VLA-4 suppression by senescence signals regulates meningeal immunity and leptomeningeal metastasis

  1. Jiaqian Li
  2. Di Huang
  3. Bingxi Lei
  4. Jingying Huang
  5. Linbing Yang
  6. Man Nie
  7. Shicheng Su  Is a corresponding author
  8. Qiyi Zhao  Is a corresponding author
  9. Ying Wang  Is a corresponding author
  1. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, China
  2. Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, China
  3. Department of Neurosurgery, Sun Yat-sen University, China
  4. Department of Medical Oncology, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, China
  5. Department of Immunology, Zhongshan School of Medicine, Sun Yat-Sen University, China
  6. Department of Infectious Diseases, Third Affiliated Hospital of Sun Yat-sen University, China
  7. Guangdong Provincial Key Laboratory of Liver Disease Research, the Third Affiliated Hospital, Sun Yat-Sen University, China

Abstract

Leptomeningeal metastasis is associated with dismal prognosis and has few treatment options. However, very little is known about the immune response to leptomeningeal metastasis. Here, by establishing an immunocompetent mouse model of breast cancer leptomeningeal metastasis, we found that tumor-specific CD8+ T cells were generated in deep cervical lymph nodes (dCLNs) and played an important role in controlling leptomeningeal metastasis. Mechanistically, T cells in dCLNs displayed a senescence phenotype and their recruitment was impaired in mice bearing cancer cells that preferentially colonized in leptomeningeal space. Upregulation of p53 suppressed the transcription of VLA-4 in senescent dCLN T cells and consequently inhibited their migration to the leptomeningeal compartment. Clinically, CD8+ T cells from the cerebrospinal fluid of patients with leptomeningeal metastasis exhibited senescence and VLA-4 downregulation. Collectively, our findings demonstrated that CD8+ T cell immunosenescence drives leptomeningeal metastasis.

Editor's evaluation

This study address an exciting area which remains less explored. Overall, the findings presented here provides immediate impact to cancer metastasis and how the interplay between tumor cells and immune cells can affect this process.

https://doi.org/10.7554/eLife.83272.sa0

Introduction

Brain metastasis is associated with one of the worst clinical outcomes and has few therapeutic options (Ahluwalia et al., 2020). The brain contains two distinctive compartments – parenchyma mainly consisting of cells and leptomeninges filled with cerebrospinal fluid (CSF) (Valiente et al., 2018). Many brain parenchymal cells can be found nowhere else in the body, including neurons, astrocytes, and microglia. Despite tremendous progress has been made in understanding the interaction between tumor cells and resident cells in parenchymal metastasis, very little is known about the unique microenvironment of leptomeningeal metastasis (LM) (Boire et al., 2020). LM, which is caused by cancer cells invading the leptomeninges, or CSF-filled spaces, represents the worst outcome of cancer patients (Franzoi and Hortobagyi, 2019; Wang et al., 2018). Despite the development of diagnostic techniques and advances in cancer treatment, the incidence of breast cancer with LM increases, ranges between 3% and 16% (Kushner and Cheung, 1992). LM is a fatal complication with dismal prognosis. Its median survival from detection is as low as 18 weeks, and 1-year survival is about 15% (Niwińska et al., 2013).

Access of circulating immune cells to the brain is limited by the blood–brain barrier (BBB). Therefore, the brain has previously been considered as an immune-privileged organ. Recently, the paradigm has shifted, as functional lymphatic vessels have been identified in meninges. Immune cells and antigens in central nervous system (CNS) can be drained to deep cervical lymph nodes (dCLNs) via meningeal lymphatic system (Louveau et al., 2015). Ablation of lymphatic vessels reduces the interaction between brain-specific T cells and dendritic cells (DC), and alleviates disease progression in experimental allergic encephalomyelitis (EAE) mice (Louveau et al., 2018), indicating that lymphatic drainage contributes to T cell activation in CNS. The very late activated Ag-4 (VLA-4) is a member of integrin family, which is widely known to mediate T cell adhesion to endothelium. In fact, VLA-4 functions as an essential adhesion molecule in T cell migration across the BBB in EAE (Bartholomäus et al., 2009; Schläger et al., 2016). However, their roles in CNS diseases are still poorly understood.

Cancer is often associated with aging as the incidences of most cancers rise dramatically in the elderly (Bray et al., 2018; Aunan et al., 2017). Oncogene activation mediates tumor cells to adopt a senescence-associated secretory phenotype (SASP), which fosters chronic inflammatory milieus (Faget et al., 2019; Fane and Weeraratna, 2020). Consequently, the aging microenvironment induces senescence of T cells, which leads to immunosuppression in multiple types of malignancies (Ye et al., 2014). Furthermore, the tumor microenvironment (TME) can induce senescence of adoptively transferred tumor-specific T cells, and therefore develop a resistance to immunotherapy (Ye et al., 2013). However,whether immunosenescence contributes to the immunosuppression of meningeal immune response to tumors remains unreported. Here, we investigated how antitumor meningeal immunity is initiated and suppressed during LM.

Results

Establishing a model of cancer leptomeningeal metastasis

To investigate the role of immunity in LM, we used immunocompetent mice and employed a two-stage in vivo selection method to enrich breast cancer cells with leptomeningeal tropism. First, selecting the cancer cells that survived in the CSF. Second, selecting cancer cells from the resulting populations for hematogenous tropism to colonize the leptomeninges through intracarotid artery injection (Figure 1A). Briefly, mouse breast cancer cells (EO771 and 4T1) and lung cancer cells (LLC) stably expressing luciferase were inoculated into the cisterna magna of syngeneic mice C57BL/6 (EO771-luc, LLC-luc) or BALB/c (4T1-luc) (Figure 1A). Once leptomeningeal metastatic lesions were established, cancer cells were isolated from the meninges and cultured ex vivo to obtain intermediate sublines. Intermediate cells were then inoculated into intracarotid artery for hematogenous dissemination to meningeal space. Cancer cells in metastatic lesions of leptomeningeal space after three times of enrichment were selected as a highly leptomeningeal metastatic subline ‘‘LM-phenotype cells’’ (Figure 1A). To evaluate the leptomeningeal metastatic capacity of this selected derivative, we performed bioluminescent imaging and animal MRI analysis after injection of EO771 LM-phenotype cells and their parental cells via intracarotid artery. Intense bioluminescence imaging (BLI) signals (Figure 1B and C) and hyperintense T1-weighted signals (Figure 1D) throughout tumors in the meningeal space demonstrated abundant neuro-anatomic metastases of mice injected with LM-phenotype cells, rather than the parental cells. Moreover, we confirmed the leptomeningeal localization of metastases by the immunohistochemical (Figure 1E, Figure 1—figure supplement 1A) and immunofluorescent staining (Figure 1F, Figure 1—figure supplement 1B). Furthermore, LM cell injection into the intracarotid artery significantly shortened animal survival compared to the parental cell (Figure 1G). Similar results were observed in mice injected with 4T1 LM-phenotype cells (Figure 1—figure supplement 1C–F) and LLC LM-phenotype cells (Figure 1—figure supplement 1G–J). Furthermore, principal component analysis (PCA) of the transcriptome confirmed that the gene expression profiles of EO771 parental, inter and LM-phenotype cells segregate independently (Figure 1H). Thus, there was a heterogeneity between LM population and its matched parental population.

Figure 1 with 1 supplement see all
Establishing a model of breast cancer leptomeningeal metastasis (LM).

(A) An illustration showing iterative in vivo selection of LM derivative cell lines. 2 × 104 tumor cells transduced with lentiviral vectors expressing luciferase were injected into the cisterna magna of recipient mice. When LM lesions were detected by IVIS, the mice were euthanized. Cells were collected and cultured before being injected into the other mice. This procedure was carried out three times to generate intermediate (Inter) cells. Next, 1 × 105 Inter cells were inoculated into the intracarotid artery. Mice bearing LM were sacrificed and tumor cells were collected from the meninges and denoted as LM derivatives. (B–G) 1 × 105 EO771 parental or LM-phenotype cells were inoculated into the intracarotid artery of recipient mice. (B, C) Tumor growth was monitored by bioluminescence imaging (BLI) imaging at day 28. Representative BLI images (B) and quantitation (C) are shown (mean ± SD, n = 12 mice per group). ***p<0.001 by two-tailed Student’s t test. (D) MRI at day 28 post-inoculation revealed LM was formed after LM-phenotype cell inoculation. The white arrows indicate metastatic lesions. (E) Neuro-anatomic localization of metastases was determined by immunohistochemical staining. Scale bar = 50 μm. (F) Representative pictures of immunofluorescent staining for LM lesions in mice (luciferase, green; DAPI, blue). The white line indicates the border of the metastatic lesions. Scale bar = 50 μm. (G) Kaplan–Meier plot of overall survival of mice. (H) Principal component analysis (PCA) plots of gene expression data showing a segregation among parental (blue), LM-phenotype (green), and inter (orange) cell lines. Genes with base mean ≥ 50, fold change ≥2 or ≤0.5 and p<0.01 were included for analysis.

CD8+ T cells constrain leptomeningeal metastasis

Emerging data show that meningeal immunity plays a crucial role in various diseases (Ransohoff and Engelhardt, 2012), but how this CNS barrier operates immunologically under LM remains poorly understood. We found that CD45+ immune cells increased in mice injected with parental or LM cells, compared with those injected with PBS, indicating that the meninges were inflamed after tumor inoculation. However, meningeal immune cell numbers in the presence of LM dropped significantly in comparison with those injected with parental cells (Figure 2A). To further investigate the changes of meningeal immune repertoire during LM, we analyzed the absolute numbers of meninge-infiltrating immune cells, including T cells, monocytes, microglia, myeloid cells, and neutrophils (Manglani et al., 2018). Interestingly, we observed that only T cells were markedly decreased in LM (Figure 2B, Figure 2—figure supplement 1A). To confirm the role of T lymphocytes in LM, we injected EO771 LM-phenotype cells into Rag2-/- mice, which carry a targeted knockout mutation in recombination activating gene 2 (Rag2) and therefore lack mature T or B cells (Fan et al., 2019). Compared with wild type (WT) C57BL/6 mice, accelerated intracranial tumor progression was observed in the Rag2-/- mice when LM-phenotype cells were injected via intracarotid arteries, which was evaluated by bioluminescent signals (Figure 2C and D). Similarly, we injected 4T1 LM-phenotype cells into the immunodeficient nude mice and immunocompetent BALB/c mice, and observed that tumor formation was significantly enhanced in nude mice (Figure 2—figure supplement 1B and C). To assess which subset of T cells contributes to constraining LM, we depleted CD4+ and CD8+ T cells in immunocompetent C57BL/6 mice via anti-CD4 (α-CD4) and anti-CD8 neutralizing antibodies (α-CD8), respectively. Analyzing the LM lesions by histopathology, we found that intracranial tumor growth dramatically increased in the mice with CD8+ T cell depletion compared with IgG neutralization (Figure 2E, Figure 2—figure supplement 1D). By contrast, depletion of CD4+ T cells even exhibited slight tumor regression, although the difference did not reach statistical significance (Figure 2E, Figure 2—figure supplement 1D). These results suggested that CD8+ T cells play an important role in constraining intracranial tumor growth.

Figure 2 with 1 supplement see all
CD8+ T cells constrain leptomeningeal metastasis (LM).

(A–B) PBS, 1 × 105 EO771 parental or LM-phenotype cells were inoculated into the intracarotid artery of recipient mice. (A) Histogram represents the absolute number of meningeal CD45+ immune cells (mean ± SD. PBS n = 4 per group; parental, LM n = 5 per group). *p<0.05, ***p<0.001 by one-way ANOVA with Tukey’s multiple-comparison test. (B) Histogram represents the absolute number of diverse meningeal immune cells mice (mean ± SD, n = 4 per group). *p<0.05 by one-way ANOVA with Tukey’s multiple-comparison test. (C, D) 1 × 105 EO771 LM-phenotype cells were injected into the intracarotid artery of wild type C57BL/6 (WT) or Rag2-/- mice. Representative images (C) and quantitation (D) for tumor growth monitored by bioluminescence imaging (BLI) at day 28 post-injection (mean ± SD, n = 12 per group.). ***p<0.001 by two-tailed Student’s t test. (E) 1 × 105 LM-phenotype cells were inoculated into the intracarotid artery of WT C57BL/6 mice treated with IgG, anti-CD4 (α-CD4), or anti-CD8 neutralizing antibodies (α-CD8), respectively. Representative images for intracranial tumor lesions are shown. Scale bar = 20 μm. (F) Evans blue was injected into the cisterna magna of WT C57BL/6 mice. The presence of dye in deep cervical lymph nodes (dCLNs) was detected after 30 min. Representative images of the Evans blue accumulation in the dCLN. The white arrowhead points to the dCLN. (G–I) CD4+ and CD8+ T cells were isolated from dCLNs of WT mice injected with EO771 cells and adoptively transferred into Rag2-/- mice, followed by the inoculation of LM-phenotype cells. (G) Schematics of the adoptive cell transfer model in immunocompetent mice. (H) Representative immunofluorescence staining for LM lesions in mice with indicated treatment (luciferase, green; DAPI, blue). The white line and arrows indicate the border of the metastatic lesions. Scale bar = 50 μm. (I) Kaplan–Meier plots of overall survival of mice with indicated treatment. Black, PBS (n = 12); blue, adoptive transfer of CD4+ T cells (n = 12, p=0.56 compared with mice treated with PBS); red, adoptive transfer of CD8+ T cells (n = 12, p<0.001 compared with mice treated with PBS).

