Cas phosphorylation regulates focal adhesion assembly

Version of Record

Accepted for publication after peer review and revision.

Download
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

635 views

Version of Record published: August 17, 2023 (This version)
Accepted Manuscript published: July 25, 2023 (Go to version)
Accepted: July 19, 2023
Received: June 16, 2023
Preprint posted: December 19, 2022 (Go to version)

1. Of interest
PM2.5 leads to adverse pregnancy outcomes by inducing trophoblast oxidative stress and mitochondrial apoptosis via KLF9/CYP1A1 transcriptional axis

Shuxian Li, Lingbing Li ... Xietong Wang

Research Article Sep 22, 2023
Further reading

Abstract
Editor's evaluation
Introduction
Results
Discussion
Materials and methods
Data availability
References
Decision letter
Author response
Article and author information
Metrics

Abstract

Integrin-mediated cell attachment rapidly induces tyrosine kinase signaling. Despite years of research, the role of this signaling in integrin activation and focal adhesion assembly is unclear. We provide evidence that the Src-family kinase (SFK) substrate Cas (Crk-associated substrate, p130Cas, BCAR1) is phosphorylated and associated with its Crk/CrkL effectors in clusters that are precursors of focal adhesions. The initial phospho-Cas clusters contain integrin β1 in its inactive, bent closed, conformation. Later, phospho-Cas and total Cas levels decrease as integrin β1 is activated and core focal adhesion proteins including vinculin, talin, kindlin, and paxillin are recruited. Cas is required for cell spreading and focal adhesion assembly in epithelial and fibroblast cells on collagen and fibronectin. Cas cluster formation requires Cas, Crk/CrkL, SFKs, and Rac1 but not vinculin. Rac1 provides positive feedback onto Cas through reactive oxygen, opposed by negative feedback from the ubiquitin proteasome system. The results suggest a two-step model for focal adhesion assembly in which clusters of phospho-Cas, effectors and inactive integrin β1 grow through positive feedback prior to integrin activation and recruitment of core focal adhesion proteins.

Editor's evaluation

This important study advances our understanding of adhesion formation in migrating cells by showing that clustering of the adaptor protein Cas and its binding partners represents the initial step in adhesion formation that occurs before integrin clustering. The evidence supporting the conclusions is convincing overall, although in a few cases, quantifications are based on limited datasets.

https://doi.org/10.7554/eLife.90234.sa0

Introduction

Cell migration on extracellular matrix (ECM) involves the repeated assembly and disassembly of integrin-mediated cell–ECM adhesions (Hynes, 2002). Integrins are heterodimers of α and β chains that can switch between inactive and active conformations. Integrin activation exposes binding sites for ECM outside the cell and for specific integrin-tail-binding proteins inside the cell. The latter can associate with other proteins to form focal adhesions that link integrins to the actin cytoskeleton, providing traction forces for actomyosin-driven cell movement (Iwamoto and Calderwood, 2015; Kanchanawong and Calderwood, 2022, Moser et al., 2009). At the ultrastructural level, focal adhesions are heterogeneous, with nanoclusters of active integrins and integrin tail-associated proteins closest to the membrane, F-actin and actin-associated proteins on top, and mechanosensing force transducers sandwiched between (Kanchanawong et al., 2010; Legerstee and Houtsmuller, 2021). Forces generated by actin polymerization and actomyosin contractility partially unfold the force transducers, exposing binding sites for other focal adhesion proteins and stabilizing the structure (Wolfenson et al., 2019). For example, talin is a conformationally sensitive protein that binds integrin through its head domain and actin through sites in its tail. Tension between the talin head and tail regions exposes binding sites for vinculin and other structural and regulatory proteins (Bachmann et al., 2023). In turn, binding to talin exposes actin-binding sites on vinculin, building links between integrins and actin filaments, providing resistance to contractile forces and anchorage for cell movement. Even though these mechanical principles are well understood, it is unclear whether they explain the early stages of adhesion assembly, when integrin clusters may be too small to develop sufficient force and where inside-out signaling, membrane lipid microdomains, the glycocalyx, and actin polymerization may also be important (Coyer et al., 2012; Henning Stumpf et al., 2020).

In addition to binding ECM and focal adhesion proteins, integrins are also signaling centers, transducing biochemical signals. Cell adhesion, or integrin clustering with antibodies or beads coated with ECM, rapidly activates Src-family tyrosine kinases (SFKs) and focal adhesion kinase (FAK), leading to tyrosine phosphorylation of several integrin-associated proteins and activating the GTPase Rac1 (Burridge and Chrzanowska-Wodnicka, 1996; Parsons et al., 2010). These signaling events are clearly important for regulating cell motility, cell cycle and cell survival, but their roles in focal adhesion dynamics remain unclear (Burridge and Chrzanowska-Wodnicka, 1996; Mitra and Schlaepfer, 2006).

One of the main substrates for integrin-stimulated tyrosine phosphorylation is an adaptor protein named Cas (p130Cas or BCAR1) (Chodniewicz and Klemke, 2004; Janoštiak et al., 2014b; Mitra and Schlaepfer, 2006). At the molecular level, Cas contains an N-terminal SH3 domain, a four-helix bundle, and a C-terminal FAT domain, separated by unstructured regions and an SFK SH3/SH2-binding site. Cas localizes to focal adhesions through its SH3 and FAT domains (Donato et al., 2010; Nakamoto et al., 1997), which bind vinculin, FAK, and paxillin in vitro (Janoštiak et al., 2014a; Polte and Hanks, 1995; Zhang et al., 2017). Cas and SFKs mutually activate each other, with Cas binding to and activating SFKs and SFKs phosphorylating Cas at up to 15 repeated YxxP motifs in the ‘substrate domain’ (SD) between the SH3 domain and four-helix bundle (Chodniewicz and Klemke, 2004; Pellicena and Miller, 2001). The Cas SD is also phosphorylated rapidly during cell adhesion (Miyamoto et al., 1995; Petch et al., 1995; Vuori and Ruoslahti, 1995). The trigger for Cas phosphorylation is unclear: integrin clustering or conformation changes or protein binding to the Cas SD may be involved (Arias-Salgado et al., 2003; Hotta et al., 2014; Sawada et al., 2006). After phosphorylation, the pYxxP motifs can bind specific SH2-domain proteins including the paralogs Crk and CrkL. Crk/CrkL in turn can bind to and stimulate various proteins, including the Rac1 guanine nucleotide exchange factor (GEF) DOCK180 (Chodniewicz and Klemke, 2004; Gotoh et al., 1995; Hasegawa et al., 1996; Klemke et al., 1998; Knudsen et al., 1994; Tanaka et al., 1994). DOCK180 can then activate Rac1. Rac1 promotes actin polymerization and lamellipodial protrusion through the WAVE/Arp2/3 complex, and induces focal complex formation through unknown mechanisms (Nobes and Hall, 1995; Stradal et al., 2004; Zaidel-Bar et al., 2003). Cas activity in focal adhesions is limited by the ubiquitin-proteasome system, which targets phosphorylated Cas for ubiquitination and degradation (Steenkiste et al., 2021; Teckchandani and Cooper, 2016; Teckchandani et al., 2014).

