cells); TNF-stimulated cells (TNF); Epi-treated cells (Epi); TNF-stimulated, Epi-treated cells (EpiTNF); HEK293 sounds where transfected and treated as follows: pcDNA (empty vector) -transfected controls (pcDNA); RelA/p65 overexpressing (p65); P50 overexpressing (p50); c-Rel-overexpressing (c-Rel); RelA/p65 and p50 simultaneous transfection P65P50; epi-treated pcDNA (empty vector) -transfected controls (EpcDNA); epi-treated RelA/p65 overexpressing (Ep65); Epi-treated P50 overexpressing (Ep50); Epi-treated c-Rel-overexpressing (EcRel); and Epi-treated RelA/p65 and P50 simultaneous transfection (Ep65p50). Values are arbitrary and represent fold induction over the condition “cells” alone, for which basal mRNA levels were considered to be zero.

Summary

We are confident that the findings shown in this section of the reply to Reviewer#2 provided information that is novel and hopefully contributed to clarify the doubts raised. Our results allowed us to establish that RelA/p65 is the main NF-κB factor responsible for the effects of the anthracyclines (Epi) in the cell models tested, both in the regulation of endogenous gene expression, as well as in regulating the kB reporter. For the relevance of these observations, we decided to include a new supplementary figure in the manuscript, Supp. Figure 4, that contains part of the information provided here. We only included data concerning RelA/p65 KO and no data related to p50 or c-Rel because RelA/p65 is the focus of our manuscript and the sole NF-κB factor that we studied structurally, by IF, and in reporter gene assays. Another change we introduced in the manuscript was in Figure 2: the former 2E part of the panel, which showed redundancy with 2F, was replaced by data stressing that TNF gene is regulated by Epi at the level of transcription and not at the level of stability of its mRNA, which to us further suggests that anthracyclines regulate transcription of NF-κB targets.

We are aware of the limitations of using a cell line such as HEK293 and reporter gene assays, and we acknowledge that we did not address the dispute in macrophages. Nevertheless, and because the experimental approaches used were chosen to mimic inflammatory stimulation and the induction of pro-inflammatory transcriptional programs, we believe that the findings shown here are relevant for the understanding of the effects of anthracyclines in inflammation. In the future, we plan to use genetically modified mouse models and isolate macrophages from those animals to do in vivo and ex-vivo studies. RelA/p65 deletion is embryonically lethal (Geisler et al., 2007) and therefore RelA/p65 KO cells can only be obtained in inducible systems. Adult RelA/p65 inactivation is possible in RelA/p65 flox/flox mice using Cre/loxP approaches, either for whole-body recombination and deletion, or using a Cre driver such as LysM-Cre to achieve deletion of RelA/p65 only in macrophages. In these KO animals we will also be able to test the protective in vivo effects by anthracyclines using the models of sepsis and septic shock which are well established in our laboratory, as we did in the past (reference in the manuscript: Figueiredo et al., 2013). The work presented in the manuscript and in this response explored anthracycline interactions with RelA/p65 and showed that these interactions are likely to limit the extent of pro-inflammatory responses, which may have beneficial consequences in conditions associated with exacerbated inflammation. A model of target gene regulation by Epi is shown in Supp. Figure 12 of the manuscript.

2. A related significant concern is the use of the "kB-33 promoter sequence" (page 10 and thereafter) in the NMR study (Figures 4 and 5 and associated supplemental data). The description of this NF-κB binding sequence was insufficient in the manuscript. In fact, this sequence is not even a "promoter" sequence as stated. This is an artificial sequence derived from a duplication of the 3' half of the immunoglobulin kappa kB enhancer element (Thanos & Maniatis, Mol. Cell. Biol. 15: 152-164, 1995), which was cited in the Chen et al. 1998 paper which was in turn cited by the authors. This sequence selectively binds RelA homodimers and not p50/RelA heterodimers or p50 homodimers. Given that the role of p65 homodimers in regulating inflammatory genes in BMDM is not established (in the current study or by others), the use of this artificial binding site in the NMR study and the relevance of the results obtained to the mechanism of action of anthracycline in repressing NF-κB dependent target genes in BMDM are highly questionable. If, on the other hand, the authors are able to demonstrate the requirement of RelA homodimers, but not p50/RelA, p50/cRel heterodimers, or cRel homodimers, for gene regulation shown in Figure 2B, this could help explain why certain other NF-κB target genes, such as IFN β or survival genes, are not affected by anthracyclines as these targets are known to be regulated by p50/RelA heterodimers (e.g., IFN β gene described in Thanos & Maniatis cited above).

