1. Chromosomes and Gene Expression

Cell cycle-specific loading of condensin I is regulated by the N-terminal tail of its kleisin subunit

  1. Shoji Tane
  2. Keishi Shintomi
  3. Kazuhisa Kinoshita
  4. Yuko Tsubota
  5. Makoto M Yoshida
  6. Tomoko Nishiyama
  7. Tatsuya Hirano  Is a corresponding author
  1. Chromosome Dynamics Laboratory, RIKEN, Japan
  2. Division of Biological Sciences, Graduate School of Science, Nagoya University, Japan
https://doi.org/10.7554/eLife.84694
Share this article
Cite this article
  1. Shoji Tane
  2. Keishi Shintomi
  3. Kazuhisa Kinoshita
  4. Yuko Tsubota
  5. Makoto M Yoshida
  6. Tomoko Nishiyama
  7. Tatsuya Hirano
(2022)
Cell cycle-specific loading of condensin I is regulated by the N-terminal tail of its kleisin subunit
eLife 11:e84694.
https://doi.org/10.7554/eLife.84694
  2. Download BibTeX
  3. Download .RIS

Abstract

Condensin I is a pentameric protein complex that plays an essential role in mitotic chromosome assembly in eukaryotic cells. Although it has been shown that condensin I loading is mitosis specific, it remains poorly understood how the robust cell cycle regulation of condensin I is achieved. Here, we set up a panel of in vitro assays to demonstrate that cell cycle-specific loading of condensin I is regulated by the N-terminal tail (N-tail) of its kleisin subunit CAP-H. Deletion of the N-tail accelerates condensin I loading and chromosome assembly in Xenopus egg mitotic extracts. Phosphorylation-deficient and phosphorylation-mimetic mutations in the CAP-H N-tail decelerate and accelerate condensin I loading, respectively. Remarkably, deletion of the N-tail enables condensin I to assemble mitotic chromosome-like structures even in interphase extracts. Together with other extract-free functional assays in vitro, our results uncover one of the multilayered mechanisms that ensure cell cycle-specific loading of condensin I onto chromosomes.

Editor's evaluation

This important study provides insight into how vertebrate condensin I activity is restricted to mitosis. Using in vitro experiments in Xenopus extracts, convincing evidence is presented that phosphorylation of the N-terminal extension of CAP-H relieves an inhibitory activity that prevents condensin I loading onto chromosomes. The authors present a speculative model for the mechanistic basis of this inhibition which will provide inspiration for future investigations in the chromosome condensation field.

https://doi.org/10.7554/eLife.84694.sa0

Introduction

Chromosome assembly is an essential cellular process that ensures equal segregation of genetic information into two daughter cells during mitosis (Batty and Gerlich, 2019; Paulson et al., 2021). Extensive studies during the past two decades or so have established the consensus that the condensin complexes play a central role in this process (Hirano, 2016; Uhlmann, 2016). Many eukaryotic species have two different condensin complexes, known as condensins I and II, although some species including fungi have only condensin I. The two condensin complexes, each of which is composed of five subunits, share a pair of SMC (structural maintenance of chromosome) ATPase subunits (SMC2 and SMC4) but are distinguished by distinct sets of non-SMC subunits (Ono et al., 2003). In condensin I, the kleisin subunit CAP-H bridges the head domains of a V-shaped SMC2–SMC4 heterodimer, and is then bound by a pair of HEAT subunits, CAP-D2 and -G (Figure 1A, right). In vertebrates, the two condensin complexes cooperate to assemble rod-shaped chromosomes in mitosis (Ono et al., 2003; Shintomi and Hirano, 2011; Green et al., 2012; Gibcus et al., 2018), but they display differential subcellular localization during the cell cycle. In HeLa cells, for instance, condensin I primarily resides in the cytoplasm during interphase, and gets loaded onto chromosomes immediately after the nuclear envelope breaks down in prometaphase (Ono et al., 2004; Hirota et al., 2004). However, mitosis-specific loading of condensin I can be recapitulated in membrane-free Xenopus egg extracts (Hirano et al., 1997), suggesting that a mechanism(s) independent of the regulation of subcellular localization also operates to ensure the mitosis-specific action of condensin I. Thus, a whole molecular picture of how the loading and action of condensin I are tightly regulated throughout the cell cycle remains to be determined.

Figure 1 with 2 supplements see all
Download asset Open asset
Deletion of the CAP-H N-tail accelerates condensin I loading and mitotic chromosome assembly.

(A) Domain organization of vertebrate CAP-H and sequence alignments of the CAP-H N-tail in eukaryotes (left). Shown in the upper half is an alignment of the CAP-H orthologs (Homo sapiens: hCAP-H, Mus musculus: mCAP-H, Gallus gallus: GgCAP-H, Xenopus laevis: XlCAP-H, Danio rerio: DrCAP-H, Schizosaccharomyces pombe: SpCAP-H, Saccharomyces cerevisiae: ScCAP-H, and Encephalitozoon cuniculi: EcCAP-H). Six mutants tested in the current study (H-dN, H-N19A, H-N19D, H-dCH, and H-crCH) are shown in the bottom half. Conserved amino-acid residues were shown in yellow (N-tail) or blue (motif I). The helix motif predicted using Jpred4 (http://www.compbio.dundee.ac.uk/jpred/) is indicated by ‘CH’ (for the conserved helix). The N19A/N19D and crCH mutation sites were shown in red and purple, respectively. Also shown in a schematic diagram of the architecture of vertebrate condensin I (right). (B) Add-back assay with holo(WT) and holo(H-dN). Mouse sperm nuclei were incubated with condensin-depleted M-HSS that had been supplemented with holo(WT) or holo(H-dN) at concentrations of 4.4, 8.8, 17.5, and 35 nM. After 30 and 150 min, the reaction mixtures were fixed and processed for immunofluorescence labeling with an antibody against mSMC4. DNA was counterstained with DAPI. Shown here is a representative image from over 10 chromosome clusters examined per condition. Scale bar, 10 μm. (C) Quantification of the intensity of mSMC4 per DNA area in the experiment shown in (B) (n = 10 clusters of chromosomes). The error bars represent the mean ± standard error of the mean (SEM). The p values were assessed by Tukey’s multiple comparison test after obtaining a significant difference with two-way analysis of variance (ANOVA). (D) Line profiles of mitotic chromosomes observed at 150 min shown in the experiment shown in (B). Signal intensities of DAPI (top) and mSMC4 (bottom) from chromosomes assembled by holo(WT) or holo(H-dN) at 17.5 or 35 nM were measured along with the lines drawn perpendicular to chromosome axes (n = 20). The mean and standard deviation (SD) were normalized individually to the DAPI intensities (arbitrary unit [a.u.]) at the center of chromosome axes (distance = 0 μm) (top). Intensities of mSMC4 signals were normalized relative to the value from holo(WT) at 35 nM (bottom). The error bars represent the mean ± SD.

Figure 1—source data 1

Microsoft excel of non-normalized data corresponding to Figure 1C.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig1-data1-v2.xlsx
Figure 1—source data 2

Microsoft excel of non-normalized data corresponding to Figure 1D.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig1-data2-v2.xlsx

Early studies demonstrated that condensin I is phosphorylated in a mitosis-specific manner in Xenopus egg extracts (Hirano et al., 1997), and that the positive supercoiling activity of condensin I can be activated by Cdk1 phosphorylation in vitro (Kimura et al., 1998; Kimura et al., 2001). More recently, a mitotic chromatid reconstitution assay using purified proteins was used to demonstrate that Cdk1 phosphorylation of condensin I allows the complex to load onto chromosomes and to drive chromatid assembly (Shintomi et al., 2015). The major targets of mitotic phosphorylation identified in these studies included the CAP-D2 and CAP-H subunits. Phosphorylation of condensin I by other mitotic kinases has also been reported (Lipp et al., 2007; Takemoto et al., 2007; St-Pierre et al., 2009). All subunits of condensin I are large polypeptides of >100 kD, making it a daunting challenge to identify all phosphorylation sites and dissect their functional impacts. A global proteomic analysis of Cdk1 phosphorylation sites provided a clue to potentially relieving this problem, however (Holt et al., 2009). This study showed that Cdk1 phosphorylation often occurs in intrinsically disordered regions (IDRs) of proteins whose evolutionary conservation is relatively poor. It seems that this rule can be applied to the subunits of condensin I as well (Bazile et al., 2010).

In the current study, we focus on the N-terminal IDR of the vertebrate kleisin subunit CAP-H. We show that this region, which is referred to as the CAP-H N-tail, acts as a negative regulatory element for condensin I function. Deletion of the N-tail accelerates condensin I loading and mitotic chromosome assembly in Xenopus egg extracts. Phosphorylation-deficient mutations in the N-tail decelerate condensin I loading, whereas phosphorylation-mimetic mutations accelerate this process. Remarkably, when the N-tail function is compromised, the resultant mutant forms of condensin I enable the assembly of mitotic chromosome-like structures even in interphase extracts. The N-tail deletion mutant is also characterized in topological loading and loop extrusion assays in vitro. Taken together, our results uncover one of the multilayered mechanisms of cell cycle regulation of condensin I.

Results

The N-terminal tail of the kleisin subunit CAP-H

The kleisin subunit CAP-H of condensin I has five sequence motifs widely conserved among eukaryotes (Figure 1A; Hara et al., 2019; Kinoshita et al., 2022). Among them, motifs I and V bind to the SMC2 neck and the SMC4 cap regions, respectively (Hassler et al., 2019), whereas motifs II and IV interact with CAP-D2 and CAP-G, respectively (Piazza et al., 2014; Kschonsak et al., 2017; Hara et al., 2019). In the current study, we focus on the N-terminal extension, located upstream of motif I, that is shared by the vertebrate CAP-H orthologs (Figure 1A). This extension, the CAP-H N-tail, has several characteristic features as summarized below. Firstly, it is ~80 amino-acid long in vertebrates, but the corresponding extension is much shorter or completely missing in fungi (Bazile et al., 2010). Secondly, although most of the N-tail is predicted to be structurally disordered, a stretch of ~17-amino-acid long, located in its middle region, is conserved among vertebrates and is predicted to form an α-helix, as judged by both the conventional secondary structure prediction software Jpred4 (https://www.compbio.dundee.ac.uk/jpred/) and AlphaFold2 (https://alphafold.ebi.ac.uk/). Thirdly, the vertebrate N-tail contains multiple SP/TP sites, sites often targeted by cyclin–CDK complexes, although their number varies among different species.

Deletion of the CAP-H N-tail accelerates condensin I loading and mitotic chromosome assembly

To address the role of the CAP-H N-tail in condensin I function, we expressed mammalian subunits of condensin I using a baculovirus expression system in insect cells, and purified recombinant complexes according to the procedure described previously (Kinoshita et al., 2015; Kinoshita et al., 2022). In the first set of experiments, a holocomplex containing wild-type hCAP-H, holo(WT), and a holocomplex containing mutant hCAP-H that lacks its N-terminal 77 amino acids, holo(H-dN), were prepared (Figure 1A and Figure 1—figure supplement 1A). We then tested the ability of these recombinant complexes to assemble mitotic chromosomes in Xenopus egg extracts (high-speed supernatants of metaphase-arrested extracts, hereafter referred to as M-HSS) that had been immunodepleted of endogenous condensin subunits (Kinoshita et al., 2015; Kinoshita et al., 2022; Figure 1—figure supplement 1C). The condensin-depleted extracts were supplemented with increasing concentrations (4.4, 8.8, 17.5, and 35 nM) of holo(WT) or holo(H-dN), mixed with mouse sperm nuclei and incubated at 22°C. Aliquots were taken from the reaction mixtures at 30 and 150 min, fixed and processed for immunofluorescence using an antibody against the recombinant subunit mSMC4 (Figure 1B). We found that holo(WT) produced a cluster of rod-shaped chromosomes with mSMC4-positive axes under the standard condition (i.e., 35-nM condensin I, 150-min incubation) set up in the previous study (Kinoshita et al., 2022). As expected, progressively poorer assembly was observed with decreasing concentrations of condensin I (17.5–4.4 nM) or at the earlier time point (30 min). Remarkably, we found that significantly higher levels of holo(H-dN) were detected on chromatin than holo(WT) at both time points and at the different concentrations of condensin I tested (Figure 1B, C). It was also noticed that the chromosomes assembled with 35 nM holo(H-dN) at 150 min were much thinner than those assembled with 35 nM holo(WT) at 150 min (Figure 1B, D). When the concentration of holo(H-dN) was reduced to 17.5 nM, the resultant chromosomes were comparable with those assembled with 35 nM holo(WT), in terms of both the morphology and the mSMC4 signal levels (Figure 1C, D). Taken together, we concluded that the deletion of the CAP-H N-tail accelerates the loading of condensin I on chromosomes in M-HSS, and that the chromosomal levels of condensin I are tightly correlated with the chromosome morphology produced.

To gain further insights into the functional contribution of the CAP-H N-tail to condensin I-mediated chromosome assembly, we next focused on the conserved helix (CH), located in the middle of the N-tail, that contains conserved basic amino acids (Figure 1A). We constructed a holocomplex containing hCAP-H that lacks the CH, holo(H-dCH), and a holocomplex containing hCAP-H in which the basic amino acids within the CH are substituted with acidic residues, holo(H-crCH) (Figure 1A and Figure 1—figure supplement 1A). Here, dCH and crCH stand for deletion of the CH and charge-reversed CH, respectively. We found that the holo(H-dCH) and holo(H-crCH) exhibited a phenotype very similar to that of holo(H-dN) in terms of both increased condensin I loading and resultant chromosome morphology (Figure 1—figure supplement 2A–C). Thus, the CH and its positive charges play an important role in negatively regulating condensin I loading in M-HSS.

