A critical role for heme synthesis and succinate in the regulation of pluripotent states transitions

  1. Damien Detraux
  2. Marino Caruso
  3. Louise Feller
  4. Maude Fransolet
  5. Sébastien Meurant
  6. Julie Mathieu
  7. Thierry Arnould
  8. Patricia Renard  Is a corresponding author
  1. Laboratory of Biochemistry and Cell Biology (URBC), NAmur Research Institute for LIfe Sciences (NARILIS), University of Namur (UNamur), Namur, Belgium, Belgium
  2. Institute for Stem Cell and Regenerative Medicine, University of Washington, United States
  3. Department of Comparative Medicine, University of Washington, United States

Abstract

Using embryonic stem cells (ESCs) in regenerative medicine or in disease modeling requires a complete understanding of these cells. Two main distinct developmental states of ESCs have been stabilized in vitro, a naïve pre-implantation stage and a primed post-implantation stage. Based on two recently published CRISPR-Cas9 knockout functional screens, we show here that the exit of the naïve state is impaired upon heme biosynthesis pathway blockade, linked in mESCs to the incapacity to activate MAPK- and TGFβ-dependent signaling pathways after succinate accumulation. In addition, heme synthesis inhibition promotes the acquisition of 2 cell-like cells in a heme-independent manner caused by a mitochondrial succinate accumulation and leakage out of the cell. We further demonstrate that extracellular succinate acts as a paracrine/autocrine signal, able to trigger the 2C-like reprogramming through the activation of its plasma membrane receptor, SUCNR1. Overall, this study unveils a new mechanism underlying the maintenance of pluripotency under the control of heme synthesis.

Editor's evaluation

In their study, Detraux D and colleagues provide compelling evidence demonstrating a role for heme biosynthesis on FGF-ERK and TGF β signalling and exit from naïve pluripotency, and in controlling the 2-cell-like cell state. The observations and conclusions provided by the authors are convincing and potentially relevant in the field of pluripotent cell state transitions.

https://doi.org/10.7554/eLife.78546.sa0

Introduction

The development and regeneration of an organism are two processes held by stem cells. These cells possess unique features such as an unlimited capacity for self-renewal and the ability to differentiate into various cell types. With their pluripotent phenotype, embryonic stem cells (ESCs) retain the ability to differentiate into all cell types of the embryo. First in mouse (Martin, 1981; Evans and Kaufman, 1981), then later in human (Thomson et al., 1998), two main states of pluripotent stem cells have been described: the naïve ESCs, resembling the inner cell mass (ICM) of the pre-implantation embryo epiblast, and the primed ESCs, mirroring the epiblast of the post-implantation stage. While these cells represent timely close stages in embryo development, they display dramatic differences, such as developmental potential (Gafni et al., 2013; Ware et al., 2014), epigenetic landscape, X-chromosome inactivation pattern and metabolic activity (Sperber et al., 2015; Theunissen et al., 2016; Zhou et al., 2012; Sahakyan et al., 2017; Grow et al., 2015; Takashima et al., 2014; Nichols and Smith, 2009). Aside from these two pluripotent stages, ESC culture is known to be very heterogenous in terms of pluripotent or epigenetic marker expression (Sustáčková et al., 2012). Interestingly, a small population (representing about 1 %) of mouse ESCs grown in naïve conditions displays features of the two-cell stage embryo (2C-like population or 2CLCs) exhibiting extended potential (Macfarlan et al., 2012). This subset also displays the expression of 2C-specific genes such as the Zscan4 cluster, the retro-transposable element MuERVL or the master regulator DUX (Macfarlan et al., 2012; Percharde et al., 2018; Ishiuchi et al., 2015), a disappearance of chromocenters and loss of the core pluripotency protein OCT4 (Macfarlan et al., 2012). However, despite the well-known differences between the different pluripotent states, little is understood about the molecular mechanisms governing the transition between them.

Several studies have started to address the question of the naive-to-primed ESC transition using different screening methods to identify genes controlling this transition (reviewed in Li et al., 2020). Notably, a few studies have revealed mTORC1/2 as a critical component for the naïve-to-primed transition (Mathieu et al., 2019; Li et al., 2018; Duggal et al., 2015) that regulates key developmental pathways such as Wnt signaling (Sperber et al., 2015; Mathieu et al., 2019; Xu et al., 2016; Taelman et al., 2019). Among the hits of the different screens, we observed the recurrence of genes involved in the heme biosynthesis pathway. This pathway, starting in mitochondria, uses succinyl-CoA and glycine as starting material. It then proceeds to successive cytosolic reactions before ending by the formation of the heme molecule in the mitochondrial matrix. Although largely studied in hematopoietic stem cells, the roles of this biosynthetic pathway and this metabolite have never been studied in the context of pluripotency. In this study, we demonstrate the incapacity of mouse ESCs (mESCs) to exit from naïve toward the primed state under heme synthesis inhibition, a process caused by the inability to activate the core MAPK and TGFβ-SMADs signaling pathways due to an accumulation of extramitochondrial succinate. We also show that heme synthesis inhibition in naïve mESCs favors the emergence of 2CLCs in the cell population. This effect is heme-independent as hemin supplementation does not prevent it. We next demonstrate that the reprogramming in 2C-like state upon heme biosynthesis inhibition is actually caused by the accumulation and release of succinate derived from the heme synthesis inhibition, acting as both paracrine and autocrine signals.

Results

Murine ESCs are dependent on heme biosynthesis to properly transition to the primed stage

In order to unveil the pathways required for the naïve-to-primed ESC transition, we compared the results of whole genome CRISPR-Cas9 screens previously published for mouse and human ESCs (Mathieu et al., 2019; Li et al., 2018). The significant hits (p val <0.05) were submitted to the DAVID functional annotation tools. For the human screen, positive hits for apoptosis were removed. Indeed, since a negative selection was applied to induce the death of primed human ESCs (hESCs), cells that acquired a resistance to cell death by mutating genes involved in apoptosis would be spared. Figure 1a displays the top Gene Ontologies (GO) for the DAVID biological processes showing ‘heme biosynthetic process’ as one of the most enriched in both studies (Mathieu et al., 2019; Li et al., 2018). Seven out of 8 enzymes of this metabolic pathway (ALAD, PBGD, UROS, UROD, CPOX, PPOX, and FECH) came out as positive hits in the CRISPR screen during the naïve-to-primed mESC transition. In hESCs, only the 4 cytosolic enzymes (PBGD, UROS, UROD, and CPOX) were highlighted. In both models, the expression of these genes both in vitro and in vivo is not modified Table 1. Together, the results stress the importance of this metabolic pathway for the naive-to-primed transition, although its role in non-hematopoietic stem cells is poorly understood.

Figure 1 with 1 supplement see all
Heme synthesis inhibition impairs the exit of mESCs from the naïve state; effect mediated by heme.

(a) DAVID biological processes GO enrichment from two independent CRISPR-Cas9 screens for the naive state exit, in mouse (left panel) (Li et al., 2020) and in human (right panel) (Mathieu et al., 2019). The heme biosynthetic pathway is highlighted In red. (b) Relative expression of naïve and primed markers of mESCs in naïve conditions (2iL), in transition for 2 days to the Epi stage (EpiLC) with or without 0.5 mM succinylacetone as heme synthesis inhibitor (EpiLC +SA) and 10 µM hemin supplementation (EpiLC +SA + H), assessed by RT-qPCR relative to Gapdh expression (Tfcp2l1, transcription factor CP2-like 1; Esrrβ, estrogen-related receptor β; Klf2/4, Kruppel-like factor 2/4; Tbx3, T-Box Transcription Factor 3; Fgf5/15, fibroblast growth factor-5/15; Zic2, zic family member 2; Otx2, homeobox protein 2). Results expressed as mean +/-S.D. *p<0.05, **p<0.01, ***p<0.001. ANOVA-1. n=3 independent biological replicates. (c) Western blot analysis of the protein abundance of OTX2 and DNMT3A relative to GAPDH as a loading control for cells in naïve conditions (2iL), in transition for 2 days to the Epi stage (EpiLC) with 0.5 mM SA (+SA) and 10 µM hemin (+H) supplementation. Representative blot of three biological replicates. (d) Phase contrast micrographs of cells in naive (2iL), or in transition to the primed (EpiLC) state with treatment with SA and hemin (H). Scale bar = 50 μm. Confocal micrographs of mESCs in naive stage or in transition for TFE3 (Transcription Factor Binding To IGHM Enhancer 3) and KLF4, in green. Scale bar = 20 μm. TFE3 n=3 and KLF4 n=3 biological replicates (e) Principal component analysis (PCA) of the normalized RNAseq data transcripts.

Figure 1—source data 1

Raw uncropped and annotated western blot images for Figure 1c.

https://cdn.elifesciences.org/articles/78546/elife-78546-fig1-data1-v2.zip
Table 1
Relative expression of heme synthesis enzymes.

(a) Fold change expression of the 8 enzymes of the heme synthesis pathway, based on normalized data from bulk RNAseq or proteomics analysis, extracted from published datasets. (b) Normalized gene expression counts of heme synthesis enzymes from in vivo mouse blastocysts analyzed by RNAseq.

aHuman ESCsMouse ESCsbMouse blastocysts
SourceDi Stephano et al.Grow et al.Sperber et al.Nakamura et al.This studyNakamura et al.
TypeProteomicsTranscriptomicsStageE4.5E5.5E6.5
EnzymeALAS0,70,881,220,950,851,016Alas171216
ALAD0,470,290,810,960,540,92Alad402233
HMBS1,430,841,221,271,150,81Hmbs736560
UROD1,121,050,621,101,330,64Uros2,25,45,7
UROS2,091,580,781,120,500,75Urod435380
CPOX1,242,071,021,251,120,87Cpox221314
PPOX2,091,541,161,371,250,56Ppox1477
FECH0,981,101,280,771,061,30Fech82628

Experimentally, to trigger the exit of the naïve mESC state, the serum-free media with naïve cytokines cocktail (LIF; CHIR99021 and PD0325901; 2iL) is switched to a media with fibroblast growth factor 2 (FGF2) and activin A for 48 hr, allowing mESCs to gain post-implantation features (EpiLC). Using succinylacetone (SA) to inhibit heme synthesis, by interfering with ALAD activity (Sassa and Kappas, 1983), and 10 μM of hemin for its rescue, we show that, when mESCs are pushed for 48 hr to exit the naïve stage (EpiLC) in the presence of SA (EpiLC +SA), the expression of the primed gene markers Fgf5, Fgf15, Otx2, Oct6, Dnmt3a, and Zic2 is significantly reduced (Figure 1b). In addition, the loss of expression for naïve markers (Esrrb, Tfcp2l1, Klf2-4, and Tbx3) is partially prevented in these conditions. This was confirmed at the protein level by a decrease in the abundance of OTX2 and DNMT3A analyzed by western blot (Figure 1c) and the increase in the abundance of KLF4 by immunofluorescence, when cells were treated with SA during the transition (Figure 1d). Furthermore, the subcellular localization of TFE3, mainly nuclear in naïve cells and only cytosolic in primed cells (Mathieu et al., 2019; Betschinger et al., 2013), remains nuclear in the presence of SA (Figure 1D). Hemin supplementation restores the gene expression, the protein abundance and the subcellular localization of TFE3 to levels similar to those found in cells incubated without SA (Figure 1a–d). To consolidate this, we then generated an ALAD KO line, which was maintained in culture with hemin supplementation to avoid degeneration. In accordance with the results obtained with SA, removal of hemin during the transition perturbed the exit from the naive state (Figure 1—figure supplement 1). Finally, principal component analysis (PCA) of the normalized gene expression from RNA sequencing also reveals the segregation of the cells treated with SA (EpiLC + SA) from either the controls (EpiLC) or the cells rescued with hemin (EpiLC +SA + H) (Figure 1e). An impairment of the naïve state exit is also observed to some extent in human ESCs (Elf1 cell line) when pushed to exit in TeSR for 4 days (Figure 1—figure supplement 1c). Overall, these results confirm the functional screen data by showing that the inhibition of heme biosynthesis impairs the naive-to-primed mESC transition.

Heme synthesis inhibition prevents the activation of key signaling pathways associated with implantation

Heme deficiency is canonically sensed in mammals through the nuclear factor BACH1 (reviewed in Zhang et al., 2018), increasing its nuclear localization or the activation of the integrated stress response (ISR; reviewed in Pakos-Zebrucka et al., 2016) through the action of the heme-regulated inhibitor (HRI). While we did not observe an accumulation of BACH1 in the nucleus following SA treatment (Figure 2—figure supplement 1a), we did observe an increase in EIF2α phosphorylation and a reduction in global protein translation, both showing activation of the ISR (Figure 2—figure supplement 1b-c). However, activation of this pathway with a chemical activator of HRI, BTdCPU (Chen et al., 2011), effectively reducing protein translation to the extent of SA, did not prevent the exit from the naive stage (Figure 2—figure supplement 1d-e). Thus, to identify the mechanisms involved in the failure of the cells to properly undergo the transition, we performed a gene set enrichment analysis (GSEA) with the KEGG pathways (Kyoto Encyclopedia of Genes and Genomes) between EpiLC and EpiLC +SA RNAseq data. While genes involved in xenobiotic detoxification or cytochrome P450 are expected to be upregulated in response to SA-induced heme deprivation (Vinchi et al., 2014; Lämsä et al., 2012), many crucial signaling pathways involved in development are shown negatively enriched in SA-treated condition (Figure 2a). We thus focused our attention on the pathways directly associated with the naive-to-primed transition that is triggered by the combined presence of FGF2 and activin A in the growth culture medium, especially since detailed analysis of the PC loadings driving the PC2 separation (Figure 1e) highlights several SMAD pathway-related proteins (Figure 2—figure supplement 1f). On the one hand, the MAPK-ERK1/2 pathway (downstream of FGF2) was not activated in EPI +SA cells, as shown by the absence of phosphorylation of ERK1/2 (Figure 2—figure supplement 1g). On the other hand, the activin A-SMAD pathway activation was also compromised as shown by the difference in nuclear localization of SMAD2/3 when compared to the EpiLC cells (Figure 2—figure supplement 1h) or SMAD3 phosphorylation (Figure 2b–c). Interestingly, chemical inhibition of those two pathways by 1 μM PD0325901 (MEKi) and 5 μM SIS3 (TGFβ-SMADi) (Figure 2—figure supplement 1g-h) shows that the inhibition of the SMAD translocation mimics the transition defects observed with SA as revealed by the gene expression analysis of naive and primed markers (Figure 2—figure supplement 1i). This pathway inhibition was especially observed after 24 h of treatment, and concomitant with the defect in gene expression (Figure 2b–d). Addition of two- or threefold increased doses of activin or FGF2 did not rescue the gene expression pattern, indicating a strong inhibition (Figure 2—figure supplement 1j). Mechanistically, previous reports have shown that heme biosynthesis consumes a lot of the glycine and succinyl-CoA precursors in the mitochondria, acting as some sort of ‘succinyl-CoA sink’ (Atamna, 2004). We thus hypothesized that heme synthesis inhibition would increase the abundance of succinyl-CoA in mitochondria, that could then exit the organelle in the form of succinate and accumulate in other cell compartments (Atamna, 2004). The accumulation of succinate precursor is reinforced by the observed decreased abundance of the succinate dehydrogenase (SDH), consuming succinate in the TCA, known to be destabilized by the loss of heme (nicely reviewed in Kim et al., 2012; Figure 2e). Together, these results indicate a possible accumulation of succinate in response to heme synthesis inhibition, that could potentially cause the transition defect. To test this hypothesis, we used butylmalonate (BM), an inhibitor of the dicarboxylate carrier (DIC; SLC25A10), to prevent leakage of succinate from the mitochondrial matrix to the cytosol (Mills et al., 2018), and this nicely resumed the transition as shown by the gene expression profile of mESCs in the EpiLC + SA + BM condition (Figure 2f).