We confirm that we have specifically chosen a sequence that selectively binds RelA homodimers and not p50/RelA heterodimers or p50 homodimers because we only assessed direct transcriptional inhibition (luciferase assay) by RelA and not by the other NF-κB subunits in the original manuscript; while we think it would be of great interest to extend the NMR studies to other subunits, we believe that the NMR studies that we performed with RelA already provide considerable information regarding the possible molecular mechanisms that explain the inhibition of RelA homodimers that are capable of driving the transcription of luciferase with a kB promoter. Instead, we have decided to concentrate our efforts and resources on testing a wide variety of conditions affecting the binding that may prove relevant in physiological conditions. The conditions tested included a range of doses of the anthracyclines, different possible stoichiometries between the components, alternative orders of addition of the players of the system, and very importantly, three members of the anthracycline family that each have distinctive biological features. We agree that it will be helpful, in the future, to expand the structural analysis to other sequences, not only targeted by other NF-κB subunits, but also by other transcription factors with known roles in regulating inflammation, such as the IRFs and STATs families for example. However, that extends beyond the scope of this work and due to the nature of the experimental approaches required to generate reliable structural data, will only be possible in the future.

3. By demonstrating the significant reduction of serum TNF levels in mice exposed to E. coli + Epi or Acla relative to E. coli group alone, the authors concluded that "our findings have in vivo physiological relevance" (page 6). However, the difference of TNF levels is ~1250 pg/ml to ~800 pg/ml, only ~36% reduction. It is unclear whether this reduction would have "physiological relevance". Thus, the authors should measure the physiological outcome of septic shock, such as death, to determine whether anthracyclines have significant physiological impact or not in vivo. This is important given the authors claim that the mechanism being studied have implications in cancer and sepsis therapies in patients.

The additional experiments suggested above are within the capacity of the authors, not very time consuming and not expensive relative to what have already being performed and therefore reasonable to make the study and the claim more conclusive and significant.

Because of the reduction of circulating TNF levels in the sepsis mouse model after anthracycline treatment, the reviewer suggested the measurement of a physiological outcome, more specifically the kinetics of death. Indeed, the physiological relevance of anthracyclines in sepsis was the central focus of a previous study conducted by our laboratory, published in Immunity in 2013 (reference in the manuscript: Figueiredo et al., 2013). In that publication, we compared the survival of WT animals subjected to sepsis (using the polymicrobial infection induced by cecal ligation and puncture model, CLP) and treated with control (PBS) or treated with anthracyclines. Figures 1A and 1B in that publication showed that the anthracyclines Epirubicin, Doxorubicin and Daunorubicin increased the survival of the mice subjected to CLP by up to 80%, without the use of antibiotics. We agree with the reviewer that the in vivo results have considerable impact for the development of future treatments targeting cancer and sepsis. The previously published observations that anthracyclines are protective in the mouse model of sepsis are a strong indication that anthracyclines will play critical roles in sepsis therapies in patients. This is being tested in a clinical trial conducted in Germany and with the participation of the authors (ClinicalTrials.gov Identifier: NCT05033808). More specifically, the trial will compare low doses of Epirubicin with placebo for the treatment of sepsis and septic shock. We see no need to repeat or extend the in vivo tests to additional anthracyclines, for which we would need a substantial number of animals and this would not be ethically appropriate.

Minor comments:

1. In addition to the insufficient/inaccurate description of the kB-33 promoter sequence above, the description of the kB-Luc reporter used in the method section ["the NF-κB firefly luciferase reporter construct (kB-luc),.. were previously described (Anrather et al., 1999)"] (page 22) require a better description. The cited paper (Anrather et al. 1999) does not have the direct information on the reporter construct and one has to look up a cite paper within the reference (i.e., Brostjan C et al. J. Immunol. 158: 3836-3844, 1997) to find the relevant reporter vector.