Most of the immune surveillance takes place in the tumor draining lymph nodes (TDLN) largely as a result of its unique cellular composition and proximity to the primary tumor (Chandrasekaran and King, 2014). It has been reported that dCLNs communicate with meningeal lymphatics directly (Louveau et al., 2015). Evans blue, which is widely used as a marker of the BBB integrity, can be preferentially drained via the lymphatics (Maloveska et al., 2018). Therefore, to visualize CNS lymphatic drainage, we injected Evans blue into the cisterna magna and detected the presence of dye in dCLNs 30 min later (Figure 2F). Furthermore, we isolated CD4+ and CD8+ T cells from dCLNs of WT mice 2 weeks after EO771 cell injection. These isolated T cells were adoptively transferred into syngeneic Rag2-/- mice, respectively, followed by LM-phenotype cell inoculation (Figure 2G). Interestingly, intracranial tumors arising in Rag2-/- mice was much smaller when receiving transferred CD8+ T cells, but not CD4+ T cells (Figure 2H, Figure 2—figure supplement 1E). More importantly, mice receiving CD8+ T cells had longer overall survival than those receiving CD4+ T cells or PBS (Figure 2I). These data suggested that CD8+ T cells are crucial effectors in controlling LM.

dCLNs generate tumor-specific CD8+ T cells against leptomeningeal metastasis

The priming of tumor-specific CD8+ T cells primarily relies on antigen-presenting DCs, which is the fundamental step that launches T cell response against tumor (Bandola-Simon and Roche, 2019; Alfei et al., 2021). To explore whether tumor-specific CD8+ T cells were primed by DCs in dCLN, we firstly examined the antigen processing of DCs. We inoculated EO771 breast tumor cells with ectopic expression of chicken ovalbumin (OVA) (EO771-OVA) into the cisterna magna of C57BL/6 mice and isolated the CD11c+ DCs from the draining dCLNs, non-draining inguinal LNs, and spleen 7 days later. Interestingly, OVA peptide/MHC class I complex, SIINFEKL/H2-Kb, was only detected on CD11c+ DCs in dCLNs but not the ones in inguinal LNs and spleen (Figure 3A, Figure 3—figure supplement 1A and B). Furthermore, we employed H-2-Kb-OVA/SIINFEKL pentamer staining to detect the generation of OVA-specific CD8+ T cells. Interestingly, we observed that a significant proportion of OVA/SIINFEKL pentamer+ CD8+ T cells was detected in the dCLNs of mice injected with EO771-OVA cells, but not in the mice injected with PBS, wild type EO771 (EO771 WT) and EO771 with an irrelevant antigen glycoprotein B (EO771-gB) cells (Figure 3B, Figure 3—figure supplement 1C). Moreover, CD11c+ DCs were subsequently isolated from dCLNs, and then co-cultured with naïve CD8+ T cells isolated from the spleens of OT-1 mice in vitro (Figure 3C). Analysis of OT-1 T cell priming revealed that only DCs from mice receiving EO771-OVA inoculation could expand OT-1 T cells (Figure 3D, Figure 3—figure supplement 1D) and induce a significant increase in IFN-γ production (Figure 3E, Figure 3—figure supplement 1E) of OT-1 T cells.

Figure 3 with 1 supplement see all
Deep cervical lymph nodes (dCLNs) generate tumor-specific CD8+ T cells against leptomeningeal metastasis (LM).

(A) Dendritic cells (DCs) from spleen, inguinal lymph nodes (LNs), and dCLNs were isolated 7 days after intra cisterna magna EO771-OVA cell injection, and later analyzed for SIINFEKL presentation (n = 8 per group). (B) PBS, EO771, and EO771 expressed with gB (EO771-gB) and OVA (EO771-OVA) were injected into C57BL/6 mice. CD8+ T cells from LNs were isolated and later analyzed for ovalbumin (OVA) pentamer expression. (C) Schematics of animal experiments detecting the generation of tumor-specific CD8+ T cells in vitro. PBS, EO771, and EO771-gB and EO771-OVA were injected into C57BL/6 mice. DCs were subsequently isolated from dCLNs, and then co-cultured with OT-1 T cells in vitro. (D) Representative histogram of CFSE dilution of OT-1 T cells co-cultured with CD11c+ cells isolated from dCLNs of mice with indicated treatment for 60 hr. (E) Representative images of IFN-γ ELISpot data of OT-1 T cells co-cultured with CD11c+ cells isolated from dCLNs of mice with indicated treatment for 60 hr. (F) Schematics of animal experiments illustrating dCLNs generate tumor-specific CD8+ T cells against LM. Surgical ligation of the lymphatics afferent to the dCLNs was performed. A week after the surgery, sham or ligation group was inoculated with EO771-OVA cells. DCs were subsequently isolated from dCLNs, and then co-cultured with OT-1 T cells in vitro. (G) Representative histogram of SIINFEKL expression on CD11c+ cells isolated from dCLNs of mice with indicated treatment. (H) Representative histogram of CFSE dilution of OT-1 T cells co-cultured with CD11c+ cells isolated from dCLNs of mice with indicated treatment for 60 hr. (I) Representative images of IFN-γ ELISpot data of OT-1 T cells co-cultured with CD11c+ cells isolated from dCLNs of mice with indicated treatment for 60 hr.

Meningeal lymphatics act as an avenue for CNS drainage and immune cell trafficking (Tavares and Louveau, 2021). We performed the surgical ligation of the lymphatic afferent to the dCLNs, which could disrupt the meningeal lymphatic drainage. A week after the surgery, sham or ligation group was inoculated with EO771-OVA cells, respectively (Figure 3F). Determined by the expression of SIINFEKL/H2-Kb complex on the surface of CD11c+ dCLN DCs, antigen processing was impaired in the mice receiving surgical ligation (Figure 3G, Figure 3—figure supplement 1F). In addition, the proliferation (Figure 3H, Figure 3—figure supplement 1G) and IFN-γ production (Figure 3I, Figure 3—figure supplement 1H) of OT-1 T cells primed by dCLN DCs were diminished. Collectively, dCLNs could generate tumor-specific CD8+ T cells.

dCLN CD8+ T cells exhibit senescence in leptomeningeal metastasis

Adaptive immune response against tumor was provoked by antigen-specific CD8+ T cells (Kim et al., 2007). Whether CD8+ T cells control metastasis in metastatic locations or affecting dissemination of cancer cells is not clear. We first evaluated whether CD8+ T cells affect the dissemination of cancer cells by analyzing disseminated tumor cells (DTCs) in peripheral blood of C57BL/6 mice injected with EO771-luc parental or LM cells. The DTCs in the blood were defined as CD45-luciferase+ cells by flow cytometry (Figure 4—figure supplement 1A). We found that the percentages of DTCs were not significantly different between these two groups (Figure 4—figure supplement 1B and C). Moreover, we injected EO771-luc LM cells into Rag2-/- mice and transferred CD8+ T cells later. We found that CD8+ T cell transfusion did not influence the percentages of DTCs in the peripheral blood (Figure 4—figure supplement 1D). These data suggested that CD8+ T cells did not affect the dissemination of cancer cells, probably the metastatic lesion. Then we observed that in the meninge, the number of CD8+ T cells of mice injected with EO771 LM-phenotype cells (LM-CD8+ T cells) was much lower than the one in mice injected with parental cells (Parental-CD8+ T cells) (Figure 4A and B, Figure 4—figure supplement 1E). Then, we further investigated the reason for the drop of CD8+ T cell count in the meninges. It is well known that tumor-specific CD8+ T cells were primed by DCs in dCLNs, migrated to meninges, and recognized and lysed tumor cells (Calzascia et al., 2005). Therefore, we evaluated the number of CD8+ T cells in dCLNs of mice injected with LM cells and parental cells. Interestingly, we found that the absolute count of LM-CD8+ T cells in dCLNs was significantly lower than Parental-CD8+ T cells (Figure 4C and D, Figure 4—figure supplement 1F). Moreover, the proliferation of LM-CD8+ T cells in dCLNs was significantly decreased, compared with the dCLN Parental-CD8+ T cells, determined by flow cytometric analysis of CD8 and Ki-67 co-staining (Figure 4E, Figure 4—figure supplement 1G). These data suggested that the decreased proliferation of CD8+ T cells in dCLNs was one of the reasons of low infiltration of CD8+ T cells in LM lesion.

Figure 4 with 1 supplement see all
Deep cervical lymph node (dCLN) CD8+ T cells exhibit senescence in leptomeningeal metastasis (LM).

(A–I) 1 × 105 EO771 parental or LM-phenotype cells were inoculated into the intracarotid artery of recipient mice. (A, B) T cells in the meninges were isolated from mice injected with EO771 parental and LM-phenotype cells and analyzed by flow cytometry. Representative images (A) and quantitation (B) of meningeal CD8+ T cells in gated CD3+ T cells are shown (mean ± SD, n = 5 per group). **p<0.01 by two-tailed Student’s t test. (C, D) T cells in the dCLNs were isolated from mice injected with EO771 parental and LM-phenotype cells and analyzed by flow cytometry. Representative images (C) and quantitation (D) of dCLN CD8+ T cells in gated CD3+ T cells are shown (mean ± SD, n = 8 per group). ***p<0.001 by two-tailed Student’s t test. (E) Representative images of proliferative capacity of CD8+ T cells isolated from dCLNs, as determined by flow cytometry for the percentages of Ki-67+ cells (n = 4 per group). (F) Representative histogram of apoptosis of CD8+ T cells isolated from dCLNs, as determined by flow cytometry for the percentages of cleaved caspase-3+ cells. Gray, isotype; blue, parental; red, LM. (G) Representative immunoblots for p53 and p21 in CD8+ T cells isolated from dCLNs. (H, I) Representative images (H) and quantitation (I) of SA-β-gal staining in CD8+ T cells isolated from dCLNs. Scale bar = 20 μm (mean ± SD, n = 10 per group). ***p<0.001 by two-tailed Student’s t test.

Since T cell proliferation is often impaired during apoptosis and senescence, we evaluated the apoptosis and senescence of LM- and Parental-CD8+ T cells in dCLNs. Determined by the apoptotic marker, cleaved caspase 3 expression, by flow cytometric analysis, LM- and Parental-CD8+ T cells have equivalent amount of cleaved caspase 3 (Figure 4F, Figure 4—figure supplement 1H), indicating that apoptosis is not the major cause contributing to the impaired proliferation of T cells. On the other hand, senescent cells exhibit stress signs, which is characterized by withdrawal from the cell cycle and loss of the capability to proliferate under stimuli of growth factors or mitogens (Montes et al., 2008). We detected the distinct increased expression of senescence markers p53 and p21 in dCLN LM- CD8+ T cells compared with dCLN Parental-CD8+ T cells (Figure 4G, Figure 4—source data 1). Moreover, the percentage of senescence-associated β-galactosidase (SA-β-gal)-positive T cells was higher in the LM-CD8+ T cells (Figure 4H and I). Similar results were also found in CD8+ T cells in dCLNs of the mice injected with LLC LM-phenotype cells (Figure 4—figure supplement 1I–K). Collectively, CD8+ T cells in dCLNs of mice bearing LM exhibit senescence.

Downregulation of VLA-4 in senescent CD8+ T cells impairs their trafficking to meninges

Besides the proliferation, we also evaluated the trafficking ability of dCLN LM- and Parental- CD8+ T cells. We isolated the dCLN CD8+ T cells, labeled with CFSE (Carboxyfluorescein succinimidyl ester) and injected into the tail vein of recipient mice. Two-photon live imaging showed that the migration of LM- CD8+ T cells to meninges in vivo was significantly less than Parental-CD8+ T cells (Figure 5A, Figure 5—figure supplement 1A), suggesting that CD8+ T cells displayed impaired trafficking ability to meninges under LM.

Figure 5 with 1 supplement see all
Downregulation of VLA-4 in senescent CD8+ T cells impairs their trafficking to meninges.

(A) CD8+ T cells were isolated from the deep cervical lymph nodes (dCLNs) of mice injected with parental and leptomeningeal metastasis (LM)-phenotype cells, respectively, stained with CFSE, and subsequently transferred to the recipient mice. 24 hr after T cell transfusion, two-photon imaging was used to reveal the in vivo migration of CFSE-labeled CTLs to meninges. Visualization of the vasculature by i.v. injection of rhodamine-dextran (red). The location of CFSE+ T cells (green) is marked by a white arrowhead. Scale bar, 50 μm. (B) T cells in the meninges and dCLNs were isolated from mice injected with parental and LM-phenotype cells. Flow cytometry analysis of VLA-4 expression in CD8+ T cells isolated from meninges (top) or dCLNs (bottom) of mice receiving parental or LM-phenotype cells. Gray, isotype; blue, Parental-CD8+ T cells; red, LM-CD8+ T cells. (C–F) C57BL/6 mice pretreated with IgG or α-VLA-4 antibodies were injected with parental EO771-luc cells via intracarotid artery. (C) Representative immunofluorescent images of meningeal CD8+ T cells from C57BL/6 mice with indicated treatment in whole-mount meninges. Scale bar = 50 μm. Red, Lyve-1; green, CD8; blue, DAPI. (D) Representative IHC images for luciferase to identify LM lesions. Scale bar = 50 μm. (E, F) Representative bioluminescence images (E) and quantitation (F) of metastases in mice with indicated treatment at day 21 post-injection (mean ± SD, n = 12 per group). ***p<0.001 by two-tailed Student’s t test. (G) CD8+ T cells in dCLNs of mice injected with EO771 LM-phenotype cells or parental cells were isolated and tested for their ability to adhere to plate-bound VCAM-1-Ig fusion protein. Histogram shows the number of cells adherent to the bottom of the wells under indicated treatments (mean ± SD, n = 4 per group). ***p<0.001, ns, not significant by two-way ANOVA with Sidak’s multiple-comparison test. (H) CD8+ T cells isolated from mice injected with EO771 LM-phenotype cells or parental cells were treated with IgG or VLA4 neutralizing antibody and later added to the top chamber of in vitro blood–brain barrier model. Histogram indicates the number of migrated CD8+ T cells after IgG or VLA4 antibody treatment(mean ± SD, n = 4 per group). ***p<0.001, ns, not significant by two-way ANOVA with Sidak’s multiple-comparison test. (I) Representative images of proliferative capacity of dCLN CD8+ T cells under indicated treatment, as determined by flow cytometry for the percentages of Ki-67+ cells. (J) Representative histogram of apoptosis of dCLN CD8+ T cells under indicated treatment, as determined by flow cytometry for the percentages of cleaved caspase-3+ cells. Gray, isotype; blue, IgG antibody; red, VLA-4 antibody.

The very late activated Ag-4 (VLA-4)-vascular adhesion molecule-1 (VCAM-1) pathway plays an important role in T cell leptomeningeal recruitment (Theien et al., 2003). Given the reduction in CD8+ T cell trafficking to meninges, we evaluated VLA-4 levels in meningeal and dCLN CD8+ T cells by flow cytometric analysis. We observed that VLA-4 levels in CD8+ T cells from both leptomeningeal space and those from dCLNs were downregulated in mice injected with LM-phenotype cells, compared with those of mice injected with parental cells (Figure 5B, Figure 5—figure supplement 1B). Similar results were found in BALB/c mice injected with 4T1 parental and LM cells (Figure 5—figure supplement 1C). To evaluate the function of VLA-4 in breast cancer LM, we applied neutralization antibody against VLA-4 and found that VLA-4 blockade decreased the number of CD8+ T cell in meninges (Figure 5C), and aggregated intracranial tumor metastasis, determined by histopathology (Figure 5D) and BLI signaling (Figure 5E and F).