Figure 2 with 1 supplement see all
SA prevents the activation of the MAPK and Activin A-SMAD pathways during the mESC transition through the cytosolic accumulation of succinate.

(a) GSEA performed on RNAseq data were analyzed for KEGG pathways. Up- and Down-regulated KEGG pathways in EpiLC + SA versus EpiLC Ctl, represented as normalized enrichment scores (NES). (b) Western blot analysis of the time course protein abundance of SMAD3 and phospho-SMAD3 relative to GAPDH as a loading control for cells in naïve conditions (2iL), in transition for up to 2 days to the Epi stage (EpiLC) with 0.5 mM SA as heme synthesis inhibitor. Representative blot of 5 biological replicates, and quantified in (c). (d) Time course gene expression analysis of Fgf5 and Tbx3 assessed by RT-qPCR, expressed as mean +/-S.D. ANOVA-2. n=5 independent biological replicates. (e) Western blot analysis of SDHB during the transition, relative to GAPDH as loading control. Representative blot of 2 biological replicates. (f) Relative expression of naïve and primed markers of mESCs in naïve conditions (2iL), in transition for 2 days to the Epi stage (EpiLC) with or without 0.5 mM SA (EpiLC + SA), 1 µM butylmalonate (+BM) or 5 µM of Sirt7 inhibitor supplementation, assessed by RT-qPCR relative to Gapdh expression. n=3 independent biological replicates. ANOVA1 (g) Median fluorescence intensity of succinyllysine residues measured by flow cytometry for mESC in transition with 5 µM Sirt7 inhibitor (Sirt7i). n=3 independent biological replicates, ANOVA1. (h) Representative western blot analysis of the abundance of the total and phosphorylated forms of SMAD3 and ERK1/2, using GAPDH as loading control, for mESC in transition with a Sirt7 inhibitor (Sirt7i), and quantified in (i).

Figure 2—source data 1

Raw uncropped and annotated western blot images for Figure 2b.

https://cdn.elifesciences.org/articles/78546/elife-78546-fig2-data1-v2.zip
Figure 2—source data 2

Raw uncropped and annotated western blot images for Figure 2e.

https://cdn.elifesciences.org/articles/78546/elife-78546-fig2-data2-v2.zip
Figure 2—source data 3

Raw uncropped and annotated western blot images for Figure 2h.

https://cdn.elifesciences.org/articles/78546/elife-78546-fig2-data3-v2.zip

Succinate accumulation and/or SDH ablation is known to increase protein lysine succinylation (Smestad et al., 2018), an effect that is observed upon SA treatment and that we mimicked by inhibiting Sirt7, a cytosolic and nuclear desuccinylase (Figure 2g). The ability of this molecule to mimic SA in the pathway’s inhibition (Figure 2h–i) and to prevent the exit of the naive state (Figure 2f) points at succinylation events as the cause of the transition defects.

Blockade of heme synthesis in naive mESCs triggers the activation of a 2C-like program

In addition to this defect in the exit from the naive state, we found that treatment of naïve 2iL cells with SA also modifies the global gene expression as 2iL + SA samples cluster away from 2iL control cells when analyzed by PCA performed on RNAseq data (Figure 3a). Our attention was thus drawn on markers reported to be expressed in the two-cell embryo. Indeed, a small proportion of the mESC population actually expresses a gene signature reminiscent of the 2 C stage, these cells thus called 2C-like cells (2CLCs) (Macfarlan et al., 2012). Indeed, the expression of the 142 genes previously identified as upregulated in this 2C-like population (Macfarlan et al., 2012) was statistically upregulated in 2iL versus 2iL + SA (Figure 3b) and this was further confirmed by RT-qPCR for a selection of the most common markers (Figure 3c) and further supported by the upregulation of the 2CLC markers in ALAD KO mESCs (Figure 3d). As the studies that characterize this 2C-like population report an important heterogeneity at the population level (Macfarlan et al., 2012; Eckersley-Maslin et al., 2016), we quantified the fraction of ZSCAN4+ and MUERVL-GAG+ cell populations by immunostaining followed by confocal microscopy observations. As shown in Figure 3e and f, treatment with SA increases the fraction of 2C-like cells by two to three folds. A similar trend is observed for genes involved in the ZGA for hESCs (Taubenschmid-Stowers et al., 2022; Figure 3g).

Heme synthesis inhibition pushes mESCs toward a 2C-like stage.

(a) Principal component analysis (PCA) of the normalized RNAseq data transcripts of naïve mESCs (2iL) treated for 48 hr with 0.5 mM SA ± 10 μM Hemin. (b) Boxplot of mean Log2FC of 2 C markers defined in Macfarlan et al., 2012 or all analyzed mRNAs in 2iL +SA versus 2iL control cells. Statistical significance is calculated by Student T-test. p<0.001. (c) Relative expression of 2 C gene markers of mESCs assessed by RT-qPCR relative to Gapdh expression and to 2iL naive control represented as a Tukey box and whisker plot. The line represents the median and the +is the mean. Oct4=octamer-binding transcription factor 4, Muervl = murine endogenous retrovirus-like, Dux = double homeobox, Zfp352=Zinc-finger protein 352, Tcstv1=2-cell-stage variable group member 1, Dub1=Ubiquitin Specific Peptidase 36, Zscan4c=Zinc Finger And SCAN Domain Containing 4, isoform c. n=9. (d) Gene expression analysis of 2CLC markers of ALAD KO mESCs grown for 2 days with or without 10 µM Hemin, assessed by RT-qPCR. n=3 biological replicates. ANOVA1 (e) Immunostaining of ZSCAN4 or MUERVL-GAG in untreated naive cells (2iL control) or treated with SA at 0.5 mM. DAPI is used as a nuclear counterstain. Scale bar = 20 μm. (f) Percentage of MUERVL- or ZSCAN4-positive cells in the whole population of naïve (2iL) mESCs or naïve treated or not with SA (2iL SA), counted from confocal micrographs as in (f) with 10 images per condition for at least 1000 cells per condition. n=4 independent biological replicates. Results expressed as mean +/-S.D. ** p<0.01; T-Tests. (g) Relative expression of ZGA related genes in hESCs assessed by RT-qPCR relative to TBP expression and normalized to naive 2iL +IGF + FGF2 (2iLIF) control, with or without 0.5 mM of SA. n=3 independent biological replicates. Results expressed as mean +/-S.D. * p<0.05, **p<0.01, ***p<0.001; t-tests.

The induction of the 2C-like program is succinate-dependent

Interestingly, and as opposed to the naive-to-primed setup, the observed phenotype seems independent of heme as it is not rescued by hemin supplementation (Figure 4a–b). We thus investigated the putative role of succinate accumulation in the phenotype. The abundance of succinylated proteins in naive cells treated or not with SA was assessed using a pan-succinyllysine antibody in confocal microscopy and in flow cytometry (Figure 4c). In basal conditions, the bulk of succinyllysine modifications are located in the mitochondria (Figure 4—figure supplement 1), as expected. However, a dramatic increase in the signal associated with succinylated proteins is observed in all subcellular compartments when heme synthesis is inhibited, an effect that is not (or very partially) rescued upon hemin supplementation (Figure 4c). We then postulated that blocking the exit of this metabolite from mitochondria would prevent the acquisition of widespread succinyl-lysine post-translational modifications and impair the acquisition of the 2C-like cells markers, only if this phenotype is dependent on increased succinate concentration. As hypothesized, addition of BM combined to SA is correlated to a rescue of both the increase in 2 C markers and the proportion of ZSCAN4 or MUERVL-positive cells in the population (Figure 4a and d). Altogether, this shows that an accumulation of extra-mitochondrial succinate upstream of heme synthesis in naive mESCs induces a 2C-like phenotype, reinforced by the inability of glycine to induce same effect (Figure 4a). In order to observe the levels of protein succinylation, and by extension the levels of succinate, in endogenous 2CLCs of the mESC population, we took advantage of a previously described reporter cell line for this 2C-state, characterized by the stable insertion of a construct containing a turboGFP-coding gene under the control of the MUERVL long terminal repeat (2 C:::turboGFP; Ishiuchi et al., 2015; Rodriguez-Terrones et al., 2020). The simultaneous observation of the endogenous GFP fluorescence, the absence of OCT4 (Macfarlan et al., 2012) and the immunostaining of the succinyl-lysine residues showed an increase in protein succinylation specifically in the 2C-like cells (GFP+; OCT4-) sub-population, as quantified by flow cytometry (Figure 4e–f).

Figure 4 with 1 supplement see all
mESC ‘2C-like’ reprogramming by SA is due to extramitochondrial succinate accumulation.

(a) Relative expression of 2 C markers of mESCs assessed by RT-qPCR relative to Gapdh expression and normalized to 2iL naive control, in mESCs treated for 2 days with 0.5 mM SA (2iL SA), with or without 10 μM Hemin (2iL SA + H), 1 μM diethyl butylmalonate (2iL SA + BM), 1 μM BM alone (BM) or 10 mM glycine. S.D. * p<0.05, **p<0.01, ***p<0.001. ANOVA-1. n=3–6 independent biological replicates. (b) Boxplot of mean Log2FC of 2 C markers defined in Macfarlan et al., 2012 or all analyzed mRNAs in 2iL + SA + H versus 2iL control cells. Statistical significance is calculated by Student T-test. p<0.001. (c) Immunostaining of succinylated lysine residues (green) in mESCs treated for 2 days with 0.5 mM SA, with or without 10 μM Hemin (SA + Hemin) and quantified by flow cytometry. Representative image of n=3 independent experiments. Scale bar = 20 μm. Results expressed as median fluorescence +/-S.D. * p<0.05, **p<0.01; ANOVA-1 (d) Percentage of MUERVL or ZSCAN4-positive cells in the whole population of naïve (2iL) mESCs or naive cells treated for 2 days with SA (2iL SA) with or without 10 μM hemin (2iL SA + H) or 1 μM diethyl butylmalonate (2iL SA + BM). n=4 independent biological replicates. Results expressed as mean +/-S.D. * p<0.05, **p<0.01, ***p<0.001; ANOVA-1. (e) Immunostaining of succinyllysine residues (Red) and Oct4 (cyan) of TBG4 cells (ES-E14TG2a mESCs with a 2C-GFP (green) reporter construct) (Mills et al., 2018). Representative image of n=3 independent experiments. Scale bar = 20 μm. Arrows indicate 2CLCs according to the GFP reporter. (f) Quantification of the median fluorescence intensity of the succinyllysine residues in the GFP +and GFP- populations of TBG4 mESCs separated by flow cytometry. n=4 independent biological replicates. * p<0.05, T-test.

Since we showed that the increase in the reprogramming of some mESCs to a 2C-like state after heme synthesis inhibition was the result of succinate exit from mitochondria, we then aimed to further confirm these results, by inducing a mitochondrial accumulation of succinate, independently of heme biosynthesis inhibition, using Atpenin A5 (AA5), an SDH inhibitor (Miyadera et al., 2003). AA5 induces the protein lysine succinylation (Figure 5a), an increase in the number of ZSCAN4-positive cells (Figure 5b) and the expression of 2 C markers (Figure 5c and e). These effects were counteracted by the addition of BM to prevent the succinate exit from the mitochondria (Figure 5b), confirming the involvement of succinate in the process.

Figure 5 with 2 supplements see all
Inhibition of SDH leading to an increase in succinate accumulation recapitulates the increase in 2CLCs due to a leakage to the extracellular space.

(a) Immunostaining of succinylated lysine residues (green) in mESCs in 2iL media or treated with 250 nM AA5. Representative image of n=3 independent experiments and quantified by flow cytometry. T-test. Scale bar = 20 μm (b) Percentage of ZSCAN4-positive cells in the whole population of naïve (2iL) mESCs or naïve treated with 250 nM AA5, with or without 1 μM diethyl butylmalonate (BM), counted from confocal micrographs with 10 images per conditions for at least 1000 cells per condition. n=3 independent biological replicates. ANOVA1 (c) Relative expression of the 2CLC genes in response to 250 nM AA5 or 0.5 µM retinoic acid (RA), with or without 10 µM HX531 and 100 nM AGN193109. (d-e) Relative expression of 2C-gene markers of mESCs assessed by RT-qPCR relative to Gapdh expression in naïve 2iL mESCs and treated with 16 mM dimethyl succinate, 40 mM sodium succinate (Na succinate), 1 μM of MCT1 and 4 inhibitor (AZD3965; AZD) and 1 μM SUCNR1 receptor antagonist (NF-56-EJ40; NF56). Data shown as mean +/-S.D. *p<0.05, **p<0.01, ***p<0.001. ANOVA-1 followed by a Tukey post-test. n=4 independent biological replicates. (f) Graphical representation of the succinate-induced 2CLC reprogramming. Created with https://www.biorender.com/.