The role of integrin-activated tyrosine phosphorylation in focal adhesion dynamics is unclear. Early studies of Cas knockout mouse embryo fibroblasts (MEFs) revealed defects in cell attachment and the actin cytoskeleton, suggesting that Cas may regulate adhesion assembly (Honda et al., 1999; Honda et al., 1998). In addition, Cas regulates spreading and migration of Caco-2 epithelial cells (Sanders and Basson, 2005). However, other studies, using mutant MEFs lacking Cas, SFKs, FAK, or paxillin, revealed no change in adhesion assembly but major inhibition of adhesion disassembly (Bockholt and Burridge, 1995; Ilić et al., 1995, Webb et al., 2004). To revisit the role of Cas phosphorylation, we have studied focal adhesion assembly in spreading and migrating epithelial cells. Unexpectedly, we found that phosphorylated Cas co-clusters with inactive integrins nearly a minute before integrin activation and recruitment of core focal adhesion proteins. Cas is required for vinculin recruitment but vinculin is not required for Cas clusters to form. A positive feedback loop between SFKs, Cas, Crk, Rac1, and reactive oxygen species (ROS) promotes the growth of the early Cas–integrin clusters and subsequent integrin activation and focal adhesion assembly, opposed by negative feedback from the ubiquitin–proteasome system. The results suggest a key role for SFK–Cas–Crk–Rac1 signaling in early stages of focal adhesion formation.

Results

Cas clusters are precursors for vinculin clusters

Cas has the potential to serve as a signaling hub that may be critical for focal adhesion assembly. However, we are only aware of one study where Cas recruitment kinetics were measured relative to other focal adhesion proteins. The results showed that Cas and paxillin are recruited simultaneously during adhesion assembly in migrating fibroblasts (Donato et al., 2010). Another study using endothelial cells showed that tyrosine phosphorylation precedes paxillin recruitment (Zaidel-Bar et al., 2003). These two studies suggest that tyrosine phosphorylation may start before Cas is recruited. However, the kinetics of tyrosine phosphorylation, Cas recruitment, and adhesion assembly may vary according to cell type, integrin, or ECM. Therefore, we evaluated the kinetics of Cas recruitment and tyrosine phosphorylation relative to focal adhesion assembly, making use of the immortalized, normal, mammary epithelial line MCF10A (Debnath and Brugge, 2005). Since Cas over-expression can stimulate cell migration (Klemke et al., 1998; Yano et al., 2000), we tagged Cas by editing the Cas gene, inserting an artificial exon encoding mScarlet (mSc) and a linker sequence into the first intron and selecting a polyclonal population of mScarlet fluorescent cells (Figure 1A, Figure 1—figure supplement 1). Western blotting revealed similar levels and phosphorylation of Cas and Cas^mSc proteins, indicating that most cells are heterozygous (Figure 1B). This intron tagging approach avoided the need for single-cell cloning that can select for variants (see Methods). To monitor focal adhesions, the Cas^mSc cells were transduced to express near-endogenous levels of YFP-tagged vinculin (VCL). Imaging using total internal reflection (TIRF) microscopy revealed that Cas^mSc and YFP-VCL substantially co-localized, as expected (Figure 1C). Staining with Cas and vinculin antibodies revealed that tagging Cas and vinculin did not alter focal adhesion number or structure (Figure 1—figure supplement 2A, B).

Figure 1 with 3 supplements see all

Download asset Open asset

Cas clusters before vinculin during focal adhesion assembly.

(A) *Cas* wildtype and *Cas^mSc* genomic organization and *Cas^mSc* mRNA structure. An artificial exon encoding mScarlet (mSc) and a 8-residue linker were inserted in intron 1. (B) Representative immunoblot showing the pY410Cas, total Cas and vinculin (VCL) in control (Ctrl) and Cas^mSc MCF10A cells. (C) Cas^mSc co-localization with YFP-VCL. Cas^mSc MCF10A cells expressing YFP-VCL were plated on COLI for 30 min and visualized by total internal reflection (TIRF) microscopy. (**D–H**) Cas^mSc clusters form before vinculin clusters. TIRF microscopy of Cas^mSc YFP-VCL cells. Individual time frames and kymographs from (D) spreading or (E) migrating cells. Arrowheads indicate a Cas^mSc clusters (magenta) that are later joined by YFP-VCL (green). (F) Pipeline for tracking regions of interest (ROIs). Upper panels: raw images. Lower panels: masks showing tracked ROIs, color coded by time of onset. (G) Median Δt_1/2 (VCL-Cas) of multiple ROIs from n = 19 spreading cells. Error bars show mean (43.8 s) and standard error of the mean (SEM) (3 s). (H) Median Δt_1/2 (VCL-Cas) of multiple ROIs from n = 13 spreading cells. Error bars show mean (68.5 s) and SEM (7 s).

To compare Cas^mSc and YFP-VCL dynamics, we performed dual-channel time-lapse TIRF imaging as cells attached and spread on collagen I (COLI). Cas^mSc formed clusters at the first points of cell–substrate contact and moved outwards with the spreading edge (Figure 1D, Video 1). Vinculin joined these clusters later, and remained after Cas departed (note transition from magenta to white to green in kymographs). Similar patterns of Cas and vinculin clustering were observed under spontaneous lamellipodial protrusions generated by fully spread cells (Figure 1E, Video 2). These results together suggest that Cas clusters are precursors of vinculin clusters during spreading and migration.

Video 1

Download asset

posterframe for video — Cas (magenta) and vinculin (green) dynamics during attachment and spreading of a Cas^mSc YFP-VCL MCF10A cell on collagen.

15 s time intervals.

Video 2

Download asset

To quantify the dynamics of cluster formation and avoid possible selection bias, we developed a computational pipeline to delineate regions of interest (ROIs) in which Cas, vinculin, or both Cas and vinculin intensities exceeded thresholds that were automatically set for each frame (see Methods). ROIs were tracked over time and quantified if they exceeded 20 pixels (0.5 μm²) in area and persisted for three or more frames (>40 s) (Figure 1F, Video 3). These thresholds exclude the smallest, shortest-lived nascent adhesions but include larger focal complexes (Kanchanawong and Calderwood, 2022). The mean intensity of each channel in each ROI was then quantified over the duration of the recording and the intensities smoothed and normalized to a range of 0–1 (Figure 1—figure supplement 3A). For each ROI, we defined Δt_1/2 (VCL-Cas) as the time interval between Cas and vinculin reaching half-maximal intensity (Figure 1—figure supplement 3B). This metric showed wide variability in time interval across different ROIs in an individual cell. However, non-parametric analysis showed that the median Δt_1/2 (VCL-Cas) was significantly greater than zero (i.e., Cas clustering preceded vinculin clustering) (median Δt_1/2 54.8 s, 95% CI 23–105 s, for 90 ROIs in the cell shown) (Figure 1—figure supplement 3C). Averaging the median time delay across multiple spreading cells in several experiments yielded a mean Δt_1/2 (VCL-Cas) 43.8 ± 3 s (mean and standard error of the mean [SEM], n = 19 cells) (Figure 1G). Similar results were obtained quantifying Cas and vinculin intensities under lamellipodia generated by migrating cells (Figure 1—figure supplement 3D). Averaging the median time delay across multiple migrating cells in several experiments yielded a mean Δt_1/2 (VCL-Cas) 68.5 ± 7 s (mean and SEM, n = 13 cells) (Figure 1H). A similar experiment using Cas^mSc YFP-VCL HeLa cells also showed vinculin clustering after Cas (median Δt_1/2 (VCL-Cas) 48.1 ± 9 s, mean and SEM, n = 13 cells) (Figure 1—figure supplement 3E, F).