The description has been considerably expanded in the Methods section: we have now included the sequences of the two kB sites in the vector; in addition, other sequences in the vector such as the promoter and enhancer have been described. Finally, there is a new reference to the originally identified consensus sequence for comparison.

2. In vivo sepsis study in the result section refers to "we co-administered Epi or Acla to mice that were challenged with LPS" (page 6). However, the methods and figure legend indicate the use of E. coli.

We thank the Reviewer for calling our the attention to this. We have now changed to “fixed E coli,” the model that was used to assess the relevance of cytokine modulation by anthracyclines in vivo.

3. The authors uses the term "inflammation" multiple times in the text to describe the induction of inflammatory genes in BMDM, but this term is misleading because inflammation refers to a physiological reaction in vivo. The authors should consider the use of more accurate description.

We agree with the Reviewer that a more accurate description was required in some of the sentences. We have now replaced a few of the mentions to “inflammation” by “induction of gene expression”, or “induction of pro-inflammatory gene expression” or “pro-inflammatory transcriptional programs” to specifically reflect our observations that RelA is capable of reducing the transcription of genes that take part in the inflammatory responses in macrophages.

4. All references lack volume and page numbers. This needs to be fixed.

This has been corrected.

5. Figure 1A: Atm-/- cells show statistically significantly different levels (although the difference is small in magnitude) relative to WT groups for some Epi doses but these differences were largely ignored in the manuscript.

We have now acknowledged these small differences in the text, more specifically in the section “Cytokine secretion and DNA damage”. Although the data clearly shows that ATM is not required for the RelA-mediated reduction of gene expression of pro-inflammatory genes, we are aware that inflammation progresses differently in ATM-/- animals compared with WT animals (shown for example in Rodier et al., 2009), and therefore direct comparisons should be avoided (this is part of the reason why we favor the “fold change” analysis for cytokine induction results). In addition, because anthracyclines target DNA, and ATM-/- cells are considerably defective in DNA damage repair and are more prone to accumulate DNA breaks, we do not exclude that Epirubicin may interact differently with the ATM-/- chromatin when compared with the WT chromatin.

6. Many of the data shown in supplemental figures lacked statistical analysis.

The statistical analysis in this manuscript was performed for all data plotted in graphs, whether the data was presented in the main figures or as supplementary material. In fact, all graphs in the main figures display the results of those statistical analyses visually. However, for the supplementary figures, we did not thoroughly display the results of the statistical tests, which was rightfully pointed by the Reviewer. What we have now decided to do was to mention the statistical analysis in the figure legends of all supplementary figures and to reference the results of the tests. We believe that the figures are now more informative and we thank the reviewer for suggesting this improvement.

Reviewer 3:

My comments/suggestions:

1. Although ATM independence in repressive effects on transcription of pro-inflammatory cytokines is convincingly demonstrated, how likely that ATR could be involved.

The roles of the ATR factor (ataxia telangiectasia and Rad3-related protein) in inflammation are also a matter of great interest to us and we have dedicated intense efforts to study this particular DNA damage factor in macrophages and other cells. Importantly, whereas ATM and ATR share roles in double-strand DNA damage, these two master kinase activities contribute distinctly to the resolution of other types of cellular injuries, such as replication stress (recently reviewed in Williams et al., 2021). We have collected data but we would not like to share those preliminary results at this time and expect that the editors and reviewers keep this piece of information under strict confidentiality. For this, we thank the editors and reviewers in advance.

2. Please indicate scale bar in figure 3A.

This has been included.

3. In Figure S1 E and F, what are the dose and times of treatments.

The details of doses and kinetics have been provided.

4. There are no description of Figure S2E-I panels in results.

We thank the Reviewer for calling the attention to this and have included the specific reference to these panels in the text.

5. Figure 3 legend, please provide times of E. coli treatments in A, and Dose of MG132 in C.

The details of doses and kinetics have been provided.