To further investigate the role of VLA-4 in T cell trafficking, we have examined the contribution of VLA-4 in the adhesion and migration of CD8+ T cells. LM- or Parental-CD8+ T cells were isolated from dCLNs and tested for their ability to adhere to plate-bound VCAM-1 protein (Figure 5G; Boire et al., 2020). Parental-CD8+ T cells with higher expression of VLA-4 exhibited specific adhesion to plate-bound VCAM-1 protein (74.77 ± 4.27%), whereas LM- CD8+ T cells with lower expression of VLA-4 displayed only background levels of adhesion (9.96 ± 0.89%). Pretreatment of Parental-CD8+ T cells with the anti-VLA-4 neutralizing antibody virtually ablated their ability to adhere to VCAM-1 (19.22 ± 3.44%), while LM-CD8+ T cells pretreated with the anti-VLA-4 antibody showed no difference in their ability to adhere to VCAM-1 (8.43 ± 0.85%) (Figure 5G). To investigate the role of VLA-4 in T cell migration, we employed an in vitro BBB model to assess the transmigration of T cells. CD8+ T cells were added to the top chamber and treated with IgG or VLA4 antibody. We observed that the migration of Parental-CD8+ T cells was much stronger than LM-CD8+ T cells, which was disrupted by anti-VLA4 treatment (Figure 5H). Furthermore, VLA-4 blockade had no effect on the proliferation (Figure 5I, Figure 5—figure supplement 1D) and cell death (Figure 5J, Figure 5—figure supplement 1E) of dCLN CD8+ T cells. Taken together, these data suggested that blocking VLA-4 in CD8+ T cells inhibited their adhesion and migration, leading to the impaired recruitment to meninges and lack of the capacity to control LM.

VLA-4 transcription is repressed by p53

To further explore the mechanisms for VLA-4 downregulation in LM-CD8+ T cells, we predicted the possible transcription factors binding to VLA-4 promoter by three different algorithms (JASPAR, PROMO, and TFBIND). Interestingly, we found p53, the senescence marker, which functions as a transcription factor involved in a myriad of cellular activities (Wang et al., 2009). To explore whether VLA-4 transcription is controlled by p53 signaling, we examined the VLA-4 expression in the CD8+ T cells isolated from dCLNs of WT and p53-deficient (Trp53-/-) mice injected with LM-phenotype cells. We found that VLA-4 levels in dCLN CD8+ T cells were lower in WT mice injected with LM-EO771 cells. By comparison, p53 knockout restored VLA-4 levels of CD8+ T cells in Trp53-/- mice inoculated with LM-EO771 cells (Figure 6A), suggesting that p53 mediated VLA-4 suppression in CD8+ T cells. In silico analyses performed with three different algorithms (JASPAR, PROMO, and TFBIND) predicted one putative p53-binding site located at –1550 to –1525 bp upstream of the VLA-4(Itga4) transcription start site (TSS) (Figure 6B). We electronically transfected pGL3 reporter plasmids containing the WT or mutant luciferase constructs of p53-binding sites of 5′-flanking region upstream of Itga4 into EL4 lymphoma cells, a T lymphoma cell line previously used for gene transcription studies (Kao et al., 2011). Upon p53 forced expression, the luciferase signal of EL4 cells transfected with full-length Itga4 TSS decreased. Moreover, mutation of p53-binding site abolished the suppression of luciferase activity (Figure 6C). To confirm these results in an endogenous setting, we performed chromatin immunoprecipitation (ChIP)–qPCR with an antibody against p53 and found an average of 4.26-fold enrichment was obtained with anti-p53 antibody in the LM-CD8+ T cells compared to ChIP with a control immunoglobulin G (IgG). By contrast, an average of 1.03-fold enrichment was found in Parental-CD8+ T cells (Figure 6D). To further illustrate the contribution of p53 in LM, we injected LM-phenotype or parental tumor cells in WT and Trp53-/- mice. In Trp53-/- mice, the senescence of CD8+ T cells was prevented as a result of p53 deficiency (Figure 6—figure supplement 1A and B), contributing to upregulation of VLA-4 (Figure 6A) and enhanced trafficking ability to meninges (Figure 6—figure supplement 1C and D). Therefore, tumor growth was inhibited in P53-deficient mice determined by BLI signal (Figure 6—figure supplement 1E and F). Taken together, these results demonstrated that VLA-4 transcription in T cells in LM is suppressed by the senescence factor p53.

Figure 6 with 1 supplement see all
VLA-4 transcription is repressed by p53.

(A) CD8+ T cells were isolated from deep cervical lymph nodes (dCLNs) of wild type (WT) or Trp53-/- mice injected with leptomeningeal metastasis (LM)-phenotype cells. Flow cytometry analysis of VLA-4 expression in CD8+ T cells from dCLNs in WT mice or Trp53-/- mice receiving LM-phenotype cells. Gray, isotype; blue, CD8+ T cells from WT mice; red, CD8+ T cells from Trp53-/mice. Numbers in plot correspond to the mean fluorescent intensity of VLA-4 in CD8+ T cells (mean ± SD, n = 4 per group). **p<0.01 compared with CD8+ T cells from WT mice by two-tailed Student’s t test. (B) A schematic of Itga4 gene promoter. P53 binding site is identified. (C) EL4 cells were transfected with WT or a mutant version in which the putative p53 binding site was mutated with four nucleotides (mutant). Afterward, EL4 cells were transfected with empty vector or P53 overexpression plasmids and harvested for the luciferase activity assay (mean ± SD, n = 4 biologically independent experiments). Results are expressed relatively to control conditions. **p≤0.01 by one-way ANOVA with Tukey’s multiple-comparison test. (D) ChIP was performed with a p53-targeting antibody or a control IgG to assess p53 binding to the Itga4 promoter in CD8+ T cells isolated from mice injected with parental or LM-phenotype cells (mean ± SD, n = 3). Cdkn1a serves as a positive control, Gapdh as a negative control for p53 binding. ***p<0.001 by two-tailed Student’s t test.

Meningeal CD8+ T cells exhibit VLA-4 downregulation and senescence in human leptomeningeal metastasis

To evaluate whether this finding in the animal model is consistent with patients with LM, we investigated VLA-4 expression and the senescence phenotype in human T cells isolated from CSF of 145 patients with nonmalignant neurological diseases and 45 patients with leptomeningeal involvements, including 6 cases of breast cancer, 35 cases of lung cancer, and 4 cases of gastrointestinal cancer (Figure 7A). We found that the proportion of SA-β-gal+CD8+ T cells was higher in CSF from metastatic patients compared with those of nonmalignant neurological disease patients (Figure 7B, Figure 7—figure supplement 1A), indicating that intracranial CD8+ T cells experienced senescence in patients with LM. Moreover, flow cytometry analysis showed the CSF CD8+ T cells of metastatic patients had lower expression of VLA-4 (Figure 7C). Moreover, the percentage of SA-β-gal+CD8+ T cells was negatively correlated with VLA-4 levels in CD8+ T cells of LM patients (Figure 7D). Collectively, these results indicated the downregulation of VLA-4 and senescence in CD8+ T cells in LM (Figure 7E).

Figure 7 with 1 supplement see all
Meningeal CD8+ T cells exhibit VLA-4 downregulation and senescence in human leptomeningeal metastasis (LM).

(A) Representative MRI images of patients with (n = 45) or without LM (n = 145). (B) Representative images for flow cytometry analysis of CD8+SA-β-gal+ T cells from cerebrospinal fluid (CSF) in patients with nonmalignant neurological diseases (n = 145) or LM (n = 45). Bars correspond to the percentages of CD8+SA-β-gal+ T cells. ***p<0.001 by two-tailed Student’s t test. (C) Flow cytometry analysis of VLA-4 expression in CD8+ T cells from CSF in patients of nonmalignant neurological diseases (n = 145) or LM (n = 45). Gray, isotype; blue, CD8+ T cells in patients of nonmalignant neurological diseases; red, CD8+ T cells in LM patients. Bars correspond to the mean fluorescent intensity (MFI) of VLA-4 in CD8+ T cells. ***p<0.001 by two-tailed Student’s t test. (D) The correlation between the percentages of SA-β-gal+CD8+ T cells and VLA-4 levels in CD8+ T cells of LM patients (n = 45, the Pearson’s correlation coefficient r2 value and the p-value are shown). (E) Schematics highlighting the major findings of this study.

Discussion

Extracranial immune cells were traditionally believed to be absent in the normal CNS due to the BBB. The recent identification of functional lymphatic vessels in brain has shifted the paradigm from immunological privilege to a distinct immune response in CNS diseases (Louveau et al., 2018; Ahn et al., 2019; Forrester et al., 2018). LM is associated with one of the worst clinical outcomes of malignancies. However, very little is known about the immune response to LM (Boire et al., 2020). Here, we uncovered that tumor-specific CD8+ T cells are generated in dCLNs and play a central role in controlling LM. Moreover, inducing immunosenescence of CD8+ T cells is essential for tumor cells to escape meningeal immune defenses and successfully establish clinical lesions in the leptomeningeal space.

During inflammation, apart from TCR signaling, T cells can also be activated in a T cell receptor-independent and cytokine-dependent manner, which is called ‘bystander effect’ (Kim and Shin, 2019). In the immunocompetent mouse model of breast cancer LM that we constructed, we provided clear evidences that tumor-specific CD8+ T cells can be generated in dCLNs and recruited to leptomeninges by VLA-4. T cells in dCLNs of mice bearing EO771-OVA LM showed specific response to OVA. In addition, OVA-specific T cells underwent antigen-specific activation and proliferation in vitro in response to EO771-OVA injection, indicating that dCLNs generate tumor-specific CD8+ T cells against LM, but not ‘bystander activation.’ Consistent with our results, previous studies have shown that activation of CNS-specific T cells in cervical lymph nodes can directly mediate the neuroinflammation observed in EAE (Furtado et al., 2008). Therefore, our data indicated that the tumor-specific CD8+ T cells primed in dCLNs play an important role in controlling LM.

In brain tumors such as glioblastoma and brain metastases, the infiltrating T cells are dysfunctioned due to tolerance and exhaustion induced by the immunosuppressive tumor microenvironment (Farber et al., 2016; Woroniecka et al., 2018). Emerging evidence suggests that immunosenescence, which is distinct from exhaustion, is an important state of T cell dysfunction and responsible for immunosuppression in the tumor microenvironment (Nikolich-Žugich, 2014). In recent studies, T cells undergo senescence in the normal aging process or in the patients with under chronic infections and cancers (Zhao et al., 2020). T cell senescence has also been found to be strongly induced in several types of malignancies, including lung cancer (Chen et al., 2014), ovarian cancer (Wu et al., 2017), and melanoma (López-Otín et al., 2013) through MAPK signaling (Wang et al., 2002). MAPK/p38 signaling is essential for activating the cell cycle regulatory molecules p53, p21, and p16, which might inhibit cell cycle progression to slow or completely arrest DNA replication and induce cell senescence (Montes et al., 2008). However, whether senescence contributes to immunosuppression in CNS metastasis remained elusive. In our study, we found that T cells in dCLNs from LM mice exhibited senescent features, including elevated expression of p53 and p21, and increased levels of secreted senescence-associated beta-galactosidase. Previous studies have indicated that increased senescent T cells resulted in T cell proliferation arrest and killing capacity defect (Ye and Peng, 2015; Appay et al., 2000). Here, we advanced this emerging concept by showing that the recruitment of T cells to meninges is impaired as a result of the suppression of VLA-4. VLA-4 is responsible for CNS tropism of T cells and VLA-4 neutralization can inhibit the homing and infiltration of antigen-specific T cells in cerebral autoimmune models (Burkly et al., 1994; Zundler et al., 2017). VLA-4 blockade in WT mice impedes T cell trafficking to meningeal lymphatics and aggravates LM. Collectively, T cell senescence impairs the trafficking of T cells, leading to the failure of tumor control.

Previous studies have demonstrated that induction of p53 plays a direct role in cellular senescence. Its activation primarily responds to the DNA damage response (DDR) caused by telomere attrition, oxidative, or oncogenic stress (Mijit et al., 2020; Kumari and Jat, 2021). Also, several p53 targets and regulators have been associated with induction of senescence (Feng et al., 2011). In our study, we identified a specific p53 binding site within the Itga4 promoter and found that the mutation of specific p53 binding site relieved its repression on the VLA-4 transcription. Consistently, in Trp53-/- mice, the senescence of CD8+ T cells was inhibited as a result of p53 deficiency, leading to upregulation of VLA-4 and enhanced trafficking ability to meninges. Therefore, p53-deficient T cells can efficiently inhibit tumor growth compared with WT T cells. In addition, in line with our study, previous studies showed that p53-deficient T cells exhibited decreased apoptosis (Madapura et al., 2012) and enhanced proliferation in T cells (Banerjee et al., 2016), supporting that p53-deficient T cells have higher anti-tumor effector function.

Collectively, our findings revealed that tumor-specific immunity originated from draining dCLNs is essential for restraining LM. Senescence signals inhibit trafficking of CD8+ T cells from dCLNs to meninges and therefore promote the progression of LM.

Materials and methods

Mice

6–8-week-old female C57BL/6 mice, BALB/c mice, and nude mice were purchased from the Laboratory Animal Center of Sun Yat-Sen University. Rag2-/- mice [B6(Cg)-Rag2tm1.1Cgn/J, 008449] were purchased from the Jackson Laboratory. Trp53-/- mice, OT-1 mice on a fully C57BL/6 background were obtained from Shanghai Model Organisms Center Inc (Shanghai, China). All mice were bred and maintained in the specific-pathogen-free (SPF) animal facility of the Laboratory Animal Center of Sun Yat-Sen University. Mice were randomized at the beginning of each experiment, and experiments were not blinded. All procedures were approved by the Animal Care and Use Committee of Sun Yat-Sen University under animal protocol 2018-000095 and 2021-000768.