Video 3

Download asset

Overall, these results show a strong tendency for Cas to form clusters at the edge of spreading or migrating epithelial cells, 45–60 s before vinculin recruitment. For comparison, the time interval between arrival of talin, vinculin, and paxillin in nascent adhesions of CHO-K1 cells migrating on fibronectin (FN) is ~14 or ~2 s for non-maturing or maturing adhesions, respectively (Han et al., 2021). The replacement of Cas clusters by vinculin clusters suggests that Cas may spatially coordinate vinculin clustering and adhesion assembly in both spreading and migrating MCF10A and HeLa cells.

Cas clusters are precursors of integrin clusters

To determine when integrins cluster relative to Cas, we transduced MCF10A Cas^mSc cells with a lentiviral vector encoding β1Ecto-pH, a recombinant integrin β1 with a pH-sensitive pHluorin tag inserted in the extracellular domain (Huet-Calderwood et al., 2017). This integrin is cell-surface expressed, localizes to adhesions, exhibits normal integrin activation, and restores adhesion in integrin β1 knockout MEFs (Huet-Calderwood et al., 2017). Live dual-color TIRF imaging of β1Ecto-pH in Cas^mSc MCF10A cells revealed that β1Ecto-pH localized to Cas clusters, but, like YFP-VCL, β1Ecto-pH kinetics were significantly delayed relative to Cas, with median Δt_1/2 (β1-Cas) 57.7 ± 6.7 s (mean and SEM, n = 19 cells) (Figure 2A–C, Video 4 left).

Figure 2 with 1 supplement see all

Download asset Open asset

Cas clusters before integrin β1 during focal adhesion assembly.

(A) Cas^mSc MCF10A cells were transduced to express β1Ecto-pH, plated on COLI and imaged 30 min by total internal reflection (TIRF) microscopy. Upper panels: individual time frames. Arrowheads indicate a Cas^mSc cluster (magenta) that is later joined by β1Ecto-pH (green). Lower panels: kymographs. (B) Median Δt_1/2 (β1-Cas) of multiple regions of interest (ROIs) from 19 spreading Cas^mSc β1Ecto-pH MCF10A cells. Error bars show mean (57.7 s) and standard error of the mean (SEM) (6.7 s). (C) Upper panels: raw images. Lower panels: masks showing tracked ROIs, color coded by time of onset. (D) *ITGB1* wildtype and *ITGB1^GFP* genomic organization and *ITGB1^GFP* mRNA structure. An artificial exon encoding the ITGB1 C-terminus, linker, GFP, and polyA signal was inserted in intron 15. (E) Immunoblot showing expression of ITGB1^GFP protein in Cas^mSc ITGB1^GFP HeLa cells. (F) Cas^mSc clusters form before ITGB1^GFP clusters. TIRF microscopy of Cas^mSc ITGB1^GFP HeLa cells. Upper panels: individual time frames. Arrowheads indicate a Cas^mSc cluster (magenta) that is later joined by ITGB1^GFP (green). Lower panels: kymographs. (G) Median Δt_1/2 (ITGB1-Cas) of multiple ROIs from 15 spreading Cas^mSc ITGB1^GFP HeLa cells. Error bars show mean (61.06 s) and standard error of the mean (SEM) (5.4 s). (H) Upper panels: raw images. Lower panels: masks showing tracked ROIs, color coded by time of onset.

Video 4

Download asset

As an independent approach to measure integrin clustering without ectopic expression, we tagged ITGB1 by inserting an artificial exon into the ITGB1 gene in HeLa Cas^mSc cells, adding an optimized linker (Parsons et al., 2008) and GFP tag to the C-terminus (Figure 2D, Figure 2—figure supplement 1). Western blotting showed a fusion protein of the expected mobility (Figure 2D). Live imaging Cas^mSc ITGB1^GFP cells revealed integrin clustering after Cas with median Δt_1/2 (ITGB1-Cas) 61.1 ± 5.4 s (mean and SEM, n = 15 cells) (Figure 2F–H, Video 4 right). Thus, integrin β1 clusters about a minute after Cas in MCF10A and HeLa cells, at approximately the same time as vinculin.

Initial Cas clusters contain Crk

Tyrosine phosphorylation is the earliest event during nascent adhesion formation in migrating fibroblasts (Zaidel-Bar et al., 2003). To determine when Cas is phosphorylated, we analyzed the recruitment of Crk, which binds to phosphorylated but not non-phosphorylated Cas and initiates downstream signaling (Chodniewicz and Klemke, 2004). We edited the CRK gene in Cas^mSc HeLa cells, adding a linker and mGreenLantern (mGL) to the C terminus (Figure 3A, Figure 3—figure supplement 1). Western blotting showed approximately equal expression of Crk^mGL and Crk, suggesting most cells are heterozygous (Figure 3B). Imaging Cas^mSc Crk^mGL cells during attachment and spreading revealed rapid recruitment of Crk^mGL on Cas^mSc clusters (Video 5 left, Figure 3C–E). The median time delay, Δt_1/2 (Crk-Cas), was 5.7 ± 2.5 s (mean and SEM, n = 21 cells) (Figure 3D), much shorter than the time for vinculin or integrin recruitment. Crk recruitment was significantly delayed by treatment with eCF506, which inhibits all SFKs but not other kinases (Fraser et al., 2016), indicating that Crk recruitment requires phosphorylation (Figure 3E, Video 5 right). Together these results suggest Cas is activated immediately as it first clusters, when integrin and vinculin density is still low.

Figure 3 with 1 supplement see all

Download asset Open asset

Cas and Crk cluster together.

(A) *Crk*^WT and *Crk^mGL* genomic organization and *Crk^mGL* mRNA structure. An artificial exon encoding the Crk C-terminus, linker, mGreenLantern (mGL), and polyA signal was inserted in intron 2. (B) Immunoblot showing expression of Crk^mGL protein in Cas^mSc Crk^mGL HeLa cells. (C) Crk^mGL clusters form shortly after Cas^mSc clusters. Total internal reflection (TIRF) micrographs of Cas^mSc Crk^mGL HeLa cells. Upper panels: individual time frames. Arrowheads indicate a Cas^mSc cluster (magenta) that is rapidly joined by Crk^mGL (green). Lower panels: kymographs. (D) Median Δt_1/2 (Crk-Cas) of multiple regions of interest (ROIs) from 10 to 21 spreading Cas^mSc Crk^mGL HeLa control and eCF506-treated cells. Error bars show mean and standard error of the mean (SEM). ***,p < 0.001 by Mann–Whitney U-test. (E) Upper panels: raw images. Lower panels: masks showing tracked ROIs, color coded by time of onset.

Video 5

Download asset

Spatial distribution of adhesion proteins in Cas–vinculin clusters

Time-lapse imaging of spreading Cas^mSc YFP-VCL cells showed that Cas^mSc is continuously added to the outer edge of Cas–vinculin clusters while YFP-VCL is added later, farther from the edge (Figure 4A). We confirmed this distribution by quantifying mScarlet and YFP intensity profiles along the axis of multiple, 4-μm-long Cas–vinculin clusters in several cells (Figure 4B). Cas^mSc peaked ~0.75 μm and YFP-VCL peaked ~1.5 μm from the edge, reflecting their temporal order of recruitment. Similar profiles were obtained for endogenous Cas and vinculin when parental MCF10A cells were fixed and immunostained after 30 min of spreading (Figure 4—figure supplement 1). Thus, we reasoned that we could estimate the temporal order of arrival and departure of other adhesion proteins from their spatial distribution within Cas–vinculin clusters. To this end, spreading cells were fixed, immunostained with various combinations of antibodies, and imaged. Normalized intensity profiles were plotted and aligned using endogenous Cas or Cas^mSc as a fiducial marker. Results are presented as heat maps in Figure 4C and sample images in Figure 4—figure supplements 2 and 3.