Succinate acts through the activation of its receptor, SUCNR1, to trigger the 2C-like program

Once in the cytosol, succinate could either inhibit the α-ketoglutarate (αKG)-dependent-dioxygenases or exit the cell through the monocarboxylate transporters (MCTs) and act as an extracellular signal molecule. Indeed, succinate is a reaction product of hydroxylation reactions catalyzed by αKG-dependent dioxygenases. Three families of dioxygenases are known to be sensitive to an increase in succinate concentration: the prolyl-hydroxylases (PDHs), the Ten-eleven translocation (TET) methylcytosine dioxygenases and the histone demethylases (HDM). Of these three classes, we ruled out a role for PHDs, responsible for HIF1α degradation, as the abundance of this transcription factor was not increased by SA nor by AA5 treatment, demonstrating a lack of stabilization following a putative PHD inhibition (Figure 5—figure supplement 1). Since recent reports in the literature have highlighted a crucial role of the epigenetic landscape and a role of the TET proteins in the acquisition of the 2CLC phenotype (Eckersley-Maslin et al., 2016; Huang et al., 2021; Schüle et al., 2019; Lu et al., 2014; Yang et al., 2016), we then focused our attention on the histone 3 (H3) and DNA methylation landscapes and observed a robust increase in the amount of trimethylation of lysines 4, 9, and 27 of H3 (H3K4,-K9, -K27) along with an increase in the global abundance of 5mC when mESCs were treated with either SA or AA5 (Figure 5—figure supplement 2a-d). However, chemical inhibition of HDMs by JIB04 (Wang et al., 2013) and/or TET by TETin-C35 (Singh et al., 2020) does not trigger a rise in the proportion of 2CLCs or in 2 C marker expression (Figure 5—figure supplement 2e-f). We then suspected that succinate could act instead as a paracrine signal after its release in the extracellular media. Indeed, exogenous supplementation with a membrane impermeable (sodium succinate) or permeable (dimethylsuccinate) form of succinate were able to increase the 2CLC marker expression (Figure 5d). We further found that inhibition of the succinate exit through the plasma membrane, by targeting MCT1 and 4 with the AZD3965 inhibitor (Beloueche-Babari et al., 2017; Reddy et al., 2020) combined to inhibition of the succinate receptor SUCNR1 by NF-56-EJ40 (Haffke et al., 2019) is able to bring down the rise in 2CLC marker expression triggered by AA5 (Figure 5e). Recent reports have shown that retinoic acid (RA) also increases the 2CLC population, an effect mediated by the retinoic acid receptor RAR but not the RXRs (Iturbide et al., 2021). While the induction of the 2CLC gene signature in response to AA5 is similar to RA, the mode of action seems to involve both RAR and RXR since the effect is rescued by addition of both inhibitors, AGN193109 and HX531, respectively (Figure 5c). These findings strongly support succinate acting as a paracrine/autocrine signal upstream of RAR/RXR transcriptional activity. Together, these sets of data highlight the critical role of succinate in the acquisition and maintenance of pluri/totipotent states in mESCs by a totally new mechanism.

Discussion

The comparison of two different genome-scale CRISPR screens in the exit of the naïve state of mouse and human ESCs (Mathieu et al., 2019; Li et al., 2018) revealed the importance of heme biosynthesis for the transition to another pluripotent state, the primed state. Using succinyl acetone (SA), a specific inhibitor of ALAD that catalyzes the second reaction of the pathway, and hemin to rescue the heme defect, we first confirmed the requirement of this pathway for the naive-to-primed transition in mESCs. This is in accordance with the embryonic lethality at the implantation stage of mouse embryos knockout for the heme synthesis pathway enzymes since the naive-to-primed transition recapitulates, in vitro, this critical step (shown for HMBS Lindberg et al., 1996, UROS Bensidhoum, 1998, UROD Phillips et al., 2001, CPOX Conway et al., 2017 and FECH Magness et al., 2002). RNAseq analysis of naïve cells undergoing transition to the primed stage in the presence of SA with or without addition of hemin revealed a failure to properly activate the MAPK and TGFβ-SMAD pathways in response to heme biosynthesis inhibition. It has been previously demonstrated that the proper activation of these two pathways is required to proceed with the transition to the primed stage (Tsanov et al., 2017; Jiapaer et al., 2018; Senft et al., 2018; Arman et al., 1998). While the inhibition of SMAD3 was able to mimic the effect observed by heme synthesis inhibition, the inhibition of MAPK by MEK inhibition proved to be inefficient at blocking the process, in contradiction to its role in the progression of pluripotency (Tsanov et al., 2017; Jiapaer et al., 2018; Arman et al., 1998). Such a connection between heme synthesis inhibition and signaling pathways has only been reported once in PC12 neuronal cells, with SA blocking the activation of the MAPK despite the presence of nerve growth factor (NGF) (Zhu et al., 2002). Thus, it seems to be a conserved mechanism among various cell identities/types, as it is also observed in our study for cells responding to FGF2 signals. While the link between heme and these crucial signaling pathways remains unknown, it brings to light a crucial importance of this metabolite and its synthesis pathway, so far poorly understood, in the context of pluripotency.

Aside from its effect on the exit of the naïve stage, we showed here that the inhibition of heme synthesis also triggers a reprogramming toward a 2C-like stage. Indeed, mESCs cultured in 2iL conditions have been previously defined as a heterogenous population that naturally includes a small percentage of cells displaying features of the two-cell stage embryo (Macfarlan et al., 2012; Rodriguez-Terrones et al., 2020). Interestingly, this 2CLC population is transient and cycles back and forth to a naive pluripotency state (Macfarlan et al., 2012; Fu et al., 2020). Unexpectedly, heme synthesis inhibition favors this reprogramming as shown by the increase in 2C-like markers in the whole population and the proportion of ZSCAN4 or MUERVL-positive cells. Strikingly, this effect is clearly dependent on the accumulation of succinate as it is (i) not rescued by hemin, (ii) blocked by inhibition of the mitochondrial succinate transporter and (iii) phenocopied by SDH inhibition. Additionally, MUERVL-positive cells spontaneously emerging in naïve ESC colonies endogenously display a high level of succinylated proteins, supporting a role for this metabolite in the identity of the 2C-like state. The role of several metabolites in the gain of 2CLC features has already been recently unveiled, highlighting a role for acetate, lactate, and D-ribose (Rodriguez-Terrones et al., 2020). This metabolite screening also showed a positive effect of succinate on the 2C-like features acquisition. Beyond its role in the cellular metabolism, we show here that the succinate accumulation outside mitochondria leads to a global reduction in cytosine demethylation activity of the TETs and histone demethylation as previously observed in cancers after accumulation of succinate or SDH mutations (Letouzé et al., 2013; Xiao et al., 2012). However, previous reports are somewhat discordant regarding the role of TETs in the acquisition of the 2CLC phenotype as their effect seems to be dependent on their interacting partners (Eckersley-Maslin et al., 2016; Huang et al., 2021; Schüle et al., 2019; Lu et al., 2014). For example, while TET2 could cooperate with PSPC1 (Paraspeckle Component 1) to reduce the expression of the retrotransposon MuERVL (Guallar et al., 2018), binding of the TET proteins with SMCHD1 (structural maintenance of chromosomes flexible hinge domain containing 1) prevents the demethylation of the Dux gene locus and thus prevents its expression (Huang et al., 2021). Succinate accumulation would result in a global decrease in the activity of all 3 TET isoforms, resembling those of a TET triple KO, already shown to induce the 2 C phenotype (Lu et al., 2014). The methylation landscape of histones, especially H3, is also highly dynamic both in vivo, at the time of the zygote genome activation (ZGA) that takes place at the 2C-stage, and in the 2CLC conversion with remodeling of H3K4me3, H3K9me3, and H3K27me3 (Zhang et al., 2021; Wang et al., 2018; Yang et al., 2022) (extensively reviewed in Xia and Xie, 2020). Similarly to the situation with the TETs, the action of HDM on the loss or acquisition of 2C-like features in vitro is complex, as loss of KDM1a (lysine demethylase 1 a) is shown to promote the expression of Zscan4 and MuERVL (Macfarlan et al., 2011) whereas loss of KDM5a and b decreases the expression of the markers and blocks the ZGA in vivo (Dahl et al., 2016). However, while the literature highlights a role for these modifications of the epigenetic landscape in the 2CLC emergence, this is not supported by the data presented here. This discrepancy could be due to differences in the culture conditions, as these previous studies use mESC grown in serum +LIF conditions, while we use ground naïve mESCs (in 2iL and serum-free culture). Such difference has been previously described in the establishment of another pluripotent state of ESCs, the paused state (Xu et al., 2022). Interestingly, instead of an epigenetic rewiring as the major cause of 2CLC reprogramming, our data shed light on succinate acting as a paracrine/autocrine signal, able to trigger the emergence of 2CLCs by an MCT-dependent export and the activation of SUCNR1 expressing cells. Further studies are now needed to precisely dissect which downstream actors are truly responsible for the activation of the 2 C transcriptional program.

Our study thus brings an additional and different example of metabolic control of pluripotency, and adds succinate to previously reported metabolites such as S-adenosylmethionine (SAM) (Sperber et al., 2015), alpha-ketoglutarate (αKG) (Carey et al., 2015; Tischler et al., 2019), glutamine (Tohyama et al., 2016), acetyl-CoA (Moussaieff et al., 2015), lactate or D-ribose (Rodriguez-Terrones et al., 2020) that are known to regulate the pluripotent states mostly through their contribution to modifications of the epigenetic landscape (reviewed in Tsogtbaatar et al., 2020). In addition to these previous studies, we highlight a role of succinate that goes beyond epigenetic landscape regulation but instead influences pluripotency regulation through protein succinylation and a paracrine effect. Further emphasis on the importance of succinate in early development is also demonstrated by the embryonic lethality of the SDH subunits in mice (Piruat et al., 2004; Siebers et al., 2018; Lepoutre-Lussey et al., 2016; Takács-Vellai et al., 2021). Altogether, these results indicate a critical role of both heme and succinate in the progression of the pluripotency continuum, ranging from the 2CLCs on one hand and to the acquisition of primed pluripotency on the other.

Materials and methods

Cell culture and ALAD ko generation

Request a detailed protocol

mESCs (ES-E14TG2a) or tbg4 mESCs (described in Ishiuchi et al., 2015) were cultured in N2B27 medium consisting of a 1:1 mixture of DMEM/F12 (Gibco, 31330–038) and Neurobasal Medium (Gibco, 21103–049) supplemented with 1 x N-2 Supplement (Gibco, 17502–048), 1 x B-27 Supplement (Gibco, 17504–044), 1/100 penicillin-streptomycin (Gibco, 15140–122), 1 x MEM nonessential amino acids (NEAA) (Gibco, 11140–035), 1 x GlutaMAX (Gibco, 35050–038), 1 x sodium-pyruvate (Gibco, 11360–039) and 0.1 mM β-mercaptoethanol (Gibco, 31350–010). Naïve mESCs were maintained on 0.2% gelatin (Sigma, G1393)-coated plates at a density of 50,000 cells/cm2 and in N2B27 medium complemented with 103 U/ml of mLIF (ESGRO, ESG1107), 3 μM of GSK3 inhibitor (CHIR99021) (Peprotech, 2520691) and 1 μM of MEK inhibitor (PD0325901) (referred to as 2iL) (SelleckChem, S1036). Cells were passaged every 2–3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 min and counted before seeding. The transition to EpiSC was obtained by transferring naïve mESCs on 15 μg/ml fibronectin (Gibco, 33010–018)-coated plates at a density of 30,000 cells/cm2 and by supplementing the N2B27 medium with 12 ng/ml of bFGF (Peprotech, 100-18B) and 20 ng/ml of activin A (Peprotech, 120–14 P). Coating proteins were incubated 1 hr before seeding. mESCs were maintained at 37 °C, 5% CO2 in a humidified incubator. Human ESCs, Elf1 line, were maintained of an irradiated MEF monolayer and grown in either RSeT (Stemcell Technologies) medium or in a medium composed of DMEM/F-12 media supplemented with 20% knockout serum replacer (KSR), 0.1 mM nonessential amino acids (NEAA), 1 mM sodium pyruvate, penicillin/streptomycin (all from Invitrogen), 0.1  mM β-mercaptoethanol (Sigma-Aldrich), 1 µM GSK3 inhibitor (CHIR99021), 1  µM of MEK inhibitor (PD0325901), 10  ng/ml human LIF (Chemicon), 5 ng/ml IGF1 (Peprotech) and 10  ng/ml bFGF. Cells were transferred to matrigel-coated plates prior to analysis. Exit from the naïve state triggered by growing the cells in mTeSR1 (StemCell technologies) for 4 days.

For knock-out generation, one million E14 mESC were electroporated with Cas9 (0.6 µM, Sigma) and gRNA (3 µM, Synthego) as RNP complex using Amaxa nucleofector (Human Stem Cell kit 2) in presence of 10 µM Hemin 10 uM. Individual colonies were hand-picked and plated into 96-well plates. DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed. The PCR product was purified using EXO-SAP enzyme (Thermo Fisher) and sent for Sanger sequencing analysis (through Genewiz).

Lines were routinely tested for mycoplasma and STR authenticated.

mESC treatment

Request a detailed protocol

The heme inhibitor succinylacetone (SA) (Sigma, D1415) is used at a concentration of 0.5 mM. Hemin (Sigma, 51280) is used at a concentration of 10 μM in 0.1 N NaOH. Diethyl butylmalonate (BM) (Sigma, 112038) is used at a concentration of 1 mM. Atpenin A5 (Santa Cruz biotechnology, sc-202475) is used at 250 nM. SIS3 (Selleck chemicals, S7959) is used at 5 μM. NF-56-EJ40 (Axon Medchem 3056) is used at 1 μM. AZD3965 (Selleckchem S7339) is used at 1 μM. Exogenous succinate is provided as either 40 mM Sodium succinate (Sigma) or 16 mM dimethylsuccinate (Sigma) supplementation. HDM inhibition was achieved with 250 nM JIB04 (Medchem express HY-13953) and TET inhibition with 5 μM TETin-C35 (Aobious AOB11121). For retinoic acid experiments, RA, HY-14649, HX531 (HY-108521) and AGN193109 (HY-U00449) were used at 0.5 µM, 10 µM and 100 nM, respectively (all from Medchemexpress). Inhibition of Sirt7 is achieved using 5 µM of the Sirt7 inhibitor 97491 (MedChemExpress).

RNA extraction and RT-qPCR

Request a detailed protocol

RNA was extracted after 2 days of culture with the ReliaPrep RNA Tissue Miniprep System (Promega, Z6111) following manufacturer’s protocol for non-fibrous tissue by adding RNA lysis buffer on pelleted cells. RNA concentrations were quantified with the Nanophotometer N60 (Implen). Reverse transcription (RT) was performed with the GoScript Reverse Transcriptase kit Random Primers (Promega, A2801) to convert 1 μg of RNA into cDNA. Briefly, RNA was mixed with RNAse-free water to obtain 1 μg of RNA in 12 μL and heated 5 min at 70 °C. Then, 8 μL of RT mix (4 μL random primers buffer, 2 μL enzyme, 2 μL RNAse free water) was added and the reaction was performed in a thermocycler (5 min at 25 °C, 60 min at 20 °C and 15 min at 70 °C).