Cell culture and treatment

Request a detailed protocol

The murine breast cancer cell lines, EO771 cells, were obtained from CH3 Biosystems, NY. Murine 4T1, Lewis Lung Cancer (LLC) cell lines were purchased from ATCC. All the cells and their derivatives were cultured in DMEM or RPIM 1640 with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 100 units/mL penicillin-streptomycin (all from Gibco). All the cell lines were tested negative for mycoplasma contamination. EO771, 4T1, and LLC cells were forced expressed with firefly luciferase. EO771 cells were transduced with the viral vectors of ovalbumin (EO771-OVA, GenePharma) or glycoprotein B (EO771-gB, Guangzhou Ige Biotechnology) (multiplicity of infection [MOI] of 10) overnight at 37℃ with 5 μg/mL polybrene (GenePharma). The established cells were selected by 2 μg/mL puromycin (Sigma).

Establishment of leptomeningeal metastasis model

Request a detailed protocol

An lLM model was generated as previously described with modifications (Boire et al., 2017; Fults et al., 2019; Chi et al., 2020). For establishing breast cancer LM model, leptomeningeal derivative cell line was selected and injected intracardially into C57BL/6 mice. In detail, 2 × 104 EO771 cells, 2 × 104 4T1 cells, and 2 × 104 LLC cells transduced with lentivirus with forced expression of firefly luciferase (GenePharma) were suspended in 10 μL of PBS and then injected into the cisterna magna of recipient mice. Tumor burdens were monitored by Bioluminescent (BLI). Mice were sacrificed when LM were detected by BLI, or the clinical signs of brain metastasis, including primary CNS dysfunction, weight loss, and behavioral abnormalities, were shown. Then, tumor cells were collected from meninges, selected by puromycin, and reinjected to the second recipient mice. The operations described above were repeated three times to derive intermediate cell line that could survive within the CSF. 1 × 105 intermediate EO771-luc, 4T1-luc, or LLC-luc cells were inoculated into the intracarotid artery of mice. After LM were detected, mice were sacrificed and tumor cells from meninges were isolated and cultured in vitro, which were identified as LM-phenotype cell line. 1 × 105 LM-phenotype cells were injected into intracarotid artery of mice to establish the LM model and tumor burden was monitored by BLI and MRI.

IVIS Lumina imaging

Request a detailed protocol

Formation of LM were monitored by IVIS Lumina imaging. Before imaging, mice were anesthetized with ketamine/xylazine injection and injected with d-luciferin (300 mg/kg). After 10 min, mice were imaged with Xenogen IVIS Lumina system (Caliper Life Sciences). Images were analyzed using Living Image software v.3.0 (Caliper Life Sciences) and BLI flux (photons/s/cm2/steradian) was calculated.

MRI

Request a detailed protocol

MRI experiments were performed on Aspect M3 (1.05 Tesla, Aspect Imaging). Animals were anesthetized with ketamine/xylazine injection throughout the imaging procedure. T1-weighted SE images (TR = 0.6 s; TE = 23 ms) were taken with or without a bolus of 0.5 mmol/kg Gd-DTPA(intravenously, 12.5 min in circulation) (Brandsma et al., 2004).

Immunofluorescence and immunohistochemistry

Request a detailed protocol

Paraffin-embedded samples were sectioned at 4 μm thickness. Sections were de-paraffinized, rehydrated, and boiled in a pressure cooker for 2 min in 10 mM citrate buffer (pH 6.0) for antigen retrieval. Then sections were blocked in PBS containing 5% bovine serum albumin (BSA) for 15 min at room temperature. For immunofluorescence assay, sections were incubated with primary antibodies specific for firefly luciferase (Abcam, Cat# ab185924, 1:100) overnight at 4℃ and subsequently incubated with Alexa Fluor-488, 555, or 647 conjugated secondary antibodies (Thermo Fisher Scientific, Cat# A32731, A32727, A-21247, 1:300) for 1 hr at room temperature. Cells were counterstained with DAPI. Images were obtained by laser scanning confocal microscopy. For immunohistochemistry assay, sections were incubated with antibodies specific for luciferase (Abcam, Cat# ab185924, 1:100) overnight at 4℃, and later were detected by DAB (Dako) according to the manufacturer’s instructions.

Transcriptomic analysis

Request a detailed protocol

Cells cultured in T25 flask at 75% confluency were collected in TRIzol Reagent (Invitrogen) for RNA extraction. mRNA purified from cancer cells was used for library construction with TruSeq RNA Sample Prep Kit v2 (Illumina) following the manufacturer’s instructions. Samples were barcoded and run on a Hiseq 2000 platform in a 50 bp/50 bp paired-end run using the TruSeq SBS Kit v3 (Illumina). An average of 40 million paired reads were generated per sample. FASTQ files from RNA-Seq results were quality assessed by FastQC v0.11.3. Raw reads were mapped to human genome hg19 (GRCh37, February 2009) or mouse genome mm10 (GRCm38, December 2011) using STAR2.3.0e (Engström et al., 2013) with standard settings for paired-end sequencing reads. On average, 84% of raw reads were uniquely mapped. Mapped reads were counted to each gene by HTSeq v0.5.4 with default settings. Differential gene expression analysis was performed following the instructions of ‘‘DESeq2’’ package deposited in Bioconductor.

In vivo administration of antibodies

Request a detailed protocol

Depleting antibodies to CD4 [GK1.5] and CD8 [53.6.72] were administered intraperitoneally (i.p.) (0.25 mg/mouse) on days 1, 4, and 6. Blocking antibody to VLA-4 [PS/2] was administered by i.p. injection (0.25 mg/mouse) on days 0, 1, and 2 since the day of tumor cell injection. Rat-anti-mouse IgG (Cat# BE0090) was used as control antibody. All antibodies were obtained from BioXCell.

Evans blue injection and detection

Request a detailed protocol

Mice were anesthetized by ketamine/xylazine i.p. injection, and then 5 μL of 10% Evans blue (Sigma-Aldrich) was delivered into the cisterna magna via intracerebroventricular (i.c.v) injection. Then, 30 min after injection, the CNS draining lymph nodes were dissected for assessment of Evans blue.

Isolation of immune cells from secondary lymphoid organs

Request a detailed protocol

Briefly, mice were anesthetized with ketamine/xylazine injection. Spleen, inguinal lymph nodes, or dCLNs were isolated, smashed, and filtered through a 40 μm filter to obtain single-cell suspension. For acquisition of meninge immune cells, transcardial perfusion with 30 mL of PBS via intracardiac puncture was performed before meninge isolation (Louveau et al., 2018).

Adoptive T cell transfer

Request a detailed protocol

For adoptive T cell transfer therapy, dCLNs from mice injected with EO771-luc cells were smashed and filtered through a 40 μm filter to obtain single-cell suspension. CD4+ and CD8+ T cells were purified by magnetic-activated cell sorting (Miltenyi, Cat# 130-117-043, 130-096-495). Cell populations were confirmed to be >90% purity by flow cytometric analysis. Thereafter, 5 × 105 CD4+ and CD8+ T cells were injected into Rag2-/- mice via caudal veins, respectively.

Flow cytometry

Request a detailed protocol

Cells collected from secondary lymph organs or CSF of patients were stained with fluorescent-conjugated antibody: fixable viability dye (Thermo Fisher Scientific, Cat# 65-0866-14), CD45 (BioLegend, Cat# 103132), CD3 (BioLegend, Cat# 100213), CD8 (Thermo Fisher Scientific, Cat# 53-0081-82, 17-0088-42), CD4 (Thermo Fisher Scientific, Cat# 62-00420-80), CD11b (BioLegend, Cat# 101222), Ly6G (BioLegend, Cat# 127613), Ly6C (BioLegend, Cat# 128017), CD11c (BioLegend, Cat# 117322), H-2Kb bound to SIINFEKL (BioLegend, Cat# 141605), OVA pentamer (ProImmune, Cat# F93-2A-G), SA-β-gal (Dojindo, Cat# SG03), and CD49d (Thermo Fisher Scientific, Cat# 12-0492-81, 16-0492-85) for 30 min at 4℃; primary antibodies: luciferase (Abcam, Cat# ab185924, 1:100), cleaved caspase-3 (Cell Signaling Technology, Cat# 9661, 1:200), and Ki-67 (Thermo Fisher Scientific, Cat# 14-5698-80, 1:50). For intracellular staining, cells were pretreated with Foxp3/Transcription Factor Fixation/Permeabilization kit (eBioscience, Cat# 00-5521-00) according to the manufacturer’s instructions. Flow cytometry was performed on Attune NxT Flow Cytometer (Thermo Fisher Scientific) and analyzed using FlowJo software.

Ex vivo activation of T cells

Request a detailed protocol

PBS, EO771, and EO771-gB and EO771-OVA were injected into C57BL/6 mice via cisterna magna. 7 days after tumor cell injection, DCs were isolated from murine lymph nodes using magnetic beads according to the manufacturer’s instructions (Miltenyi Biotec, Cat# 130-100-875). OT-1 T cells were isolated from peripheral blood of OT-1 mice and labeled with 0.5 μM CFSE (Thermo Fisher, Cat# C34554) for 15 min at 37℃. After purification, DCs (5 × 104) and CFSE-labeled OT-1 T cells (105) were incubated in flat 96-well plate for 60 hr. Subsequently, OT-1 T cells were harvested for flow cytometry and IFN-γ ELISpot assay.

IFN-γ ELISpot assay

Request a detailed protocol

ELISpot assays were performed using a mouse IFN-γ ELISpot kit according to the manufacturer’s procedure (DAKAWE, China). The harvested OT-1 T cells were added to ELISpot plates and cultured overnight at 37℃. Plates were then washed four times with washing buffer and incubated with biotinylated detection antibody for IFN-γ (DAKAWE) for 1 hr at 37°C. Following four additional washes with washing buffer, the plates were incubated with avidin–horseradish peroxidase (HRP) (DAKAWE) for 1 hr at 37°C. Plates were then washed four more times with washing buffer and two washes with PBS. After 15 min incubation with AEC substrate (BD), the reaction was stopped. The plates were washed with deionized water and dried overnight before membrane removal. Spots were counted using an ELISpot reader (ImmunoSpot S6 ULTRA-V, Cellular Technology, Cleveland, OH).

Lymphatic vessel ligation

Request a detailed protocol

Mice were anesthetized by ketamine and xylazine, and the skin of the neck was shaved and cleaned with iodine and 70% ethanol. A midline incision was made on the neck 5 mm above the clavicle. The sternocleidomastoid muscles were retracted, and the dCLNs were exposed on both sides. Ligation of the afferent lymphatic vessels was performed with 10-0 synthetic, nonabsorbable sutures. Sham surgeries consisting of the skin incision and retraction of the sternocleidomastoid muscle were performed on the control mice. The incision was sutured and the mice were allowed to recover on a heat pad until fully awake.

Two-photon microscopy

Request a detailed protocol

Before two-photon microscopy, 1 × 106 CD8+ T cells from dCLNs of mice injected with parental or LM cells were isolated, labeled by 0.5 μM CFSE (Thermo Fisher, Cat# C34554) for 15 min at 37℃, and transferred to recipient mice via caudal veins. 24 hr after T cell transfusion, mice were anesthetized, and thinned skull windows were prepared. Mice were injected with 100 μL rhodamine dextran solution (100 mg/mL, Sigma, R9379) where indicated to visualize blood vessels. Images were captured in z-stacks of 10–30 planes (1 μm step size) using an Olympus FVMPE-RS two-photon microscope.

Whole-mount meninge preparation

Request a detailed protocol

Anesthetized mice were euthanized, brains were sterilely dissected, and placed in ice-cold sterile PBS. Meninges within the skullcap were fixed in 4% paraformaldehyde (PFA) overnight and separated from the skullcap. Then the meninges were incubated in the block-perm buffer containing 2% normal goat serum, 1% BSA, 0.1% Triton X, and 0.05% Tween for 1 hr at room temperature with gentle rocking. The primary antibody anti-mouse CD8 (Novus, Cat# ABX-160A, 1:100), anti-lyve-1 (R&D Systems, Cat# AF2125), and the secondary antibody Alexa Fluor 488, 555 rabbit anti-mouse IgG, Alexa Fluor 555 rabbit anti-goat IgG (Life Technologies) were employed for CD8+ T cell and lymphatic vessel staining. The meninges were mounted with Prolong Gold with DAPI (Molecular Probes).

DTC detection with luciferase assay

Request a detailed protocol

100 μL blood was centrifuged at 92 × g for 5 min, and plasma was discarded and the sediment were subsequently for flow cytometry and luciferase assay. For flow cytometry, cells were stained with anti-firefly luciferase (Abcam, Cat# ab185924, 1:100) and anti-CD45 antibodies (BioLegend, Cat# 103132). For luciferase assay, cell lysis buffer (200 μL) (Beyotime) was added to resuspend cells, incubated at room temperature for 8–10 min with occasional shaking, then centrifuged at 12,000 × g for 5 min. The supernatant was aspirated into another tube and 100 μL of luciferin working solution (Beyotime) was added to the sample, reacting with luciferase of DTCs of EO771-luc. Immediately, the RLU in each sample was assayed by luminometer (Infinite M200 Pro, Tecan). To set up standard curve, the freshly harvested EO771-luc cells were counted, and 0, 5, 10, 20, 30, 40, 50, and 60 cells were added to tubes, respectively. RLU was assayed and the derived equation was used as standard curve to calculate the DTC numbers from mice with metastases.

Cell adhesion assays

Request a detailed protocol

According to Sasaki et al., 96-well-ELISA plates were coated with 10 μg/mL of mouse VCAM-1 recombinant protein or heat-denatured BSA. T cells harvested and suspended in binding buffer (0.5% BSA, 2 mM CaCl2, 2 mM MgCl2 in PBS) were subsequently added to the plate. For blocking experiments, cells suspended in binding buffer were pretreated with 20 μg/mL of α-CD49d mAbs (PS/2) for 15 min at 37°C, and then added to the plate. Plates were centrifuged at 500 rpm for 1 min and were placed at room temperature with gentle shaking for 30 min for cell adhesion. The plate was then gently washed three times using binding buffer, and the number of adherent cells was counted by flow cytometry. Percent adhesion was calculated as the (number of adherent cells to VCAM-1 - number of adherent cells to heat-denatured BSA)/Number of total input cells.