6. Please provide Figure S1G as the legend states panel G description.

Reference to panel G has been removed from the legend of figure S1.

Methods:

KO studies

We performed CRISPR/Cas9 mediated KOs of NF-κB subunits in HEK293 cells and for that we used commercially available double nickase plasmids (Santa Cruz, Author response table 1) consisting of a pair of plasmids each encoding a D10A mutated Cas9 nuclease and a target-specific 20 nt guide RNA (gRNA). Plasmid transfection was performed as described in the manuscript using the amounts of DNA suggested by Santa Cruz. We chose to use nickases because they generate single-strand rather than double-strand breaks, so when used with two adjacent gRNA, the probability of off-target editing is lower. The resulting population was tested (at week 1 of KO) for RNA levels and protein expression of the different subunits.

Author response table 1
Tools for CRISPR/Cas9 in HEK293 cells.
Human GeneProteinDouble Nickase Plasmid
RELAp65 (RelA) subunitsc-400004-NIC-2
NFKB1P50 subunitsc-400087-NIC-2
RELc-Relsc-400478-NIC-2
Scrambled control RNA sequence-sc-437281

RNA

RNA extraction, cDNA synthesis and qRT-PCR were done as explained in the main Methods section of the manuscript. For one round of deletions that we show as an example, we concluded from RNA quantifications that the KO cells in the population were 71% in the case of RelA/p65, 63% in the case of p50 and 75% in the case of c-Rel (Author response image1). The percentage of KO cells in the population tended to decrease over time as assessed by RNA levels (Author response image 1) and therefore we were careful to only culture cells for short periods following gene editing. These KOs were corroborated at the protein level, as shown by WB. The sequences of the primers were retrieved from Primer Bank (https://pga.mgh.harvard.edu/primerbank/) and can be found in Author response table 2.

Author response table 2
Human primers used.
Human GeneForward PrimerReverse Primer
RELA/ p65ATGTGGAGATCATTGAGCAGCCCTGGTCCTGTGTAGCCATT
NFKB1/ p50GAAGCACGAATGACAGAGGCGCTTGGCGGATTAGCTCTTTT
REL/ c-RelCAACCGAACATACCCTTCTATCCTCTGCTTCATAGTAGCCGTCT
GAPDHGAGTCAACGGATTTGGTCGTTTGATTTTGGAGGGATCTCG

Antibodies

The KOs were also corroborated at the protein level, as shown by WB. The antibodies used in this reply were from Santa Cruz: anti p65/RelA antibody (C-20) sc-372 at 1:2000 dilution; anti p50 antibody (NLS) sc-114 at 1:2000 dilution; and anti c-Rel antibody (C-terminus) sc-71 at 1:1000 dilution.

Overexpressions

The full-length RelA overexpression construct, which was previously used in the manuscript, is a pcDNA3-based vector and was described in the Methods section (reference in the manuscript: Anrather et al., 1999.). Full-length p50 and c-Rel-containing overexpression constructs were created similarly.

RNA-seq

RNA integrity was assessed in a Fragment Analyser (Agilent Technologies), and samples with RNA Quality Number (RQN)>8 were further used for mRNA-library preparation using SMART-Seq2. Illumina libraries were generated with the Nextera based protocol and libraries quality were assessed in Fragment Analyzer before sequencing. Sequencing was carried out in NextSeq 2000 Sequencer (Illumina) at the IGC Genomics facility using 100 SE P2 kit and 25 million reads per library. Sequencing data was demultiplex and converted to FASTQ format using bcl2fastq v2.19.1.403 (Illumina).

References:

de Jesús TJ, Ramakrishnan P. NF-κB c-Rel Dictates the Inflammatory Threshold by Acting as a Transcriptional Repressor. iScience. 2020 Mar 27;23(3):100876. doi: 10.1016/j.isci.2020.100876.

Geisler F, Algül H, Paxian S, Schmid RM. Genetic inactivation of RelA/p65 sensitizes adult mouse hepatocytes to TNF-induced apoptosis in vivo and in vitro. Gastroenterology. 2007 Jun;132(7):2489-503. doi: 10.1053/j.gastro.2007.03.033.