The qPCR was performed on the ViiA 7 Real-Time PCR System (Thermo Fisher) with 10 ng of cDNA per reaction, SYBR Green GoTaq qPCR Master Mix (Promega, A6002) and primers listed in the Table 2 at a final concentration of 300 nM. Altogether, 2 μL of cDNA (5 ng/μL), 1 μL of forward primer (6 μM), 1 μL of reverse primer (6 μM), 10 μL of Master Mix and 6 μL of RNAse-free water were added in each well. Relative expression was calculated using the 2-∆Ct method with GAPDH as an endogenous control.

Table 2
List of primers used in qPCR.
GeneSequences (5’ → 3’)
Mouse
DNMT3AF: CTGCTGTGGAATACCCTGTTAG
R: CTTTCTACCTGCTGCCATACTC
ESRRBF: GCACCTGGGCTCTAGTTGC
R: TACAGTCCTCGTAGCTCTTGC
FGF5F: GGGATTGTAGGAATACGAGGAGTT
R: CCAGAAGAATGGACGGTTGT
FGF15F: TGTTTCACCGCTCCTTCTTT
R: TTCTCCATCCTGTCGGAATC
GAPDHF: CATGGCCTTCCGTGTTCCT
R: CCTGCTTCACCACCTTCTTG
KLF2F: CTAAAGGCGCATCTGCGTA
R: TAGTGGCGGGTAAGCTCGT
KLF4F: CCAGCAAGTCAGCTTGTGAA
R: GGGCATGTTCAAGTTGGATT
OCT4F: CACGAGTGGAAAGCAACTCA
R: AGATGGTGGTCTGGCTGAAC
OTX2F: TATCTAAAGCAACCGCCTTACG
R: AAGTCCATACCCGAAGTGGTC
REX1F: CCCTCGACAGACTGACCCTAA
R: TCGGGGCTAATCTCACTTTCAT
TFCP2L1F: GCTGGAGAATCGGAAGCTAGG
R: AAAACGACACGGATGATGCTC
ZIC2F: CAAGGTCCGGGTGCTTACC
R: ATTAAAGGGAGGCCCCGAATA
TBX3F: CTCCATTCCAGTTTGGTCAA
R: CAACAGCAGCCTGGTTACAC
OCT6F: TTTCTCAAGTGTCCCAAGCC
R: ACCACCTCCTTCTCCAGTTG
DNMT3BF: GGCAAGGACGACGTTTTGTG
R: GTTGGACACGTCCGTGTAGTGAG
DUXF: AAAGGAAGAGCATGTGCCAGC
R: GCAGTAAGCTGTCCTGGGAAC
ZFP352F: AAGTCCCACATCTGAAGAAACAC
R: GGGTATGAGGATTCACCCACA
TCSTV1F: TGAACCCTGATGCCTGCTAAGACT
R: AGATGGCTGCAAAGACACAACTGC
ZSCAN4CF: CCGGAGAAAGCAGTGAGGTGGA
R: CGAAAATGCTAACAGTTGAT
MuERV-LF: CCCATCATGAGCTGGGTACT
R: CGTGCAGATCCATCAGTAAA
DUB1F: GCAGGCCAACCTCAAACAG
R: CGCAGGGCTCTCCTAAATCTT
Human
ZSCAN4F: TGGAAATCAAGTGGCAAAAA R: CTGCATGTGGACGTGGAC
LEUTXF: GCTACAATGGGGAAACTGGR: CTCTTCCATTTGGCACGCTG
DUX4F: AGGAAGAATACCGGGCTCTG
R: AGTCTCTCACCGGGCCTAG
TFCP2L1Hs01011666_m1
KLF4F: GGGAGAAGACACTGCGTCA
R: GGAAGCACTGGGGGAAGT
ESRRBhs01584024_m1
SALL1F: AGAGAACTCACACTGGAGAG
R: CATGTGTACCTTAAGATTGCCT
ETV4F: CGACTCTGAAGATCTCTTCC
R: TCATCACTGTCTGGTACCT

Western blot analyses

Request a detailed protocol

Pellets of cells were lysed by adding protein lysis buffer 20 mM Tris-HCl; pH 7.5, 150 mM NaCl, 15% Glycerol, 2% SDS, 25 x protease inhibitor cocktail (PIC, cOmplete protease inhibitor cocktail, Roche 11697498001), 25 x phosphatase inhibitor buffer (PIB, composed of 25 mM Na3VO3, 250 mM 4-nitrophenylphosphate, 250 mM β-glycerophosphate and 125 mM NaF), 1% TRITON X-100, SuperNuclease (Sino Biologicals, 25 U/10 μL) and by pipetting up and down. The protein concentration was determined by Pierce protein assay (ThermoFisher, 22660). Samples were mixed with Laemmli buffer (SDS, β-mercaptoethanol, Bromophenol blue) and heated for 5 min at 95 °C before loading. An amount of 10 μg of proteins were loaded on SDS-containing 10 or 12% polyacrylamide gels. At the end of migration, proteins were transferred to PVDF membranes (IPFL00010) by liquid transfer. Membranes were then blocked in LI-COR Intercept blocking buffer PBS for 1 hr at RT and incubated overnight at 4 °C with the primary antibodies. Membranes were washed three times for 5 min with PBS +0.1% Tween-20 (PBST) before and after 1 h-incubation with the secondary antibodies at RT. Detections were performed and quantified with Odyssey LI-COR scanner. Primary and secondary antibodies were both diluted in Licor PBST. GAPDH was used as loading control. Primary and secondary antibodies for GAPDH detection were incubated 30 min. Antibodies and dilutions used are: anti-GAPDH 1:20000(Sigma, G8795), anti-KLF4 1:200 (R&D, AF3158), anti-Oct4 1:100 (Santa Cruz, sc-5279), anti-OTX2 1:100 (R&D, AF1979), anti-pan-succinyllysines 1:300 (PTM-401), anti-TFE3 1:400 (Sigma, HPA023881), anti-ZSCAN4 1:400 (Millipore, AB4340), anti-MUERVL-GAG 1:200 (Novus, NBP2-66963), anti-ERK1/2 1:1000 (Cell Signaling 9102), anti-phosphoERK1/2 1:1000 (Cell Signaling 9101), anti-SMAD2/3 1:1000(Cell Signaling 8685), anti-SMAD3 1:1000 (Abcam ab52903).

Immunofluorescence

Request a detailed protocol

Cells were seeded on coated glass cover (Assistent) slips 2 days before fixation with 4% paraformaldehyde (Sigma, 30525-89-4) for 15 min. Coating was performed for 1 hr with 15 μg/ml of fibronectin or with 3.5 μg/cm2 Cell-Tak (VWR, 734–1081) diluted in 0.1 M sodium bicarbonate. Cells were permeabilized and blocked for 30 min incubation in blocking buffer (PBS, 0.1% TRITON, 1% BSA). Immunostaining was performed by an overnight incubation of cover slips at 4 °C on 30 μL drops containing primary antibody diluted in blocking buffer. After three washes of 5 min in blocking buffer, the cells were incubated for 1 hr in the dark and at RT with 30 μL drops containing secondary antibody and DAPI (Sigma, 10 236 276 001) diluted 1:1000 in blocking buffer. Cover slips were mounted with Mowiol after three washes of 5 min in blocking buffer. Analyses were performed with a Leica TCS SP5 confocal microscope (Leica microsystems). For 5mC analysis, cells were fixed for 15 min with 4% PFA, permeabilized for 10 min with PBS-0.5% Triton X-100 and treated with 4 N HCl for 20 min to denature DNA. Cells were then washed once with distilled water a 2 hr blocking with 2% BSA and 0.5% Triton X-100. After these steps, the staining process would resume as described above, using a 5mC primary antibody (Sigma SAB2702243) diluted 1:300 in blocking buffer (PBS, 0.1% TRITON, 1% BSA).

Flow cytometry

Request a detailed protocol

Cells were detached by a 5 min incubation with Accutase and spun for 5 min at 400 g. The cell pellet was then washed with PBS-10 % FBS followed by another centrifugation. The pellet, containing at least 106 cells, was fixed by adding 100 μl of 4% PFA for 15 min. After centrifugation, the cells were permeabilized with the Invitrogen permeabilization buffer (00833356) for 30 min at room temperature. Antibodies were incubated for 1h30 at room temperature in PBS-10 % FBS and briefly vortexed every 30 min. After three washes with PBS-10 % FBS, the cells were incubated with an anti-rabbit Alexa 647 1:1000 for 1 hr. Cell pellets were washed twice before being resuspended in PBS-10 % FBS and analysed with the FACSVerse machine. TBG4 ESCs (previously published Eckersley-Maslin et al., 2016) were used for pan-succinyllysine levels measure in 2CLCs, by gating the turboGFP +population and measuring the alexa 647 intensity.

RNA sequencing

Request a detailed protocol

Sequence libraries were prepared with the Lexogen QuantSeq 3' mRNA-Seq library prep kit according to the manufacturer’s protocol. Samples were indexed to allow for multiplexing. Library quality and size range were assessed using a Bioanalyzer (Agilent Technologies) with the DNA 1000 kit (Agilent Technologies, California, USA). Libraries were subsequently sequenced on an Illumina HiSeq4000 instrument. Single-end reads of 50 bp length were produced with a minimum of 1 M reads per sample.

Quality control of raw reads was performed with FastQC v0.11.7, available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc. Adapters were filtered with ea-utils fastq-mcf v1.05 (Erik Aronesty (2011), ea-utils: “Command-line tools for processing biological sequencing data; https://github.com/ExpressionAnalysis/ea-utils copy archived at Expression Analysis, 2021). Splice-aware alignment was performed with HiSAT2 against the mouse reference genome mm10. Reads mapping to multiple loci in the reference genome were discarded. Resulting BAM files were handled with Samtools v1.5 (Li et al., 2009). Quantification of reads per gene was performed with HT-seq Count v2.7.14. Count-based differential expression analysis was done with R-based Bioconductor package DESeq2. Reported p-values were adjusted for multiple testing with the Benjamini-Hochberg procedure, which controls false discovery rate (FDR).

Data analysis

Request a detailed protocol

TMM normalized rLog transformed counts were used for Principal Component analysis using R package PCATools. Gene set enrichment analysis (GSEA) was made on gene list ranked on Log2FC using R package ClusterProfiler (Yu et al., 2012). For genes with FC >2 in MUERVL::Tomato+ list from Macfarlan et al., 2012, Z score was calculated from TMM-rLog transformed counts and plotted as heatmap using R package Heatmap.plus. Analysis was made using statistical programming language R.

Statistical analysis

Request a detailed protocol

One-way ANOVA statistical test followed Turkey multiple comparison test or student T-Tests were conducted on all results when indicated using GraphPad Prism version 9.1.1, GraphPad Software, San Diego, California USA, https://www.graphpad.com.

Data availability

Sequencing data have been deposited in GEO under the accession GSE178089. Data files for the western blot images have been added as raw images of scans.

The following data sets were generated
    1. Detraux D
    2. Caruso M
    (2021) NCBI Gene Expression Omnibus
    ID GSE178089. The critical role of heme synthesis in the regulation of pluripotent states is succinate-dependent.

References

    1. Bensidhoum M
    (1998)
    The disruption of mouse uroporphyrinogen III synthase (uros) gene is fully lethal
    Transgenics 2:275–280.
    1. Zhu Y
    2. Hon T
    3. Ye W
    4. Zhang L
    (2002)
    Heme deficiency interferes with the Ras-mitogen-activated protein kinase signaling pathway and expression of a subset of neuronal genes
    Cell Growth & Differentiation 13:431–439.

Decision letter

  1. Simón Méndez-Ferrer
    Reviewing Editor; University of Cambridge, United Kingdom
  2. Mone Zaidi
    Senior Editor; Icahn School of Medicine at Mount Sinai, United States

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "A critical role for heme synthesis and succinate in the regulation of pluripotent states transitions" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Mone Zaidi as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) Are the levels of heme itself, or the mentioned 7 enzymes of the heme pathway regulated during differentiation?

2) Further experiments are needed to determine whether the lack of proper Tgf β and FGF-ERK signalling activation are cause or consequence of the observed differentiation defects. How do cells sense heme deficiency and does how heme deficiency result in inability to activate ERK/MAPK and TGF β signaling?

3) Can the authors attempt to titrate pathway inhibition to a similar level as observed in heme pathway deficient ESCs? Furthermore, can the differentiation defect be rescued upon overstimulation of FGF-ERK and TGF β to reach WT levels?

4) Analyse cell proliferation and viability after SA (or AA5) treatment. If there is an impact on cellular health, this needs to be reported and taken into careful consideration when interpreting results.

5) The statement made in lines 150-152 and shown as Suppl. Figure 2b should be further supported by proper quantification using replicate assays.

6) Expression levels in TS cells or in trophoblast tissue must be used as control to judge the effect size. The statement that SA treatment expands the lineage potential of ESCs needs to be supported by appropriate and statistically strong data beyond the increase in some marker genes (which are also expressed in embryonic tissues).

7) Please provide direct evidence for disruption of heme biosynthesis directly instructing cells to take on a 2CLC state. How strong is the effect of inhibiting heme synthesis and succinate in inducing the 2CLC population as the absolute number of Zscan4+ or MuERVL+ cell is < 3%? The authors could use other 2CLC inducers (such as acetate (Rodriguez-Terrones, 2020) and RA (Iturbide, A., 2021) as a control, for comparison. The functional assay of 2 cell-like cells after heme synthesis inhibition should be test in vivo by 8-cell or blastocyst injection.

8) Quantification and comparison of pan succinate levels in Figures4c and 5a would be required for interpretation.

9) What happens with positive enriched genes in the SA-treated condition? Upregulation plot should be added to Figure 2a and discussed.

10) In the section describing the upregulation of 2-cell-stage-related genes when SA is added, please add a scramble as control, treat 2iL cells with an inhibitor of a different metabolic pathway for 48h and analyze by rt-PCR a) the 2-cell-related genes, b) the differentiation towards trophoblast cells.