Cell migration assays

Request a detailed protocol

Murine brain microvascular endothelial cells (MBMECs) were isolated as previously described (Meena et al., 2021; Ruck et al., 2014). In brief, mice were sacrificed and meninge-free forebrains were collected, minced, then digested with 10 mg/mL of collagenase II and 1 mg/mL DNase (Worthington Biochemical) in DMEM in a shaker for 1 hr at 37°C. The digested tissues were suspended with 20% BSA solution prepared in DMEM to remove myelin. The pellets were further digested by 1 mg/mL of collagenase/dispase and 1 mg/mL DNase (Roche Applied Science) in DMEM for 1 hr at 37°C. The microvessels obtained from the pellets after digestion were separated on a 33% continuous Percoll gradient (700 g, 10 min). The microvessel compartments were washed twice in DMEM and cultured in endothelial cell medium. Five days after isolation, MBMECs were trypsinized and seeded onto precoated Transwell inserts (pore size 3 µm; Corning) at 2 × 104 cells per insert. When MBMECs reached confluence, 2 × 105 T cells per insert were added directly on top of MBMECs. After 24 hr, migrated cells were collected from the lower chamber, while nonmigrating cells remained in the upper chamber.

Western blot

Request a detailed protocol

dCLN CD8+ T cells were washed with PBS and lysed with RIPA buffer containing proteinase inhibitor. Lysates were centrifuged for 25 min at 4℃ at 12,000 × g. Protein extracted from the cells were fractionated by 10% SDS–polyacrylamide gels and further transferred to polyvinylidene difluoride membranes. Membranes were blocked with TBS/0.05% Tween-20/5% skim milk and then incubated with primary antibodies against p53 (ProteinTech, Cat# 10442-1-AP, 1:1000), p21 (ProteinTech, Cat# 27296-1-AP, 1:1000), and GAPDH (ProteinTech, Cat# HRP-60004, 1:10,000) at 4℃ overnight. Membranes were washed three times with TBST and then incubated with peroxidase-conjugated secondary antibody (Cell Signaling Technology, Cat# 7074S, 1:3000). The antigen-antibody reaction was visualized by enhanced chemiluminescence assay (ECL, Thermo Fisher Scientific).

Cellular senescence assay

Request a detailed protocol

For senescence-associated β-galactosidase (SA-β-gal) staining, dCLN CD8+ T cells were isolated, fixed, and stained for SA-β-gal at 37℃ overnight by Senescence-associated β-Galactosidase Staining Kit (Beyotime, Cat# C0602) according to the manufacturer’s instruction. For quantification of SA-β-gal-positive cells, images were randomly taken at ×40 magnification (BX-63, Olympus) and then analyzed manually with ImageJ.

Luciferase reporter assay

Request a detailed protocol

The luciferase assay was performed using luciferase assay reagent according to the manufacturer’s instructions. Briefly, a fragment spanning from –2000 to +100 relative to the TSS of the murine VLA-4 genomic sequence was fused to pGL3-Basic vector to generate VLA-4 WT (–2000/+100)-luc. The C/G to A/T mutations at the consensus p53-binding site were introduced by site-directed mutagenesis (from 5′-GGAGCCC-3′ to 5′-GGATAAA-3′). For luciferase reporter experiments, a murine T lymphoma cell line EL4 was transfected with VLA-4-wild type-luc or VLA-4-mutant-luc reporter and pRL-TK-Renilla for 24 hr using a Bio-Rad Gene Pilser Xcell Electroporation System. Afterward, the cells were transduced with lentivirus with p53 overexpression or empty vector. After 24 hr transfection, cells were lysed and analyzed with the Dual-Luciferase reporter assay system (Promega, Cat# E1960). Renilla Luciferase (R-luc) was used to normalize firefly luciferase (F-luc) activity to evaluate reporter translation efficiency.

Chromatin immunoprecipitation assay (ChIP)

Request a detailed protocol

The ChIP assay was performed using a ChIP Assay Kit (Millipore) according to the manufacturer’s instructions. Briefly, dCLN CD8+ T cells were isolated and fixed in 1% formaldehyde for 10 min at room temperature. Fixed cells were washed and then lysed in ChIP lysis buffer. The whole-cell extracts were then sonicated for 10 cycles of 10 s on /20 s off and 50% AMPL with Sonics VCX130 (Sonics & Materials, Inc, Newtown). Antibodies directed against p53 (ProteinTech, 10442-1-AP, 1 μg) or rabbit IgG (ProteinTech, Cat# B900610, 1 μg) were used. The precipitated DNA was subjected to PCR amplification. The primer sequences used in ChIP assays:

  • Itga4: forward (5′>3′) TCTTCTCAGAGTGTGTGGA;

  • reverse (5′>3′) GAGCACCCAGCAACATTT.

  • Gapdh: forward (5′>3′) GCCCTGCTTATCCAGTCCTA;

  • reverse (5′>3′) GGTCCAAAGAGAGGGAGGAG.

  • Cdkn1a: forward (5′>3′) TAGCTTTCTGGCCTTCAGGA;

  • reverse (5′>3′) TGGGTATCATCAGGTCTCCA.

Patients and tissue samples

Request a detailed protocol

CSF samples were obtained by lumbar puncture or extraventricular drain from 145 cases of nonmalignant neurological diseases (45 cases from brain injury, 25 cases from neurodegenerative diseases, 50 cases from cerebrovascular diseases, and 25 cases from benign primary tumors) and 45 cases of brain metastasis, including 6 cases of breast cancer, 35 cases of lung cancer, and 4 cases of gastrointestinal cancer at Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University (Guangzhou, China) between 2017 and 2020. CSF sample were centrifuged at 450 × g for 8 min, and the cells of the CSF sediment were collected and preserved in cryovials with the 1 mL of freezing medium (90% FBS supplemented with 10% DMSO) in liquid nitrogen for future flow cytometry analysis. To minimize bias, samples were blinded to laboratory personnel. All samples were collected with informed consents, and all related procedures were performed with the approval of the internal review and ethics board of Sun Yat-Sen Memorial Hospital under protocol 2020-136.

Statistics

The number of events and information about the statistical details and methods are indicated in the relevant figure legends. Data are expressed as the mean ± SD and were analyzed using GraphPad Prism 8.0. Two-tailed Student’s t-tests were used to identify significant differences between two groups. One-way ANOVA with Tukey’s multiple-comparison test were used for comparison of more than two groups. Pearson’s correlation was used to assess the relationship between VLA-4 expression and the activity of SA-β-gal in CD8+ T cells in the CSF of patients with brain metastases. Kaplan–Meier survival curves were plotted and log-rank test was done. p<0.05 was considered statistically significant. The experiments were not randomized, and the investigators were not blinded to allocation during experiments and outcome assessment, except for when noted otherwise.

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting file; Source Data files have been provided for Figure 1H, Figure 4G and Figure 4—figure supplement 1I.

References

  1. Book
    1. Ahluwalia M
    2. Metellus P
    3. Soffietti R
    (2020) Central nervous system metastases
    In: Ahluwalia M, editors. Brain Metastases Cell Partners and Tumor Microenvironment. Cham: Springer. pp. 59–71.
    https://doi.org/10.1007/978-3-030-23417-1
    1. Bandola-Simon JM
    2. Roche PA
    (2019)
    Dendritic cells dysfunction in tumor-draining lymph nodes
    The Journal of Immunology 202:135.

Decision letter

  1. Ping-Chih Ho
    Reviewing Editor; Ludwig Institute for Cancer Research, Switzerland
  2. Satyajit Rath
    Senior Editor; Indian Institute of Science Education and Research (IISER), India
  3. Ping-Chih Ho
    Reviewer; Ludwig Institute for Cancer Research, Switzerland

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting the paper "VLA-4 suppression by senescence signals regulates meningeal immunity and leptomeningeal metastasis" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, including Ping-Chih Ho as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by a Senior Editor.

Comments to the Authors:

We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife.

This decision is based on the evaluation from reviewers since critical issues have been raised.

Reviewer #1:

Overall, it is an interesting paper to address how T cells fail to prevent leptomeningeal metastasis. The topic is timely and interesting. However, several key weakness of this manuscript can be identified as below:

1. T cell activation part present in figure 3 is problematic. The transferred of OT-1 cells in the design does not support dCLN can facilitate generation of tumor antigen-specific T cells. It suggests that OT-1 T cells in dCLN lost cytokine production in OVA-expressing tumor-bearing mice. I would suggest to rewrite this and re-perform the experiment for strengthening the conclusion.

2. The contribution of VLA4 is not fully examined in this study despite that a strong correlation is presented.

3. How p53 is activated in CD8 is not unknown and whether p53 targeting can improve the metastasis control is not clear.

4. Moreover, the involvement of CD8 on controlling metastasis in metastatic locations or affecting dissemination of cancer cells is not clear. This is the key message of this paper. Thus, it should be addressed properly.

Although the message is interesting, I do suggest the authors to address immunology parts, especially T cell activation and the contribution of CD8 T cells on hampering leptomeningeal metastasis, in more details. Moreover, a direct examination the role of VLA4 expression in T cells on hampering metastasis is needed.

Reviewer #2:

In the submitted manuscript, Li et al. propose an interesting hypothesis that meningeal CD8+ T cells enter senescence in a p53-dependent manner in leptomeningeal metastasis (LM). While the observations are intriguing, the manuscript is not prepared carefully and lacks information critical for rigor and reproducibility. The use of a single mouse model severely limits the generalizability of the claims. Moreover, the mouse experiments are underpowered in all cases. The immunological observations are not internally consistent. Finally, the clinical validation materials are derived from what they call 'brain metastasis' (parenchymal metastasis), a completely different entity from leptomeningeal metastases, and these findings should not be generalized to LM.

Major Points (A-E):

A. Many of the claims and conclusions must be reconsidered as the primary observations are derived from a single cell line. This is not sufficient to make generalized conclusions that are stated in the Results section, given the lack of similar observations in human breast cancer LM patients. The community standard for such claims is at least two cell lines (and corresponding models); three would provide even greater certainty. The model itself is also inadequately characterized:

– Quantification of disease burden is not consistent throughout the manuscript: The authors state that they quantified LM tumor volume from MRI experiments using the formula commonly used to quantify subcutaneous tumors: length x width2 x 0.52. Given that LM forms sheet-like structure on the surface of the brain, rather than a sphere, this formula is not appropriate. Later in the manuscript, they use (2D) area rather than volume. This discrepancy must be addressed.

– New models of metastasis generated through iterative in vivo selection are typically introduced with the corresponding transcriptome. This is a great service to the larger metastasis community. It would also go a long way toward overcoming the use of a single cell line in the manuscript. Is it possible for the authors to characterize the bulk transcriptome of Parental, Intermediate and LeptoM cells?

– Tumor cells in Figure 2B are not really apparent. Also, different brain areas seem to be showed. Images and insets from the same anatomic locations would be helpful.

B. Certain of the Immunologial observations presented are either internally inconsistent or are inconsistent with clinical data.

– Authors use gP as a control for OVA experiments. Cancer cells overexpressing gB (human?) were introduced into wild type mice with adoptively transferred OT-I CD8+ cells, then dcLN CD8+ cells were isolated and challenged in vitro with corresponding peptides. No response is observed when CD8+ cells from E0771 gB mice are cultured with the peptides. In figure 2F the authors show that dcLN CD8+ cells from E0771 primed mice are able to control the growth of cancer and provide survival benefit, i.e. the cells in dcLNs recognize E0771 cancer cells to some extent. How would authors explain and address this discrepancy – the lack of gB specific CD8 T cells? Can authors isolate cells from E0771 WT mice and expose them to E0771 WT lysate to estimate the proportion of cancer-specific cells?

– In Figure 4, the authors are showing drop in meningeal T cell numbers in the presence of cancer. LM is known to induce pleocytosis, this would not be reflected in relative numbers and thus absolute CD3 and CD8 numbers should be provided. What immune cell types are taking over meninges in the presence of cancer?

– Authors claim that in CD8+ T cells in P53 deficient mice do not downregulate VLA4 and likely do not undergo senescence. Can authors reproduce the results from Figure 5 in P53 deficient mice? Does cancer grow less in these mice? BLI signal should be quantified.

C. Setting aside the use of a single mouse model, there are serious issues with the work's rigor and reproducibility:

– Some of the antibody dilutions (1:00) seem incorrect.

– For Figure 5 source data, full membrane scans should be provided. The images that are shown are still somewhat cropped.

– Why were the LeptoM cells established in Rag2-/- mice (line 306)?

– Authors claim they performed whole mount stainings of meninges, but such images are nowhere to be found.

– In methods, authors say that the data are representative of at least three independent experiments with 4-6 mice per experiment. Most experiments in the submitted manuscript show only 5, sometimes 4 animals. Why did the authors not include the other two experiments, i.e. majority of animals? Please, provide data from all performed experiments as dot plots (not bar plots).

– The actual BLI quantification should be shown in main figures.

– In Figure 2, authors state that tumor growth was monitored by BLI, but show pictures of brains ex vivo. It should be clearly stated in the figure legends what signal and at what time point was quantified.

– Additional positive and negative controls for the P53 ChIP in Figure 6 should be provided. It would be also helpful to align the mutant Itga4 promoter sequence below the WT one in Figure 6B.

D. The methods section is incomplete and does not provide sufficient detail for interested readers to reproduce the experiments, and/or for adequate assessment of the experiments presented. Methods need to be carefully checked and all the lacking information regarding reagents and their use should be provided. In particular:

– Details related to senescence analysis with ImageJ are not provided.

– It is unclear how were the in vivo treatments with antibodies performed.

– Gating strategy for tissues used in this manuscript should be shown.

– Authors state that they purified CD4+ T cells and confirmed their purity with flow cytometry, but no anti-CD4 antibody is mentioned in the methods.

– OT-I mice are not mentioned in methods.

– Were the transgenic mice maintained as homozygous colonies? This statement should be added into the corresponding methods paragraph.

– Numerous viral vectors (luciferase, ovalbumin, glycoprotein B) are employed; the source and backbone are unclear.

– There is no source, concentration, length of incubation mentioned for several reagents (OVA and gB proteins, CFSE etc.)..

– How were the CSF pellets preserved and stored?

E. The clinical samples do not provide validation for the overall hypothesis:

– Although the authors analyzed an impressive number of clinical samples (Figure 7), the metastatic samples seem to be derived from "brain metastases" and not LM. Given this limitation, the proposed observations from a single mouse model cannot be reflected to human LM.