Phosphorylation-deficient and phosphorylation-mimetic mutations of the CAP-H N-tail decelerate and accelerate condensin I loading, respectively

We next wished to understand how phosphorylation of the CAP-H N-tail might affect its function. Previous studies had shown that Xenopus CAP-H is phosphorylated in a mitosis-specific manner in Xenopus egg extracts (Hirano et al., 1997; Kimura et al., 1998), and that Xenopus and human CAP-H can be phosphorylated by cyclin B-Cdk1 in vitro (Kimura et al., 1998; Kimura et al., 2001; Shintomi et al., 2015). Whereas hCAP-H has three SP sites and one TP site in its N-tail (Figure 2—figure supplement 1A), it is known that Cdk1 phosphorylation is not exclusively proline directed (Brown et al., 2015; Suzuki et al., 2015; Krasinska and Fisher, 2022). Moreover, a phospho-proteomic analysis identified phosphorylation at both SP/TP and non-SP/TP sites in this region (Hornbeck et al., 2015). Thus, the targets of mitosis-specific phosphorylation in CAP-H have not yet been fully characterized.

To test whether phosphorylation of the hCAP-H N-tail plays an important role in condensin I loading, we prepared a holocomplexes harboring phosphorylation-deficient mutations in the CAP-H N-tail, holo(H-N19A), where all serines and threonines present in the N-tail were substituted with alanines (Figure 1A and Figure 1—figure supplement 1A). When the holo(WT) and holo(H-N19A) were incubated with M-HSS, two phosphoepitopes (pS17 and pS76) were detectable in the former, but not in the latter (Figure 2—figure supplement 1A, B; Materials and methods). Neither of the epitopes was detected in both complexes that had been incubated with interphase HSS (I-HSS), indicating that the corresponding sites are phosphorylated in holo(WT) in a mitosis-specific manner. Holo(H-N19A) was then subjected to the add-back assay in M-HSS. We found that the loading of holo(H-N19A) onto chromatin was greatly reduced compared to holo(WT) or holo(H-dN) (Figure 2A–C). The resultant chromosomes produced by holo(H-N19A) were poorly organized and abnormally thick, having hazy surfaces (Figure 2A–C).

Figure 2 with 1 supplement see all
Download asset Open asset
Phosphorylation-deficient and phosphorylation-mimetic mutations of the CAP-H N-tail decelerate and accelerate condensin I loading, respectively.

(A) Mouse sperm nuclei were incubated with condensin-depleted M-HSS that had been supplemented with holo(WT), holo(H-dN), or holo(H-N19A) at a final concentration of 35 nM. After 30 and 150 min, the reaction mixtures were fixed and processed for immunofluorescence labeling with an antibody against mSMC4. DNA was counterstained with DAPI. Shown here is a representative image from over 10 chromosome clusters examined per condition. Scale bar, 10 μm. (B) Quantification of the intensity of mSMC4 per the DAPI area in the experiment shown in (A) (n = 10 clusters of chromosomes). The error bars represent the mean ± standard error of the mean (SEM). The p values were assessed by Tukey’s multiple comparison test after obtaining a significant difference with one-way analysis of variance (ANOVA) at each time point. A dataset from a single representative experiment out of more than three repeats is shown. (C) Line profiles of mitotic chromosomes observed at 150 min in the experiment shown in (A). Signal intensities of DAPI (top) and mSMC4 (bottom) of the chromosomes assembled with holo(WT) (black), holo(H-dN) (red), or holo(H-N19A) (blue) were measured along with the lines drawn perpendicular to chromosome axes (n = 20). The mean and standard deviation were normalized individually to the DAPI intensities (arbitrary unit [a.u.]) at the center of chromosome axes (distance = 0 μm) within each set. Intensities of mSMC4 signals from holo(H-dN) and holo(H-N19A) were normalized relative to the value from holo(WT). A dataset from a single representative experiment out of more than three repeats is shown. (D) Add-back assay using holo(WT), holo(H-dN), and holo(H-N19D) at a final concentration of 35 nM was performed as described in (A). Shown here is a representative image from over 10 chromosome clusters examined per condition. Scale bar, 10 μm. (E) Quantification of the intensity of mSMC4 per the DAPI area in the experiment shown in (D) (n = 10 clusters of chromosomes). The error bars represent the mean ± SEM. The p values were assessed by Tukey’s multiple comparison test after obtaining a significant difference with one-way ANOVA at each time point. A dataset from a single representative experiment out of more than three repeats for holo(WT) and holo(H-dN) and two repeats for holo(H-N19D) is shown. (F) Line profiles of mitotic chromosomes assembled observed at 150 min in the experiment shown in (D). The signal intensities of DAPI (top) and mSMC4 (bottom) of the chromosomes assembled with holo(WT) (black), holo(H-dN) (red), or holo(H-N19D) (green) were measured and plotted as described in (C) (n = 20). A dataset from a single representative experiment out of more than three repeats for holo(WT) and holo(H-dN) and two repeats for holo(H-N19D) is shown.

Figure 2—source data 1

Microsoft excel of non-normalized data corresponding to Figure 2B.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig2-data1-v2.xlsx
Figure 2—source data 2

Microsoft excel of non-normalized data corresponding to Figure 2C.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig2-data2-v2.xlsx
Figure 2—source data 3

Microsoft excel of non-normalized data corresponding to Figure 2E.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig2-data3-v2.xlsx
Figure 2—source data 4

Microsoft excel of non-normalized data corresponding to Figure 2F.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig2-data4-v2.xlsx

To further substantiate the observations described above, we then prepared and tested a holocomplex harboring phosphorylation-mimetic mutations, holo(H-N19D) (Figure 1A and Figure 1—figure supplement 1A), in which all serines and threonines in the N-tail were substituted with aspartic acids. Remarkably, we found that holo(H-N19D) behaved very similarly to holo(H-dN) in the add-back assay (Figure 2D–F). Although we cannot rule out the possibility that the introduction of multiple mutations into the N-tail causes unforeseeable adverse effects on protein conformations, these results supported the idea that multisite phosphorylation in the CAP-H N-tail relieves its negative effects on condensin I loading and mitotic chromosome assembly.

Deletion of the CAP-H N-tail enables condensin I to assemble mitotic chromosome-like structures even in interphase extracts

Having observed the accelerated loading of holo(H-dN) in M-HSS, we wondered how the mutant complex would behave in interphase extracts. To eliminate potential complications from the subcellular localization of condensin I (Ono et al., 2004; Shintomi and Hirano, 2011), we used membrane-free I-HSS in the following experiments in which no nuclear envelope was assembled around the chromatin introduced. Consistent with the previous study (Hirano et al., 1997), endogenous Xenopus condensins failed to associate with chromatin in I-HSS, leaving a spherical compact mass, although they bound to chromatin and assembled a cluster of rod-shaped chromosomes in M-HSS (Figure 3A). We then monitored the morphological changes of sperm nuclei in a condensin-depleted I-HSS. We found that the nuclei were transiently swollen at early time points (15–30 min) and then converted into compact chromatin masses at a late time point (150 min) (Figure 3B). The terminal morphology was very similar to that observed in the undepleted I-HSS described above (Figure 3A). The same was true in the condensin-depleted extract that had been supplemented with 35 nM holo(WT). Signals of mSMC4 were hardly observed on the chromatin masses under this condition (Figure 3B). When the condensin-depleted extract was supplemented with 35 nM holo(H-dN), however, significant levels of mSMC4 signals were detectable on chromatin, especially at early time points (Figure 3B). It was also noticed that the compact masses observed at 150 min had somewhat irregular surfaces.

Figure 3 with 1 supplement see all
Download asset Open asset
Deletion of the CAP-H N-tail enables condensin I to assemble mitotic chromosome-like structures even in interphase extracts.

(A) Mouse sperm nuclei were incubated with M-HSS (left) and I-HSS (right) for 150 min, and the reaction mixtures were fixed and processed for immunofluorescence labeling with an antibody against XSMC2 (bottom). DNA was counterstained with DAPI (top). Scale bar, 10 μm. (B) Mouse sperm nuclei were incubated with condensin-depleted I-HSS that had been supplemented with a control buffer, holo(WT), or holo(H-dN) at a final concentration of 35 or 150 nM. After 15, 30, and 150 min, the reaction mixtures were fixed and processed for immunofluorescence labeling with an antibody against mSMC4. DNA was counterstained with DAPI. Shown here is a representative image from over 10 chromosome clusters examined per condition. Scale bar, 10 μm. (C) Blow-up images of a chromatin ‘mass’ assembled with 150 nM holo(WT) at 150 min and a cluster of mitotic ‘chromosome-like’ structures assembled with 150 nM holo(H-dN) at 150 min in the experiment shown in (B). Frequencies of the chromosomal phenotypes observed under the two conditions, which include ‘intermediate’ structures, are plotted on the right (n = 10 for each condition). Scale bar, 10 μm. (D) Quantification of mSMC4 intensities on interphase chromatin when added holo(WT) or holo(H-dN) at 150 nM. The graph shows the intensity of mSMC4 per the DAPI area (n = 10 masses of chromatin) shown in (B). The error bars represent the mean ± standard error of the mean (SEM). The p values were assessed by Tukey’s multiple comparison test after obtaining a significant difference with two-way analysis of variance (ANOVA). A dataset from a single representative experiment out of three repeats is shown. Another set of the reproduced result was also shown in Figure 3—figure supplement 1.

Figure 3—source data 1

Microsoft excel of non-normalized data corresponding to Figure 3D.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig3-data1-v2.xlsx

To further extend the observations obtained at the standard concentration (35 nM) of condensin I added back into the extracts, we tested a higher concentration (150 nM) of holo(WT) and holo(H-dN) in the same assay. We found that 150 nM holo(WT) produced a temporal series of chromatin masses that was very similar to that observed with 35 nM holo(H-dN). In contrast, 150 nM holo(H-dN) produced morphological phenotypes strikingly different from the other conditions tested. At 15 and 30 min, high levels of mSMC4 signals were detectable on chromatin masses in which entangled thin chromatin fibers were observed (Figure 3B, D). At 150 min, although mSMC4 signals on chromatin decreased, a cluster of rod-shaped, mitotic chromosome-like structures with mSMC4-positive axes was clearly discernible in each of the chromatin masses (Figure 3B, D). A blow-up image of a representative example is shown in Figure 3C. It is important to note that not only the SP/TP sites in the CAP-H N-tail but also those in the CAP-D2 C-tail were barely phosphorylated in I-HSS (Figure 2—figure supplement 1A, B).

Finally, holo(H-crCH) and holo(H-N19D) were subjected to the same add-back assay at the concentration of 150 nM (Figure 3—figure supplement 1A, B). We found that both mutant complexes behaved similarly to holo(H-dN) although the loading efficiency of holo(H-N19D) was somewhat lower than that of holo(H-crCH). These results demonstrated that, when the CAP-H N-tail is compromised, condensin I gains the ability to assemble mitotic chromosome-like structures even in interphase extracts.

Deletion of the CAP-H N-tail enhances topological loading onto circular DNA and increases the frequency of loop formation in vitro

We next compared the activities of holo(WT) and holo(H-dN) in two different functional assays without the aid of Xenopus egg extracts. In the first setup, we employed the so-called topological loading assay that had been originally developed to assess an ATP-dependent topological entrapment of nicked circular DNA by the cohesin ring (Murayama and Uhlmann, 2014). Briefly, holo(WT) and holo(H-dN) were incubated with nicked circular or linearized DNA in the absence of nucleotides or the presence of ATP or AMP-PNP, and then condensin–DNA complexes were recovered on beads by immunoprecipitation. After being washed with a high-salt buffer, the samples were split into two, and the DNA and proteins that remained on the beads were analyzed by agarose gel electrophoresis (Figure 4A) and immunoblotting (Figure 4B). Under this condition, virtually no linear DNA was recovered with either holo(WT) or holo(H-dN) regardless of the presence or absence of nucleotides (Figure 4A). In contrast, nicked circular DNA was recovered on the beads with holo(WT) in an ATP-dependent manner. Notably, a significantly higher amount (~2.5-fold) of nicked circular DNA was recovered with holo(H-dN) than with holo(WT) (Figure 4A, C).

Figure 4 with 1 supplement see all
Download asset Open asset
Deletion of the CAP-H N-tail enhances topological loading onto circular DNA and increases the frequency of loop formation in vitro.

(A–C) Topological loading assay. (A) Loading reactions onto nicked circular DNA (NC) or linearized DNA (L) were set up with a control buffer, holo(WT) or holo(H-dN) in the absence of nucleotides (none) or the presence of ATP or AMP-PNP. DNAs recovered on beads after a high-salt wash were analyzed by agarose gel electrophoresis. (B) Confirmation of the efficiency of immunoprecipitation in the experiment shown in (A). Using the one-tenth volume of the recovered samples, immunoblotting analysis was performed with the antibodies indicated. (C) Quantification of the recovery of NC DNA in the experiments shown in (A). The error bars represent the mean ± standard error of the mean (SEM) from three independent experiments. The p values were assessed by Tukey’s multiple comparison test after obtaining a significant difference with two-way analysis of variance (ANOVA). (D–H) Loop extrusion assay. The error bars represent mean ± SEM. The p values shown in (F)–(H) were assessed by a two-tailed Mann–Whitney U-test. (D) Frequency of DNA loop formation by holo(WT) or holo(H-dN) (n = 3, ≥53 DNAs per condition). (E) Time-lapse images of DNA loop extrusion events by holo(WT) and holo(H-dN). DNA was stained with Sytox Orange. Scale bar, 1 μm. (F) Loop extrusion rate by holo(WT) or holo(H-dN) in the same experiment as in (E) (from three independent experiments, n = 21 and 59 for holo(WT) and holo(H-dN), respectively). (G) Duration time to maintain DNA loops by holo(WT) or holo(H-dN) in the same experiment as in (E) (from three independent experiments, n = 27 and 81 for holo(WT) and holo(H-dN), respectively). (H) Loop size produced by holo(WT) or holo(H-dN) in the same experiment as in (E) (from three independent experiments, n = 21 and 59 for holo(WT) and holo(H-dN), respectively).