11) The authors provide a very detailed molecular analysis on the effect of heme synthesis inhibition on the pluripotency exit. However, functional characterization (such as teratoma formation) is important to tell whether these naive mESC after treatment with heme synthesis blocker have any defects on the pluripotency exit and differentiation.

12) Although it is clear that heme synthesis is important for the mouse pluripotency status transition, it is not clear whether this is a mechanism present in human as well. The authors presented bioinformatic data suggesting that this might be the case. Does heme synthesis blockade increase the emergence of human 2 cell-like cells?

13) A genetic approach would complement and strengthen the specificity of the conclusions obtained with chemicals. For example, the inhibition of heme synthesis by SA should also be confirmed by knockout or knockdown of proteins in this pathway like ALAD, PBGD et al.

Reviewer #1 (Recommendations for the authors):

The authors will find below a list of my concerns.

1. For readers of the stem cell field a more detailed introduction into the heme synthesis pathway needs to be included in the introduction,

2. The statement made in lines 150-152 and shown as Suppl. Figure 2b should be further supported by proper quantification using replicate assays.

3. Lines 207-209. The rationale and the conclusion behind the experiment shown in Suppl. Figure 4 must be better explained.

4. Line 98: the word 'prevented' is too strong for the observed effect. Oct6, Otx2 and Dnmt3b are clearly upregulated, merely less than in WT.

5. The authors could put their findings in context of data on the impact of modulating the intracellular αKG/succinate ratio on pluripotency maintenance (https://doi.org/10.1038/nature13981; https://doi.org/10.15252/embj.201899518).

6. Does BM also rescue the exit from pluripotency phenotype?

7. Quantification and comparison of pan succinate levels in Figures4c and 5a would be helpful and required for interpretation. As there is basically no staining detectable in untreated cells in 4a and some in 5a, it is unclear whether SA and AA5 effects are similar in size. It appears that AA5 treatment has a much weaker effect.

Reviewer #2 (Recommendations for the authors):

– In the first part, regarding the analysis of previously published results of CRISPR-Cas9 screens (lines 77-87): It would be ideal to use an alternative annotation tool for gene ontology analyses. DAVID is already outdated. If the finding is corroborated with an alternative method, it not only gives strength to the initial observations but allows finding new targets of interest.

– The second title, "Heme synthesis inhibition prevents the activation of key developmental signaling pathways," needs to be more specific. Because heme is a critical component of general cell homeostasis, it is evident that the inhibition will affect key signaling pathways, not only in development but in any stage of mammal's life.

In this same section, what happens with positive enriched genes in the SA-treated condition? It should be added the up-regulation plot side Figure 2a, and a correspondent discussion about it.

– In the section describing the upregulation of 2-cell-stage-related genes when SA is added, it is needed to add a scramble-inhibition as control. Treat 2iL cells with an inhibitor of a different metabolic pathway for 48h and analyze by rt-PCR (a) the 2-cell-related genes, (b) the differentiation towards trophoblast cells.

– What happens with the glycine levels after heme synthesis inhibition? Does glycine play a role in the induction of a 2-cell-like state? Ideally authors should include an experiment to test this role.

– The following is optional, but it could be a considerable improvement to provide the bulk RNA seq comparing the inhibition of SUCNR1 vs. the activation induced by succinate, to see all other pathways that could crosstalk and describe better the mechanism of the succinate in pluripotent/totipotent states.

– The authors provide a very detailed molecular analysis on the effect of heme synthesis inhibition on the pluripotency exit. However, functional characterization (such as teratoma formation) is important to tell whether these naive mESC after treatment with heme synthesis blocker have any defects on the pluripotency exit and differentiation.

– Although it is clear that heme synthesis is important for the mouse pluripotency status transition, it is not clear whether this is a mechanism present in human as well. The authors presented bioinformatic data suggesting that this might be the case. It is important that the authors perform functional studies in the human cells to further substantiate this point.

– It is not clear how the cell senses heme deficiency and how heme deficiency results in inability to activate ERK/MAPK and TGF β signaling. Could the authors provide comments into this aspect?

– How strong the effect of inhibiting heme synthesis and succinate in inducing the 2CLC population are as the absolute number of Zscan4+ or MuERVL+ cell are quite low (< 3%)? I suggest that the authors include other 2CLC inducers such as acetate (Rodriguez-Terrones, 2020) and RA (Iturbide, A., 2021) as a control for comparison.

– The authors performed the 2CLC experiment with 2iL condition. However, a quick review of the literature indicates that many of these studies have been done in FBS/LIF system. Can the authors comment on the difference between 2iL condition and FBS/LIF in the study of 2CLC?

– The authors analyzed that heme synthesis is also important human pluripotent state transition. It will be interesting to see the scenario in human pluripotent stem cells, which will largely make the study difference, especially if the heme synthesis blockade will also increase the emergence of human 2 cell-like cells.

– The functional assay of 2 cell-like cells after heme synthesis inhibition should be tested in vivo by 8-cell or blastocyst injection

– The whole study of inhibition is chemical achieved. As a supplement, the authors should also test with genetic intervention instead of sole chemicals. For example, the inhibition of heme synthesis by SA should also be confirmed by knockout or knockdown of proteins in this pathway like ALAD, PBGD et al. Also similar with AA5.

– To make the finding here more convincing and significant, it will be good to confirm in embryos.

– The manuscript should include the metabolism part in the introduction instead of using large paragraphs in the main text to introduce these pathways and previous studies.

https://doi.org/10.7554/eLife.78546.sa1

Author response

Essential revisions:

1) Are the levels of heme itself, or the mentioned 7 enzymes of the heme pathway regulated during differentiation?

We thank the reviewer to point that it is important to verify whether there could be a regulation of heme biosynthesis during the naïve-to-primed transition. To answer this, we explored the expression of the 8 genes encoding enzymes in the pathway, from this study and previously published ones, both in human and mouse and from in vivo blastocysts or in vitro models (Grow et al., 2015; Sperber et al., 2015; Di Stefano et al., 2018; Nakamura et al., 2016). While some of the enzymes show a slight change during the exit of the naïve state, none are consistent between the different studies and no significant trend for the pathway is observed. This has been added as Table 2.

2) Further experiments are needed to determine whether the lack of proper Tgf β and FGF-ERK signalling activation are cause or consequence of the observed differentiation defects. How do cells sense heme deficiency and does how heme deficiency result in inability to activate ERK/MAPK and TGF β signaling?

3) Can the authors attempt to titrate pathway inhibition to a similar level as observed in heme pathway deficient ESCs? Furthermore, can the differentiation defect be rescued upon overstimulation of FGF-ERK and TGF β to reach WT levels?

We thank the reviewers for their highly relevant comments. We have addressed these two questions simultaneously.

Heme deficiency is canonically sensed in mammals through the nuclear factor BACH1 (reviewed in (Zhang et al., 2018)) or the activation of the Integrated Stress Response (ISR) through the Heme Responsive Inhibitor (HRI) or EIF2AK1 (reviewed in (Pakos‐Zebrucka et al., 2016)).

BACH1 heterodimerized with MAF proteins (among others) binds to DNA and represses the transcription of target genes. Upon heme binding to BACH1, the complex dissociates and BACH1 is exported in the cytosol, thus relieving the repression of target genes. As seen in these immunofluorescence analyses of BACH1 subcellular localization (Figure 2 – Supplement Figure 1a), the abundance of nuclear BACH1 is comparable in 2iL, EPI, and EPI +SA conditions, indicating that the inhibition of heme synthesis does not affect BACH1 activity. On the opposite and as expected, the addition of hemin provokes the nuclear exclusion of BACH1. This data indicates that BACH1 is not responsible for the heme deficiency sensing in our model. This was added to the manuscript.

As another putative way of heme depletion to act on the transition from naïve to primed, we also investigated the role of the ISR. Indeed, various environmental and pathological conditions, including protein homeostasis (proteostasis) defects, nutrient deprivation, viral infection, and oxidative stress, activate the ISR to restore the balance by reprogramming gene expression, all converging to the phosphorylation and activation of the eukaryotic translation initiation factor eIF2. Heme depletion is known to be one of the stresses activating this pathway, allowing the phosphorylation and activation of the heme-regulated inhibitor (HRI) kinase, in turn phosphorylating EIF2α. To assess the activation of this pathway, we targeted two levels: the phosphorylation of EIF2α by western blot analysis and the global protein synthesis levels with a SUnSET assay (Schmidt et al., 2009) (Figure 2 – Supplement Figure 1b-c). The increase in EIF2α phosphorylation (Figure 2 – Supplement Figure 1b), a direct result of the activity of HRI in absence of heme, indicates the activation of a kinase upstream of the pathway. The global reduction in protein synthesis, observed with the levels of puromycin-labelled peptides (Figure 2 – Supplement Figure 1c), further confirms the activation of the ISR upon inhibition of heme synthesis.

To further explore the possible implication of this ISR-HRI axis in the inhibition of native-to-primed transition induced by heme synthesis inhibition, we used a chemical activator of HRI (BTdCPU; (Chen et al., 2011)) to assess whether it could induce a similar effect as SA or not. Treatment of cells with 2µM BTdCPU, reduces protein synthesis to a similar extent that SA (Figure 2 – Supplement Figure 1d), but fails at preventing the naïve stage exit (Figure 2 – Supplement Figure 1e), indicating an HRI-independent mechanism. These results were added to the manuscript and are now part of Figure 2 – Supplement Figure 1.

In a final attempt to identify the mechanism behind the failure of MAPK and TGFβ activation following heme synthesis inhibition, we also searched the GO terms associated with heme binding that could regulate the pathways or receptor mentioned. The analysis did not reveal any putative regulators. However, following an interesting suggestion from the reviewers, we observed that an increase in Activin A or FGF2 concentration (2- or 3-fold increase) did not rescue the naïve exit defect (Figure 2 – Supplement Figure 1j), suggesting a strong intracellular mechanism. Since activin and FGF are the sole signals used to trigger the exit, an impairment of those would indeed prevent it, especially for TGFβ pathway, as shown in the supplementary figure 3i. Thus, instead of chemically block the TGFb pathway, we decided to investigate the temporal activation of SMAD3 phosphorylation during the exit of naïve stage, with or without SA (Figure 2b-c). Quantification of the phosphorylation kinetics of SMAD3 indicates a significant decrease starting after 24h post induction of the exit when treated with SA (Figure 2b-c). This correlates with the gene expression kinetics of Fgf5 and Tbx3 (Figure 2d), suggesting a key role of the SMAD3 pathway perturbation in the effect.

Mechanistically, it is known that heme synthesis inhibition raises the levels of succinyl-CoA and succinate, since 8 moles of succinyl-CoA and 8 moles of glycine are needed to produce 1 mole of heme, heme synthesis acting thus as a “succinyl-CoA sink” (Atamna 2004). In addition, succinate accumulation upon heme synthesis inhibition is reinforced by the drastically reduced abundance of succinate dehydrogenase (SDH) consuming succinate in the TCA that consumes succinate. Indeed, SDH is a heme-dependent complex known to be destabilized by the loss of heme nicely reviewed in (Kim et al., 2012), as confirmed in Figure 2e, showing the drastically reduced SDH abundance after heme synthesis inhibition. Together this indicates a possible accumulation of succinate in response to heme synthesis inhibition, an accumulation that could cause the transition defect. To test this hypothesis, we used butylmalonate as an inhibitor of the dicarboxylate carrier (DIC; SLC25A10) to prevent leakage of succinate from the mitochondrial matrix to the cytosol, and this nicely resumed the transition as shown by the gene expression profile of mESCs in the EpiLC + SA + BM condition (Figure 2f). Succinate accumulation and/or SDH ablation is known to increase protein lysine succinylation (Smestad et al., 2018), an effect that is observed upon SA treatment (Figure 2g) and that we mimicked by inhibiting Sirt7, a cytosolic and nuclear desuccinylase (Figure 2g). The ability of this molecule to mimic SA in the pathway inhibition (Figure 2h-i) and to prevent the exit of the naïve state (Figure 2f) points at succinylation events as the cause of the transition defects.

This new data is now inserted, commented and discussed in the manuscript as part of figure 2 or Figure 2 – Supplement Figure 1.

4) Analyse cell proliferation and viability after SA (or AA5) treatment. If there is an impact on cellular health, this needs to be reported and taken into careful consideration when interpreting results.

We used a live:dead staining kit (Invitrogen L3224, using calcein-AM and ethidium homodimer-1) to analyze the survival fraction of cells after two days in culture, following either SA or AA5 treatment. No significant change was observed (Author response image 1A). The cell cycle analysis was performed by flow cytometry with propidium iodide. Overall, SA treatment increases slightly the G2 cell population, while AA5 increases the S population (Author response image 1B). Since these two drugs induced similar effects in the acquisition of 2CLCs in the naïve population, it is thus unlikely that the effects of these molecules on cell viability and proliferation do affect the results obtained and presented.

Author response image 1
Effect of heme synthesis (SA) and SDH (AA5) inhibitors on mESC homeostasis.

(A) Cell survival analysis of mESCs in 2iL naïve control, in mESCs treated with 0.5 mM SA or 250 nM Atpenin A5 (AA5) for 2 days, assessed using calcein-AM and ethidium homodimer-1 (Invitrogen) in confocal microscopy, expressed as % of Calcein-AM-positive cells to the whole population and represented as means +/- S.D. N.S p>0.05, ANOVA1. n=3 biological independent replicates. (B) Cells cycle analysis of mESCs in 2iL naïve control, in mESCs treated with 0.5 mM SA or 250 nM Atpenin A5 (AA5) for 2 days and assessed using propidium iodide by flow cytometry and quantified with FLowJo software. n=3 biological independent replicates.

5) The statement made in lines 150-152 and shown as Suppl. Figure 2b should be further supported by proper quantification using replicate assays.

6) Expression levels in TS cells or in trophoblast tissue must be used as control to judge the effect size. The statement that SA treatment expands the lineage potential of ESCs needs to be supported by appropriate and statistically strong data beyond the increase in some marker genes (which are also expressed in embryonic tissues).

Questions 5 and 6, both related to the increase in cell potential, are thus treated simultaneously. While further quantification of gene expression (Cdx2, Tead4, Gata3, Eomes, Hand1, Elf5, Krt18, Cited1, Tfap2c and Ets1) following SA or AA5 treatment still shows a trend toward an increase of differentiation efficiency (Author response image 2), we observed high variability and the increase in the expression of trophoblast-specific genes was not significant (n=6). While this still could be interesting, we hypothesize that since the number of 2CLCs is increased from 1 to 3 % upon SA or AA5 treatment, the effect on lineage potential will remain limited (see also the response to question 7). Because of the lack of significance, we removed the data and related discussion on the extended potential from the manuscript.