– An inverse correlation is demonstrated in Figure D; a negative Pearson's correlation coefficient is expected.

– Gating strategy for human samples has to be shown.

https://doi.org/10.7554/eLife.83272.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Reviewer #1:

Overall, it is an interesting paper to address how T cells fail to prevent leptomeningeal metastasis. The topic is timely and interesting.

We thank the reviewer for the positive comments for our manuscript.

However, several key weakness of this manuscript can be identified as below:

1. T cell activation part present in figure 3 is problematic. The transferred of OT-1 cells in the design does not support dCLN can facilitate generation of tumor antigen-specific T cells. It suggests that OT-1 T cells in dCLN lost cytokine production in OVA-expressing tumor-bearing mice. I would suggest to rewrite this and re-perform the experiment for strengthening the conclusion.

We thank the reviewer for the constructive suggestion. We have performed additional experiments to support our conclusion that dCLN can facilitate the generation of tumor antigen-specific T cells. The details are as below:

1) It’s well documented that the generation of tumor antigen-specific CD8+ T cells depends on effective tumor antigen presentation by dendritic cells (DCs) in lymph nodes (LNs), which is the fundamental step that launches T cell response against tumor (1,2). Thus, we firstly examined the peptide/MHC class I complex on the cell surface of DCs of mice bearing leptomeningeal metastasis, which indicated the tumor antigen presentation by DCs in LNs. Since deep cervical lymph nodes (dCLNs) could communicate with meningeal lymphatics directly, dCLNs were considered as the tumor draining LNs and inguinal LNs were taken as nondraining LNs. We inoculated EO771 breast tumor cells with ectopic expression of chicken ovalbumin (OVA) into the cisterna magna of C57BL/6 mice and isolated the CD11c+ DCs from dCLNs, inguinal LNs and spleen 7 days later. We found that OVA peptide/MHC class I complex, SIINFEKL/H2-Kb, was only detected on CD11c+ DCs in dCLNs, but not the ones in inguinal LNs or the spleen (revised Figure 3A, Figure 3—figure supplement 3A, B).

2) Further, to investigate whether dCLNs can give rise to tumor-specific CD8+ T cells during tumor dissemination to leptomeningeal space, we injected PBS, EO771 cells (EO771 WT), EO771-OVA and EO771 with an irrelevant antigen glycoprotein B (EO771-gB) into C57BL/6 mice via the cisterna magna. We used H-2Kb-OVA/SIINFEKL pentamer staining to detect OVA-specific CD8+ T cells in dCLN after tumor inoculation and observed that a significant proportion of OVA/SIINFEKL pentamer+ CD8+ T cells was detected in the dCLNs of mice injected with EO771-OVA cells, but not in the mice injected with PBS, EO771 WT or EO771-gB cells (revised Figure 3B, Figure 3—figure supplement 3C). Furthermore, CD11c+ DCs were subsequently isolated from draining dCLNs, and then co-cultured with naive OT-1 CD8+ T cells (revised Figure 3C). Analysis of OT-1 T cell priming revealed that only DCs from mice receiving EO771-OVA inoculation could expand OT-1 T cells (revised Figure 3D, Figure 3—figure supplement 3D) and induce a significant increase in IFN-γ production (revised Figure 3E, Figure 3—figure supplement 3E) of OT-1 T cells.

3) In addition, surgical ligation of the lymphatic afferent to the dCLNs which could impair the antigen presentation in LNs was performed before EO771-OVA tumor cell inoculation (revised Figure 3F). Determined by the expression of SIINFEKL/H2-Kb complex on the surface of CD11c+ DCs, antigen processing (revised Figure 3G, Figure 3—figure supplement 3F) was impaired in the mice receiving surgical ligation. In addition, the proliferation (revised Figure 3H, Figure 3—figure supplement 3G) and IFN-γ production (revised Figure 3I, Figure 3—figure supplement 3H) of OT-1 T cells primed by DCs were diminished.

2. The contribution of VLA4 is not fully examined in this study despite that a strong correlation is presented.

In the previous manuscript, we found that VLA-4 level was downregulated in CD8+ T cells in mice injected with LM-phenotype cells and the trafficking capacity of these CD8+ T cells was impaired. We also proved that VLA-4 blockade diminished CD8+ T cell recruitment to meninges and then aggregated intracranial tumor metastasis in mice injected with parental tumor cells. To further address this question, we have examined the contribution of VLA-4 in T cell trafficking, including adhesion and migration.

1) As previously reported, VLA-4 can bind to vascular cell adhesion molecule-1 (VCAM-1) on the endothelial cells, which was required for T cells to access into central nervous system (CNS) (3,4). To further investigate the role of VLA-4 in T cell adhesion, we isolated CD8+ T cells from the dCLNs of mice injected with EO771 LM-phenotype cells (LM-CD8+ T cells) and parental cells (Parental-CD8+ T cells) and tested their ability to adhere to plate-bound VCAM-1-Ig fusion protein (revised Figure 5G) (5). In line with the differential expression of VLA-4 expression on CD8+ T cells, Parental-CD8+ T cells exhibited specific adhesion to plate-bound VCAM-1-Ig (74.77±4.27%), whereas, LM-CD8+ T displayed only background levels of adhesion (9.96±0.89%) (revised Figure 5G). Moreover, pretreatment of Parental-CD8+ T cells with the anti-VLA-4 Ab virtually ablated their ability to adhere to VCAM-1(19.22±3.44%), while LM-CD8+ T cells pretreated with the anti-VLA-4 Ab showed no difference in their ability to adhere to VCAM-1 (8.43±0.85%), supporting that downregulation of VLA-4 in LM-CD8+ T cells impaired their ability of adhesion (revised Figure 5G).

2) To further investigate the role of VLA-4 in T cell migration, we employed an in vitro blood-brain barrier model to assess the transmigration of T cells. Briefly, primary glial cell cultures were obtained from newborn mouse cerebral cortex and the capillaries were isolated from arterioles and venules of the brain vascular components. Endothelial cells (ECs) were harvested from digested capillaries, and later were plated on the upper side of transwell inserts until they reached confluence about 4–5 days after plating(6,7). LM- and Parental CD8+ T cells were added to the top chamber and treated with IgG or VLA4 antibody. We observed that the migration of Parental-CD8+ T cells was much stronger than LM-CD8+ T cells, which was disrupted by anti-VLA4 treatment (revised Figure 5H).

Collectively, these data suggest that VLA-4 plays an essential role in the adhesion and migration of T cells.

3. How p53 is activated in CD8 is not unknown and whether p53 targeting can improve the metastasis control is not clear.

We thank the reviewer for bringing up this important issue. Previous studies have demonstrated that induction of p53 is pivotal for the establishment of senescence, mainly following its activation by the DNA damage response (DDR) caused by telomere attrition, oxidative or oncogenic stress (8,9). Also, several p53-targets and regulators have been linked to induction of senescence (10). In recent studies, T cells undergo senescence in the normal aging process or in the patients with under chronic infections and cancers (11). Moreover, tumor-derived soluble factors induced T cell senescence through MAPK signaling (12). MAPK/p38 signaling is essential for activating the cell cycle regulatory molecules p53, p21, and p16, which might inhibit cell cycle progression to slow or completely arrest DNA replication and induce cell senescence (13).

To further explore whether p53 targeting can improve the metastasis control, we injected EO771 LM-phenotype or parental tumor cells in wildtype (WT) and Trp53-/- mice. In Trp53-/- mice, the senescence of CD8+ T cells was prevented as a result of p53 deficiency (Figure 6—figure supplement 6A-B), contributing to upregulation of VLA-4 (Figure 6A) and enhanced trafficking ability to meninges (Figure 6—figure supplement 6 C-D). Therefore, leptomeningeal metastatic tumor growth was inhibited in P53 deficient mice determined by BLI signal (Figure 6—figure supplement 6E-F). In addition, previous studies showed that p53 deficient T cells exhibited decreased apoptosis (14) and enhanced proliferation in T cells(15), supporting that p53 deficient T cells have higher anti-tumor effector function. Therefore, targeting p53 in CD8+ T cells can improve the metastasis control. As suggested, we have provided further discussion in the revised manuscript to clarify this issue (Line 406-418, Page 15).

4. Moreover, the involvement of CD8 on controlling metastasis in metastatic locations or affecting dissemination of cancer cells is not clear. This is the key message of this paper. Thus, it should be addressed properly.

We thank the reviewer for bringing up this important issue. Indeed, breast cancer is hematogenous spread to the leptomeninges through arterial vessels and venous circulation (16,17). Therefore, we and others (18) established the leptomeningeal derivatives of breast cancer cells by hematogenous dissemination through intracarotid artery injection. In the previous manuscript, we found that the mice with CD8+ T cell depletion dramatically increased intracranial tumor growth (revised Figure 2E, Figure 2—figure supplement 2D).

Moreover, intracranial tumors arising in Rag2-/- mice was much smaller when receiving transferred CD8+ T cells, but not CD4+ T cells (revised Figure 2H-I, Figure 2—figure supplement 2E).

To further evaluate the involvement of CD8+ T cells on controlling metastasis in metastatic locations or affecting dissemination of cancer cells, we performed the following experiments in the revised manuscript:

1) We first evaluated whether the involvement of CD8+ T cells on controlling metastasis in affecting dissemination of cancer cells. We analyzed the disseminated tumor cells (DTC) from peripheral blood of C57BL/6 mice injected with luciferase-overexpressed (luc-) EO771 parental or LM cells. The DTCs in the blood were defined as CD45-luciferase+ cells by flow cytometry (revised Figure 4—figure supplement 4A). We found that the percentages of DTCs were not significantly different between two groups (revised Figure 4—figure supplement 4B-C). Moreover, we injected EO771-luc LM cells into Rag2-/- mice and transferred CD8+ T cells later. We found that CD8+ T cell transfusion did not influence the percentages of DTCs (revised Figure 4—figure supplement 4D), suggesting that CD8+ T cells did not affect the dissemination of cancer cells.

2) We observed that in the meninge, the number of CD8+ T cells of mice injected with EO771 LM-phenotype cells (LM-CD8+ T cells) was much lower than the one in mice injected with parental cells (Parental-CD8+ T cells) (revised Figure 4A-B, Figure 4—figure supplement 4E). Then, we further investigated the reason for the drop of CD8+ T cell count in the meninges. The tumor-specific CD8+ T cells were primed by DCs in dCLNs, migrated to meninges, and recognized and lysed tumor cells (19). Therefore, we evaluated the number of CD8+ T cells in dCLNs of mice injected with LM cells and parental cells. Interestingly, we found that the absolute count of LM-CD8+ T cells in dCLNs was significantly lower than Parental-CD8+ T cells (Figure 4C-D, Figure 4—figure supplement 4F). In addition, purified LM- and Parental- CD8+ T cells were labeled with CFSE and transferred into the tail vein of recipient mice. Two-photon live imaging showed that LM-CD8+ T cells migrated much less to the meninges in vivo, compared with Parental- CD8+ T cells (revised Figure 5A, Figure 5—figure supplement 5A). These results suggested that CD8+ T cell trafficking to meninges is impaired under leptomeningeal metastasis.

Taken together, we conclude that CD8+ T cells did not affect the dissemination process. T cell trafficking to the metastatic locations, however, was impaired, which led to acceleration of leptomeningeal metastasis. Nevertheless, the preclinical murine leptomeningeal metastasis model was established on the hematogenous dissemination through intracarotid artery injection, rather than the hematogenous spread from the primary lesion, which is different from the metastatic spread from human patients. Therefore, whether CD8+ T cells influence the dissemination of tumor cells in patients’ needs further study.

Although the message is interesting, I do suggest the authors to address immunology parts, especially T cell activation and the contribution of CD8 T cells on hampering leptomeningeal metastasis, in more details. Moreover, a direct examination the role of VLA4 expression in T cells on hampering metastasis is needed.

We thank the reviewer for the constructive suggestions. In summary, we have addressed this reviewer’s concerns as follow:

1) We have performed more convincing experiments to strengthen the conclusion that tumor-specific T cells activate in dCLNs and rewritten the immunology parts of Figure 3. We’ve demonstrated that tumor antigen-presented DCs and tumor antigen-specific CD8+ T cells were detected in tumor draining dCLNs, rather than in spleen or non-draining inguinal LNs (revised Figure 3A-B, Figure 3—figure supplement 3B-C). Moreover, DCs isolated from dCLNs of mice injected with EO771-OVA cells could specifically activated naive OT-1 CD8+ T cells in vitro (revised Figure 3C-E, Figure 3—figure supplement 3D-E). Furthermore, we performed the surgical ligation of the lymphatic afferent to the dCLNs in mice to validate the generation of antigen-specific CD8+ T cells in dCLNs (revised Figure 3F-I, Figure 3—figure supplement 3F-H).

2) We have examined the contribution of VLA-4 in T cell adhesion to plate-bound VCAM-1-Ig. In addition, we employed an in vitro blood-brain barrier model to assess the transmigration of T cells (revised Figure 5G, H).

3) We’ve injected LM-phenotype or parental tumor cells in wildtype and Trp53-/- mice and found that targeting p53 in CD8+ T cells can upregulate the expression of VLA-4 (revised Figure 6A) and enhanced their trafficking ability to meninges (revised Figure 6—figure supplement 6C-D), leading to effective tumor control (revised Figure 6—figure supplement 6E-F). Moreover, we’ve rewritten the Discussion sections to clarify the contribution of p53 in T cells and provide the novelty of our study.

4) We’ve analyzed the DTCs in the peripheral blood of the mice and found that CD8+ T cell transfusion did not influence the presence of DTCs (revised Figure 4—figure supplement 4A-D). Two-photon live imaging suggested that CD8+ T cell trafficking to meninges is impaired under leptomeningeal metastasis. These data implied that CD8+ T cells did not affect the dissemination process, and T cell trafficking to the metastatic locations was impaired, which led to acceleration of leptomeningeal metastasis.

Reviewer #2:

In the submitted manuscript, Li et al. propose an interesting hypothesis that meningeal CD8+ T cells enter senescence in a p53-dependent manner in leptomeningeal metastasis (LM). While the observations are intriguing, the manuscript is not prepared carefully and lacks information critical for rigor and reproducibility. The use of a single mouse model severely limits the generalizability of the claims. Moreover, the mouse experiments are underpowered in all cases. The immunological observations are not internally consistent. Finally, the clinical validation materials are derived from what they call 'brain metastasis' (parenchymal metastasis), a completely different entity from leptomeningeal metastases, and these findings should not be generalized to LM.