Figure 4 with 4 supplements see all

Download asset Open asset

Spatial distribution of proteins in focal adhesions.

(A) Representative image of spreading Cas^mSc YFP-VCL MCF10A cells illustrating quantification approach. Inset shows 4 × 0.8 μm region of interest (ROI) used to quantify intensity against distance from cell edge. (B) Normalized intensity profiles of Cas^mSc and YFP-VCL across ≥20 ROIs from several cells. Error bars indicate mean and standard error of the mean (SEM). (C) Heat map of normalized intensity profiles for various antigens in Cas^mSc cell adhesions stained with indicated antibodies. (D) Normalized intensity profiles using conformation-sensitive integrin β1 antibodies; AIIB2, total integrin β1; mAb13, bent closed (BC) and extended closed (EC) conformations; 9EG7, EC and extended open (EO) conformations; 12G10, EO conformation. (E) Model showing inferred progression from nascent adhesions or focal complexes containing high levels of pY410Cas, inactive integrin and pY861FAK, to focal adhesions containing low levels of Cas and high levels of active integrin, vinculin, pY397FAK, F-actin, talin, paxillin, and kindlin.

The intensity profiles show several important features. First, Cas phosphorylation, detected with pY410 Cas antibody, is maximal at the head of the cluster, ~0.5 μm from the cell edge (Figure 4C). We were unable to detect Crk with available antibodies but the Crk paralog CrkL peaked at the head of the cluster, consistent with high levels of phospho-Cas and rapid recruitment of Crk during adhesion assembly (Figure 3C). The head of the cluster also contained the Cas SH3-binding protein FAK, phosphorylated at Y861, an SFK phosphorylation site (Eliceiri et al., 2002). This population of FAK is unlikely to be active since it has low levels of autophosphorylation at Y397, a site required for kinase activity (Le Coq et al., 2022). This suggests that the head of the cluster is the peak of SFK activity.

Next, the peak of vinculin at ~1.5 μm also contains highest levels of mechanosensing and structural components of focal adhesions, including kindlin2, talin1, paxillin, kinase-active pY397 FAK, and F-actin, but decreased amounts of pY410Cas and total Cas (Figure 4C). The presence of mechanosensing proteins suggests this part of the cluster is attached to the ECM and subject to mechanical force.

Finally, the distribution of integrin β1 varied according to the antibody used. Total integrin β1, detected with conformation-insensitive antibody AIIB2 (Mould et al., 2016), forms two peaks, one coincident with pY410Cas and pY861FAK and one aligning with the peak of vinculin. The first peak was also detected with mAb13, specific for inactive, bent-closed (BC) and extended-closed (EC) β1 integrin conformations (Su et al., 2016). The second peak was detected with 12G10, specific for the active, extended-open (EO) conformation, and by 9EG7, which detects both EO and EC conformations (Su et al., 2016; Figure 4C, D). This suggests that integrin activation increases as kindlin, talin, and vinculin are recruited, consistent with the roles of kindlin/talin binding and mechanical force in integrin activation.

Overall, while differential antibody access may affect immunofluorescent staining profiles, the spatial patterns suggest a temporal sequence of events in which active phosphorylated Cas and Crk/CrkL initially cluster with inactive integrin β1 and SFK phosphorylated but kinase-inactive FAK. Since integrin β1 is in its BC conformation it is probably not attached to the ECM. Later, phosphorylated and total Cas levels decrease as integrin β1 recruits talin and kindlin, adopts the EO conformation, and able to bind ECM. Mechanical forces from the actin cytoskeleton then expose binding sites for vinculin and a mature focal adhesion is formed (model, Figure 4E).

Phosphorylated Cas is enriched in the adhesome

Even though many imaging studies have detected Cas in focal adhesions, Cas is not routinely detected in the adhesome, as defined by proteomics or proximity biotinylation (Kanchanawong and Calderwood, 2022). However, low abundance proteins may be significantly enriched in the adhesome yet escape detection. We used Western blotting to estimate the proportion of Cas and selected other adhesion proteins in the adhesome relative to the non-adhesome (supernatant) fraction. Cells were seeded on polylysine or COLI for 60 min and incubated with protein–protein cross-linking reagents before lysis and separation of adhesome and supernatant fractions as described (Humphries et al., 2009; Schiller et al., 2011). We then reversed the cross-links and performed Western blotting on the adhesome and supernatant samples. We found that the adhesome contained ~20–27% of total cellular integrin β1, talin, vinculin, paxillin, and total and autophosphorylated (pY397) FAK, but only ~7% of a control protein, ERK (Figure 4—figure supplement 4). The adhesome fraction also contained ~25% of total cellular Cas, suggesting it is as enriched in adhesions as bona fide adhesome proteins. Moreover, the adhesome also contained ~73% of phospho-Cas, detected with pY410 or pY249 antibodies, and pY861 FAK. This suggests that pY410 Cas, pY249 Cas, and pY861 FAK are significantly enriched in the adhesome fraction relative to their non-phosphorylated (or in the case of FAK, pY397 phosphorylated) forms. This suggests that these phosphorylations occur locally within adhesions and are rapidly lost when Cas or FAK dissociate. In contrast, autophosphorylated pY397 FAK remains active in the cytosol.

Cas, Crk, and SFKs regulate vinculin recruitment and focal adhesion assembly

The early arrival of Cas at sites of future focal adhesions suggests Cas may nucleate adhesion assembly. To test this possibility, we depleted Cas from Cas^mSc cells using siRNA (Figure 5—figure supplement 1A). Cas-depleted cells were non-migratory and their adhesions were immobile (Figure 5—figure supplement 1B, Video 6). Initial cell attachment and spreading were strongly inhibited, with significant decreases in cell area. Cas depletion inhibited focal adhesion formation, and Cas and vinculin intensity in remaining adhesions were inhibited to a similar degree (Figure 5A, B). Immunostaining of other focal adhesion proteins including talin1, kindlin2, and FAK in the remaining adhesions was also reduced (Figure 5—figure supplement 1C). By way of comparison, we treated cells with vinculin siRNA. Vinculin depletion was inefficient (Figure 5—figure supplement 1A), but significantly reduced vinculin intensity in adhesions (Figure 5A, B). However, there was no reduction in cell spreading, the number of Cas clusters, or the intensity of Cas in vinculin-depleted cells. This suggests that Cas regulates vinculin recruitment but vinculin does not regulates Cas recruitment, consistent with their order of assembly.

Video 6

Download asset

Figure 5 with 5 supplements see all

Download asset Open asset

Cas is required for focal adhesion assembly.

(A) Representative images (ventral section) of Cas^mSc MCF10A cells treated with control, Cas, or vinculin siRNA and fixed and stained with vinculin antibodies after 30 min of spreading on COLI. (B) Quantification of mean cell area and the number and mean intensities of Cas and/or vinculin clusters. Error bars show mean and standard error of the mean (SEM) for n = 10–50 cells from three biological repeats. (C) Median Δt_1/2 (VCL-Cas) of multiple regions of interest (ROIs) from 8 to 20 spreading Cas^mSc YFP-VCL MCF10A cells treated with Ctrl, Crk, CrkL, and Crk + CrkL siRNA. Error bars show mean and SEM. (D) Median Δt_1/2 (VCL-Cas) from 13 to 16 time-lapse dual-color total internal reflection (TIRF) micrographs of spreading Cas^mSc YFP-VCL MCF10A cells treated with DMSO or SFK inhibitor eCF506. (E) Mean cluster intensity of pY410Cas, Cas^mSc and YFP-VCL in Cas^mSc YFP-VCL MCF10A cells treated with control, Src, Fyn, or Yes1 siRNA and fixed after 30 min of spreading. Error bars show mean and SEM from n = 7–10 cells from three biological repeats. (F) Cas requirement for outside-in signaling. YFP-VCL MCF10A cells were treated with control or Cas siRNA and allowed to attach in the absence or presence of Mn²⁺ for 30 min. Graphs show the mean cell spread area and mean intensity of YFP-VCL clusters. Error bars show mean and SEM for n = 6–20 cells from two biological repeats. ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 by Kruskal–Wallis followed by Dunn’s multiple comparison test (**A–E**) or pairwise Mann–Whitney U-tests (F).