Author response image 2
Expression of trophoblast lineage markers after differentiation.

Relative mRNA expression of trophoblasts lineage markers of mESCs differentiated for 6 days after culture for 2 days in naïve 2iL control condition (blue) or with 0.5 mM SA (orange), or 250 nM AA5 (grey), assessed by RT-qPCR. Data shown as means +/- S.D. n=6 biological independent replicates.

7) Please provide direct evidence for disruption of heme biosynthesis directly instructing cells to take on a 2CLC state. How strong is the effect of inhibiting heme synthesis and succinate in inducing the 2CLC population as the absolute number of Zscan4+ or MuERVL+ cell is < 3%? The authors could use other 2CLC inducers (such as acetate (Rodriguez-Terrones, 2020) and RA (Iturbide, A., 2021) as a control, for comparison. The functional assay of 2 cell-like cells after heme synthesis inhibition should be test in vivo by 8-cell or blastocyst injection.

The updated figure 5c now includes RA as a positive control as presented in Iturbide et al. 2021 and as suggested by the reviewers. Interestingly, we observe that the gene expression levels of the 2CLC markers after RA treatment increase to a similar extent than with AA5, but not SA.

These authors showed that the RA-induced 2CLC increase is due to activation of the RARγ since inhibition of RXR (with the HX531 inhibitor) does not rescue the effect while a RAR inhibitor (AGN193109) does. Very interestingly, the AA5-induced 2CLC signature seems to depend on both receptors as HX531 (RXR inhibitor) and AGN193109 (pan-RAR inhibitor) do inhibit the AA5-induced 2CLC gene expression signature.

Since genetic ablation of heme synthesis enzymes is embryonic lethal around the implantation time (Lindberg et al., 1996; Bensidhoum et al., 1998; Phillips et al., 2001; Conway et al., 2017; Magness et al., 2002), we expect this experiment to bear toxicity for the embryo, especially since accumulation of heme synthesis intermediate is known for its toxicity (Lämsä et al., 2012; Handschin et al., 2005). Furthermore, injection of the 2CLC in early embryos is rarely used, including in Iturbide, 2021 or Rodriguez-Terrones, 2020.

8) Quantification and comparison of pan succinate levels in Figures4c and 5a would be required for interpretation.

We thank the reviewers for pointing at this issue. We performed a quantification of the pan succinyllysine residue levels by flow cytometry and the results are now shown in addition to the more qualitative confocal micrographs in figures 4 and 5. These results better support our claims and conclusion.

9) What happens with positive enriched genes in the SA-treated condition? Upregulation plot should be added to Figure 2a and discussed.

The upregulation plot has been added to figure 2a. A majority of the Gene ontology (GO) terms found upregulated in EpiLC SA vs EpiLC includes cytochrome-associated proteins for xenobiotic detoxification or oxidative phosphorylation. This probably corresponds to a compensatory mechanism since the absence of heme reduces the abundance of proteins encoded by to those genes, as previously shown (Lämsä et al., 2012; Vinchi et al., 2014).

10) In the section describing the upregulation of 2-cell-stage-related genes when SA is added, please add a scramble as control, treat 2iL cells with an inhibitor of a different metabolic pathway for 48h and analyze by rt-PCR a) the 2-cell-related genes, b) the differentiation towards trophoblast cells.

To validate the metabolic effect of SA or AA5 on the 2CLC population, we thank the reviewers for suggesting using alternative metabolism inhibitors. We used two different metabolic inhibitors: Etomoxir as an inhibitor of Carnitine Palmitoyl Transferase (CPT-1), thus blocking fatty acid oxidation, and 6-aminonicotinamide (6-AN), an antimetabolite blocking the pentose phosphate pathway (PPP) metabolism. These two molecules fail to induce a 2CLC signature (Author response image 3).

Author response image 3
Inhibitors of pentose phosphate pathway and fatty acid oxidation do not trigger a 2CLC signature.

Relative expression of 2C markers of mESCs assessed by RT-qPCR relative to Gapdh expression and normalized to expression level of 2iL naïve control, in mESCs treated with 50 µM Etomoxir or 50 µM 6-aminonicotinamide for 48 h. n=3 independent biological replicates.

11) The authors provide a very detailed molecular analysis on the effect of heme synthesis inhibition on the pluripotency exit. However, functional characterization (such as teratoma formation) is important to tell whether these naive mESC after treatment with heme synthesis blocker have any defects on the pluripotency exit and differentiation.

As explained in the Discussion section, the fact that heme synthesis knock-out is embryonic lethal around the implantation stage in mouse (Lindberg et al., 1996; Bensidhoum et al., 1998; Phillips et al., 2001; Conway et al., 2017; Magness et al., 2002) strongly suggests an implantation defect, hence, pluripotency exit. This is further supported by the loss of Oct4 in ALAD KO mESCs after removal of hemin (Supp. Figure 2b). Furthermore, teratoma formation assay or embryoid body formation assays after a temporary blockade (2 days) of heme synthesis through SA would quickly be attenuated as heme synthesis would resume after injection, especially since these assays extends for weeks.

12) Although it is clear that heme synthesis is important for the mouse pluripotency status transition, it is not clear whether this is a mechanism present in human as well. The authors presented bioinformatic data suggesting that this might be the case. Does heme synthesis blockade increase the emergence of human 2 cell-like cells?

To answer this question, we used Elf1 hESC cells (Ware et al., 2014) grown in RSeT media to mimic the naïve conditions, and triggered the exit toward the primed stage for 4 days in TeSR media (both commercially available, StemCell technologies), with or without 0.5 mM of SA. We observe a significant prevention of the loss of naïve markers, as in mESCs, while not preventing the increase in a primed signature. This has been updated and commented in the manuscript, with an updated Figure 1 – Supplement Figure 1c.

In addition, naïve Elf1 hESCs maintained either in RSeT medium or in 2iL-I-F (GSK3 and MEK inhibitors, LIF, IGF1 and FGF2) media (Sperber et al., 2015) treated with 0.5 mM of SA for 2 days, show a significant upregulation of markers associated with the 8-cell stage (the human homolog of the 2CLC), corresponding to the zygote genome activation event (Taubenschmid-Stowers et al., 2022), suggesting a similar mechanism (Figure 3g, Author response image 4).

Author response image 4
Heme synthesis inhibition in naïve hESCs triggers a ZGA gene signature.

Relative expression of ZGA related genes in hESCs assessed by RT-qPCR relative to TBP expression and normalized to naïve control, with or without 0.5 mM of SA. n=3 independent biological replicates. Results expressed as means +/- S.D. * p < 0.05, **p < 0.01, ***p < 0.001 ; t-tests.

13) A genetic approach would complement and strengthen the specificity of the conclusions obtained with chemicals. For example, the inhibition of heme synthesis by SA should also be confirmed by knockout or knockdown of proteins in this pathway like ALAD, PBGD et al.

We thank the reviewer for this important comment. Using the CRISPR-Cas9 technology, we generated an ALAD KO E14-mESC line using CRISPR/Cas9 (Figure 1 – Supplement Figure 1a). To maintain a healthy population, this line is grown in a medium supplemented with hemin and removal of this supplement allows to reveal the heme synthesis inhibition. As shown in the updated figure 3 (Figure 3d), removal of hemin in the culture medium for 2 days induces a strong increase in 2CLC marker expression.

We also performed the transition from naïve to primed in these ALAD KO mESCs. Genetic ablation of ALAD also prevents mESCs to properly exit the naïve state as the naïve marker expression is maintained. On the other hand, primed markers, except Dnmt3b, are upregulated (Figure 1 – Supplement Figure 1b). While this is in apparent contrast to the chemical inhibition of ALAD, the complete loss of ALAD seems to perturb the pluripotency state as seen by the complete loss of Oct4 expression, thus impairing the proper transition. This loss of Oct4 transcript could be due to the complete loss of heme, impairing the formation of G-quadruplexes, known to promote Oct4 gene expression (Renčiuk et al., 2017; Gray et al., 2019).

References

Bensidhoum M, Larou M, Lemeur M, Dierich A, Costet P, Raymond S, Daniel JY, De Verneuil H and Ged C (1998) The disruption of mouse uroporphyrinogen III synthase (uros) gene is fully lethal. Transgenics 2: 275–280

Chen T, Ozel D, Qiao Y, Harbinski F, Chen L, Denoyelle S, He X, Zvereva N, Supko JG, Chorev M, et al. (2011) Chemical genetics identify eIF2α kinase heme-regulated inhibitor as an anticancer target. Nat Chem Biol 7: 610–616

Conway AJ, Brown FC, Fullinfaw RO, Kile BT, Jane SM and Curtis DJ (2017) A mouse model of hereditary coproporphyria identified in an ENU mutagenesis screen. DMM Dis Model Mech 10: 1005–1013

Gray LT, Puig Lombardi E, Verga D, Nicolas A, Teulade-Fichou MP, Londoño-Vallejo A and Maizels N (2019) G-quadruplexes Sequester Free Heme in Living Cells. Cell Chem Biol 26: 1681-1691.e5

Grow EJ, Flynn RA, Chavez SL, Bayless NL, Wossidlo M, Wesche DJ, Martin L, Ware CB, Blish CA, Chang HY, et al. (2015) Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells. Nature 522: 221

Handschin C, Lin J, Rhee J, Peyer AK, Chin S, Wu PH, Meyer UA and Spiegelman BM (2005) Nutritional regulation of hepatic heme biosynthesis and porphyria through PGC-1alpha. Cell 122: 505–515

Kim HJ, Khalimonchuk O, Smith PM and Winge DR (2012) Structure, function, and assembly of heme centers in mitochondrial respiratory complexes. Biochim Biophys Acta 1823: 1604–1616

Lämsä V, Levonen AL, Sormunen R, Yamamoto M and Hakkola J (2012) Heme and heme biosynthesis intermediates induce heme oxygenase-1 and cytochrome P450 2A5, enzymes with putative sequential roles in heme and bilirubin metabolism: different requirement for transcription factor nuclear factor erythroid- derived 2-like 2. Toxicol Sci 130: 132–144

Lindberg RLP, Porcher C, Grandchamp B, Ledermann B, Bürki K, Brandner S, Aguzzi A and Meyer UA (1996) Porphobilinogen deaminase deficiency in mice causes a neuropathy resembling that of human hepatic porphyria. Nat Genet 12: 195–199

Magness ST, Maeda N and Brenner DA (2002) An exon 10 deletion in the mouse ferrochelatase gene has a dominant-negative effect and causes mild protoporphyria. Blood 100: 1470–1477

Nakamura T, Okamoto I, Sasaki K, Yabuta Y, Iwatani C, Tsuchiya H, Seita Y, Nakamura S, Yamamoto T and Saitou M (2016) A developmental coordinate of pluripotency among mice, monkeys and humans. Nature 537: 57–62

Pakos‐Zebrucka K, Koryga I, Mnich K, Ljujic M, Samali A and Gorman AM (2016) The integrated stress response. EMBO Rep 17: 1374–1395

Phillips JD, Jackson LK, Bunting M, Franklin MR, Thomas KR, Levy JE, Andrews NC and Kushner JP (2001) A mouse model of familial porphyria cutanea tarda. Proc Natl Acad Sci 98: 259–264

Renčiuk D, Ryneš J, Kejnovská I, Foldynová-Trantírková S, Andäng M, Trantírek L and Vorlíčková M (2017) G-quadruplex formation in the Oct4 promoter positively regulates Oct4 expression. Biochim Biophys acta Gene Regul Mech 1860: 175–183

Schmidt EK, Clavarino G, Ceppi M and Pierre P (2009) SUnSET, a nonradioactive method to monitor protein synthesis. Nat Methods 6: 275–277

Sperber H, Mathieu J, Wang Y, Ferreccio A, Hesson J, Xu Z, Fischer KA, Devi A, Detraux D, Gu H, et al. (2015) The metabolome regulates the epigenetic landscape during naive-to-primed human embryonic stem cell transition. Nat Cell Biol 17: 1523–1535

Di Stefano B, Ueda M, Sabri S, Brumbaugh J, Huebner AJ, Sahakyan A, Clement K, Clowers KJ, Erickson AR, Shioda K, et al. (2018) Reduced MEK inhibition preserves genomic stability in naive human embryonic stem cells. Nat Methods 15: 732–740

Taubenschmid-Stowers J, Rostovskaya M, Santos F, Ljung S, Argelaguet R, Krueger F, Nichols J and Reik W (2022) 8C-like cells capture the human zygotic genome activation program in vitro. Cell Stem Cell 29: 449-459.e6

Vinchi F, Ingoglia G, Chiabrando D, Mercurio S, Turco E, Silengo L, Altruda F and Tolosano E (2014) Heme exporter FLVCR1a regulates heme synthesis and degradation and controls activity of cytochromes P450. Gastroenterology 146: 1325–1338

Ware CB, Nelson AM, Mecham B, Hesson J, Zhou W, Jonlin EC, Jimenez-Caliani AJ, Deng X, Cavanaugh C, Cook S, et al. (2014) Derivation of naive human embryonic stem cells. Proc Natl Acad Sci 111: 4484–4489

Zhang X, Guo J, Wei X, Niu C, Jia M, Li Q and Meng D (2018) Bach1: Function, Regulation, and Involvement in Disease. Oxid Med Cell Longev 2018

Reviewer #1 (Recommendations for the authors):

The authors will find below a list of my concerns.

1. For readers of the stem cell field a more detailed introduction into the heme synthesis pathway needs to be included in the introduction.

A description of the heme synthesis pathway is now included in the introduction section of the revised version, line 65-67. The following has been added: “This pathway, starting in mitochondria, uses succinyl-CoA and glycine as starting material. It then proceeds to successive cytosolic reactions before ending by the formation of the heme molecule in the mitochondrial matrix.”

2. The statement made in lines 150-152 and shown as Suppl. Figure 2b should be further supported by proper quantification using replicate assays.

While further quantification of gene expression (Cdx2, Tead4, Gata3, Eomes, Hand1, Elf5, Krt18, Cited1, Tfap2c and Ets1) following SA or AA5 treatment to validate the increase in lineage potential still shows an increase (Author response image 3), we observed high variability and the increase in the expression of trophoblast-specific genes was not significant (n=6). While this still could be interesting, we hypothesize that since the number of 2CLCs is increased from 1 to 3 % upon SA or AA5 treatment, the effect on lineage potential will remain limited (see also the response to the Editor’s question 7). Because of the lack of significance, we removed the data and related discussion on the extended potential from the revised manuscript.