Figure 4—source data 1

Raw data uncropped gel corresponding to Figure 4A.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig4-data1-v2.zip
Figure 4—source data 2

Raw data uncropped blots corresponding to Figure 4B.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig4-data2-v2.zip
Figure 4—source data 3

Quantitative data from three independent experiments corresponding to Figure 4C.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig4-data3-v2.xlsx
Figure 4—source data 4

Microsoft excel of quantitative data corresponding to Figure 4D, F, G and H.

https://cdn.elifesciences.org/articles/84694/elife-84694-fig4-data4-v2.xlsx

In the second setup, a loop extrusion assay using single DNA molecules was performed (Sakata et al., 2021; Kinoshita et al., 2022). In brief, holo(WT) and holo(H-dN) were labeled with Alexa Fluor 488 through a HaloTag (Figure 1—figure supplement 1B) and subjected to the assay using U-shaped DNA. We found that holo(WT) and holo(H-dN) formed DNA loops on ~17% and ~33% of the U-shaped DNA, respectively, in the presence of ATP (Figure 4D). Time-lapse images of DNA loop extrusion events by holo(WT) and holo(H-dN) are shown in Figure 4E. Despite the difference in the frequency of loop formation, no significant differences were observed between holo(WT) and holo(H-dN) in other parameters, such as the rate of loop extrusion, the loop duration time, or the loop size formed (Figure 4F–H). Neither holo(WT) nor holo(H-dN) supported loop formation in the absence of ATP (Figure 4—figure supplement 1). Taken together, these results show that deletion of the CAP-H N-tail affects the initial interactions with DNA, but not the core activity responsible for the expansion of DNA loops.

Discussion

Previous studies showed that mitotic phosphorylation of Cut3/SMC4 regulates the nuclear import of condensin in fission yeast (Sutani et al., 1999) and that phosphorylation of Smc4/SMC4 slows down the dynamic turnover of condensin on mitotic chromosomes in budding yeast (Robellet et al., 2015; Thadani et al., 2018). In the current study, we have focused on the phosphoregulation of vertebrate condensin I by its kleisin subunit CAP-H.

We have constructed and tested a panel of mutant complexes to provide evidence that the N-tail of the kleisin subunit CAP-H negatively regulates the loading of condensin I and the resultant assembly of mitotic chromosomes in Xenopus egg extracts (Figure 5A). Recent studies from our laboratory showed that deletion of the CAP-D2 C-tail, which also contains multiple SP/TP sites (Figure 2—figure supplement 1A), has little impact on condensin I function as judged by the same and related add-back assays using Xenopus egg extracts (Kinoshita et al., 2022; Yoshida et al., 2022). Thus, the CAP-H N-tail represents the first example of negative regulatory elements that have been identified in vertebrate condensin I. Phosphorylation-deficient mutations (H-N19A) and phosphorylation-mimetic mutations (H-N19D) in the N-tail decelerate and accelerate condensin I loading, respectively, allowing us to propose the following working model (Figure 5B). The SMC2-kleisin gate is closed when the CAP-H motif I binds to the SMC2 (Hassler et al., 2019) and prevents its untimely opening during interphase. The CH located in the middle of the N-tail could play a critical contribution to this stabilization. Upon mitotic entry, multisite phosphorylation of the N-tail relieves the stabilization, allowing the opening of the DNA entry gate, hence, the loading of condensin I onto chromosomes. Thus, the kleisin N-tail of vertebrate condensin I could act as a ‘gatekeeper’ of the SMC2-kleisin gate. It is possible that, analogous to the Cdk1 inhibitor Sic1 (Örd et al., 2019), multisite phosphorylation of the CAP-H N-tail sets up an ultrasensitive switch-like response that can be activated at a certain threshold level of phosphorylation, thereby ensuring robust cell cycle regulation of condensin I loading. Although our model predicts that the SMC2 neck–kleisin interface is used as a DNA entry gate, we are aware that several studies reported evidence arguing against this possibility (e.g., Houlard et al., 2021; Shaltiel et al., 2022). Our current data do not exclude other models.

Figure 5
Download asset Open asset
Regulation of condensin I by the N-tail of its kleisin subunit.

(A) Summary of the mutant complexes tested in the current study. NT: not tested. (B) Model of cell cycle regulation of condensin I loading. The SMC2-kleisin gate is closed when the CAP-H motif I binds to the SMC2 neck (a). In our model, this binding is stabilized by the CAP-H N-tail, thereby preventing its untimely opening during interphase. The conserved helix located in the middle of the N-tail contributes to this stabilization, possibly through direct interaction with the SMC2 head or neck. Upon mitotic entry, multisite phosphorylation of the N-tail relaxes this stabilization (b). ATP binding and hydrolysis by the SMC subunits trigger the opening of the DNA entry gate, thereby enabling condensin I to load onto chromosomes (c, d). Thus, the kleisin N-tail of vertebrate condensin I could act as a ‘gatekeeper’ of the SMC2-kleisin gate.

It should be added that CAP-H2, the kleisin subunit of condensin II, lacks the N-terminal extension that corresponds to the CAP-H N-tail. Thus, the negative regulation by the kleisin N-tail reported here is not shared by condensin II. Interestingly, however, a recent study from our laboratory has shown that the deletion of the CAP-D3 C-tail causes accelerated loading of condensin II onto chromatin (Yoshida et al., 2022). It is therefore possible that condensins I and II utilize similar IDR-mediated regulatory mechanisms, but they do so in different ways.

In terms of the regulatory role of the CAP-H N-tail, it would be worthy to discuss the model previously proposed by Tada et al., 2011. According to their model, aurora B-mediated phosphorylation of the CAP-H N-tail allows its direct interaction with the histone H2A N-tail, which in turn triggers condensin I loading onto chromatin. Accumulating, multiple lines of evidence, however, strongly argue against this model: (1) aurora B is not essential for single chromatid assembly in Xenopus egg extracts (MacCallum et al., 2002) or in a reconstitution assay (Shintomi et al., 2015); (2) the H2A N-tail is dispensable for condensin I-dependent chromatid assembly in the reconstitution assay (Shintomi et al., 2015); (3) even whole nucleosomes are not essential for condensin I-mediated assembly of chromatid-like structures (Shintomi et al., 2017). The current study demonstrates that the deletion of the CAP-H N-tail accelerates, rather than decelerates, condensin I loading, providing an additional piece of evidence against the model proposed by Tada et al., 2011.

Our results show that, when the CAP-H N-tail function is compromised, the mutant condensin I complexes gain the ability to assemble mitotic chromosome-like structures even in interphase extracts. This raises the intriguing possibility that vertebrate condensin I can escape the tight requirement for Cdk1 phosphorylation under certain conditions. Finally, it should be mentioned that, although our recombinant condensin I complexes work excellently in the add-back assays using Xenopus egg extracts (Kinoshita et al., 2015; Kinoshita et al., 2022) (the current study), we have so far been unsuccessful in using these recombinant complexes to recapitulate positive DNA supercoiling or chromatid reconstitution, both of which require proper Cdk1 phosphorylation in vitro (Kimura et al., 1998; Shintomi et al., 2015). Faithfully reconstituting the key activities of condensin I using the recombinant subunits and dissecting multiple phosphorylation events required for its activation are important issues to be addressed in the future.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Spodoptera frugiperda)Sf9 insect cellsThermo Fisher Scientific12659017
Cell line (Spodoptera frugiperda)Sf9 insect cellsThermo Fisher ScientificB825-01
Cell line (Trichoplusia ni)High Five insect cellsThermo Fisher ScientificB85502
Strain, strain background (Escherichia coli)MAX Efficiency DH10bac Competent CellsThermo Fisher Scientific10361012
Biological sample (Xenopus laevis)Xenopus laevis eggsHamamatsu Seibutsu-KyozaiRRID:NXR_0031Female, adult frogs
Biological sample (Mus musculus)Mus musculus sperm nucleiMus musculus cauda epididymis (BALB/c×C57BL/6J)F1; Shintomi et al., 2017N/AMale, adult mice
Antibodyanti-XSMC4 (rabbit polyclonal)Hirano and Mitchison, 1994In-house: AfR8LWB (2 μg/ml)
Antibodyanti-XSMC2 (rabbit polyclonal)Hirano and Mitchison, 1994In-house: AfR9-6WB (1 μg/ml)
Antibodyanti-XSMC2 (rabbit polyclonal, biotin-labeled)Hirano and Mitchison, 1994In-house: AfR9IF (1 μg/ml)
Antibodyanti-XCAP-D2 (rabbit polyclonal)Hirano et al., 1997In-house: AfR16LWB (1 μg/ml)
Antibodyanti-XCAP-G (rabbit polyclonal)Hirano et al., 1997In-house: AfR11-3LWB (1 μg/ml)
Antibodyanti-XCAP-H (rabbit polyclonal)Hirano et al., 1997In-house: AfR18WB (0.7 μg/ml)
Antibodyanti-XCAP-D3 (rabbit polyclonal)Ono et al., 2003In-house: AfR196-2LWB (1 μg/ml)
Antibodyanti-mSMC4 (rabbit polyclonal)Lee et al., 2011In-house: AfR326-3LWB (1 μg/ml); IF (1 μg/ml)
Antibodyanti-mSMC2 (rabbit polyclonal)Lee et al., 2011In-house: AfR329-4LWB (1 μg/ml)
Antibodyanti-hCAP-D2 (rabbit polyclonal)Kimura et al., 2001In-house: AfR51-3WB (1 μg/ml)
Antibodyanti-hCAP-G (rabbit polyclonal)Kimura et al., 2001In-house: AfR55-4WB (1 μg/ml); IP (refer to Materials and methods)
Antibodyanti-hCAP-H (rabbit polyclonal)Kimura et al., 2001In-house: AfR57-4WB (1 μg/ml)
Antibodyanti-XTopo IIa (rabbit antiserum)Hirano and Mitchison, 1993In-house: αC1-6WB (1/2000)
Antibodyanti-hCAP-H pS17 (hHP1) (rabbit polyclonal)This paper; custom ordered from SIGMA GenosysIn-house: AfR464-3PWB (1 μg/ml)
Antibodyanti-hCAP-H pS76 (hHP2) (rabbit polyclonal)This paper; custom ordered from SIGMA GenosysIn-house: AfR470-3PWB (1 μg/ml)
Antibodyanti-hCAP-D2 pT1339 (hDP1) (rabbit polyclonal)This paperIn-house: AfR173-4PWB (1 μg/ml)
Antibodyanti-hCAP-D2 pT1384 (hDP2) (rabbit polyclonal)This paperIn-house: AfR175-4PWB (1 μg/ml)
Antibodyanti-hCAP-D2 pT1389 (hDP3) (rabbit polyclonal)This paperIn-house: AfR177-4PWB (1 μg/ml)
AntibodyAlexa Fluor 568-conjugated anti-rabbit IgGThermo Fisher ScientificA11036 [RRID: AB_10563566]IF (1/500)
AntibodyHorseradish peroxidase-conjugated anti-rabbit IgGVector LaboratoriesPI-1000 [RRID: AB_2336198]WB (1/10,000)
Peptide, recombinant proteinhHP1This paper; custom ordered from SIGMA Genosys[C]PHSASpSPSERV
Peptide, recombinant proteinhHP2This paper; custom ordered from SIGMA Genosys[C]PRLLApSPSSRS
Peptide, recombinant proteinPrecission ProteaseCytiva27-0843-01Used in purification of recombinant condensin I;
Kinoshita et al., 2022
Peptide, recombinant proteinBenzonase nucleaseNovagen71205Used in purification of recombinant condensin I;
Kinoshita et al., 2022
Peptide, recombinant proteinλ Protein PhosphataseNew England BiolabsP0753S
Peptide, recombinant proteinNt.BspQI nicking endonucleaseNew England BiolabsR0644S
Peptide, recombinant proteinEcoRI restriction enzymeTaKaRa Bio1040A
Peptide, recombinant proteinSerotropin (PMSG)ASKA Pharmaceutical Co, LtdUsed in preparation of HSS;
Shintomi and Hirano, 2018
Peptide, recombinant proteinGonatropin (HCG)ASKA Pharmaceutical Co, LtdUsed in preparation of HSS;
Shintomi and Hirano, 2018
Recombinant DNA reagentpUC19Genbank: L9137RRID: Addgene_50005
Recombinant DNA reagentλDNANew England BiolabsN3011S
Sequence-based reagenthCAP-H (CH) deletion-FThis paperForward primerGAACGACTTCTCTACCGACTCTCCC
Sequence-based reagenthCAP-H (CH) deletion-RThis paperReverse primerGTAGAGAAGTCGTTCTGAGGGAAGTC
Sequence-based reagenthCAP-H (WT and dN) forwardThis paperForward primerGAAGCGCGCGGAATTCGCCA
Sequence-based reagenthCAP-H (WT) reverseThis paperReverse primerGAAGTACAGGTCCTCAGTGGTAGGTT
CCAGGTCGCCCTGCCTAACTAA
Sequence-based reagenthCAP-H (dN) reverseThis paperReverse primerGAAGTACAGGTCCTCAGTGGTAGGTT
CCAGGTCGCCCTGCCTGACTAA
Sequence-based reagentHaloTag forwardThis paperForward primerGAGGACCTGTACTTCCAGTCTGACAAC
GACATGGCCGAAATCGGAACT
Sequence-based reagentHaloTag reverseThis paperReverse primerAGCGGCCGCGACTAGTTTATC
CGCTGATTTCCAGGGTA
Commercial assay or kitPrimeSTAR Mutagenesis Basal KitTaKaRa BioR046A
Commercial assay or kitIn-Fusion HD Cloning KitTaKaRa Bio639650
Commercial assay or kitNucleobond PC100MACHERREY-NAGEL GmbH & Co KG740573.100
Chemical compound, drugCytochalasin DSigma-AldrichC8273Used in preparation of HSS;
Shintomi and Hirano, 2018
Chemical compound, drugATPSigma-AldrichA2383
Chemical compound, drugAMP-PNPJena BioscienceNU-407
Software, algorithmUNICORN7Cytiva
Software, algorithmPrism 8GraphPad
Software, algorithmOlympus cellSens DimensionsOlympus
Software, algorithmExcelMicrosoft
Software, algorithmPhotoshopAdobe
Software, algorithmImageJhttps://imagej.nih.gov/ij
OtherImmobilon Western Chemiluminescent HRP SubstrateMilliporeWBKLS500Used detection of immunoblots
OtherAlexa Fluor 488-conjugated streptavidinThermo Fisher ScientificS11223IF (1/500)
OtherStreptavidinMerckS47621 mg/ml (Loop extrusion assay)
OtherHaloTag Alexa Fluor 488 LigandPromegaG1001
OtherPD-10 columnCytiva17-0851-01
OtherDynabeads Protein AThermo Fisher Scientific10002DFor immunodepletion with HSS and immunoprecipitation in topological loading assay
OtherrProtein A Sepharose Fast FlowCytiva17-1279-01For immunoprecipitation with HSS
OtherGlutathione Sepharose 4BCytiva17075601Used in purification of recombinant condensin I; Kinoshita et al., 2022
OtherHiTrap Q HP 1 mlCytiva17115301Used in purification of recombinant condensin I; Kinoshita et al., 2022
OtherAmicon Ultra-15MilliporeUFC905024Used in ultrafiltration of purified condensin I; Kinoshita et al., 2022
OtherDAPIRoche10236276001IF (2 μg/ml)
OtherGelRedBiotium41003
OtherSytox OrangeThermo Fisher ScientificS11368