To control for possible non-specific effects of Cas siRNA, we transduced MCF10A cells to express tagged wildtype or mutant mouse Cas, and knocked down endogenous Cas with human Cas-specific siRNA. As shown in Figure 5—figure supplement 2, wildtype mouse Cas (mCasWT) rescued cell spreading and adhesion formation and was recruited approximately a minute before vinculin. However, mutant mouse Cas (mCas15F), lacking the fifteen YxxP phosphorylation sites in the SD, did not rescue cell spreading or adhesion formation.

We investigated whether Crk/CrkL and SFKs are required for Cas-dependent focal adhesion assembly. We used siRNA to deplete Crk, CrkL, or both and measured the time lag between Cas and vinculin recruitment. Depleting Crk and CrkL together but not separately slowed vinculin recruitment significantly, suggesting functional overlap (Figure 5C, Figure 5—figure supplement 3A–C, Video 7). Inhibiting SFKs with the pan-SFK inhibitor eCF506 also significantly delayed vinculin recruitment (Figure 5D, Video 7 bottom panels). To test whether a specific SFK is required, we knocked down each of the major SFKs – Src, Fyn, and Yes1 – and measured adhesion and spreading. Remarkably, cell spreading, adhesion number, vinculin intensity, and Cas phosphorylation were all inhibited by depletion of Yes1 but not Src or Fyn, while Cas cluster formation was normal (Figure 5E, Figure 5—figure supplement 3D–F). This implies that Yes1 may have a special role in phosphorylating Cas and recruiting Crk/CrkL to stimulate adhesion assembly in MCF10A cells spreading.

Video 7

Download asset

FAK, kindlin, and talin are not required for Cas clustering

We found that Cas and FAK cluster together early during adhesion assembly (Figure 4C), raising the possibility that FAK recruits Cas, as reported in spreading fibroblasts (Zhang et al., 2014). Therefore, we tested whether FAK is required for Cas clustering by depleting FAK with siRNA. Depleting FAK had no effect on MCF10A cell spreading, the intensity of Cas or vinculin clusters, or the median time delay between Cas and vinculin recruitment (Figure 5—figure supplement 4A–C). Kindlin2 and talin1 directly bind integrin tails and play important roles in integrin adhesion in fibroblasts, with kindlin2 interacting with paxillin and talin1 recruiting vinculin and providing attachment for actin, enabling force generation, adhesion maturation and cell spreading (Bachmann et al., 2023). Kindlin2 or talin1 siRNA had no effect on Cas clustering, but depleting talin1 decreased cell spreading and the intensity of vinculin clusters, and depleting either kindlin2 or talin1 increased the time delay between Cas and vinculin recruitment (Figure 5—figure supplement 4D–F). This suggests a sequence of events where Cas regulates cell spreading and recruitment of talin1 and kindlin2, and talin1 and kindlin2 are required to recruit vinculin.

Cas regulates ‘outside-in’ integrin activation

Integrins can be activated ‘inside-out’ by proteins binding to their cytoplasmic tails, or ‘outside-in’ by interactions with the ECM or with molecules or ions that stabilize the active open conformation (Hynes, 2002). We tested whether Cas is required for outside-in adhesion assembly by treating control or Cas-depleted cells with Mn²⁺, which stabilizes the active integrin conformation (Gailit and Ruoslahti, 1988; Lenter et al., 1993). While Mn²⁺ increased the spread area of control cells, it did not increase spreading of Cas siRNA-treated cells and did not rescue the intensity of vinculin clusters (Figure 5F). As a control for potential off-target effects of Cas siRNA we found that expression of mCasWT but not mCas15F rescued outside-in signaling by Mn²⁺ (Figure 5—figure supplement 5A–C). This suggests that phosphorylation of Cas is rate limiting for outside-in as well as inside-out integrin activation.

Cas regulates focal adhesion assembly on different ECM, in different cell types, and through different integrins

Our finding that Cas and SFKs are required for adhesion assembly conflicts with previous results (Bockholt and Burridge, 1995; Webb et al., 2004). However, the previous studies used mutant fibroblasts spreading on FN while we used epithelial cells on COLI. This raises the possibility that Cas may be dispensable for adhesion formation in certain cell types or ECM. To investigate further, we depleted Cas from MCF10A cells and plated them on FN or COLI. Cas depletion inhibited cell spreading and the number, area and vinculin intensity of adhesions on both substrates (Figure 6A). Moreover, time-lapse imaging showed that Cas preceded vinculin clustering by a similar time interval on FN as on COLI (Figure 6B, Video 8). Therefore, Cas plays a similar role in adhesion assembly when epithelial cells attach to either FN or COLI.

Figure 6 with 2 supplements see all

Download asset Open asset

Cas is required for MCF10A and human foreskin fibroblast (HFF) cell spreading and adhesion assembly on different extracellular matrix (ECM).

(A) MCF10A cells plated for 30 min on COLI- or fibronectin (FN)-coated surfaces after control or Cas siRNA treatment. Mean cell area, mean VCL intensity, mean cluster area and number of 7–41 cells in two biological repeats. (B) Median Δt_1/2 (VCL-Cas) of Cas^mSc YFP-VCL MCF10A cells spreading on FN or COLI. Error bars indicate mean and standard error of the mean (SEM). n = 23–25. ns, non-significant by Mann–Whitney test. (C) HFF cells plated for 30 min on COLI- or FN-coated surface after control or Cas siRNA treatment. Mean cell area, mean VCL intensity, mean cluster number, and area, of 6–9 cells in two biological repeats. ns, non-significant; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001 by Kruskal–Wallis followed by Dunn’s multiple comparison test.

Video 8

Download asset

To test whether Cas also regulates adhesion assembly in fibroblasts, we depleted Cas from human foreskin fibroblasts (HFFs) and plated them on FN or COLI. As with epithelial cells, Cas depletion inhibited HFF cell spreading and adhesion formation on both ECMs (Figure 6C, Figure 6—figure supplement 1A).