3. Lines 207-209. The rationale and the conclusion behind the experiment shown in Suppl. Figure 4 must be better explained.

The lines 251-254 of the manuscript have been amended to clarify the conclusion of Suppl. Figure 4 (now Figure 5 – Supplement Figure 1 in the revised manuscript). The following is now stated: “Of these three classes, we ruled out a role for PHDs, responsible for HIF1α degradation, as the abundance of this transcription factor was not increased by SA nor by AA5 treatment, demonstrating a lack of stabilization following a putative PHD inhibition (Figure 5 – Supplement Figure 1).”

4. Line 98: the word 'prevented' is too strong for the observed effect. Oct6, Otx2 and Dnmt3b are clearly upregulated, merely less than in WT.

We updated the line 98 to more accurately phrase the observed effect.

5. The authors could put their findings in context of data on the impact of modulating the intracellular αKG/succinate ratio on pluripotency maintenance (https://doi.org/10.1038/nature13981; https://doi.org/10.15252/embj.201899518).

We amended the end of the Discussion section to include the missing reference and commented further on the difference between these studies and ours.

6. Does BM also rescue the exit from pluripotency phenotype?

We thank reviewer 1 for this suggestion. Indeed, addition of BM to SA during the naïve state exit rescues the observed phenotype, revealing succinate as a mechanistic actor. This is now shown in the updated figure 2 (Figure 2f).

7. Quantification and comparison of pan succinate levels in Figures4c and 5a would be helpful and required for interpretation. As there is basically no staining detectable in untreated cells in 4a and some in 5a, it is unclear whether SA and AA5 effects are similar in size. It appears that AA5 treatment has a much weaker effect.

In order to further back our claims, we quantified the pan-succinyllysine residue abundance through flow cytometry. These quantifications were added to figures 2g, 4c and 5a. The quantification strengthens the results observed by immunofluorescence.

Reviewer #2 (Recommendations for the authors):

– In the first part, regarding the analysis of previously published results of CRISPR-Cas9 screens (lines 77-87): It would be ideal to use an alternative annotation tool for gene ontology analyses. DAVID is already outdated. If the finding is corroborated with an alternative method, it not only gives strength to the initial observations but allows finding new targets of interest.

We compared the results generated by DAVID with other functional annotation tools. We ran over-representation analysis using the R package ClusterProfiler (Yu et al., 2012), which assess enrichment of terms by calculating p-values using the hypergeometric distribution method described in Boyle et al., 2004. The analysis was performed using GO databases (including biological process, molecular function and subcellular localization) as well as hallmark (h) (Liberzon et al., 2015) and canonical pathways (CP, part of curated database, C) databases of Molecular Signature Database (MSigDB, please see https://www.gsea-msigdb.org/). The results show significant enrichment of terms related to heme metabolism (“heme biosynthetic process”, “porphyrin-containing compound biosynthetic process”, “protoporphyrinogen IX metabolic process”) for both the human and mouse CRISPR-Cas9 screen list (Author response Tables 1 and 2) confirming the results generated by DAVID. We maintain the DAVID results in the main figure as the DAVID tool has been continuously updated and improved from initially reported publications (Jiao et al., 2012; Sherman et al., 2007, 2022). As of today, the last update of the DAVID knowledgebase (v2023q1) was released in April 2023 and is cited in more than 60 000 scientific publications highlighting its robustness.

Author response table 1
Overrepresentation analysis (ORA) of mESC screen.

Top 50 hit of the biological process gene ontology (GO) terms from the mouse CRISPR-Cas9 screen

GO:0140053

mitochondrial RNA metabolic process

IDDescriptionGeneRatioBgRatiopvaluep.adjust
mitochondrial gene expression59/530108/233552,1943E-688,1912E-65
GO:0032543mitochondrial translation50/53076/233555,4613E-641,0194E-60
GO:0033108mitochondrial respiratory chain complex assembly47/53084/233552,9765E-553,7037E-52
GO:0010257NADH dehydrogenase complex assembly37/53049/233553,0091E-512,2466E-48
GO:0032981mitochondrial respiratory chain complex I assembly37/53049/233553,0091E-512,2466E-48
GO:0007005mitochondrion organization79/530489/233554,5039E-442,8022E-41
GO:0006091generation of precursor metabolites and energy59/530404/233551,7562E-309,3653E-28
GO:0045333cellular respiration40/530159/233552,1561E-301,0061E-27
GO:0022900electron transport chain30/53084/233553,6581E-281,5173E-25
GO:0022904respiratory electron transport chain29/53080/233551,7473E-276,5225E-25
GO:0046034ATP metabolic process43/530256/233556,2247E-252,1125E-22
GO:0006119oxidative phosphorylation30/530107/233551,3283E-244,1322E-22
GO:0015980energy derivation by oxidation of organic compounds42/530250/233552,222E-246,3806E-22
GO:0042773ATP synthesis coupled electron transport24/53062/233559,046E-242,4121E-21
GO:0042775mitochondrial ATP synthesis coupled electron transport23/53058/233554,023E-231,0012E-20
GO:000095918/53045/233551,8641E-184,3491E-16
GO:0043039tRNA aminoacylation17/53043/233552,1272E-174,671E-15
GO:0043038amino acid activation17/53044/233553,3946E-177,0399E-15
GO:0006399tRNA metabolic process26/530161/233553,9816E-157,8229E-13
GO:0006418tRNA aminoacylation for protein translation15/53040/233554,2779E-157,9846E-13
GO:0017004cytochrome complex assembly14/53034/233557,4415E-151,3228E-12
GO:0006120mitochondrial electron transport, NADH to ubiquinone12/53022/233558,676E-151,4722E-12
GO:0008535respiratory chain complex IV assembly12/53024/233553,4812E-145,6501E-12
GO:0070129regulation of mitochondrial translation12/53027/233552,1033E-133,2715E-11
GO:0006744ubiquinone biosynthetic process10/53017/233555,6158E-138,0629E-11
GO:1901663quinone biosynthetic process10/53017/233555,6158E-138,0629E-11
GO:0006520cellular amino acid metabolic process28/530244/233552,2261E-123,0777E-10
GO:0062125regulation of mitochondrial gene expression12/53032/233552,4637E-123,2847E-10
GO:0006743ubiquinone metabolic process10/53019/233552,5607E-123,2962E-10
GO:0034660ncRNA metabolic process38/530445/233552,942E-123,6609E-10
GO:0006401RNA catabolic process28/530258/233558,6577E-121,0426E-09
GO:0033617mitochondrial cytochrome c oxidase assembly10/53021/233559,3856E-121,0949E-09
GO:0009060aerobic respiration16/53076/233551,2209E-111,3811E-09
GO:0034248regulation of cellular amide metabolic process35/530409/233552,0566E-112,258E-09
GO:0006417regulation of translation32/530350/233552,7541E-112,9374E-09
GO:0006783heme biosynthetic process10/53023/233552,9224E-112,9937E-09
GO:0032259methylation32/530351/233552,9672E-112,9937E-09
GO:0007034vacuolar transport20/530143/233559,0443E-118,8848E-09
GO:0006402mRNA catabolic process24/530220/233552,4302E-102,3261E-08
GO:0006779porphyrin-containing compound biosynthetic process tetrapyrrole biosynthetic process10/53028/233553,0269E-102,7019E-08
GO:003301410/53028/233553,0269E-102,7019E-08
GO:0043414macromolecule methylation28/530300/233553,0399E-102,7019E-08
GO:0019827stem cell population maintenance21/530172/233554,0678E-103,5106E-08
GO:0000956nuclear-transcribed mRNA catabolic process17/530109/233554,1379E-103,5106E-08
GO:0098727maintenance of cell number21/530176/233556,2463E-105,1816E-08
GO:0016569covalent chromatin modification35/530464/233556,4242E-105,2133E-08
GO:0016570histone modification34/530450/233551,0876E-098,6383E-08
GO:0042168heme metabolic process10/53032/233551,3714E-091,0666E-07
GO:0032008positive regulation of TOR signaling11/53043/233552,2114E-091,6847E-07
Author response table 2
Overrepresentation analysis (ORA) of hESC screen.

Top 50 hit of the biological process gene ontology (GO) terms from the human CRISPR-screen

IDDescriptionGeneRatioBgRatiopvaluep.adjust
GO:0097194execution phase of apoptosis8/16094/188621,3494E-060,00187098
GO:0006414translational elongation9/160134/188622,1432E-060,00187098
GO:0032543mitochondrial translation9/160134/188622,1432E-060,00187098
GO:0090200positive regulation of release of cytochrome c from mitochondria5/16027/188622,8639E-060,00187515
GO:0070125mitochondrial translational elongation7/16088/188629,8885E-060,00453049
GO:0140053mitochondrial gene expression9/160165/188621,1757E-050,00453049
GO:2001235positive regulation of apoptotic signaling pathway8/160126/188621,2109E-050,00453049
GO:0097193intrinsic apoptotic signaling pathway11/160283/188623,0718E-050,0099803
GO:0090199regulation of release of cytochrome c from mitochondria5/16044/188623,4297E-050,0099803
GO:0051204protein insertion into mitochondrial membrane5/16048/188625,2618E-050,01378068
GO:1900739regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathw4/16026/188626,445E-050,01406611
GO:1900740positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signali4/16026/188626,445E-050,01406611
GO:0090151establishment of protein localization to mitochondrial membrane5/16053/188628,5226E-050,01586063
GO:0046501protoporphyrinogen IX metabolic process3/16011/188629,4023E-050,01586063
GO:0006919activation of cysteine-type endopeptidase activity involved in apoptotic process6/16087/188629,7175E-050,01586063
GO:0001836release of cytochrome c from mitochondria5/16055/188620,000101910,01586063
GO:0006400tRNA modification6/16089/188620,000110280,01586063
GO:0070126mitochondrial translational termination6/16089/188620,000110280,01586063
GO:0001844protein insertion into mitochondrial membrane involved in apoptotic signaling pathway4/16030/188620,000115060,01586063

– The second title, "Heme synthesis inhibition prevents the activation of key developmental signaling pathways," needs to be more specific. Because heme is a critical component of general cell homeostasis, it is evident that the inhibition will affect key signaling pathways, not only in development but in any stage of mammal's life.

In this same section, what happens with positive enriched genes in the SA-treated condition? It should be added the up-regulation plot side Figure 2a, and a correspondent discussion about it.

We thank reviewer 2 for these comments. We accordingly corrected the section 2 as a whole, changing its title and the related figure 2a. The new secondary title is Heme synthesis inhibition prevents the activation of key signaling pathways associated with implantation. The upregulated terms have been also commented in the main text section (lines 132-134).

– In the section describing the upregulation of 2-cell-stage-related genes when SA is added, it is needed to add a scramble-inhibition as control. Treat 2iL cells with an inhibitor of a different metabolic pathway for 48h and analyze by rt-PCR (a) the 2-cell-related genes, (b) the differentiation towards trophoblast cells.

In order to validate the metabolic effect of heme synthesis inhibition we inhibited two other unrelated metabolic pathways: the pentose phosphate pathway with 6-aminonicotinamide and the fatty acid oxidation with Etoxomir. We do not observe any effect of the inhibition of these pathways on the upregulation of the 2CLC program (Figure 1 - Supplement Figure 1c).

– What happens with the glycine levels after heme synthesis inhibition? Does glycine play a role in the induction of a 2-cell-like state? Ideally authors should include an experiment to test this role.

To investigate the putative role of a glycine accumulation on the acquisition of a 2CLC gene signature, we tested the supplementation in 10 mM of glycine of the 2iL naïve medium. As shown in Author response image 5, no gene expression increase is observed.

Author response image 5
Glycine supplementation does not trigger a 2CLC gene signature.

Relative expression of 2C gene markers of mESCs assessed by RT-qPCR relative to Gapdh expression and to 2iL naïve control, after supplementation with 10 mM of glycine for 48 h. n=3 independent replicates. Data shown as means +/-S.D. p>0.05, T-tests.

– The following is optional, but it could be a considerable improvement to provide the bulk RNA seq comparing the inhibition of SUCNR1 vs. the activation induced by succinate, to see all other pathways that could crosstalk and describe better the mechanism of the succinate in pluripotent/totipotent states.

While comparing the effect we observe on the 2CLC gene signature through heme synthesis or SDH inhibition to the previously published RA induction we noticed that inhibition of RAR and RXR rescued the increase in gene expression (Figure 5c). While this does not pinpoint the exact mechanism, these observations bring light to an intermediate involved.

– The authors provide a very detailed molecular analysis on the effect of heme synthesis inhibition on the pluripotency exit. However, functional characterization (such as teratoma formation) is important to tell whether these naive mESC after treatment with heme synthesis blocker have any defects on the pluripotency exit and differentiation.

As explained in the Discussion section, the fact that heme synthesis knock-out is embryonic lethal around the implantation stage in mouse (Lindberg et al., 1996; Bensidhoum et al., 1998; Phillips et al., 2001; Conway et al., 2017; Magness et al., 2002) strongly suggests an implantation defect, hence, pluripotency exit. This is further supported by the loss of Oct4 in ALAD KO mESCs after removal of hemin (Figure 1 – Supplement Figure 1b). Furthermore, teratoma formation assay or embryoid body formation assays after a temporary blockade (2 days) of heme synthesis through SA would quickly be attenuated as heme synthesis would resume after injection, especially since these assays extends for weeks.

– Although it is clear that heme synthesis is important for the mouse pluripotency status transition, it is not clear whether this is a mechanism present in human as well. The authors presented bioinformatic data suggesting that this might be the case. It is important that the authors perform functional studies in the human cells to further substantiate this point.

To answer this question, we used Elf1 hESC cells (Ware et al., 2014) grown in RSeT media to mimic the naïve conditions, and triggered the exit toward the primed stage for 4 days in TeSR media (both commercially available, StemCell technologies), with or without 0.5 mM of SA. We observe a significant prevention of the loss of naïve markers, as in mESCs, while not preventing the increase in a primed signature (Figure 1 – Supplement Figure 1c).

– It is not clear how the cell senses heme deficiency and how heme deficiency results in inability to activate ERK/MAPK and TGF β signaling. Could the authors provide comments into this aspect?

We thank the reviewers for their highly relevant comments. We have addressed these two questions simultaneously.

Heme deficiency is canonically sensed in mammals through the nuclear factor BACH1 (reviewed in (Zhang et al., 2018)) or the activation of the Integrated Stress Response (ISR) through the Heme Responsive Inhibitor (HRI) or EIF2AK1 (reviewed in (Pakos‐Zebrucka et al., 2016)).