We thank the reviewer for the constructive suggestions. We have revised the manuscript as follow:

1) We have adopted two more mouse models to prove the results: breast cancer cells 4T1 (revised Figure 1—figure supplement 1C-F, Figure 2—figure supplement 2A-B, Figure 5—figure supplement 5C) and murine non-small cell lung cancer cells LLC (Figure 1—figure supplement 1G-J, Figure 4—figure supplement 4I-K).

2) We’ve performed new experiments to further support the conclusion that dCLNs can facilitate the generation of tumor antigen-specific T cells. We detected the tumor antigen-presented DCs and tumor antigen-specific CD8+ T cells in tumor draining dCLNs, rather than in spleen or non-draining inguinal LNs (revised Figure 3A-B, Figure 3—figure supplement 3B-C). Moreover, DCs isolated from dCLNs of mice injected with EO771-OVA cells could specifically activated naive OT-1 CD8+ T cells in vitro (revised Figure 3C-E, Figure 3—figure supplement 3D-E). Furthermore, we performed the surgical ligation of the lymphatic afferent to the dCLNs in mice to validate the generation of antigen-specific CD8+ T cells in dCLNs (revised Figure 3F-I, Figure 3—figure supplement 3F-H).

3) The cancer patients that we have included were all with leptomeningeal metastasis validated by MRI to validate our conclusion (Figure 7A).

4) We have compared the percentages and absolute numbers of immune cells in the CSF and meninges of mice injected with PBS, parental and LM cells. Details are presented as below:

Major Points (A-E):

A. Many of the claims and conclusions must be reconsidered as the primary observations are derived from a single cell line. This is not sufficient to make generalized conclusions that are stated in the Results section, given the lack of similar observations in human breast cancer LM patients. The community standard for such claims is at least two cell lines (and corresponding models); three would provide even greater certainty.

We thank the reviewer for the suggestions and confirmed our results by using two more cell lines: 4T1 and LLC cells: breast cancer cells 4T1 (Figure 1—figure supplement 1C-F, Figure 2—figure supplement 2A-B, Figure 5—figure supplement 5C) and murine non-small cell lung cancer cells LLC (Figure 1—figure supplement 1G-J, Figure 4—figure supplement 4I-K).

The model itself is also inadequately characterized:

– Quantification of disease burden is not consistent throughout the manuscript: The authors state that they quantified LM tumor volume from MRI experiments using the formula commonly used to quantify subcutaneous tumors: length x width2 x 0.52. Given that LM forms sheet-like structure on the surface of the brain, rather than a sphere, this formula is not appropriate. Later in the manuscript, they use (2D) area rather than volume. This discrepancy must be addressed.

In the previous manuscript, we used 2D area to quantify the metastatic lesions in slices(20,21). In the revised manuscript, we performed T1 weighted Gd-enhanced MRI to confirm leptomeningeal metastases (Figure 1D, Figure 1—figure supplement 1F and 1J) as described before (22). Higher sensitivity of Gd-enhanced MRI can identify tumor by differential contrast uptake in meningeal layers (dura-arachnoid or pia-arachnoid) to offer a definitive diagnosis over CT and CSF examination. Intensities and distribution of Gd contrast in MRI scans indicate the presence of leptomeningeal metastasis. We have rewritten this part in the Methods (Line 480-483, Page 17).

– New models of metastasis generated through iterative in vivo selection are typically introduced with the corresponding transcriptome. This is a great service to the larger metastasis community. It would also go a long way toward overcoming the use of a single cell line in the manuscript. Is it possible for the authors to characterize the bulk transcriptome of Parental, Intermediate and LeptoM cells?

We thank the reviewer for the suggestions. As the reviewer suggested, we characterized the bulk transcriptome of parental, intermediate and LM-phenotype cells by RNA sequencing (RNA-seq). Analysis of the transcriptome of these cell lines demonstrated that the gene expression profiles of the parental, intermediate and LM-phenotype cell lines segregate independently by principal component analysis(Figure 1H). Thus, each LM-phenotype population was both phenotypically and transcriptomally distinct from its matched parental and inter population.

– Tumor cells in Figure 2B are not really apparent. Also, different brain areas seem to be showed. Images and insets from the same anatomic locations would be helpful.

We have reperformed the experiments and supplied more apparent images and insets from the same anatomic locations in Figure 2E and Figure 2—figure supplement 2D.

B. Certain of the Immunologial observations presented are either internally inconsistent or are inconsistent with clinical data.

– Authors use gP as a control for OVA experiments. Cancer cells overexpressing gB (human?) were introduced into wild type mice with adoptively transferred OT-I CD8+ cells, then dcLN CD8+ cells were isolated and challenged in vitro with corresponding peptides. No response is observed when CD8+ cells from E0771 gB mice are cultured with the peptides. In figure 2F the authors show that dcLN CD8+ cells from E0771 primed mice are able to control the growth of cancer and provide survival benefit, i.e. the cells in dcLNs recognize E0771 cancer cells to some extent. How would authors explain and address this discrepancy – the lack of gB specific CD8 T cells? Can authors isolate cells from E0771 WT mice and expose them to E0771 WT lysate to estimate the proportion of cancer-specific cells?

We thank the reviewer for the constructive suggestion. We have realized the experimental design before was insufficient to prove the hypothesis, and we performed additional experiments to support our conclusion that dCLN can facilitate generation of tumor antigen-specific T cells. The details are as below:

1) It’s well documented that the generation of tumor antigen-specific CD8+ T cells depends on effective tumor antigen presentation by dendritic cells (DCs) in lymph nodes (LNs), which is the fundamental step that launches T cell response against tumor (1,2). Thus, we firstly examined the peptide/MHC class I complex on the cell surface of DCs of mice bearing leptomeningeal metastasis, which indicated the tumor antigen presentation by DCs in LNs. Since deep cervical lymph nodes (dCLNs) could communicate with meningeal lymphatics directly, dCLNs were considered as the tumor draining LNs and inguinal LNs were taken as nondraining LNs. We inoculated EO771 breast tumor cells with ectopic expression of chicken ovalbumin (OVA) into the cisterna magna of C57BL/6 mice and isolated the CD11c+ DCs in dCLNs, inguinal LNs and spleen 7 days later. We found that OVA peptide/MHC class I complex, SIINFEKL/H2-Kb, was only detected on CD11c+ DCs in dCLNs, but not on the ones in inguinal LNs or the spleen (revised Figure 3A, Figure 3—figure supplement 3B).

2) Further, to investigate whether dCLNs can give rise to tumor-specific CD8+ T cells during tumor dissemination to leptomeningeal space, we injected PBS, EO771 cells (EO771 WT), EO771-OVA and EO771 with an irrelevant antigen glycoprotein B (EO771-gB) into C57BL/6 mice via the cisterna magna (revised Figure 3B). We used H-2Kb-OVA/SIINFEKL pentamer staining to detect OVA-specific CD8+ T cells in dCLN after tumor inoculation and observed that only DCs from mice receiving EO771-OVA inoculation could generate OVA antigen-specific T cells (revised Figure 3B, Figure 3—figure supplement 3C). Further, DCs were subsequently isolated from draining dCLNs, and then co-cultured with naive OT-1 CD8+ T cells (revised Figure 3C). Analysis of OT-1 T cell priming revealed that only DCs from mice receiving EO771-OVA inoculation could expand OT-1 T cells (revised Figure 3D, Figure 3—figure supplement 3D) and induce a significant increase in IFN-γ production of OT-1 T cells (revised Figure 3E, Figure 3—figure supplement 3E).

3) In addition, surgical ligation of the lymphatic afferent to the dCLNs which could impair the antigen presentation in LNs was performed before EO771-OVA tumor cell inoculation (revised Figure 3F). Determined by the expression of SIINFEKL/H2-Kb complex on the surface of CD11c+ DCs, antigen processing (revised Figure 3G, Figure 3—figure supplement 3F) was impaired in the mice receiving surgical ligation. In addition, the proliferation (revised Figure 3H, Figure 3—figure supplement 3G) and IFN-γ production (revised Figure 3I, Figure 3—figure supplement 3H) of OT-1 T cells primed by DCs were diminished.

– In Figure 4, the authors are showing drop in meningeal T cell numbers in the presence of cancer. LM is known to induce pleocytosis, this would not be reflected in relative numbers and thus absolute CD3 and CD8 numbers should be provided. What immune cell types are taking over meninges in the presence of cancer?

We thank the reviewer for the suggestions. In the previous manuscript, we found that the number of CD8+ T cells in the meninges of mice injected with LM cells was much lower than the one in mice injected with parental cells. In addition, two-photon live imaging showed that T cells isolated from mice with LM migrated much less to the meninges in vivo, compared with those from mice injected with parental cells. These results suggested that CD8+ T cell trafficking to meninges is impaired under leptomeningeal metastasis.

As the reviewer mentioned, cerebral spinal fluid (CSF) showed pleocytosis in patients with leptomeningeal metastases(23,24). As previously described, "Pleocytosis" refers to increased CSF nucleated cell (NC) count beyond reference range (typically >5 NC/µl), which occurs in the patients with infections (61.3%), miscellaneous (12.7%), vascular (9.7%), neurodegenerative (7%), neoplastic (5%), and inflammatory disease (4.2%) (25). In details, lymphocytes were the predominant population in CSF of patients with lymphomatous meningitis (LyM) and leptomeningeal carcinomatosis (LC), while LC patients often presented an increased rate of monocytes and the polymorphonuclear cells in CSF(24). In our previous manuscript, we only compared the percentages of meningeal T cells in mice injected with parental and LM cells, but not the T cell number in CSF. Since T cell floating in the CSF were able to reattach to the leptomeninges and invade the parenchyma, we compared the absolute numbers of different immune cell types in the leptomeninges and CSF of mice injected with PBS, parental and LM cells, respectively (revised Figure 2A-B). We found that the meninges of mice injected with parental and LM cells showed more CD45+ leukocytes, compared with the mice injected with PBS(revised Figure 2A). We analyzed the absolute numbers of meninge-infiltrating immune cells, including T cells, monocytes, microglia, myeloid cells and neutrophils(26). Interestingly, we observed that only T cells were markedly decreased in leptomeningeal metastasis (revised Figure 2B, Figure 2—figure supplement 2A), especially CD3+CD8+ T cells (revised Figure 4A-B). The main immune cell types in the and meninges of mice injected with LM cells were monocytes (27.75±29.95 cells), CD4+ T cells (185±47.67 cells) and microglia(40±24.59 cells).

– Authors claim that in CD8+ T cells in P53 deficient mice do not downregulate VLA4 and likely do not undergo senescence. Can authors reproduce the results from Figure 5 in P53 deficient mice? Does cancer grow less in these mice? BLI signal should be quantified.

As the reviewer suggested, we have reproduced the experiments to further illustrate the contribution of p53 in senescence(15). We injected LM-phenotype or parental tumor cells in wild type (WT) and Trp53-/- mice to investigate whether p53 targeting can improve the metastasis control. In Trp53-/- mice, the senescence of CD8+ T cells was inhibited as a result of p53 deficiency (revised Figure 6—figure supplement 6A-B), leading to upregulation of VLA-4 (revised Figure 6A) and enhanced trafficking ability to meninges (revised Figure 6—figure supplement 6C-D). Therefore, tumor growth was inhibited in P53 deficient mice determined by BLI signal (revised Figure 6—figure supplement 6E-F).

C. Setting aside the use of a single mouse model, there are serious issues with the work's rigor and reproducibility:

– Some of the antibody dilutions (1:00) seem incorrect.

We apologize for the mistakes and have corrected them in the revised manuscript in Page 18 line 491, line 496.

– For Figure 5 source data, full membrane scans should be provided. The images that are shown are still somewhat cropped.

The images was taken by G:Box Chemi XT4. We’ve already provided the full membrane scans without editing and the shown images haven’t been cropped in Figure 4 source data 1.

– Why were the LeptoM cells established in Rag2-/- mice (line 306)?

We apologize for the misunderstanding caused. LM-phenotype cell was established in wild type C57BL/6 mice, but not Rag2-/- mice (revised Figure 1A). Instead, we inoculated LM-phenotype cells in Rag2-/- mice to investigate the role of T cells in leptomeningeal metastasis (revised Figure 2C-D). We have revised the legends and Methods.

– Authors claim they performed whole mount stainings of meninges, but such images are nowhere to be found.

We apologize for not referring to whole mount staining of meninges in previous Figure 4D. Images of previous Figure 4D were parts of whole mount meninges. In the previous studies, images of whole mount staining were also presented in a similar way (27,28). In the revised manuscript, we supplied the entire image of whole mount meninges and the inside lymphatic vessels were indicated by Lyve-1(red) (revised Figure 5C).

– In methods, authors say that the data are representative of at least three independent experiments with 4-6 mice per experiment. Most experiments in the submitted manuscript show only 5, sometimes 4 animals. Why did the authors not include the other two experiments, i.e. majority of animals? Please, provide data from all performed experiments as dot plots (not bar plots).

We are sorry for the mistake. The number of events and information about the statistical details and methods are indicated in the relevant figure legends. As suggested, we have provided the data from all performed experiments as dot plots (Figure 1C, 2A-B, 2D, 4B, 4D, 4I, 5F-H, 6C-D, Figure 1—figure supplement 1A-B, 1D, 1H, Figure 2—figure supplement 2C-E, Figure 3—figure supplement 3B-H, Figure 4—figure supplement 4C-D, 4G-H, 4K, Figure 5—figure supplement 5A-E, Figure 6—figure supplement 6B, 6D, 6F).

– The actual BLI quantification should be shown in main figures.

As suggested, the actual BLI quantification was shown in the main figures adjacent to the images accordingly (Figure 1B-C, 2C-D, 5E-F; Figure 1—figure supplement 1C-D, 1G-H, Figure 2—figure supplement 2B-C, Figure 6—figure supplement 6E-F).

– In Figure 2, authors state that tumor growth was monitored by BLI, but show pictures of brains ex vivo. It should be clearly stated in the figure legends what signal and at what time point was quantified.