Proteomic analysis of MCF10A cells reveals expression of a variety of α and β integrin chains (Ly et al., 2018). However, all α chains that are expressed can heterodimerize with β1, and all the β chains that are expressed can heterodimerize with αv (Hynes, 2002). We tested the roles of β1 and αv heterodimers in Cas-dependent adhesion of epithelial and fibroblast cells using siRNA. On COLI, β1 depletion strongly inhibited spreading and recruitment of vinculin to Cas clusters, while depleting αv had smaller effects. In contrast, on FN, both β1 and αv were required for spreading and vinculin recruitment (Figure 6—figure supplement 1B, C). Thus, Cas regulates β1-dependent adhesion assembly on COLI, and β1- or αv-dependent adhesion assembly FN. To further identify the specific integrins regulated by Cas, we noted that MCF10A cells express α chains α2, 3, 5, and v at 10-fold higher level than other α chains, while β3 is under-expressed relative to β1 and β6 (Ly et al., 2018). This makes α2β1 a strong candidate to bind COLI and α5β1 and αvβ6 strong candidates to bind FN. Indeed, integrin α2β1-blocking mAb P1E6 (Carter et al., 1990; Tuckwell et al., 1995) prevented COLI binding while integrin α5β1-blocking monoclonal antibody (mAb) P8D4 (Alfandari et al., 2003; Davidson et al., 2002) prevented FN binding (Figure 6—figure supplement 2A). The exact αv integrin regulated by Cas is unclear, but immunofluorescence of HFFs spreading on FN did not reveal any αv clusters that do not also contain β1 (Figure 6—figure supplement 2B). Early β1 clusters at the edge lack αv. Taken together, these results suggest that Cas nucleates α2β1 and α5β1 adhesions on COLI and FN, respectively, and is also required for subsequent recruitment of αv on FN.

SFK–Cas–Crk–Rac1 signaling regulates adhesion assembly

SFK–Cas–Crk/CrkL signaling is mediated by Crk/CrkL effectors including DOCK180, a Rac1 GEF (Chodniewicz and Klemke, 2004). Rac1 is known to regulate lamellipodia protrusion by binding to the WAVE regulatory complex (WRC) and driving Arp2/3 complex-mediated actin polymerization (Takenawa and Suetsugu, 2007). Transient activation of Rac1 also induces formation of nascent adhesions at the cell edge, although the specific mechanism is unclear (Nobes and Hall, 1995; Zaidel-Bar et al., 2003). We used a Forster resonance energy transfer (FRET) biosensor (Rac1-2G) to measure Rac1 activity during MCF10A cell adhesion (Fritz et al., 2015). Rac1-2G FRET activity was stimulated around the periphery of cells attaching to collagen and was inhibited by the Rac1-specific inhibitor EHT1864 (Onesto et al., 2008; Figure 7A). EHT1864 also inhibited cell spreading and reduced and delayed vinculin clustering but had no effect on Cas clustering (Figure 7B, Video 9 top). Importantly, depleting Cas or Yes1 inhibited Rac1 (Figure 7C, D), consistent with Rac1 activation by the SFK–Cas–Crk/CrkL pathway (Chodniewicz and Klemke, 2004). Together, these results suggest that early clustering of phosphorylated Cas with Crk and inactive integrins activates Rac1 to trigger both cell spreading and assembly of vinculin-containing focal adhesions.

Figure 7

Download asset Open asset

Rac1 mediates Cas-dependent cell spreading and adhesion assembly.

(A) Allosteric inhibitor EHT1864 inhibits Rac1 activation during cell attachment. FRET ratio images (left) and quantification (right) of Rac1-2G MCF10A cells treated with DMSO or EHT1864 and imaged after 30 min attachment. (B) Cell spreading and vinculin but not Cas recruitment requires Rac1. Images and quantification of spreading Cas^mSc YFP-VCL MCF10A cells treated with DMSO or EHT1864. Error bars show mean and standard error of the mean (SEM) of 8–20 cells in three biological repeats. (**C, D**) Rac1 activation requires Cas and Yes1. FRET ratio images (left) and quantification (right) of Rac1-2G MCF10A cells treated with (C) control or Cas, or (D) control or Yes1 siRNA. Error bars show mean and SEM from >30 cells from three biological replicates. ns, not significant; *p < 0.05; ***p < 0.001; ****p < 0.0001 by Mann–Whitney U-tests.

Video 9

Download asset

Linkage between cell spreading and adhesion assembly through positive and negative feedback

If the sole function of Cas in focal adhesion assembly is to activate Rac1, then Rac1 activation may bypass the need for Cas. To test this possibility, we over-expressed either wildtype or constitutively active GFP-Rac1^Q61L in MCF10A Cas^mSc cells by transient transfection and examined cells during attachment to collagen. As expected, GFP-Rac1^Q61L cells spread more than GFP-Rac1^WT cells (Figure 8A). Surprisingly, Cas depletion prevented Rac1-induced spreading (Figure 8A). This suggests that, even though Cas requires Rac1 to support normal spreading and adhesion formation, active Rac1 requires Cas to induce spreading, raising the possibility of a positive feedback loop from Rac1 back to Cas.

Figure 8

Download asset Open asset

Positive and negative feedback regulates focal adhesion assembly.

(A) Rac1 requires Cas to induce cell spreading. Images and quantification of MCF10A cells expressing EGFP-Rac1WT or -Rac1Q61L that were treated with control or Cas siRNA and fixed after 30 min of spreading. (**B, C**) Reactive oxygen species (ROS) regulates Rac1 activation, Rac1 activation, cell spreading and vinculin recruitment to Cas clusters. (B) FRET images and quantification of Rac1-2G MCF10A cells treated with DMSO or NADPH-dependent oxidase inhibitor diphenylamineiodonium (DPI) and fixed after 30 min of spreading. (C) Images and quantification of Cas^mSc YFP-VCL MCF10A cells treated with DMSO or DPI. Graphs show mean cell area, mean Cas^mSc and YFP-VCL intensity, and median Δt_1/2 (VCL-Cas) from 7 to 12 cells in three biological repeats. (D) Inhibiting Cullins accelerates vinculin recruitment to Cas clusters. Images and quantification of Cas^mSc YFP-VCL MCF10A cells treated with control or SOCS6 siRNA or with DMSO or Cullin Neddylation inhibitor MLN4924. Graphs show median Δt_1/2 (VCL-Cas) from 8 to 12 cells in three biological repeats. All error bars represent mean and standard error of the mean (SEM) and all p values by Mann–Whitney U-tests. (E) Two-step model. In the first step, co-clustering of Cas with inactive integrin leads to SFK-dependent phosphorylation of Cas, recruitment of Crk/CrkL, activation of Rac1, ROS production, and positive feedback that strengthens and maintains signaling to form a nascent adhesion. Positive feedback is opposed by negative feedback resulting from CRL5^SOCS6. In a second step, integrin β1 is activated and talin1, kindlin2, vinculin, actin, and other proteins are recruited to form a focal adhesion. The second step may be triggered by growth of the nascent adhesion to a critical size, or by decreased occupancy with Cas. See Discussion for details.

We investigated which Rac1 effector may be involved in positive feedback on Cas. Rac1 stimulates localized production of ROS by the Nox1 NADPH-dependent oxidase by binding p47^phox (Ushio-Fukai, 2006). ROS are short-range signaling molecules, rapidly reacting with and inhibiting protein-tyrosine phosphatases (PTPs) and increasing local tyrosine phosphorylation of various substrates including Cas, SFKs, and p190RhoGAP (Garton et al., 1996; Giannoni et al., 2005; Nimnual et al., 2003; Tonks, 2005). Thus, Rac1 potentially activates Cas through a Rac1–ROS–PTP–SFK–Cas pathway. Such a positive feedback loop, where the output signal is fed back as input, can amplify the signal, enhancing the outcome (Brandman and Meyer, 2008). To test whether ROS are involved in positive feedback and adhesion assembly in MCF10A cells, we inhibited Nox1 with diphenylamineiodonium (DPI) (Reis et al., 2020). DPI inhibited Rac1 (Figure 8B), inhibited cell spreading, and delayed vinculin recruitment to Cas clusters (Figure 8C, Video 9). This suggests that positive feedback through ROS amplifies and sustains SFK–Cas–Crk/CrkL–Rac1 activity that recruits vinculin.