Hoffmann A, Leung TH, Baltimore D. Genetic analysis of NF-kappaB/Rel transcription factors defines functional specificities. EMBO J. 2003 Oct 15;22(20):5530-9. doi: 10.1093/emboj/cdg534.

Leung TH, Hoffmann A, Baltimore D. One nucleotide in a kappaB site can determine cofactor specificity for NF-kappaB dimers. Cell. 2004 Aug 20;118(4):453-64. doi: 10.1016/j.cell.2004.08.007.

Martin EW, Chakraborty S, Presman DM, Tomassoni Ardori F, Oh KS, Kaileh M, Tessarollo L, Sung MH. Assaying Homodimers of NF-κB in Live Single Cells. Front Immunol. 2019 Nov 7;10:2609. doi: 10.3389/fimmu.2019.02609.

Oeckinghaus A, Ghosh S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol. 2009 Oct;1(4):a000034. doi: 10.1101/cshperspect.a000034.

Tsui R, Kearns JD, Lynch C, Vu D, Ngo KA, Basak S, Ghosh G, Hoffmann A. IκBβ enhances the generation of the low-affinity NFκB/RelA homodimer. Nat Commun. 2015 May 7;6:7068. doi: 10.1038/ncomms8068.

Rodier F, Coppé JP, Patil CK, Hoeijmakers WA, Muñoz DP, Raza SR, Freund A, Campeau E, Davalos AR, Campisi J. Persistent DNA damage signalling triggers senescence-associated inflammatory cytokine secretion. Nat Cell Biol. 2009 Aug;11(8):973-9. doi: 10.1038/ncb1909.

Wan F, Lenardo MJ. Specification of DNA binding activity of NF-kappaB proteins. Cold Spring Harb Perspect Biol. 2009 Oct;1(4):a000067. doi: 10.1101/cshperspect.a000067.

Williams RM, Zhang X. Roles of ATM and ATR in DNA double strand breaks and replication stress. Prog Biophys Mol Biol. 2021 May;161:27-38. doi: 10.1016/j.pbiomolbio.2020.11.005.

https://doi.org/10.7554/eLife.77443.sa2

Article and author information

Author details

  1. Angelo Ferreira Chora

    Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology
    Contributed equally with
    Dora Pedroso
    Competing interests
    No competing interests declared
  2. Dora Pedroso

    Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Methodology
    Contributed equally with
    Angelo Ferreira Chora
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5735-5094
  3. Eleni Kyriakou

    1. Institute of Structural Biology, Molecular Targets and Therapeutics Center, Helmholtz Zentrum München, Neuherberg, Germany
    2. Bavarian NMR Centre, Department of Bioscience, School of Natural Sciences, Technical University of Munich, Garching, Germany
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared
  4. Nadja Pejanovic

    Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal
    Contribution
    Data curation, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared
  5. Henrique Colaço

    Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2026-0163
  6. Raffaella Gozzelino

    NOVA Medical School (NMS), Lisbon, Portugal
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  7. André Barros

    Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    Contribution
    Data curation, Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared
  8. Katharina Willmann

    Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    Contribution
    Validation, Investigation, Methodology
    Competing interests
    No competing interests declared
  9. Tiago Velho

    1. Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    2. Centro Hospitalar Lisboa Norte - Hospital de Santa Maria, EPE, Avenida Professor Egas Moniz, Lisbon, Portugal
    Contribution
    Data curation, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0455-8189
  10. Catarina F Moita

    Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    Contribution
    Data curation, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9910-2343
  11. Isa Santos

    1. Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    2. Serviço de Cirurgia, Centro Hospitalar de Setúbal, Setúbal, Portugal
    Contribution
    Validation, Investigation, Methodology
    Competing interests
    No competing interests declared
  12. Pedro Pereira

    Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  13. Silvia Carvalho

    Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  14. Filipa Batalha Martins

    Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  15. João A Ferreira

    Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  16. Sérgio Fernandes de Almeida

    Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, Portugal
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7774-1355
  17. Vladimir Benes

    EMBL Genomics Core Facilities, Heidelberg, Germany
    Contribution
    Data curation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0352-2547
  18. Josef Anrather