Preparation of recombinant condensin I complexes

Request a detailed protocol

DNA constructs for expressing condensin I subunits in insect cells were described previously (Kinoshita et al., 2022). Among them, a special note on the hCAP-H sequence is placed here because multiple cDNA sequences encoding different isoforms of hCAP-H with different lengths have been deposited in the database. Among them, the longest annotated polypeptide of hCAP-H is 741 amino-acid long (NP_056156.2). For historical reasons, our laboratory has been using a sequence of 730 amino-acid long as our reference sequence, whose translation starts at the second methionine of NP_056156.2 (Onn et al., 2007; Kinoshita et al., 2015; Kinoshita et al., 2022). The sequence corresponding to the first 11 amino acids of NP_056156.2 is completely missing in the ortholog of Xenopus laevis, and is not conserved in the ortholog of Mus musculus (in the latter case, the corresponding sequence is 8 amino-acid long rather than 11 amino-acid long). It is therefore very unlikely that the polypeptide of 730 amino-acid long used in the current study behaves differently from that of 741 amino-acid long. For this reason, the sequence of 730 amino-acid long is used as a ‘full-length’ hCAP-H in the current study. The recombinant expression vector containing mSMC2 and mSMC4 cDNAs was described previously (Kinoshita et al., 2015). The cDNA sequences for hCAP-D2, -G, and -H codon optimized for the cabbage looper Trichoplusia ni were synthesized (GeneArt Gene Synthesis Service) and cloned into the pFastBac1 vector (Thermo Fisher Scientific). Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows: forward 5′-GAACGACTTCTCTACCGACTCTCCC-3′, reverse 5′-GTAGAGAAGTCGTTCTGAGGGAAGTC-3′. Full-length and N-terminally deleted versions of HaloTag-hCAP-H vectors were constructed by fusing the 3′ ends of the corresponding cDNAs with a HaloTag fragment using In-fusion HD Cloning Kit (TaKaRa). The following primers were used for the construction of these HaloTag-hCAP-H vectors: hCAP-H (WT and dN) forward 5′-GAAGCGCGCGGAATTCGCCA-3′, hCAP-H (WT) reverse 5′-GAAGTACAGGTCCTCAGTGGTAGGTTCCAGGTCGCCCTGCCTAACTAA-3′, hCAP-H (dN) reverse 5′-GAAGTACAGGTCCTCAGTGGTAGGTTCCAGGTCGCCCTGCCTGACTAA-3′, HaloTag forward 5′-GAGGACCTGTACTTCCAGTCTGACAACGACATGGCCGAAATCGGAACT-3′ HaloTag reverse 5′-AGCGGCCGCGACTAGTTTATCCGCTGATTTCCAGGGTA-3′.

Note that the HaloTag was fused to the C-terminus of CAP-H in the current study because we wanted to investigate the effect of the N-terminal deletion of CAP-H. We used N-terminally HaloTagged CAP-H constructs in our previous study (Kinoshita et al., 2022). DH10Bac (Thermo Fisher Scientific) was transformed with the plasmid vectors to produce bacmid DNAs, with which Sf9 cells were transfected to generate the corresponding baculoviruses. To produce recombinant condensin I complexes, High Five cells (Thermo Fisher Scientific) were infected with the baculoviruses carrying the condensin I subunits, and the resultant complexes were purified from cell lysates by two-step column chromatography as described previously (Kinoshita et al., 2022).

Antibodies

Primary antibodies used in the present study were as follows: anti-XSMC4 (in-house identifier AfR8L, affinity-purified rabbit antibody), anti-XSMC2 (AfR9-6 for immunodepletion and immunoblotting, biotin-labeled AfR9 for immunofluorescence, affinity-purified rabbit antibody), anti-XCAP-D2 (AfR16L, affinity-purified rabbit antibody), anti-XCAP-G (AfR11-3L, affinity-purified rabbit antibody), anti-XCAP-H (AfR18, affinity-purified rabbit antibody; Hirano and Mitchison, 1994; Hirano et al., 1997), anti-XCAP-D3 (AfR196-2L, affinity-purified rabbit antibody; Ono et al., 2003), anti-mSMC4 (AfR326-3L, affinity-purified rabbit antibody), anti-mSMC2 (AfR329-4L, affinity-purified rabbit antibody; Lee et al., 2011), anti-hCAP-D2 (AfR51-3, affinity-purified rabbit antibody), anti-hCAP-G (AfR55-4, affinity-purified rabbit antibody), anti-hCAP-H (AfR57-4, affinity-purified rabbit antibody; Kimura et al., 2001), and anti-XTopo IIα (αC1-6, rabbit antiserum; Hirano and Mitchison, 1993). Two custom phospho-specific antibodies against hCAP-H (AfR464-3P and AfR470-3P, affinity-purified rabbit antibodies) were raised against the phosphopeptides hHP1 ([C]PHSASpSPSERV) and hHP2 ([C]PRLLApSPSSRS), respectively (SIGMA Genosys), where cysteines (C) were added for chemical conjugation. The phosphoserines in hHP1 and hHP2 corresponded to pS17 and pS76 in the 730 amino-acid long isoform, respectively, and to pS28 and pS87 in the 741 amino-acid long isoform, respectively (see above for the explanation of the isotypes with different lengths). The epitopes recognized by anti-hHP1 and anti-hHP2 were detectable on holo(WT), but not on holo(H-N19A), that had been preincubated with Δcond M-HSS (Figure 2—figure supplement 1B). Each epitope was sensitive to phosphatase treatment (Figure 2—figure supplement 1C), and competed with its own phosphopeptide but not with others (Figure 2—figure supplement 1D). Three phospho-specific antibodies against hCAP-D2 (AfR173-4P, AfR175-4P, and AfR177-4P, affinity-purified rabbit antibodies) were raised against the phosphopeptides hDP1 ([C]DNDFVpTPEPRR), hDP2 ([C]MTEDEpTPKKTT), and hDP3 ([C]TPKKTpTPILRA), respectively, and purified according to the procedure described previously (Kimura et al., 1998). The phosphothreonines in hDP1, hDP2, and hDP3 corresponded to pT1339, pT1384, and pT1389, respectively (Figure 2—figure supplement 1A). Secondary antibodies used in the present study were as follows: Alexa Fluor 568-conjugated anti-rabbit IgG (A11036 [RRID: AB_10563566], Thermo Fisher Scientific), Alexa Fluor 488-conjugated streptavidin (S11223, Thermo Fisher Scientific), and horseradish peroxidase-conjugated anti-rabbit IgG (PI-1000 [RRID: AB_2336198], Vector Laboratories).

Animals

Female X. laevis frogs (RRID:NXR_0031, Hamamatsu Seibutsu-Kyozai) were used to lay eggs to harvest Xenopus egg extract (Hirano et al., 1997). Frogs were used in compliance with the institutional regulations of the RIKEN Wako Campus. Mice (BALB/c × C57BL/6JF1) for sperm nuclei (Shintomi et al., 2017) were used in compliance with protocols approved by the Animal Care and Use Committee of the University of Tokyo (for M. Ohsugi who provided mouse sperm).

Preparation of Xenopus egg extracts

Request a detailed protocol

The high-speed supernatant of metaphase-arrested Xenopus egg extracts (M-HSS) was prepared as described previously (Shintomi and Hirano, 2018). For the preparation of interphase HSS (I-HSS), a low-speed supernatant (LSS) of metaphase-arrested extracts was supplemented with CaCl2 and cycloheximide at final concentrations of 0.4 mM and 100 μg/ml, respectively (Losada et al., 2002). After incubation at 22°C for 30 min, the interphase LSS was further fractionated by centrifugation at 50,000 rpm at 4°C for 90 min to yield I-HSS.

Immunodepletion, add-back assay and immunofluorescence

Request a detailed protocol

Immunodepletion of endogenous Xenopus condensins I and II from the extracts was performed using Dynabeads Protein A (10002D, Thermo Fisher Scientific) as described previously (Δcond) (Kinoshita et al., 2022). The efficiency of immunodepletion was checked every time by immunoblotting. An example of immunodepletion from M-HSS is shown in Figure 1—figure supplement 1C. We also confirmed that a similar efficiency of immunodepletion was achieved from I-HSS. Add-back assays using mouse sperm nuclei were performed as described previously (Kinoshita et al., 2022). After incubation at 22°C, aliquots of the reaction mixtures were taken at indicated time points and fixed by adding 10 volumes of KMH (20 mM HEPES-KOH [pH 7.7], 100 mM KCl, and 2.5 mM MgCl2) containing 4% formaldehyde and 0.1% Triton X-100 at 22°C for 15 min. The fixed chromatin was sedimented onto a coverslip through 5 ml cushion of XBE2 (10 mM HEPES-KOH [pH 7.7], 100 mM KCl, 2 mM MgCl2, 0.1 mM CaCl2, 5 mM EGTA, and 50 mM sucrose) containing 30% glycerol by centrifugation at 5000 rpm for 10 min. For immunofluorescence, the coverslips were blocked with TBS-Tx containing 1% bovine serum albumin (BSA) for 30 min and then incubated with primary antibodies for 60 min. After being washed three times with TBS-Tx, the coverslips were incubated with secondary antibodies for 60 min. After DNA was stained with DAPI, they were mounted with VectaShield mounting medium (H-1000, Vector Laboratories) onto slides and then observed under an Olympus BX63 fluorescent microscope equipped with a UPlanSApo ×100/1.40 NA oil immersion lens and an ORCA-Flash 4.0 digital complementary metal oxide semiconductor camera C11440 (Hamamatsu Photonics). The fluorescent images were acquired using CellSens Dimension software (Olympus).

Quantitative analyses of immunofluorescent images and statistics

Request a detailed protocol

Immunofluorescent images acquired by microscopic observation were quantified using ImageJ software (https://imagej.nih.gov/ij). Line profiles of mitotic chromosomes were scanned according to the procedure described previously (Kinoshita et al., 2022). For quantification of recombinant condensin I complexes on chromatin, the DAPI- and mSMC4-positive signals from the images were segmented using the threshold function and the integrated densities and the areas were measured. The mSMC4 intensities were divided by the DAPI-positive areas to assess the accumulation of condensin complexes on chromosome clusters. The total number of chromosome cluster images counted for statistical analysis in each experiment is described in the appropriate figure legends. The data were handled with Excel software (Microsoft), and the graphs were drawn using GraphPad Prism software (version 8, GraphPad Software). Tukey’s multiple comparison test after obtaining a significant difference with one-way analysis of variance (ANOVA) (Figure 2B, E, and Figure 1—figure supplement 2C) or two-way ANOVA (Figures 1C and 3D, and Figure 3—figure supplement 1B).

Immunoblotting

Request a detailed protocol

Denatured protein samples were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred onto a nitrocellulose membrane (Cytiva). The membrane was blocked with 5% skim milk in TBS-Tw (20 mM Tris–HCl [pH 7.5], 150 mM NaCl, and 0.05% Tween 20) for 30 min and incubated with primary antibodies diluted with 1% BSA in TBS-Tw for 1 hr. After being washed three times with TBS-Tw, the membrane was incubated with a peroxidase-conjugated secondary antibody diluted with TBS-Tw for 1 hr. After being washed three times with TBS-Tw, the membrane was treated with a chemiluminescence substrate for peroxidase (WBKLS500, Merck). The chemiluminescent image was acquired using an image analyzer (Amersham Imager 680, Cytiva).