Positive feedback loops require negative feedback to avoid runaway amplification (Brandman and Meyer, 2008). Phosphorylation-dependent signaling can be inhibited by PTPs or phosphorylation-dependent proteolysis. Cas signaling is inhibited by negative feedback through the CRL5^SOCS6 ubiquitin ligase complex, which targets activated Cas for proteasomal degradation (Teckchandani and Cooper, 2016; Teckchandani et al., 2014). We tested whether CRL5^SOCS6 regulates focal adhesion assembly during MCF10A cell attachment. Either SOCS6 depletion or a Cullin inhibitor, MLN4924, shortened Δt_1/2 (VCL-Cas) during cluster assembly, consistent with CRL5^SOCS6 interfering with focal adhesion formation by negative feedback on phospho-Cas signaling (Figure 8D, Video 10).

Video 10

Download asset

Together, these results suggest a model in which nascent clusters of inactive integrin β1, phosphorylated Cas, active SFKs and Crk stimulate Rac1 and generate ROS, creating positive feedback that strengthens and maintains signaling, fine-tuned by negative feedback from CRL5^SOCS6. Subsequently, integrin β1 is activated and talin1, kindlin2, vinculin, and other mechanosensing proteins assemble to form a focal adhesion (Figure 8E).

Discussion

Recent studies of focal adhesion assembly have elucidated the fundamental role of mechanosensitive proteins such as talin in activating integrins and recruiting vinculin under RhoA-dependent actomyosin tension (Henning Stumpf et al., 2020; Kanchanawong et al., 2010; Legerstee and Houtsmuller, 2021; Wolfenson et al., 2019; Zhu et al., 2021). Other structural components of focal adhesions are recruited within a few seconds of talin binding and ECM engagement (Bachir et al., 2014; Choi et al., 2008; Han et al., 2021; Laukaitis et al., 2001). Steps preceding mechanosensing are unclear, however. Our results suggest a two-step model in which SFKs, Cas, Crk/CrkL, and Rac1 play a key role before talin and vinculin (Figure 8E). In the first step, phosphorylated Cas and Crk/CrkL cluster with inactive integrin β1. This step does not require talin1, kindlin2, vinculin, or other structural proteins tested, and these proteins are only present at low level. Moreover, the integrin is inactive, so presumably not bound to the ECM. The clusters appear to grow through positive feedback involving SFKs, Cas, Crk/CrkL, Rac1, and ROS, opposed by negative feedback through CRL5^SOCS6. Clusters may need to reach a critical size for force transmission before the next step can occur (Coyer et al., 2012). In the second step, integrin β1 is activated and mechanosensing and structural proteins accumulate. FAK is present at low level in step one but is not activated until step 2, consistent with FAK as a mechanosensor (Le Coq et al., 2022). Remarkably, levels of total and phosphorylated Cas decline during the second step. Thus, in our model, Cas regulates the first step of integrin clustering but may not be needed for the final assembly.

Our model is based largely on experiments using epithelial cells attaching to collagen through integrin α2β1 and contrast with previous studies reporting normal focal adhesion assembly when Cas and SFK-mutant fibroblasts were spreading or migrating on FN (Bockholt and Burridge, 1995; Webb et al., 2004). FN adhesions contain αv as well as β1 integrin heterodimers, so in principle a non-β1 integrin could bypass the need for Cas. Different integrins are known to have different properties. For example, integrin αv adhesions are larger and more reliant on RhoA than integrin β1 adhesions (Coyer et al., 2012), and talin1 binds more strongly to β3 than β1 (Anthis et al., 2010; Lu et al., 2016). However, our preliminary experiments suggest that the two-step model applies also to fibroblasts on FN. We found that Cas is required for epithelial and fibroblast adhesion and spreading on FN, mediated by α5β1 and one or more αv integrins. Cas clusters were also precursors of focal adhesions when epithelial cells spread on FN. A Cas requirement for adhesion assembly in previous studies of mutant fibroblasts may have been hidden by expression of Cas family members or compensation during isolation of the cell lines.

The type of integrin may explain the unexpected finding that Yes1 was limiting for integrin β1 adhesion assembly on collagen. Previous studies showed that Src regulates αvβ3 adhesions but not α5β1 adhesions (Felsenfeld et al., 1999), while Fyn and Cas were both needed for force-sensitive integrin αvβ3 adhesions (Kostic and Sheetz, 2006; von Wichert, 2003). Yes1 has a higher affinity than Src or Fyn for integrin β1 cytoplasmic tails (Arias-Salgado et al., 2003; Arias-Salgado et al., 2005). In addition, liquid-ordered membrane microdomains (lipid rafts) contain Yes1 and Fyn but not Src (Resh, 1999). These microdomains play a poorly understood role in integrin clustering (Lietha and Izard, 2020). Therefore, Yes1 preference for membrane microdomains and integrin tails may explain its special role in Cas-dependent integrin clustering.

SFK–Cas–Crk/CrkL–Rac1 signaling not only initiates focal adhesion formation but also cell spreading. Curiously, cell spreading induced by active Rac1 was also Cas dependent. This appears to be due to positive feedback by Rac1-dependent ROS generation and ROS activation of SFK–Cas signaling (Garton et al., 1996; Giannoni et al., 2005; Nimnual et al., 2003; Tonks, 2005; Ushio-Fukai, 2006). Such feedback may serve to amplify and spread the signal, allowing the initial integrin–Cas clusters to grow in the face of negative feedback through CRL5^SOCS6. However, the positive feedback makes it challenging to identify the exact mechanism for initial cluster growth and later adhesion assembly. For example, SFK–Cas–Crk/CrkL signaling may only be required to activate Rac1, and Rac1 may then induce integrin clustering. Indeed, seminal studies showed that transient expression of active Rac1 induces focal complexes, although the Rac1 effector involved is unclear (Nobes and Hall, 1995). That study also showed that Rac1-induced focal complexes only mature into focal adhesions when Rac1 is inhibited, RhoA is activated, and actomyosin tension develops. The loss of Cas from clusters may thus be important in our system to locally decrease Rac1 activity and allow force generation for focal adhesion maturation. Unfortunately, the Rac1 sensor we used did not allow high resolution temporal imaging of Rac1 activity at the level of individual adhesions. Alternatively, Rac1 may only be needed to generate ROS and stimulate Cas phosphorylation, and the latter may induce integrin clustering. This could occur by formation of networks of phospho-Cas, Crk, and multivalent Crk-binding proteins like DOCK180, linked somehow to integrin tails. Recent studies elegantly showed that phospho-Cas forms protein condensates when mixed with an SH2–SH3 protein, Nck, and an Nck-binding protein, N-WASP, in vitro (Case et al., 2022). These protein condensates synergize with FAK–paxillin condensates and kindlin to cluster integrin tails on planar lipid bilayers in vitro. It is possible that similar protein condensates or networks form in our system. These condensates could then grow in space and time through Rac1-induced actin polymerization, and positive feedback through ROS.