    Feil Family Brain and Mind Research Institute, Weill Cornell Medicine, New York, United States
    Contribution
    Resources
    Competing interests
    No competing interests declared
  19. Sebastian Weis

    1. Institute for Infectious Disease and Infection Control, Friedrich-Schiller University, Jena, Germany
    2. Department of Anesthesiology and Intensive Care Medicine, Jena University Hospital, Friedrich-Schiller University, Jena, Germany
    3. Leibniz Institute for Natural Product Research and Infection Biology, Hans Knöll Institute (HKI), Jena, Germany
    Contribution
    Visualization
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3201-2375
  20. Miguel P Soares

    Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    Contribution
    Resources
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9314-4833
  21. Arie Geerlof

    Institute of Structural Biology, Molecular Targets and Therapeutics Center, Helmholtz Zentrum München, Neuherberg, Germany
    Contribution
    Resources, Methodology
    Competing interests
    No competing interests declared
  22. Jacques Neefjes

    Department of Cell and Chemical Biology, LUMC, Leiden, Netherlands
    Contribution
    Resources, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6763-2211
  23. Michael Sattler

    1. Institute of Structural Biology, Molecular Targets and Therapeutics Center, Helmholtz Zentrum München, Neuherberg, Germany
    2. Bavarian NMR Centre, Department of Bioscience, School of Natural Sciences, Technical University of Munich, Garching, Germany
    Contribution
    Conceptualization, Data curation, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1594-0527
  24. Ana C Messias

    1. Institute of Structural Biology, Molecular Targets and Therapeutics Center, Helmholtz Zentrum München, Neuherberg, Germany
    2. Bavarian NMR Centre, Department of Bioscience, School of Natural Sciences, Technical University of Munich, Garching, Germany
    Contribution
    Conceptualization, Resources, Supervision, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    For correspondence
    ana.messias@helmholtz-muenchen.de
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5449-9922
  25. Ana Neves-Costa

    Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    Contribution
    Conceptualization, Data curation, Formal analysis, Supervision, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    arcosta@igc.gulbenkian.pt
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6506-7829
  26. Luis Ferreira Moita

    1. Innate Immunity and Inflammation Laboratory, Instituto Gulbenkian de Ciência, Oeiras, Portugal
    2. Instituto de Histologia e Biologia do Desenvolvimento, Faculdade de Medicina da Universidade de Lisboa, Lisbon, Portugal
    Contribution
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    lferreiramoita@gmail.com
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0707-315X

Funding

H2020 European Research Council (647888)

  • Angelo Ferreira Chora

Fundação para a Ciência e a Tecnologia (PTDC/BIMMEC/ 4665/2014)

  • Angelo Ferreira Chora

Fundação para a Ciência e a Tecnologia (EXPL/MED-IMU/0620/2021)

  • Ana Neves-Costa

Fundação para a Ciência e a Tecnologia (EXPL/MED-OUT/0745/2021)

  • Ana Neves-Costa

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

We are grateful to the Genomics Unit, Bioinformatics, and the Animal House at IGC. We thank Margarida Gama-Carvalho for the critical revision of the manuscript. This work was supported by the European Commission Horizon 2020 (ERC-2014-CoG 647888-iPROTECTION) and by Fundação para a Ciência e Tecnologia (FCT: PTDC/BIM-MEC/4665/2014 and EXPL/MED-IMU/0620/2021). SW is funded by the Deutsche Forschungsgemeinschaft, DFG, project number WE 4971/6-1, the Excellence Cluster Balance of the Microverse (EXC 2051; 390713860), and the Federal Ministry of Education and Research (BMBF) project number 01EN2001.

Ethics

All animal studies were performed in accordance with Portuguese regulations and approved by the Instituto Gulbenkian de Ciência ethics committee and DGAV (A011_2019).