Detection of phosphoepitopes in Xenopus egg extracts

Request a detailed protocol

For immunoprecipitation, rProtein A Sepharose (rPAS, Cytiva) was equilibrated with TBS. 5 μl of rPAS were coupled with 5 μg anti-hCAP-G antibody at 4°C for 2 hr with rotation and then washed three times with KMH. Holo(WT) or holo(H-N19A) was added to Δcond M-HSS or I-HSS at a final concentration of 35 nM, along with 1/50 vol of 50× energy mix (50 mM Mg-ATP, 500 mM phosphocreatine, and 2.5 mg/ml creatine kinase [pH 7.5]) and incubated at 22°C for 150 min. The final reaction volume was 15 μl. The reaction mixtures were immunoprecipitated with the anti-hCAP-G antibody-coupled rPAS on ice for 30 min. The beads were washed with 150 μl KMH containing 20 mM β-glycerophosphate and 0.1% Triton X-100, and then centrifuged (7000 rpm) at 4°C for 1 min. The recovered beads were further washed three times with 200 μl of KMH containing 20 mM β-glycerophosphate and 0.1% Triton X-100, followed by two repeated washes with 200 μl of KMH containing 20 mM β-glycerophosphate. The immunoprecipitants were analyzed by immunoblotting. For dephosphorylation, the immunoprecipitants bound to the beads were washed with 200 μl of KMH containing 20 mM β-glycerophosphate and 0.1% Triton X-100, and then washed twice with 200 μl of KMH. The washed beads were incubated with 10 μl of dephosphorylation buffer (1× NEB buffer for PMP supplemented with 1 mM MnCl2) with or without 100U λProtein Phosphatase (P0753S, λPPase) (New England Biolabs). A cocktail of phosphatase inhibitors (50 mM NaF, 10 mM Na3VO4, and 50 mM EDTA at final concentrations) was added to one of the reaction mixtures containing λPPase. The reaction mixtures were incubated at 30°C for 30 min and analyzed by immunoblotting. For the peptide competition assay, a primary antibody solution containing AfR464-3P or AfR470-3P (20 μg/ml) was preincubated with or without phosphopeptides (hHP1 or hHP2 at a final concentration of 100 μg/ml) at room temperature for 60 min in 50 μl of TBS. The mixtures were then diluted 20 times with TBS-Tw containing 1% BSA and used for probing immunoblots.

Topological loading assay

Request a detailed protocol

A topological loading assay was performed according to the procedure described by Murayama and Uhlmann, 2014 with minor modifications. Nicked circular DNA and linearized DNA were used as DNA substrates in this assay. To prepare the nicked circular DNA, negatively supercoiled plasmid DNA (pUC19) purified from Escherichia coli cells using Nucleobond PC100 (MACHERREY-NAGEL GmbH & Co KG) was treated with the nicking enzyme Nt.BspQI (R0644S, New England Biolabs). The linearized DNA was prepared by digesting the negatively supercoiled DNA with Eco RI (1040A, TaKaRa Bio). The treated DNAs were extracted with phenol/chloroform/isoamyl alcohol (25:24:1) and then purified by ethanol precipitation. For condensin I loading assay, 2 pmol of holo(WT) or holo(H-dN) and 90 ng of nicked or linearized DNA were mixed in reaction buffer (35 mM Tris–HCl [pH 7.5], 1 mM Tris-(2-carboxyethyl)phosphine (TCEP), 50 mM NaCl, 7 mM MgCl2, 0.003% Tween 20, and 15% glycerol) and then supplemented with ATP or AMP-PNP (NU-407, Jena Bioscience) at a final concentration of 2 mM. The final reaction volume was 15 μl. The mixture was incubated at 32°C for 1 hr. Note that the final concentration of NaCl in the loading reaction was 77 mM because of carry-over from the storage buffer of purified condensin I. The loading reaction was terminated by adding 85 μl of IP buffer (35 mM Tris–HCl [pH 7.5], 0.5 mM TCEP, 500 mM NaCl, 10 mM EDTA, 5% glycerol, and 0.35% Triton X-100). Condensin I–DNA complexes were then immunoprecipitated with 10 μl of Dynabeads protein A (10002D, Thermo Fisher Scientific) that had been pre-coupled with 2.5 μg of affinity-purified anti-hCAP-G. The beads were washed three times with 750 μl of Wash Buffer-I (35 mM Tris–HCl [pH 7.5], 0.5 mM TCEP, 750 mM NaCl, 10 mM EDTA, and 0.35% Triton X-100), and then once with 500 μl of Wash Buffer-II (35 mM Tris–HCl [pH 7.5], 0.5 mM TCEP, 100 mM NaCl, and 0.1% Triton X-100). To check the efficiency of immunoprecipitation, protein samples were retrieved from a one-tenth volume of the beads and analyzed by immunoblotting. The remaining beads were treated with 15 μl of deproteinization solution (10 mM Tris–HCl [pH 7.5], 1 mM EDTA, 50 mM NaCl, 0.75% SDS, and 1 mg/ml proteinase K) and incubated at 50°C for 20 min. The recovered DNAs were electrophoresed on a 1% agarose gel in Tris-acetate EDTA (TAE) buffer, and stained with GelRed (Biotium). The fluorescent images were acquired using an image analyzer (Amersham Imager 680, Cytiva). The signal intensities of nicked circular DNAs recovered by holo(WT) and holo(H-dN) were quantified using ImageJ software. Three independent experiments were performed and assessed by Tukey’s multiple comparison test after obtaining a significant difference with two-way ANOVA.

Loop extrusion assay

Request a detailed protocol

The HaloTag holocomplexes were labeled with HaloTag Alexa Fluor 488 Ligand (Promega) at room temperature for 30 min. The labeled complexes were applied onto a PD-10 column (Cytiva) to remove unbound fluorescent ligands. A loop extrusion assay was performed as described previously (Sakata et al., 2021; Kinoshita et al., 2022). In brief, coverslips were coated with 1 mg/ml streptavidin in ELB++ (10 mM HEPES–KOH [pH 7.7], 50 mM KCl, 2.5 mM MgCl2, and 1 mg/ml BSA) for 30 min. After assembling microfluidic flow cells that can switch the flow direction, they were incubated with ELB++ for 30 min, and then washed with T20 buffer (40 mM Tris–HCl [pH 7.5], 20 mM NaCl, and 0.2 mM EDTA). Biotin-labeled λ DNA in T20 buffer was attached to the coverslips for 5 min, and then unbound DNA was washed off with imaging buffer (50 mM Tris–HCl [pH 7.5], 50 mM NaCl, 5 mM MgCl2, 3 mM ATP, and 1 mM DTT). The flow direction was switched, and the flow cells were washed with the same buffer for another 10 min. Then, 1 nM condensin in the imaging buffer was introduced into the flow cells at 20 μl/min for 1.5 min, and washed off with the same buffer at 20 μl/min. For visualization of Sytox Orange (22 nM)-stained DNA and Alexa 488-labeled condensin, 488 and 561 nm lasers were used, respectively. Images were taken every 5 s for 20 min after introducing condensin. The images were analyzed using the ImageJ software. To determine the loop size, the fluorescence intensity of looped DNA was divided by that of the entire DNA molecule for each image, and multiplied by the length of the entire DNA molecule (48.5 kb). The loop rate was obtained by averaging the increase in looped DNA size per second. The loop duration was calculated by measuring the time from the start of DNA loop formation until the DNA loop became unidentifiable. The data in Figure 4F-H were statistically analyzed by a two-tailed Mann–Whitney U-test.

Materials availability

Request a detailed protocol

All unique/stable reagents generated in this study are available from the corresponding author.

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files.

References

Decision letter

  1. Adèle L Marston
    Reviewing Editor; University of Edinburgh, United Kingdom
  2. Jessica K Tyler
    Senior Editor; Weill Cornell Medicine, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

https://doi.org/10.7554/eLife.84694.sa1

Author response

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Comments

The work described in this manuscript starts with an in-silico analysis of the primary amino-acid sequence of CAP-H proteins that reveals the presence in vertebrate orthologs of an N-terminal extension of ~80 amino acids in length which contains 19 serine or threonine residues and also, in its centre, a stretch of conserved basic amino acids predicted to form a helix. These features suggest a regulatory module. Using Xenopus egg extracts depleted of endogenous condensins and supplemented with recombinant condensin I holocomplexes, either wildtype or mutants, the authors show that deleting the N-terminal tail of CAP-H, or just the central helix (CH), increases the association condensin I with chromatin in mitotic egg extracts and accelerates the formation of mitotic chromosomes. Interestingly, they also show that deleting the N-tail enables a substantial amount of condensin I to associate with chromatin in interphase extracts and to form chromosome-like structures, while WT condensin I cannot. Using in vitro assays and naked DNA as substrate, the authors further show that removing the N-terminal tail of CAP-H improves both the topological (salt-resistant) association of condensin I with DNA and it loop extrusion activity. These experiments appear to me as are clear and robust. They convincingly reveal that N-tail of human CAP-H hinders the binding of condensin I to DNA and both its loop-extrusion and chromosome-shaping activities. However, the mechanism through which such hindrance is achieved remains elusive (see major comments 1-3).

A complementary part of the work tackles the important question of the cell cycle control of such counteracting effect. Using newly-designed antibodies against two phospho-serine residues within the tail, the authors provide evidence that the tail is phosphorylated in mitosis-specific manner. This points towards phosphorylation as a biological mean to modulate the effect of the tail on condensin's binding during the cell cycle. In support to this idea, using non-phosphorylatable or phosphomimic substitutions of all the serine and threonine residues within the tail (n=19), including one substitution within the CH domain (Ser 70), the authors show that nonphosphorylatable mutations (H-N19A) or phosphomimic mutations (H-N19D) respectively reduce or improve condensin I binding to chromatin in mitotic egg extracts. This suggests that the phosphorylation of the N-terminal tail in mitosis might relieve its negative effect on condensin I binding to chromatin. The weaknesses I see in this part of the study concern (1) the validation of the phospho-antibodies, which appears to me as insufficiently described (major comment 4), (2) the possibility the bulk changes in amino acids (n=19 out of 80) could impact the folding of the central helix (minor comment X) and (3) that some substitutions could impact the binding of condensin I by different mechanisms (minor comment X).

Major comments:

1. On the model. The authors propose that the N-tail could stabilise an interaction between the N-terminal part of CAP-H and SMC2's neck, which would restrain the transient opening of a DNA entry gate within the ring, necessary for the topological engagement of DNA and loop formation. Although the model is sound, I see no direct data that support it in the manuscript. Such model predicts that a CAP-H protein containing or not the N-terminal tail (or the central helix) should exhibit different binding strengths to SMC2 in vitro. It seems to me that the authors could easily test this prediction using the recombinant proteins they produced in the context of this study.

We thank the reviewer for pointing out this important issue. To test whether the CAP-H N-tail indeed contributes to the stabilization of the SMC2-kleisin gate, we set up a highly sophisticated functional assay described by Hassler et al. (2019). The authors used this assay to demonstrate that an N-terminal fragment of kleisin (engineered to be cleaved by TEV protease) is released from the rest of the condensin complex in an ATPdependent (i.e., head-head engagement-dependent) manner. We reasoned that this assay is most powerful to prove our hypothesis in a mechanistically relevant context. We envisioned that the CAP-H fragment lacking its N-tail can readily be released whereas the CAP-H fragment retaining its N-tail is more difficult to be released (because of the postulated stabilization of the SMC2-CAP-H interaction). Despite substantial efforts in making TEV-cleavable constructs and in testing various releasing conditions, we have not been able to recapitulate the ATP-dependent release even with the holo(H-dN) construct. Thus, unfortunately, this trial enabled us to neither prove nor disprove our hypothesis.

We are fully aware that the full reconstitution of ATP-dependent and phosphorylation-stimulated gate-opening reaction in vitro is a very important direction in the future. It is beyond the scope of the current study, however.

2. On ATP-hydrolysis. Given the importance of ATP hydrolysis for the engagement of condensin into a topological mode of association with DNA and for its loop extrusion activity, I suggest that the authors measure the impact of the N-tail and of the CH domain on the rate of ATP hydrolysis by condensin I holocomplexes. I suppose that it can be relatively easily done (PMID: 9288743) using the recombinant WT and mutant versions they purified in the course of this study.

We appreciate this constructive comment. In fact, we did a preliminary experiment and found that ATPase activities (either in the absence or presence of DNA) were not significantly different between holo(WT) and holo(H-dN). We were not surprised with this result because our previous study on condensin II indicated that enhanced ATP hydrolysis by a class of mutant complexes is not directly coupled to their enhanced association with chromosomes (Yoshida et al., 2022, eLife). We consider that other functional assays, such as the topological loading assay and the loop extrusion assay shown in the current manuscript, are more informative assays to address ATP-dependent activities of the condensin complexes.

3. A conundrum with previous work? In Kimura et al. Science 1998 (PMID: 9774278), the lab of Tatsuya Hirano has shown that Xenopus condensin I purified from mitotic egg extracts induces the supercoiling of plasmid DNA in vitro, but fails to do so when it is purified from interphase egg extracts. This echoes the inhibitory effect of the N-tail of the topological binding of condensin I described in the current manuscript. However, using a gel shift assay, Kimura et al. 1998 also provide evidence that interphase and mitotic condensin I bind plasmid DNA in vitro with similar efficiencies. At first sight, this prior observation seems to contradict the idea that the N-tail of CAP-H restrains DNA binding unless it is phosphorylated in mitosis. Is it possible that the in vitro binding assays used in Kimura et al. 1998 and in this work might assess different modes of binding? I suggest that this apparent conundrum should to be discussed.

We thank the reviewer for following our early studies. As discussed below, we are confident that our conclusion reported in the current study by no means contradicts our previous observations.

We reason that the confusion expressed by the reviewer stems from intrinsic, technical limitations of the gel-shift assay. Such limitations become apparent especially when it is applied to the functional analyses of complicated protein machines such as condensins. For instance, the DNA-binding activity of condensin I detected by the gel-shift assay is neither ATP-dependent nor phosphorylation-dependent (Kimura and Hirano, 1997; Kimura et al., 1998). It is fundamentally different from the ATP-dependent activities detected by the topological loading and loop extrusion assays reported in the current study (It remains unknown whether the two activities are stimulated by mitotic phosphorylation). Thus, the DNA-binding activity detected by the gel-shift assay does not reflect “productive” DNA interactions that depend on ATP hydrolysis in vitro. We therefore consider that gel-shift analyses of holo(WT) and holo(H-dN) would not produce any useful information.