BACH1 heterodimerized with MAF proteins (among others) binds to DNA and represses the transcription of target genes. Upon heme binding to BACH1, the complex dissociates and BACH1 is exported in the cytosol, thus relieving the repression of target genes. As seen in immunofluorescence analyses of BACH1 subcellular localization (Figure 2 – Supplement Figure 1a), the abundance of nuclear BACH1 is comparable in 2iL, EpiLC, and EpiLC+SA conditions, indicating that the inhibition of heme synthesis does not affect BACH1 activity. On the opposite and as expected, the addition of hemin provokes the nuclear exclusion of BACH1. This data indicates that BACH1 is not responsible for the heme deficiency sensing in our model.

As another putative way of heme depletion to act on the transition from naïve to primed, we also investigated the role of the ISR. Indeed, various environmental and pathological conditions, including protein homeostasis (proteostasis) defects, nutrient deprivation, viral infection, and oxidative stress, activate the ISR in order to restores balance by reprogramming gene expression, all converging to the phosphorylation and activation of the eukaryotic translation initiation factor eIF2. Heme depletion is known to be one of the stresses activating this pathway, allowing the phosphorylation and activation of the heme-regulated inhibitor (HRI) kinase, in turn phosphorylating EIF2α. To assess the activation of this pathway, we targeted two levels: The phosphorylation of EIF2α by western blot analysis and the global protein synthesis levels with a SUnSET assay (Schmidt et al., 2009). The increase in EIF2α phosphorylation (Figure 2 – Supplement Figure 1b), a direct result of the activity of HRI in absence of heme, indicates the activation of a kinase upstream of the pathway. The global reduction in protein synthesis, observed with the levels of puromycin-labelled peptides (Figure 2 – Supplement Figure 1c), further confirm the activation of the ISR upon inhibition of heme synthesis.

To further explore the possible implication of this ISR-HRI axis in the inhibition of native-to-primed transition induced by heme synthesis inhibition, we used a chemical activator of HRI (BTdCPU; (Chen et al., 2011)) to assess whether it could induce a similar effect as SA or not. Treatment with 2 µM BTdCPU, reduces protein synthesis to a similar extent that SA (Figure 2 – Supplement Figure 1d), but fails at preventing the naïve stage exit (Figure 2 – Supplement Figure 1e), indicating an HRI-independent mechanism. These results were added to the manuscript in lines 119-126.

– How strong the effect of inhibiting heme synthesis and succinate in inducing the 2CLC population are as the absolute number of Zscan4+ or MuERVL+ cell are quite low (< 3%) ?. I suggest that the authors include other 2CLC inducers such as acetate(Rodriguez-Terrones, 2020) and RA (Iturbide, A., 2021) as a control for comparison.

The updated figure 5 now includes RA as a positive control as presented in Iturbide et al., 2021 and as suggested by the reviewers. Interestingly, we observe that the gene expression levels of the 2CLC markers after RA treatment increase to a similar extent than with AA5, but not SA.

These authors showed that the RA-induced 2CLC increase is due to activation of the RARγ since inhibition of RXR (with the HX531 inhibitor) does not rescue the effect while a RAR inhibitor (AGN193109) does. Very interestingly, the AA5-induced 2CLC signature seems to depend on both receptors as HX531 (RXR inhibitor) and AGN193109 (pan-RAR inhibitor) do inhibit the AA5-induced 2CLC gene expression signature.

Since genetic ablation of heme synthesis enzymes is embryonic lethal around the implantation time (Lindberg et al., 1996; Bensidhoum et al., 1998; Phillips et al., 2001; Conway et al., 2017; Magness et al., 2002), we expect this experiment to bear toxicity for the embryo, especially since accumulation of heme synthesis intermediate is known for its toxicity (Lämsä et al., 2012; Handschin et al., 2005). Furthermore, injection of the 2CLC in early embryos is rarely used, including in Iturbide (2021) or Rodriguez-Terrones (2020).

– The authors performed the 2CLC experiment with 2iL condition. However, a quick review of the literature indicates that many of these studies have been done in FBS/LIF system. Can the authors comment on the difference between 2iL condition and FBS/LIF in the study of 2CLC?

We thank the reviewer to point at this difference. We also observe an increase in the expression of 2CLC marker genes in response to AA5, followed by a reduction when the FBS+LIF basal media was supplemented with BM (Author response image 6). This finding highlights a conserved mechanism with the 2iLIF basal media.

Author response image 6
Succinate accumulation induces a 2CLC gene signature in mESCs grown in FBS+LIF conditions.

Gene expression analysis of 2CLC genes of mESCs grown in a media with 15% FBS supplemented with LIF, with or without addition of 250nM atpenin A5 and 10µM butylmalonate, assessed by RT-qPCR relative to Gapdh expression and to FBS/LIF control. Results expressed as mean +/- S.D. *p<0.05, **p < 0.01, ***p < 0.001. ANOVA-1. n=3 independent biological replicates.

– The authors analyzed that heme synthesis is also important human pluripotent state transition. It will be interesting to see the scenario in human pluripotent stem cells, which will largely make the study difference, especially if the heme synthesis blockade will also increase the emergence of human 2 cell-like cells.

To answer this question, we used Elf1 hESC cells (Ware et al., 2014) grown in RSeT media to mimic the naïve conditions, and triggered the exit toward the primed stage for 4 days in TeSR media (both commercially available, StemCell technologies), with or without 0.5 mM of SA. We observe a significant prevention of the loss of naïve markers, as in mESCs, while not preventing the increase of a primed signature (Figure 1 – Supplement Figure 1c).

In addition, naïve Elf1 hESCs maintained either in RSeT medium or in 2iL-I-F (GSK3 and MEK inhibitors, LIF, IGF1 and FGF2) media (Sperber et al., 2015) treated with 0.5 mM of SA for 2 days, show a significant upregulation of markers associated with the 8-cell stage (the human homolog of the 2CLC), corresponding to the zygote genome activation event (Taubenschmid-Stowers et al., 2022), highlighting a similar mechanism (Author response image 4; Figure 3g).

– The whole study of inhibition is chemical achieved. As a supplement, the authors should also test with genetic intervention instead of sole chemicals. For example, the inhibition of heme synthesis by SA should also be confirmed by knockout or knockdown of proteins in this pathway like ALAD, PBGD et al. Also similar with AA5.

We thank the reviewer for this important comment. Using the CRISPR-Cas9 technology we generated an ALAD KO E14-mESC line using CRISPR/Cas9 (Figure 1 – Supplement Figure 1a). To maintain a healthy population, this line was grown in a medium supplemented with hemin and removal of this supplement allowed to reveal the heme synthesis inhibition. As shown in the updated figure 3 (Figure 3e), removal of hemin in the culture medium for 2 days induces a strong increase in 2CLC marker expression.

We also performed the transition from naïve to primed in these ALAD KO mESCs. Genetic ablation of ALAD also prevents mESCs to properly exit the naïve state as the naïve marker expression is maintained. On the other hand, primed markers, except Dnmt3b, are upregulated (Figure 1 – Supplement Figure 1b). While this is in apparent contrast to the chemical inhibition of ALAD, the complete loss of ALAD seems to perturb the pluripotency state as seen by the complete loss of Oct4 expression, thus impairing the proper transition. This loss of Oct4 transcript could be due to the complete loss of heme, impairing the formation of G-quadruplexes, known to promote Oct4 gene expression (Renčiuk et al., 2017; Gray et al., 2019).

– The functional assay of 2 cell-like cells after heme synthesis inhibition should be tested in vivo by 8-cell or blastocyst injection

– To make the finding here more convincing and significant, it will be good to confirm in embryos.

As explained in the Discussion section, the fact that heme synthesis knock-out is embryonic lethal around the implantation stage in mouse (Lindberg et al., 1996; Bensidhoum et al., 1998; Phillips et al., 2001; Conway et al., 2017; Magness et al., 2002) strongly suggests an implantation defect, hence, pluripotency exit. This is further supported by the loss of Oct4 in ALAD KO mESCs after removal of hemin (Supp. Figure 1A). While we expect either reduction in survival or development arrest by the treated embryos (heme synthesis or SDH inhibition), obtaining embryos for the experiments was challenging and thus was not performed.

– The manuscript should include the metabolism part in the introduction instead of using large paragraphs in the main text to introduce these pathways and previous studies.

We updated the introduction section in lines 65-67. However, the bulk of the heme synthesis/succinate flow remained in the result section to better guide the reader.

https://doi.org/10.7554/eLife.78546.sa2

Article and author information

Author details

  1. Damien Detraux

    1. Laboratory of Biochemistry and Cell Biology (URBC), NAmur Research Institute for LIfe Sciences (NARILIS), University of Namur (UNamur), Namur, Belgium, Namur, Belgium
    2. Institute for Stem Cell and Regenerative Medicine, University of Washington, Seattle, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9704-2076
  2. Marino Caruso

    Laboratory of Biochemistry and Cell Biology (URBC), NAmur Research Institute for LIfe Sciences (NARILIS), University of Namur (UNamur), Namur, Belgium, Namur, Belgium
    Contribution
    Software, Investigation, Visualization, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  3. Louise Feller

    Laboratory of Biochemistry and Cell Biology (URBC), NAmur Research Institute for LIfe Sciences (NARILIS), University of Namur (UNamur), Namur, Belgium, Namur, Belgium
    Contribution
    Investigation, Methodology, Writing – review and editing
    Competing interests
    No competing interests declared
  4. Maude Fransolet

    Laboratory of Biochemistry and Cell Biology (URBC), NAmur Research Institute for LIfe Sciences (NARILIS), University of Namur (UNamur), Namur, Belgium, Namur, Belgium
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  5. Sébastien Meurant

    Laboratory of Biochemistry and Cell Biology (URBC), NAmur Research Institute for LIfe Sciences (NARILIS), University of Namur (UNamur), Namur, Belgium, Namur, Belgium
    Contribution
    Investigation, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0711-9605
  6. Julie Mathieu

    1. Institute for Stem Cell and Regenerative Medicine, University of Washington, Seattle, United States
    2. Department of Comparative Medicine, University of Washington, Seattle, United States
    Contribution
    Conceptualization, Supervision, Writing – review and editing
    Competing interests
    No competing interests declared
  7. Thierry Arnould

    Laboratory of Biochemistry and Cell Biology (URBC), NAmur Research Institute for LIfe Sciences (NARILIS), University of Namur (UNamur), Namur, Belgium, Namur, Belgium
    Contribution
    Supervision, Writing – review and editing
    Competing interests
    No competing interests declared
  8. Patricia Renard

    Laboratory of Biochemistry and Cell Biology (URBC), NAmur Research Institute for LIfe Sciences (NARILIS), University of Namur (UNamur), Namur, Belgium, Namur, Belgium
    Contribution
    Conceptualization, Supervision, Writing – original draft, Writing – review and editing
    For correspondence
    patsy.renard@unamur.be
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4144-3353

Funding

Fonds De La Recherche Scientifique - FNRS

  • Sébastien Meurant

Fonds de la Recherche dans l’Industrie et l’Agriculture

  • Damien Detraux
  • Marino Caruso

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We are grateful to Dr. Maria Helena Padilla-Torres (Institute of epigenetics and stem cells; Helmholtz Zentrum München) for kindly providing the 2 C:::turboGFP mESC cell line. We also thank the Morphym platform – UNamur for the help with confocal and flow cytometry analysis.

This work was supported by the Fonds de la Recherche Scientifique – FNRS, 5, rue d’Egmont, 1000 Brussels. DD and MC are recipient of a (Fonds de la Recherche dans l’Industrie et l’Agriculture [FRIA], Belgium), fellowship and S.M. is recipient of a (Fonds National de la Recherche Scientifique [FNRS], Belgium) fellowship.

Senior Editor

  1. Mone Zaidi, Icahn School of Medicine at Mount Sinai, United States

Reviewing Editor

  1. Simón Méndez-Ferrer, University of Cambridge, United Kingdom

Version history

  1. Preprint posted: March 11, 2022 (view preprint)
  2. Received: March 11, 2022
  3. Accepted: July 8, 2023
  4. Accepted Manuscript published: July 10, 2023 (version 1)
  5. Version of Record published: August 14, 2023 (version 2)

Copyright

© 2023, Detraux et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 302
    Page views
  • 103
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Damien Detraux
  2. Marino Caruso
  3. Louise Feller
  4. Maude Fransolet
  5. Sébastien Meurant
  6. Julie Mathieu
  7. Thierry Arnould
  8. Patricia Renard
(2023)
A critical role for heme synthesis and succinate in the regulation of pluripotent states transitions
eLife 12:e78546.
https://doi.org/10.7554/eLife.78546

Further reading

    1. Developmental Biology
    2. Neuroscience
    Igor Y Iskusnykh, Nikolai Fattakhov ... Victor V Chizhikov
    Research Article

    Development of the nervous system depends on signaling centers – specialized cellular populations that produce secreted molecules to regulate neurogenesis in the neighboring neuroepithelium. In some cases, signaling center cells also differentiate to produce key types of neurons. The formation of a signaling center involves its induction, the maintenance of expression of its secreted molecules, and cell differentiation and migration events. How these distinct processes are coordinated during signaling center development remains unknown. By performing studies in mice, we show that Lmx1a acts as a master regulator to orchestrate the formation and function of the cortical hem (CH), a critical signaling center that controls hippocampus development. Lmx1a co-regulates CH induction, its Wnt signaling, and the differentiation and migration of CH-derived Cajal–Retzius neurons. Combining RNAseq, genetic, and rescue experiments, we identified major downstream genes that mediate distinct Lmx1a-dependent processes. Our work revealed that signaling centers in the mammalian brain employ master regulatory genes and established a framework for analyzing signaling center development.

    1. Developmental Biology
    2. Evolutionary Biology
    Salvatore D'Aniello, Stephanie Bertrand, Hector Escriva
    Feature Article

    Cephalochordates and tunicates represent the only two groups of invertebrate chordates, and extant cephalochordates – commonly known as amphioxus or lancelets – are considered the best proxy for the chordate ancestor, from which they split around 520 million years ago. Amphioxus has been an important organism in the fields of zoology and embryology since the 18th century, and the morphological and genomic simplicity of cephalochordates (compared to vertebrates) makes amphioxus an attractive model for studying chordate biology at the cellular and molecular levels. Here we describe the life cycle of amphioxus, and discuss the natural histories and habitats of the different species of amphioxus. We also describe their use as laboratory animal models, and discuss the techniques that have been developed to study different aspects of amphioxus.