Senior Editor

  1. Mone Zaidi, Icahn School of Medicine at Mount Sinai, United States

Reviewing Editor

  1. Yousef Abu-Amer, Washington University Medical Center, United States

Publication history

  1. Preprint posted: April 29, 2020 (view preprint)
  2. Received: January 31, 2022
  3. Accepted: November 29, 2022
  4. Accepted Manuscript published: December 7, 2022 (version 1)
  5. Version of Record published: December 21, 2022 (version 2)

Copyright

© 2022, Chora, Pedroso et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 734
    Page views
  • 129
    Downloads
  • 1
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Angelo Ferreira Chora
  2. Dora Pedroso
  3. Eleni Kyriakou
  4. Nadja Pejanovic
  5. Henrique Colaço
  6. Raffaella Gozzelino
  7. André Barros
  8. Katharina Willmann
  9. Tiago Velho
  10. Catarina F Moita
  11. Isa Santos
  12. Pedro Pereira
  13. Silvia Carvalho
  14. Filipa Batalha Martins
  15. João A Ferreira
  16. Sérgio Fernandes de Almeida
  17. Vladimir Benes
  18. Josef Anrather
  19. Sebastian Weis
  20. Miguel P Soares
  21. Arie Geerlof
  22. Jacques Neefjes
  23. Michael Sattler
  24. Ana C Messias
  25. Ana Neves-Costa
  26. Luis Ferreira Moita
(2022)
DNA damage independent inhibition of NF-κB transcription by anthracyclines
eLife 11:e77443.
https://doi.org/10.7554/eLife.77443

Further reading

    1. Immunology and Inflammation
    2. Microbiology and Infectious Disease
    Justin L Roncaioli, Janet Peace Babirye ... Russell E Vance
    Research Advance Updated

    Bacteria of the genus Shigella cause shigellosis, a severe gastrointestinal disease driven by bacterial colonization of colonic intestinal epithelial cells. Vertebrates have evolved programmed cell death pathways that sense invasive enteric pathogens and eliminate their intracellular niche. Previously we reported that genetic removal of one such pathway, the NAIP–NLRC4 inflammasome, is sufficient to convert mice from resistant to susceptible to oral Shigella flexneri challenge (Mitchell et al., 2020). Here, we investigate the protective role of additional cell death pathways during oral mouse Shigella infection. We find that the Caspase-11 inflammasome, which senses Shigella LPS, restricts Shigella colonization of the intestinal epithelium in the absence of NAIP–NLRC4. However, this protection is limited when Shigella expresses OspC3, an effector that antagonizes Caspase-11 activity. TNFα, a cytokine that activates Caspase-8-dependent apoptosis, also provides potent protection from Shigella colonization of the intestinal epithelium when mice lack both NAIP–NLRC4 and Caspase-11. The combined genetic removal of Caspases-1, -11, and -8 renders mice hyper-susceptible to oral Shigella infection. Our findings uncover a layered hierarchy of cell death pathways that limit the ability of an invasive gastrointestinal pathogen to cause disease.

    1. Computational and Systems Biology
    2. Immunology and Inflammation
    Anastasia O Smirnova, Anna M Miroshnichenkova ... Alexander Komkov
    Tools and Resources

    High-throughput sequencing of adaptive immune receptor repertoires is a valuable tool for receiving insights in adaptive immunity studies. Several powerful TCR/BCR repertoire reconstruction and analysis methods have been developed in the past decade. However, detecting and correcting the discrepancy between real and experimentally observed lymphocyte clone frequencies is still challenging. Here we discovered a hallmark anomaly in the ratio between read count and clone count-based frequencies of non-functional clonotypes in multiplex PCR-based immune repertoires. Calculating this anomaly, we formulated a quantitative measure of V- and J-genes frequency bias driven by multiplex PCR during library preparation called Over Amplification Rate (OAR). Based on the OAR concept, we developed an original software for multiplex PCR-specific bias evaluation and correction named iROAR: Immune Repertoire Over Amplification Removal (https://github.com/smiranast/iROAR). The iROAR algorithm was successfully tested on previously published TCR repertoires obtained using both 5' RACE (Rapid Amplification of cDNA Ends)-based and multiplex PCR-based approaches and compared with a biological spike-in-based method for PCR bias evaluation. The developed approach can increase the accuracy and consistency of repertoires reconstructed by different methods making them more applicable for comparative analysis.