We apologize for the unclarity. Tumor growth was monitored by BLI once a week. Mice were sacrificed when leptomeningeal metastases were detected by BLI, or the clinical signs of brain metastasis, including primary central nervous system disturbances, weight loss, and behavioral abnormalities, were shown. The images of Figure 2A were ex vivo bioluminescence imaging at day 28 post-injection when mice were sacrificed. In the revised manuscript, we have provided the time point of the detection in the legends (Page 33 line 972).

– Additional positive and negative controls for the P53 ChIP in Figure 6 should be provided. It would be also helpful to align the mutant Itga4 promoter sequence below the WT one in Figure 6B.

We thank the reviewer for this suggestion. As the reviewer suggested, we re-performed ChIP with additional positive and negative controls. Mutant Itga promoter sequence was shown in Figure 6B. p53 binding to exon 4 of the Gapdh gene and Cdkn1a were used as negative and positive controls, respectively. We observed an average 4.26-fold enrichment was obtained with anti-p53 in the CD8+ T cells of mice injected with EO771 LM-phenotype cells, as compared to ChIP with a control immunoglobulin G (IgG). By contrast, an average 1.03-fold enrichment was found in T cells injected with parental cells(revised Figure 6D).

D. The methods section is incomplete and does not provide sufficient detail for interested readers to reproduce the experiments, and/or for adequate assessment of the experiments presented. Methods need to be carefully checked and all the lacking information regarding reagents and their use should be provided. In particular:

As suggested, in the revised manuscript, we have provided sufficient detail of the methods, amended the mistakes and carefully checked the method section.

– Details related to senescence analysis with ImageJ are not provided.

As suggested, we added method for quantification of SA-β-gal+ T cells in Page 24 line 676-678. For quantification of SA-β-gal-positive cells, images were randomly taken at 40× magnification (BX-53, Olympus) and then manually counted with ImageJ.

– It is unclear how were the in vivo treatments with antibodies performed.

As suggested, the concentration and the route of administration were defined in Page 18 line 513-518.

in vivo administration of antibodies

Depleting antibodies to CD4 [GK1.5] and CD8 [53.6.72] were administered by intraperitoneal injection (0.25 mg/mouse) on day 1, 4 and 6. Blocking antibody to VLA-4[PS/2] was administered by intraperitoneal injection (0.25 mg/ mouse) on day 0, 1, 2 since the day of tumor cell injection. Rat-anti-mouse IgG (Cat.No. BE0090) was used as control antibody. All antibodies were obtained from BioXCell.”

– Gating strategy for tissues used in this manuscript should be shown.

As suggested, all gating strategies were shown. Gating strategies for Figure 2A-B, 3A, 4A, 4C, 7B and Figure 4—figure supplement 4B was shown in Figure 2—figure supplement 2A, Figure 3—figure supplement 3A, Figure 4—figure supplement 4E, 4F, Figure 7—figure supplement 7A and Figure 4—figure supplement 4A, respectively.

– Authors state that they purified CD4+ T cells and confirmed their purity with flow cytometry, but no anti-CD4 antibody is mentioned in the methods.

As suggested, we added the lacking information in the method section(Page 19 line 546).

– OT-I mice are not mentioned in methods.

As suggested, we added the lacking information in the method section(Page 15 line 430-431).

OT-1 mice on a fully C57BL/6 background were obtained from Shanghai Model Organisms Center Inc (Shanghai, China). All mice were bred and maintained in the specific-pathogen-free (SPF) animal facility of the Animal Experiment Center of Sun Yat-Sen University.

– Were the transgenic mice maintained as homozygous colonies? This statement should be added into the corresponding methods paragraph.

Rag2-/- and OT-1 mice were maintained as homozygous colonies, and Trp53-/- mice were obtained from Shanghai Nanfang Moshi Company. As suggested, we added the lacking information in the method section(Page 15 line 429-431).

Trp53-/- mice, OT-1 mice on a fully C57BL/6 background were obtained from Shanghai Model Organisms Center Inc (Shanghai, China). All mice were bred and maintained in the specific-pathogen-free (SPF) animal facility of the Animal Experiment Center of Sun Yat-Sen University.

– Numerous viral vectors (luciferase, ovalbumin, glycoprotein B) are employed; the source and backbone are unclear.

As suggested, we added the lacking information in the method section(Page16 line 445-448).

EO771 cells were transduced with the viral vectors of ovalbumin (EO771-OVA, GenePharma) or glycoprotein B (EO771-gB, Guangzhou Ige Biotechnology) (multiplicity of infection[MOI] of 10) overnight at 37℃ with 5 μg/mL polybrene (GenePharma). The established cells were selected by 2 μg/mL puromycin(Σ).

– There is no source, concentration, length of incubation mentioned for several reagents (OVA and gB proteins, CFSE etc.)..

As suggested, we added the lacking information in the method section(Page 20 line 563-565).

OT-1 T cells were labeled with 0.5μM CFSE (Thermo Fisher, Cat.lot. C34554) for 15 min at 37℃.

– How were the CSF pellets preserved and stored?

As suggested, we added the lacking information in the method section(Page 25 line 718-720).

CSF sample were centrifuged at 450g for 8 min, and the cells of the CSF sediment were collected and preserved in cryovials with the 1 mL of freezing medium (90% FBS supplemented with 10%DMSO) in liquid nitrogen for future flow cytometry analysis.

E. The clinical samples do not provide validation for the overall hypothesis:

– Although the authors analyzed an impressive number of clinical samples (Figure 7), the metastatic samples seem to be derived from "brain metastases" and not LM. Given this limitation, the proposed observations from a single mouse model cannot be reflected to human LM.

We thank the reviewer for raising an important question. In the clinical samples that we collected, there were 145 patients with non-malignant neurological diseases and 45 patients with leptomeningeal involvements which were confirmed by MRI as shown in Figure 7A, including 6 cases of breast cancer, 35 cases of lung cancer, and 4 cases of gastrointestinal cancer.

– An inverse correlation is demonstrated in Figure D; a negative Pearson's correlation coefficient is expected.

R-squared was previously provided in Figure 7D. We have corrected it in the revised manuscript.

– Gating strategy for human samples has to be shown.

As suggested, gating strategy for Figure 7B-C was shown in Figure 7—figure supplement 7A.

https://doi.org/10.7554/eLife.83272.sa2

Article and author information

Author details

  1. Jiaqian Li

    1. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    2. Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Investigation, Methodology, Writing – original draft
    Contributed equally with
    Di Huang and Bingxi Lei
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7162-8960
  2. Di Huang

    1. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    2. Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Funding acquisition, Validation, Investigation, Methodology, Writing – original draft, Writing – review and editing
    Contributed equally with
    Jiaqian Li and Bingxi Lei
    Competing interests
    No competing interests declared
  3. Bingxi Lei

    Department of Neurosurgery, Sun Yat-sen University, Guangzhou, China
    Contribution
    Validation, Investigation
    Contributed equally with
    Jiaqian Li and Di Huang
    Competing interests
    No competing interests declared
  4. Jingying Huang

    1. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    2. Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Investigation, Writing – original draft
    Competing interests
    No competing interests declared
  5. Linbing Yang

    1. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    2. Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Funding acquisition, Writing – review and editing, Verification of research outputs
    Competing interests
    No competing interests declared
  6. Man Nie

    Department of Medical Oncology, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Sun Yat-sen University Cancer Center, Guangzhou, China
    Contribution
    Funding acquisition, Writing – review and editing, Verification of research outputs
    Competing interests
    No competing interests declared
  7. Shicheng Su

    1. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    2. Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    3. Department of Immunology, Zhongshan School of Medicine, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Conceptualization, Supervision, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    sushch@mail.sysu.edu.cn
    Competing interests
    No competing interests declared
  8. Qiyi Zhao

    1. Department of Infectious Diseases, Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China
    2. Guangdong Provincial Key Laboratory of Liver Disease Research, the Third Affiliated Hospital, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Supervision, Investigation, Methodology
    For correspondence
    zhaoqyi@mail.sysu.edu.cn
    Competing interests
    No competing interests declared
  9. Ying Wang

    1. Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    2. Breast Tumor Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration
    For correspondence
    wangy556@mail.sysu.edu.cn
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0413-831X

Funding

National Key Research and Development Program of China (2021YFA1300502)

  • Shicheng Su

Natural Science Foundation of China (91942309)

  • Shicheng Su

Natural Science Foundation of China (92057210)

  • Shicheng Su

Natural Science Foundation of China (82222029)

  • Di Huang

Natural Science Foundation of China (82071754)

  • Ying Wang

Natural Science Foundation of China (82271793)

  • Ying Wang

Natural Science Foundation of China (81971481)

  • Qiyi Zhao

Natural Science Foundation of China (82173064)

  • Qiyi Zhao

Natural Science Foundation of China (81602205)

  • Bingxi Lei

Natural Science Foundation of China (82002786)

  • Linbing Yang

Natural Science Foundation of China (82003859)

  • Man Nie

Natural Science Foundation of Guangdong Province (2020A1515011458)

  • Di Huang

Natural Science Foundation of Guangdong Province (2022B1515020023)

  • Qiyi Zhao

Natural Science Foundation of Guangdong Province (2021A1515010230)

  • Linbing Yang

Science and Technology Program of Guangzhou (202103000070)

  • Shicheng Su

Science and Technology Program of Guangzhou (202201020467)

  • Qiyi Zhao

Sun Yat-Sen Projects for Clinical Trials (SYS-C-202003)

  • Ying Wang

Fundamental Research Funds for the Central Universities (22ykqb01)

  • Qiyi Zhao

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

This work was supported by grants from the National Key Research and Development Program of China (2021YFA1300502 to SS), the Natural Science Foundation of China (91942309 to SS, 92057210 to SS, 82222029 to DH, 82071754 to YW, 82271793 to YW, 81971481 to QZ, 82173064 to QZ, 81602205 to BL, 82002786 to LY, 82003859 to MN), the Natural Science Foundation of Guangdong Province (2020A1515011458 to DH, 2022B1515020023 to QZ, 2021A1515010230 to LY), Science and Technology Program of Guangzhou (202103000070 to SS, 202201020467 to QZ), Sun Yat-Sen Projects for Clinical Trials (SYS-C-202003 to YW), Fundamental Research Funds for the Central Universities (22ykqb01 to QZ).

Ethics

Human subjects: All samples were collected with informed consents, and all related procedures were performed with the approval of the internal review and ethics board of Sun Yat-Sen Memorial Hospital under protocol 2020-136.

All mice were bred and maintained in the specific-pathogen-free (SPF) animal facility of the Laboratory Animal Center of Sun Yat-Sen University. All procedures were approved by the Animal Care and Use Committee of Sun Yat-Sen University under animal protocol (2018-000095 and 2021-000768).

Senior Editor

  1. Satyajit Rath, Indian Institute of Science Education and Research (IISER), India

Reviewing Editor

  1. Ping-Chih Ho, Ludwig Institute for Cancer Research, Switzerland

Reviewer

  1. Ping-Chih Ho, Ludwig Institute for Cancer Research, Switzerland

Publication history

  1. Received: September 6, 2022
  2. Preprint posted: September 20, 2022 (view preprint)
  3. Accepted: November 24, 2022
  4. Accepted Manuscript published: December 9, 2022 (version 1)
  5. Version of Record published: December 30, 2022 (version 2)
  6. Version of Record updated: January 24, 2023 (version 3)

Copyright

© 2022, Li, Huang, Lei et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 523
    Page views
  • 74
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jiaqian Li
  2. Di Huang
  3. Bingxi Lei
  4. Jingying Huang
  5. Linbing Yang
  6. Man Nie
  7. Shicheng Su
  8. Qiyi Zhao
  9. Ying Wang
(2022)
VLA-4 suppression by senescence signals regulates meningeal immunity and leptomeningeal metastasis
eLife 11:e83272.
https://doi.org/10.7554/eLife.83272

Further reading

    1. Cancer Biology
    Jiangfei Chen, Kunal Baxi ... Myron S Ignatius
    Research Article

    In embryonal rhabdomyosarcoma (ERMS) and generally in sarcomas, the role of wild-type and loss or gain-of-function TP53 mutations remains largely undefined. Eliminating mutant or restoring wild-type p53 is challenging; nevertheless, understanding p53 variant effects on tumorigenesis remains central to realizing better treatment outcomes. In ERMS, >70% of patients retain wild-type TP53, yet mutations when present are associated with worse prognosis. Employing a kRASG12D-driven ERMS tumor model and tp53 null (tp53-/-) zebrafish, we define wild-type and patient-specific TP53 mutant effects on tumorigenesis. We demonstrate that tp53 is a major suppressor of tumorigenesis, where tp53 loss expands tumor initiation from <35% to >97% of animals. Characterizing three patient-specific alleles reveals that TP53C176F partially retains wild-type p53 apoptotic activity that can be exploited, whereas TP53P153D and TP53Y220C encode two structurally related proteins with gain-of-function effects that predispose to head musculature ERMS. TP53P153D unexpectedly also predisposes to hedgehog expressing medulloblastomas in the kRASG12D-driven ERMS-model.

    1. Cancer Biology
    Aojia Zhuang, Aobo Zhuang ... Chen Ding
    Research Article Updated

    The presence of lymph node metastasis (LNM) affects treatment strategy decisions in T1NxM0 colorectal cancer (CRC), but the currently used clinicopathological-based risk stratification cannot predict LNM accurately. In this study, we detected proteins in formalin-fixed paraffin-embedded (FFPE) tumor samples from 143 LNM-negative and 78 LNM-positive patients with T1 CRC and revealed changes in molecular and biological pathways by label-free liquid chromatography tandem mass spectrometry (LC-MS/MS) and established classifiers for predicting LNM in T1 CRC. An effective 55-proteins prediction model was built by machine learning and validated in a training cohort (N=132) and two validation cohorts (VC1, N=42; VC2, N=47), achieved an impressive AUC of 1.00 in the training cohort, 0.96 in VC1 and 0.93 in VC2, respectively. We further built a simplified classifier with nine proteins, and achieved an AUC of 0.824. The simplified classifier was performed excellently in two external validation cohorts. The expression patterns of 13 proteins were confirmed by immunohistochemistry, and the IHC score of five proteins was used to build an IHC predict model with an AUC of 0.825. RHOT2 silence significantly enhanced migration and invasion of colon cancer cells. Our study explored the mechanism of metastasis in T1 CRC and can be used to facilitate the individualized prediction of LNM in patients with T1 CRC, which may provide a guidance for clinical practice in T1 CRC.