Related to that, could it be possible for the authors to assess the impact of the N-tail on the salt-sensitive binding of condensin to DNA, i.e. by reproducing the topological binding assay but omitting the high salt washes? I guess this information could be useful to fully apprehend the impact of the N-tail on the binding of condensin.

When we set up the topological loading assay, we actually tested a low-salt wash condition that the reviewer suggests here. Although a much higher level of DNA recovery was observed with the low-salt condition than with the high-salt wash condition, no nucleotide dependency was detectable with the low-salt condition. Moreover, no difference in DNA recovery between holo(WT) and holo(H-dN) was observed. Thus, the low-salt condition allowed us to detect the “bulk” DNA-binding activity that is equivalent to that detected by the gel-shift assay. These results were fully consistent with the discussion above.

4. Validation of phospho-antibodies and by extension showing the phosphorylation of the tail. The newly-designed phospho-serine antibodies used in this study to show that the N-tail is phosphorylated at serine 17 and serine 76 in mitosis (Figure 2-figure supplement 1) are, in my view, not characterized enough. This piece of data is key to substantiate the idea that the tail is phosphorylated in mitosis. Yet, showing that these antibodies detect epitopes on WT condensin I from mitotic egg extracts but not on the H-N19A counterpart, nor on WT condensin I from interphase extracts, does not demonstrate the phospho-specificity of such antibodies. I suggest that a PPase treatment should be conducted to assess the phospho-specificity of these antibodies. Moreover, since the lab of Tatsuya Hirano has the know-how to deplete Cdc2/CDK1 from Xenopus egg extract, such strategy could/should be used to further validate the antibodies and assess to which extent the Ntail is phosphorylated in a Cdc2-dependent manner.

We have performed two sets of experiments to confirm the specificity of the phosphoepitopes recognized by anti-hHP1 and anti-hHP2. In the first set, we performed a phosphatase treatment assay. Holo(WT) that had been preincubated with Δcond M-HSS was immunoprecipitated using an antibody against hCAP-G, treated with λ protein phosphatase in the presence or absence of phosphatase inhibitors, and analyzed by immunoblotting using anti-hHP1 and anti-hHP2. The results (now shown in Figure 2-figure supplement 1C) demonstrated that the epitopes recognized by anti-hHP1 and anti-hHP2 are sensitive to phosphatase treatment. In the second set, we performed a phosphopeptide competition assay. Holo(WT) that had been preincubated with Δcond M-HSS was immunoprecipitated and subjected to immunoblotting. The membranes were triplicated and probed with anti-hHP1 in the presence of no competing peptide, hHP1 or hHP2. Similarly, another set of triplicated membranes was probed with anti-hHP2 in the presence of no competing peptide, hHP1 or hHP2. We found that the signal recognized by anti-hHP1 competed with hHP1, but not with hHP2, and that the signal recognized by anti-hHP2 competed with hHP2, but not with hHP1. The results (now shown in Figure 2-figure supplement 1D) demonstrated the sequence specificity of the phosphoepitopes recognized by the two antibodies. The procedures for these experiments have been described in Materials and methods.

Because Cdk1 depletion from M-HSS creates an HSS equivalent to I-HSS, we do not consider that the suggested experiment will provide additional information.

Minor comments:

1. The impact of the 19 mutations, A or D, introduced within the tail on the folding of the central helix? The idea that the negative effect of the N-tail is relieved by phosphorylation is based on the chromatin binding phenotypes exhibited by the H-N19D or H-N19A mutant holocomplexes, in which 19 amino-acids out of 80 have been modified, include one in the central helix. The authors also provide evidence that the central helix (CH) located within the tail plays a key role in the negative regulation of condensin I binding. Thus, I wonder to which extent the folding of the central helix could be impacted by the mutations introduced in the tail and notably the one within the central helix itself. Could the author assess the structure of mutated tails using Alphofold and/or discuss this point?

According to the reviewer’s suggestion, we performed structure predictions using Alphafold2, and found that neither the N19A nor N19D mutations alter the original prediction of helix formation that was made for the wild-type CH sequence. A conventional secondary structure prediction using Jpred4 reached the same conclusion.

2. Phosphorylation of serine 70 in the central helix by Aurora-B kinase? A prior study by Tada et al. (PMID: 21633354) has shown (1) that serine 70 of the N-tail of hCAP-H is phosphorylated by Aurora-B kinase, (2) that the mutation S70A reduces the binding of condensin I to chromatin in HeLa cells and (3) that hCAP-H interacts with histone H2A in an Aurora-B dependent manner. This draws a picture in which the phosphorylation of Ser70 by Aurora-B would improve condensin I binding to chromatin by promoting an interaction between hCAP-H and histone H2A/nucleosomes.

Intriguingly, Ser 70 in Tada et al. correspond to the serine residue located within the conserved central helix analysed in this study, and this Ser70 residue is mutated in the H-N19D or H-N19A holocomplexes that show reduced chromatin binding in this study. This raises the question as what could be the contribution of the S70A or S70D substitution to the chromatin binding phenotypes shown by the H-N19D or H-N19A holocomplexes. This is not discussed in the manuscript, and the authors do not cite this earlier work (PMID: 21633354) in their manuscript. Is there any reason for that? I suggest it should be cited and discussed.

We thank the reviewer for bringing up this issue. In many respects, we do not trust the data reported by Tada et al. (2011) and the resultant model they proposed. Previous and emerging lines of evidence reported from our own and other laboratories indicate that histones compete with condensins for DNA binding, strongly arguing against the possibility that histone H2A acts as a “chromatin receptor” for condensins. We formally discussed and criticized the Tada 2011 model in our previous publications, which included Shintomi et al. (2015) NCB, Shintomi et al. (2017) Science, Hirano (2016) Cell and Kinoshita/Hirano (2017) COCB. We thought that those were enough. That said, we also consider that the reviewer is right. The current study demonstrates that the deletion of the CAP-H N-tail accelerates, rather than decelerates, condensin I loading, providing an additional line of evidence that argues against the Tada model. A critical comparison between the Tada 2011 model and our current model would benefit the readers. In the revised manuscript, we have added the following discussion:

“In terms of the regulatory role of the CAP-H N-tail, it would be worthy to discuss the model previously proposed by Tada et al. (2011). According to their model, aurora B-mediated phosphorylation of the CAP-H N-tail allows its direct interaction with the histone H2A N-tail, which in turn triggers condensin I loading onto chromatin. Accumulating lines of evidence, however, strongly argue against this model: (i) aurora B is not essential for single chromatid assembly in Xenopus egg extracts (MacCallum et al., 2002) or in a reconstitution assay (Shintomi et al., 2015); (ii) the H2A N-tail is dispensable for condensin I-dependent chromatid assembly in the reconstitution assay (Shintomi et al., 2015); (iii) even whole nucleosomes are not essential for condensin I-mediated assembly of chromatid-like structures (Shintomi et al., 2017). The current study demonstrates that the deletion of the CAP-H N-tail accelerates, rather than decelerates, condensin I loading, providing an additional piece of evidence against the model proposed by Tada et al. (2011).”

3. Other minor comments

– Please provide a microscope image of DNA loop in Figure 4D.

In the revised manuscript, we have provided a set of time-lapse images of loop extrusion events catalyzed by holo(WT) and holo(H-dN) in Figure 4E.

– The authors do not compare the kleisin of condensin I with the one of condensin II with respect to the features tackled in this work. Given the different behaviours condensin I and II, such comparison could be informative for the readers.

We thank the reviewer for this constructive comment. In the revised manuscript, we have added the following statement:

“It should also be added that CAP-H2, the kleisin subunit of condensin II, lacks the N-terminal extension that corresponds to the CAP-H N-tail. Thus, the negative regulation by the kleisin N-tail reported here is not shared by condensin II.”

– The authors do not reference the work of Robellet et al. Genes & Dev (2015) (PMID: 25691469) on the regulation of condensin binding in budding yeast by an SMC4 phospho-tail. I suggest that the analogy should be discussed.

According to the reviewer’s comment, we have added the following statements at the beginning of Discussion.

“Previous studies showed that mitotic phosphorylation of Cut3/SMC4 regulates the nuclear import of condensin in fission yeast (Sutani et al. 1999) and that phosphorylation of Smc4/SMC4 slows down the dynamic turnover of condensin on mitotic chromosomes in budding yeast (Robellet et al. 2015; Thadani et al. 2018). In the current study, we have focused on the phosphoregulation of vertebrate condensin I by its kleisin subunit CAP-H.”

– In the introduction section, lane 5, the sentence "Many if not all eukaryotic species have two different condensin complexes" appears inappropriate since budding and fission yeast cells possess a single condensin complexes, similar to condensin I in term of primary amino-acid sequence.

We thought that the original wording “Many if not all” was good enough to imply that some species, which include budding yeast and fission yeast, have only a single condensin complex. To make it clear, however, we have modified the sentence in the revised manuscript as follows:

“Many eukaryotic species have two different condensin complexes although some species including fungi have only condensin I.”

– page 4; typo: motif I and V bind to the SMC neck and the SMC4 cap regions, respectively. Should read SMC2 neck.

The reviewer is right. It should read the SMC2 neck. Corrected.

– Are the data and the methods presented in such a way that they can be reproduced?

Yes

– Are the experiments adequately replicated and statistical analysis adequate?

Yes

– Are prior studies referenced appropriately? Not all of them (see above) – Are the text and figures clear and accurate?

Yes

Cross-consultation comments

I consider the comments from all reviewers as helpful for the authors.

Reviewer #1 (Significance (Required)):

Summary

Condensins are genome organisers of the family of SMC ATPase complexes and are best characterized as the drivers of mitotic chromosome assembly (condensation). It is acknowledged that condensins shape mitotic chromosomes by massively associating with DNA upon mitotic entry (loading step) and by folding chromatin fibres into arrays of loops, most likely through an ATP-dependent extrusion of DNA into loops, as seen in vitro. What remains unclear, however, are the mechanisms by which condensins load onto DNA and fold it into arrays of loops in vivo, and how these reactions are coupled with the cell cycle, i.e. restricted mostly to mitosis. Condensins are ring shaped pentamers that change conformation upon ATP-hydrolysis. in vitro studies suggest that condensins bind DNA via ATP-hydrolysis-independent, direct electrostatic contacts between condensin subunits and DNA. Such electrostatic contacts are salt-sensitive in in-vitro assays. Upon ATP-hydrolysis, condensins engage into an additional mode of binding that is resistant to high salt concentration and likely to be topological in nature. Both modes of association are necessary to form DNA loops. Vertebrates possess two types of condensin complexes, condensin I and II, each composed of a same SMC2-SMC4 ATPase core but associated with two different sets of three non-SMC subunits; a kleisin and two HEAT-repeat proteins. Condensin II is nuclear during interphase and stably binds chromatin upon mitotic entry, while condensin I is located in the cytoplasm during interphase and binds chromatin in a dynamic manner upon nuclear envelope breakdown. How the spatiotemporal control of condensin I and II is achieved remains poorly understood. Previous studies have shown that the phosphorylation of condensin I by mitotic kinases, such as CDK1, Aurora-B and Polo, play a positive role in its binding to chromatin and/or its functioning, but the underlying mechanisms remain to be characterised. In this manuscript, Shoji Tane and colleagues provide good evidence that the N-terminal tail of the human kleisin subunit of condensin I, hCAP-H, serves as a regulatory module for the cell-cycle control of condensin I binding to chromatin and chromosome shaping activity. The authors clearly show that the N-tail of CAP-H hinders the binding of condensin I to chromatin in Xenopus egg extracts and, using in vitro assays, that the N-tail also hinders the topological association of condensin I with DNA and its loop extrusion activity. The authors provide additional data suggesting that the phosphorylation of the N-tail of CAP-H, in mitosis, relieves its inhibitory effect on condensin I binding. Based on their findings, Tane et al. propose a model suggesting that the N-terminal tail of CAP-H constitutes a gate keeper that maintains condensinrings in a closed conformation that is unfavourable for topological binding to DNA, and whose locking effect is relieved in mitosis by phosphorylation.

Taken as a whole, this work has the potential to reveal a molecular basis for the cell cycle regulation of condensin I in vertebrate cells and as such to significantly improve our understanding of the integrated functioning condensin I. The characterisation of the inhibitory effect of the N-tail on condensin binding to chromatin and to naked DNA in vitro is well described, the data are clear and robust and the results convincing. On the other hand, some of the data on the phospho-regulation appear to me as are more debatable and I think that some of the results described here deserve to be discussed in the context of previous works. Finally, I see no data in the manuscript that directly supports the mechanistic model proposed by the authors, while it seems to me that such model could have been easily tested exprimentally. Thus, I suggest that Tane and colleagues should perform a couple of relatively easy experiments to strengthen their claims and that a few omitted prior studies on the topic should be referenced and discussed.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

The manuscript reveals that the N-terminal region of CAPH could play a role in regulating condensin I activity, using a range of in vitro methods. They propose that the N-terminal region of CAPH inhibits complex activity, and this is turned off upon deletion or phosphorylation, by using truncations, phospho-mimics or phospho-deficient mutations.

While the results are interesting to the field, and helps to address the question as to how condensin complexes are controlled in a cell cycle dependent manner, some key data and controls are necessary to ensure the conclusion is robust.

Main comments

What is meant by "unperturbed I-HSS" on page 7, ie membrane containing versus membrane free or condensin depleted?

We apologize for having created unnecessary confusion. We meant that the “unperturbed I-HSS” is the “undepleted I-HSS”. As far as the issue of membrane-containing vs membrane-free is concerned, we explicitly mentioned that “we used membrane-free I-HSS in the following experiments” several lines above. In the revised manuscript, we have revised the statement accordingly.

In many of the protein gels eg figure 4B, the bands for SMC2 and 4 are more intense that the non-SMC components. The method for protein purification also does not include a size exclusion step to ensure sample homogeneity. Authors should perform some sort of quality control checks on samples such as analytical gel filtration or mass photometry to ensure stoichiometry/homogeneity. This is particularly important for samples eg the N19A, where activity is reduced compared to wild-type as poor protein behaviour could create false negative results.

As the reviewer is fully aware, the reconstitution and purification of multiprotein complexes, such as condensins, is by no means an easy task. We notice that many groups in the field share common concerns about sample homogeneity and subunit stoichiometry, and that these concerns cannot completely be eliminated even after size exclusion chromatography. Because the current study handles a large number of mutant complexes, we consider that the purification by two-step column chromatography is the most practical approach. We do not notice any abnormal behaviors of holo(H-N19A) in the processes of expression and purification. It is also important to emphasize that the H-N19D mutations cause the completely opposite phenotype. Taken all together, we are confident of our current conclusions.

That said, in the revised manuscript, we have added the following statement in Results:

“Although we cannot rule out the possibility that the introduction of multiple mutations into the N-tail causes unforeseeable adverse effects on protein conformations, these results supported the idea that ….”

Loop extrusion assays in figure 4D-G shows no example data i.e. no pictures or videos of loops being formed. These should also be included.

In the revised manuscript, we have provided a set of time-lapse images of loop extrusion events catalyzed by holo(WT) and holo(H-dN) in Figure 4E.

Given the mutant holo(H-dN) has higher activity than wild-type, a negative control such as holo(H-dN) without ATP or holo(H-dN) ATPase deficient mutant should also be measured in loop extrusion assays, to ensure the activity is derived from the ATPase activity.

In the revised manuscript, we have added loop formation data for both holo(WT) and holo(H-dN) in the absence or presence of ATP (Figure 4-figure supplement 1). We are confident that both complexes support loop extrusion strictly in an ATP-dependent manner.

According to the methods, this work performs the same loop extrusion assay as described in Kinoshita et al., 2022, however, in Kinoshita et al., wild type condensin I makes loops in 30-50% of DNA molecules, where in this study the percentage is less than half that. Can the author please explain the discrepancy given the same method was used?

First of all, we wish to remind the reviewer that the holo(WT) constructs used in the two studies are not identical: CAP-H was N-terminally HaloTagged in all constructs used in Kinoshita et al. (2022), whereas the same subunit was C-terminally HaloTagged in the pair of constructs used in the current study. Because we wanted to compare the activities between the full-length CAP-H and N-terminally deleted version of CAP-H (H-dN), we reasoned that it would be inappropriate to put the HaloTag to the N-terminus of CAP-H. The difference in the constructs could explain the observed discrepancy, even if it might not be the sole reason.

The design of the constructs was accurately described in each manuscript, but the statements were not very explicit about the positions of the HaloTag. To clarify this issue, we have added the following sentences in the revised manuscript:

“Note that the HaloTag was fused to the C-terminus of CAP-H in the current study because we wanted to investigate the effect of the N-terminal deletion of CAP-H. We used N-terminally HaloTagged CAP-H constructs in our previous study (Kinoshita et al., 2022).”

In the concluding statement the author suggests "Upon mitotic entry, multisite phosphorylation of the N-tail relieves the stabilization, allowing the opening of the DNA entry gate, hence, the loading of condensin I onto chromosomes." This seems unlikely as fusion the N-terminus of the of the kleisin to the C-terminus of SMC2 is able to function for yeast (Shaltiel et al. 2022) and condensin II (Houlard et al. 2021), and equivalently in cohesin (Davidson et al. 2019).

We appreciate the reviewer’s concern. In our view, however, the issue of the “DNA entry gate” remains under debate in the SMC field (e.g., Higashi et al. [2020] Mol Cell; Taschner and Gruber [2022] bioRxiv). For instance, Shaltiel et al. (2022) demonstrated that neck-gate fusion constructs can support in vitro activities including topological loading under certain conditions, but also showed that such constructs greatly reduce the cell viability, leaving the possibility that the gate opening is required for some physiological functions.

That said, it is true that the data reported in the current manuscript do not exclude the possibility that the SMC2 neck-kleisin interface is not used as a DNA entry gate for condensin I loading. In the revised manuscript, we have added the following statement in Discussion:

"Although our model predicts that the SMC2 neck-kleisin interface is used as a DNA-entry gate, we are aware that several studies reported evidence arguing against this possibility (e.g., Houlard et al. [2021]; Shaltiel et al. [2022]). Our current data do not exclude other models."

Reviewer #2 (Significance (Required)):

This is an interesting story that reveals new insights about condensin regulation.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

This paper reveals a role of an N-terminal extension of CAP-H in the regulation of condensin-I activity in Xenopus extracts using biochemical reconstitution experiments. The authors demonstrate that a motif in the N-terminal tail that is conserved in vertebrates acts as an inhibitor of condensin I activity. Using several mutant constructs, it is shown that the inhibition by this motif is in turn counteracted by the phosphorylation of neighbouring serine and threonine residues in mitosis, presumably at least in part by Cdk. Mutants that have lost this inhibition are able to condense chromatin into chromatid-like structures more efficiently and to some degree even in interphase extracts. Moreover, one such mutant is characterized in detail by biochemical and biophysical experiments and shown to have increased capacity in salt-stable DNA loading and in DNA loop extrusion.

Major comments:

This is a beautiful and thorough study that is presented in a clear and concise manner.

The main conclusions are well justified. No additional experiments are needed to support them. Replication and statistical analysis appear adequate. The final model is however largely speculative. Recent work has indicated that loading of yeast condensin does not require gate opening. The authors may thus want to include alternative scenarios or remain more vague.

This comment is related to the last comment of Reviewer#2. See above for our response.

The H-N19A mutant has a loss of function phenotype (possibly due to folding problem caused by 19 point mutations rather than lack of phosphorylation), the authors could consider to rescue the phenotype by also including the CH motif mutations in this construct (or make an explanatory statement in the text).

We understand the reviewer’s logic here, but overlaying additional mutations into the H-N19A mutations could cause an unforeseeable effect, potentially making the interpretation of the outcome complicated.

We also wish to point out that it may be inappropriate to regard the phenotype exhibited by holo(H-N19A) as a simple loss-of-function phenotype. This is because the opposite, accelerated loading phenotype exhibited by holo(H-dN) can be regarded as a consequence of loss of negative regulation. Like holo(H-dN), the phosphomimetic mutant complex holo(H-N19D) displayed an accelerated loading phenotype, fully supporting our conclusion. In the revised manuscript, we have added the following statement in Results:

“Although we cannot rule out the possibility that the introduction of multiple mutations into the N-tail causes unforeseeable adverse effects on protein conformations, these results supported the idea that ….”

Albeit not necessary for the main conclusions, the authors could possibly significantly strengthen their study by testing for binding partners of the N-tail and the CH motif by running AlphaFold predictions against the condensin I subunits.

We appreciate this constructive comment. We attempted to predict possible interactions between SMC2 and a CAP-H fragment containing its N-tail and motif I using ColabFold (Mirdita et al., 2022, Nat. Methods). The algorism excellently predicted the proper folding of the CAP-H motif I and its interaction with the SMC2 neck. Under this condition of predictions, however, the N-tail remained largely disordered (except for the CH), and no interaction with any part of SMC2 was predicted. The same was true when the N19D mutations were introduced in the N-tail sequence. Thus, this trial did not provide much information about the potential interaction target(s) of the CAP-H N-tail.

The efficiency of depletion of condensin subunits from I-HSS extracts is not documented (in contrast to M-HSS extracts – Figure 1-figure supplement 1C). While any condensin remaining in these extracts might not be active (or interfering), the authors may want to at least comment on this in the text.

We check the efficiency of immunodepletion every time by immunoblotting and confirm that a high level of depletion is achieved from both M-HSS and I-HSS. According to the reviewer’s comment, the following statement was placed in Materials and methods:

“The efficiency of immunodepletion was checked every time by immunoblotting. An example of immunodepletion from M-HSS was shown in Figure 1-figure supplement 1C. We also confirmed that a similar efficiency of immunodepletion was achieved from I-HSS.”

The authors should include information on the quantification of chromatid morphology. Is the analysis based on chromatids taken from the same images/imaging session, from technical replicates, biological replicates?

In the revised manuscript, we have added statements on image presentation and experimental repeats in the appropriate figure legends and methods section. During the revision process, we repeated the experiments shown in Figure 1-figure supplement 2, and obtained the same results. In the revised manuscript, the original set of data has been replaced with the new set of data along with panel C (Quantification of the intensity of mSMC4 per DNA area).

Minor comment:

The colour scheme in Figure 5A is confusing. Use less colour? The orange and red colours are moreover quite similar.

According to the reviewer’s comment, we have modified Figure 5A.

Reviewer #3 (Significance (Required)):

The findings provide new insights into how condensin-I activity is restricted outside of mitosis. It was previously assumed that this regulation was (largely) due to the exclusion of condensin I from the nucleus prior to nuclear envelope breakdown. This study shows that another pathway is contributing to the regulation and implies that controlling condensin I activity is more important than previously appreciated. Whether all residual nuclear condensin I is inactivated, remains to be determined. The physiological impact of loss of autoinhibition on chromosome segregation and cell cycle progression also remains to be uncovered. The observed effects are robust and appear significant. Future research on condensin I using reconstitution will likely benefit from being able to control or eliminate the self-inhibition.

This reviewer has expertise on the biochemistry and structural biology of SMC protein complexes.

Reviewer #4 (Evidence, reproducibility and clarity (Required)):

Mitotic chromosome formation is a cell cycle-regulated process that is crucial for eukaryotic genome stability. The chromosomal condensin complex promotes chromosome condensation, but the temporal control over condensin function is only scantly understood. In this impressive manuscript, "Cell cycle-specific loading of condensin I is regulated by the N-terminal tail of its kleisin subunit", Tane and colleagues provide important new insight into the cell cycle-regulation of condensin. The authors identify a kleisin N-tail that acts as a negative regulator of condensin's DNA interactions. Removal of this N-tail, or its cell cycle-dependent phosphorylation, relieves inhibition and activates condensin. This is a simple, yet very important story, that advances our molecular understanding of chromosome formation. The experiments are performed to a very high technical standard and support the authors conclusions. This manuscript is highly suitable for publication in any molecular biology journal, once the authors have considered the following points.

1. Introduction. (a) The authors could better explain their own prior work (Kimura et al. 1998), which has identified the condensin XCAP-D2 and XCAP-H as the targets of phosphoregulation. The current manuscript explains the role of XCAP-H phosphorylation.

According to the reviewer’s comment, we have added the following sentence in Introductions:

“The major targets of mitotic phosphorylation identified in these studies included the CAP-D2 and CAP-H subunits.”

b) Given the limited knowledge about condensin cell cycle regulation, it seems prudent to provide a brief summary of what is known. Fission yeast Smc4 phosphorylation regulates condensin nuclear import (Sutani et al. 1999), while budding yeast Smc4 phosphorylation slows down the dynamic turnover of the condensin complex on chromosomes (Robellet et al. 2015 and Thadani et al. 2018).

We appreciate this constructive comment. According to the reviewer’s comment, we have added the following statements at the beginning of Discussion.

“Previous studies showed that mitotic phosphorylation of Cut3/SMC4 regulates the nuclear import of condensin in fission yeast (Sutani et al. 1999) and that phosphorylation of Smc4/SMC4 slows down the dynamic turnover of condensin on mitotic chromosomes in budding yeast (Robellet et al. 2015 and Thadani et al. 2018). In the current study, we have focused on the phosphoregulation of vertebrate condensin I by its kleisin subunit CAP-H.”

2. Extracts were mixed with mouse sperm nuclei. If there is a reason why mouse rather than Xenopus sperm nuclei were used, this would be interesting to know.

The original motivation for introducing mouse sperm nuclei into Xenopus egg extracts was to test the functional contribution of nucleosomes to mitotic chromosome assembly. When mouse sperm nuclei are incubated with an extract depleted of the histone chaperone Asf1, the assembly of octasomes can be suppressed almost completely. Remarkably, we found that even under this “nucleosome-depleted” condition, mitotic chromosome-like structures can be assembled in a manner dependent on condensins (Shintomi et al., 2017, Science). Xenopus sperm nuclei cannot be used in this type of experiment because they endogenously retain histones H3 and H4 and are therefore competent in assembling octasomes even in the Asf1-depleted extract. During this study, we realized that the use of mouse sperm nuclei in Xenopus egg extracts provides additional and deep insights into the basic mechanisms of mitotic chromosome assembly. For instance, the functional contribution of condensin II to chromosome assembly could be observed more prominently when mouse sperm nuclei are used as a substrate than when Xenopus sperm nuclei are used (Shintomi et al., 2017, Science). We suspected that the slow kinetics of nucleosome assembly on the mouse sperm substrate creates an environment in favor of condensin II’s action. For these reasons, our laboratory now extensively uses mouse sperm nuclei for the functional analyses of condensin II (Yoshida et al., 2022. eLife) and other purposes (Kinoshita et al., 2022, JCB). Yoshida et al. (2022) used experimental approaches analogous to the current study, and found that the deletion of the CAP-D3 C-tail, causes accelerated loading of condensin II. One of the long-term goals in our laboratory is to critically compare and contrast the actions of condensin I and condensin II in mitotic chromosome assembly. Thus, the use of the same substrate in the two complementary studies can be fully justified.

During the preparation of this response, we realized that the readers would benefit from a brief statement about the comparison between condensin I and condensin II. In the revised manuscript, we have added the following statement in Discussion:

“It should also be added that CAP-H2, the kleisin subunit of condensin II, lacks the N-terminal extension that corresponds to the CAP-H N-tail. Thus, the negative regulation by the kleisin N-tail reported here is not shared by condensin II. Interestingly, however, a recent study from our laboratory has shown that the deletion of the CAP-D3 C-tail causes accelerated loading of condensin II onto chromatin (Yoshida et al., 2022). It is therefore possible that condensins I and II utilize similar IDR-mediated regulatory mechanisms, but they do so in different ways.”

3. Page 5. "we next focused on the conserved helix (CH) […], that is enriched with basic amino acids." Based on the provided sequence alignment, the helix contains an equal number of both basic and acidic residues. Is it correct to characterize this helix as positively charged?

The reviewer is right. In the revised manuscript, we have used a more neutral expression as follows:

“…we next focused on the conserved helix (CH) […], that contains conserved basic amino acids.”

4. To prevent N-tail phosphorylation, the authors create a (H-N19A) allele, referring to Cdk promiscuity. Cdk cooperation with other mitotic kinases can also be expected. Nevertheless, in case the authors created a variant with only the 4 Cdk consensus sites mutated, it would be interesting to know its consequences.

We consider that this is a reasonable question. In our early experiments, we noticed that introduction of multiple SP/TP sites in the non-SMC subunits of condensin I including CAP-H caused a relatively mild phenotype in mitotic chromosome assembly in Xenopus egg extracts. Then we found that the deletion of the CAP-H N-tail caused a very clear, accelerated loading phenotype, prompting us to focus on the regulatory function of the CAP-H N-tail. As the reviewer correctly points out, the current study does not pinpoint the number and position of target sites involved in the proposed phosphoregulation by the CAP-H N-tail. We wish to address this important issue in the near future, along with reconstitution of the phosphoregulation using purified components.

5. Figure 2-figure supplement 1A, a second region of mitotic condensin phosphorylation is XCAP-D2. The authors state that XCAP-D2 phosphorylation does not impact on condensin function in their assays. This is very relevant to the current paper, so it would be good to see the Yoshida et al. 2022 ELife publication (in press) as an accompanying manuscript.

We thank the reviewer for pointing out this issue, but it is not necessarily clear to us what the reviewer requests. In the original manuscript, we cited Yoshida et al. (2022) in Discussion as follows:

“Recent studies from our laboratory showed that the deletion of the CAP-D2 C-tail, which also contains multiple SP/TP sites (Figure 2-figure supplement 1A), has little impact on condensin I function as judged by the same and related add-back assays using Xenopus egg extracts (Kinoshita et al., 2022; Yoshida et al., 2022).”

We believe that the current statement is good enough.

6. One of the authors' most striking results is chromosome formation in interphase egg extracts using condensin (H-dN). At the same time, condensin (H-dN) is unable to support DNA supercoiling or chromosome reconstitution with recombinant components. More emphasis might be placed on this important piece of information, and possible reasons should be discussed. Can Cdk-treatment restore condensin (H-dN) biochemical activity? If not, then condensin (H-dN) might have lost more than just an inhibitory Ntail. The cohesin N-tail is thought to fulfil a positive role during DNA loading (Higashi et al. 2020). Could it be that the condensin N-tail encompasses both positive and negative roles?

We were also surprised to find that holo(H-dN) gains the ability to assemble mitotic chromosome-like structures in interphase extracts. It should be stressed, however, that the formation of mitotic chromosome-like structures in I-HSS requires a much higher concentration (150 nM) than the standard concentration used in M-HSS (35 nM). Thus, the deletion of the CAP-H N-tail alone cannot make the condensin I complex fully active in I-HSS. We think that the negative regulation by the CAP-H N-tail is not the sole mechanism responsible for the very tight cell cycle regulation of condensin I function. We emphasize this important point by mentioning that “our results uncover one of the multi-layered mechanisms that ensure cell cycle-specific loading of condensin I onto chromosomes” in Summary.

At the end of Discussion, we describe the limitations of the current study: “we have so far been unsuccessful in using these recombinant complexes to recapitulate positive DNA supercoiling or chromatid reconstitution, both of which require proper Cdk1 phosphorylation in vitro”. We are fully aware that full reconstitution of phosphorylation dependent activation of condensin I in vitro is one of the most important directions in the future.

Although we currently do not have any evidence to suggest that the H N-tail has a positive role, we do not exclude such a possibility.

7. Here comes my main question for the authors (though I should stress that I do not expect an answer for publication in a Review Commons journal). The authors now have a unique opportunity to gain key mechanistic insight into condensin by answering the question, 'how does the kleisin N-tail inhibit condensin'? The authors allude to a model in which the N-tail interacts with Smc2 to close/obstruct the kleisin N-gate, through which the DNA likely enters the condensin ring. Can the authors biochemically recapitulate an interaction between an isolated N-tail (or N-terminal section of XCAPH) and Smc2? Does Cdk phosphorylation alter this interaction?

This comment is related to Comment #1 of Reviewer#1. See above for our response.

Minor points.

8. The condensin loop extrusion results would benefit from a supplementary movie or time-series, to illustrate the comparison. Details of how loop rate, duration and sizes were assessed should be added to the methods section.

In the revised manuscript, we have provided a set of time-lapse images of loop extrusion events catalyzed by holo(WT) and holo(H-dN) in Figure 4E. We have also added the following explanations for how the parameters of loop extrusion reactions were assessed in Materials and methods:

“To determine the loop size, the fluorescence intensity of the looped DNA was divided by that of the entire DNA molecule for each image, and multiplied by the length of the entire DNA molecule (48.5 kb). The loop rate was obtained by averaging the increase in looped DNA size per second. The loop duration was calculated by measuring the time from the start of DNA loop formation until the DNA loop became unidentifiable.”

9. Figure 2-figure supplement 1A legend, "hHP4" should probably read "hHP2".

The reviewer is right. It should read hHP2. Corrected.

Reviewer #4 (Significance (Required)):

See above.

https://doi.org/10.7554/eLife.84694.sa2

Article and author information

Author details

  1. Shoji Tane

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Conceptualization, Data curation, Formal analysis, Funding acquisition, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0209-347X

  2. Keishi Shintomi

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Resources, Supervision, Funding acquisition, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0484-9901

  3. Kazuhisa Kinoshita

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Resources, Supervision, Funding acquisition, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0882-4296

  4. Yuko Tsubota

    Division of Biological Sciences, Graduate School of Science, Nagoya University, Nagoya, Japan
    Contribution
    Data curation, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7479-2747

  5. Makoto M Yoshida

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Data curation, Funding acquisition, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0618-1717

  6. Tomoko Nishiyama

    Division of Biological Sciences, Graduate School of Science, Nagoya University, Nagoya, Japan
    Contribution
    Supervision, Funding acquisition, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8349-6536

  7. Tatsuya Hirano

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Conceptualization, Supervision, Funding acquisition, Validation, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    hiranot@riken.jp
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4219-6473

Funding

Japan Society for the Promotion of Science (#17K15070)

  • Shoji Tane

Japan Society for the Promotion of Science (#19H05755)

  • Keishi Shintomi

Japan Society for the Promotion of Science (#22H02551)

  • Keishi Shintomi

Japan Society for the Promotion of Science (#19K06499)

  • Kazuhisa Kinoshita

Japan Society for the Promotion of Science (#20H05937)

  • Tomoko Nishiyama

Japan Society for the Promotion of Science (#18H05276)

  • Tatsuya Hirano

Japan Society for the Promotion of Science (#20H05938)

  • Tatsuya Hirano

Precursory Research for Embryonic Science and Technology (JPMJPRK4)

  • Tomoko Nishiyama

Japan Society for the Promotion of Science (#20K15723)

  • Makoto M Yoshida

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank F Inoue, H Watanabe, and M Ohsugi for their help with mouse sperm nuclei preparation, and members of the Hirano lab for critically reading the manuscript. This work was supported by Grant-in-Aid for Scientific Research/KAKENHI (#17K15070 [to ST], #19H05755 and #22H02551 [to KS], #19K06499 [to KK], #20K15723 [to MMY], #20H05937 [to TN], and #18H05276 and #20H05938 [to TH]) and by JST PRESTO (JPMJPRK4 [to TN]).

Ethics

Female Xenopus laevis frogs (RRID: NXR_0031, Hamamatsu Seibutsu-Kyozai) were used to lay eggs to harvest Xenopus egg extract (Hirano et al., 1997). Frogs were used in compliance with the institutional regulations of the RIKEN Wako Campus. Mice (BALB/c × C57BL/6J F1) for sperm nuclei (Shintomi et al., 2017) were used in compliance with protocols approved by the Animal Care and Use Committee of the University of Tokyo (for M. Ohsugi who provided mouse sperm).

Senior Editor

  1. Jessica K Tyler, Weill Cornell Medicine, United States

Reviewing Editor

  1. Adèle L Marston, University of Edinburgh, United Kingdom

Publication history

  1. Preprint posted: August 19, 2022 (view preprint)
  2. Received: November 4, 2022
  3. Accepted: November 28, 2022
  4. Accepted Manuscript published: December 13, 2022 (version 1)
  5. Version of Record published: December 28, 2022 (version 2)

Copyright

© 2022, Tane et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 577
    Page views
  • 95
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Shoji Tane
  2. Keishi Shintomi
  3. Kazuhisa Kinoshita
  4. Yuko Tsubota
  5. Makoto M Yoshida
  6. Tomoko Nishiyama
  7. Tatsuya Hirano
(2022)
Cell cycle-specific loading of condensin I is regulated by the N-terminal tail of its kleisin subunit
eLife 11:e84694.
https://doi.org/10.7554/eLife.84694

Categories and tags

Research organism

Further reading

    1. Cell Biology
    2. Chromosomes and Gene Expression

    Cohesin-independent STAG proteins interact with RNA and R-loops and promote complex loading

    Hayley Porter, Yang Li ... Suzana Hadjur
    Research Article Updated

    Most studies of cohesin function consider the Stromalin Antigen (STAG/SA) proteins as core complex members given their ubiquitous interaction with the cohesin ring. Here, we provide functional data to support the notion that the SA subunit is not a mere passenger in this structure, but instead plays a key role in the localization of cohesin to diverse biological processes and promotes loading of the complex at these sites. We show that in cells acutely depleted for RAD21, SA proteins remain bound to chromatin, cluster in 3D and interact with CTCF, as well as with a wide range of RNA binding proteins involved in multiple RNA processing mechanisms. Accordingly, SA proteins interact with RNA, and R-loops, even in the absence of cohesin. Our results place SA1 on chromatin upstream of the cohesin ring and reveal a role for SA1 in cohesin loading which is independent of NIPBL, the canonical cohesin loader. We propose that SA1 takes advantage of structural R-loop platforms to link cohesin loading and chromatin structure with diverse functions. Since SA proteins are pan-cancer targets, and R-loops play an increasingly prevalent role in cancer biology, our results have important implications for the mechanistic understanding of SA proteins in cancer and disease.

    1. Chromosomes and Gene Expression
    2. Genetics and Genomics

    Decapping factor Dcp2 controls mRNA abundance and translation to adjust metabolism and filamentation to nutrient availability

    Anil Kumar Vijjamarri, Xiao Niu ... Alan G Hinnebusch
    Research Article

    Degradation of most yeast mRNAs involves decapping by Dcp1/Dcp2. DEAD-box protein Dhh1 has been implicated as an activator of decapping, in coupling codon non-optimality to enhanced degradation, and as a translational repressor, but its functions in cells are incompletely understood. RNA-Seq analyses coupled with CAGE sequencing of all capped mRNAs revealed increased abundance of hundreds of mRNAs in dcp2Δ cells that appears to result directly from impaired decapping rather than elevated transcription. Interestingly, only a subset of mRNAs requires Dhh1 for targeting by Dcp2, and also generally requires the other decapping activators Pat1, Edc3 or Scd6; whereas most of the remaining transcripts utilize NMD factors for Dcp2-mediated turnover. Neither inefficient translation initiation nor stalled elongation appears to be a major driver of Dhh1-enhanced mRNA degradation. Surprisingly, ribosome profiling revealed that dcp2Δ confers widespread changes in relative translational efficiencies (TEs) that generally favor well-translated mRNAs. Because ribosome biogenesis is reduced while capped mRNA abundance is increased by dcp2&Delta, we propose that an increased ratio of mRNA to ribosomes increases competition among mRNAs for limiting ribosomes to favor efficiently translated mRNAs in dcp2Δ cells. Interestingly, genes involved in respiration or utilization of alternative carbon or nitrogen sources are up-regulated, and both mitochondrial function and cell filamentation are elevated in dcp2Δ cells, suggesting that decapping sculpts gene expression post-transcriptionally to fine-tune metabolic pathways and morphological transitions according to nutrient availability.

    1. Chromosomes and Gene Expression
    2. Genetics and Genomics

    Mouse B2 SINE elements function as IFN-inducible enhancers

    Isabella Horton, Conor J Kelly ... Edward B Chuong
    Research Article Updated

    Regulatory networks underlying innate immunity continually face selective pressures to adapt to new and evolving pathogens. Transposable elements (TEs) can affect immune gene expression as a source of inducible regulatory elements, but the significance of these elements in facilitating evolutionary diversification of innate immunity remains largely unexplored. Here, we investigated the mouse epigenomic response to type II interferon (IFN) signaling and discovered that elements from a subfamily of B2 SINE (B2_Mm2) contain STAT1 binding sites and function as IFN-inducible enhancers. CRISPR deletion experiments in mouse cells demonstrated that a B2_Mm2 element has been co-opted as an enhancer driving IFN-inducible expression of Dicer1. The rodent-specific B2 SINE family is highly abundant in the mouse genome and elements have been previously characterized to exhibit promoter, insulator, and non-coding RNA activity. Our work establishes a new role for B2 elements as inducible enhancer elements that influence mouse immunity, and exemplifies how lineage-specific TEs can facilitate evolutionary turnover and divergence of innate immune regulatory networks.