Our studies also raise the question of how phospho-Cas induces integrin β1 clustering. Cas localization to focal adhesions requires its SH3 and FAT domains (Donato et al., 2010; Nakamoto et al., 1997). These domains are thought to localize Cas in adhesions by direct binding to FAK, vinculin and paxillin (Janoštiak et al., 2014a; Polte and Hanks, 1995; Zhang et al., 2017). However, FAK, vinculin, and paxillin levels were low in initial phospho-Cas–Crk–integrin clusters and increase when Cas levels decrease, suggesting that Cas associates with integrins through a different mechanism. For example, the integrin β1 tail may bind to Yes1 that is associated with Cas (Arias-Salgado et al., 2005), or membrane microdomains could mediate co-clustering of Yes1 with integrins (Lietha and Izard, 2020). Whatever the mechanism for cluster formation, cluster growth could then activate associated SFKs by increasing transphosphorylation (Arias-Salgado et al., 2003; Berrier et al., 2002; Bodeau et al., 2001; Buensuceso et al., 2003). Further understanding of the precise mechanism will require additional in vivo and in vitro analysis.

Materials and methods

Plasmids

pMSCV-Puro-EYFP-vinculin, pMSCV-Puro-EYFP-mCasWT, pMSCV-Puro-EYFP-mCas15F, and pBabe-Puro-mCherry-mVCL were described previously (Teckchandani and Cooper, 2016). EGFP-Rac1^WT and EGFP-Rac1^Q61L were provided by K. Wennerberg, University of North Carolina, Chapel Hill, NC (Arthur et al., 2004). The following vectors were gifts from the indicated investigators: pmScarlet-i_C1 (Dorus Gadella, Addgene plasmid # 85044), pORANGE cloning template vector (Harold MacGillavry, Addgene # 131471), pCE-mp53DD (Shinya Yamanaka, Addgene # 41856), pLenti-Rac1-2G (Olivier Pertz, Addgene # 66111), pcDNA3.1-mGreenLantern (Gregory Petsko, Addgene # 161912) (Campbell et al., 2020), pMD2.G and psPAX2 (Didier Trono, Addgene #12259 and 12260). pLenti Ecto-pHluorin β1 integrin with 4-residue linkers was kindly provided by David A. Calderwood (Yale University School of Medicine, USA) (Huet-Calderwood et al., 2017).

Gene editing

Request a detailed protocol

We inserted fluorescent protein tags into endogenous genes by homology-independent intron targeting, with modifications (Serebrenik et al., 2019; Zhong et al., 2021). Intron targeting has several advantages over exon targeting. First, the exact position of artificial exon within the intron is unimportant, allowing insertion at the single guide RNA (sgRNA) SpCas9 target site with highest predicted efficiency. Second, the exon does not need to be inserted precisely, since errors should be corrected by RNA splicing. Thus, homology arms are unnecessary, shortening the donor sequence. Third, by inserting a fluorescent protein open-reading frame lacking an initiation codon, the majority of fluorescent cells should be correctly targeted and can be isolated by FACS without need for single-cell cloning.

We used the pORANGE vector which encodes an sgRNA, SpCas9, and a polylinker for subcloning the donor sequence (Willems et al., 2020). Target sites were identified in introns of interest using the CHOPCHOP sgRNA designer (Labun et al., 2019). Corresponding sgRNA sequences were synthesized (Integrated DNA Technologies), annealed and inserted into pORANGE using combined restriction digestion and ligation at the BbsI sites. Donor sequences were then inserted at the HindIII (5′) and XhoI or BamHI at (3′) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).

For N-terminal tagging of Cas with mScarlet, the donor contained: (1) a canonical splice acceptor (SA) sequence Smith, 1997; (2) mScarlet, lacking its initiation codon and followed by a 24-nucleotide sequence encoding GGMDELYK; (3) a canonical splice donor (SD) sequence (Connelly and Manley, 1988). The donor sequence for mScarlet and linker was PCR amplified from pmScarlet-i_C1 using Q5 High-Fidelity DNA polymerase (New England Biolabs).

For C-terminal tagging of ITGB1 and Crk, the donor contained: (1) the SA sequence; (2) the last exon coding sequence with the stop codon replaced by a linker (GGGGARRRGQAGDPPVAT for ITGB1 [Parsons et al., 2008] or GGGS for Crk), the fluorescent tag and stop codon; (3) the SV40 3′ processing and polyadenylation sequence (Connelly and Manley, 1988). The ends of donor were sandwiched between inverted sites for the gene targeting sgRNA, ensuring donor excision by SpCas9 (Connelly and Manley, 1988; Willems et al., 2020) (see figure supplements for Cas9 target site orientation). The donor sequences were ordered as gBlocks (Integrated DNA Technologies).

The targeting vectors were transiently transfected with Lipofectamine 2000 into MCF10A epithelial cells or HeLa cells together with pCE-mp53DD, an episomal plasmid encoding a dominant-negative mutant of TP53, to avoid apoptosis due to DNA damage responses (Haapaniemi et al., 2018; Ihry et al., 2018). Two weeks after transfection, fluorescent cells were checked visually on a Leica Stellaris 5 confocal microscope and selected by FACS.

Oligonucleotides for Cas gene editing

Request a detailed protocol

Name	Sequence and notes
Cas sgRNA	BbsI-TARGET
Cas gRNA Fw	caccgATCAGCGGTGTTCACTCAAG
Cas gRNA Rv	aaacCTTGAGTGAACACCGCTGATc
Cas mScarlet PCR	HindIII-TARGET-PAM-SPLICE AC CEPTOR-mScarlet
mSc Donor HindIII Fw	ataaagcttATCAGCGGTGTTCACTCAA GGGGCTAATCTCCTCTCTTCTCCTCTCT CCAGgtgagcaagggcgaggcagt
	XhoI-PAM-TARGET-SPLICE DONOR-mScarlet_linker
mSc Donor XhoI Rv	atactcgagCCCCTTGAGTGAACACCGCT GATAACCAATACTTACcttgtacagctcgtccatgcc
Cas Genomic PCR
a	CACCTCTACATTCTAGCCTGGG
b	GAACCTGCAACCCAAAACAC
c	GCCCCGTAATGCAGAAGAAG
d	GCATGAACTCCTTGATCACTGC
Cas cDNA PCR
a	TCGGAGCCCCGAGGGCACGCG
b	CACGATGCCCTGGCGCCCATG
c	CCGCGGCACCAACTTCCCTCC
d	CGGGGATGTCGGCGGGGTGCT

Oligonucleotides and gBlocks for Crk gene editing

Request a detailed protocol

Name	Sequence and notes
Crk sgRNA	BbsI-TARGET
Crk gRNA Fw	CACCGCCCTGCGGCTGGACTTACGT
Crk gRNA Rv	AAACACGTAAGTCCAGCCGCAGGGC
Crk Genomic PCR
a	TGACCCATACAGTGACTTCAGG
b	TTATGCATCTGGGCTTGTACTG
c	GAGCAAAGACCCCAACGAGAA
d	GCTGAACTTGTGGCCGTTTAC
Crk cDNA PCR
a’	CTGATTGGAGGTAACCAGGAG
b’	GCAGATGAACTTCAGGGTCAG
Crk^mGL gBlock (Donor)	HindIII-PAM-TARGET-SPLICE ACCEPTOR -3’ORF-GGGS-mGL-stop-spacer-SV40polyA- PAM-TARGET-BamHI
	agcataaagcttCCAACGTAAGTCCAGCCGCAGGG CTAATCTCCTCTCTTCTCCTCTCTCCAGGTCGGTGA GCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTC AGTGGGAAGGGGAGTGTAATGGCAAACGAGGTCA CTTCCCATTCACACATGTCCGTCTGCTGGATCAACA GAATCCCGATGAGGACTTCAGCggcgctagcatggtgag caagggcgaggagctgttcaccggggtggtgcccatcctggtcgagc tggacggcgacgtaaacggccacaagttcagcgtgtccggcgaggg cgagggcgatgccacctacggcaagctgaccctgaagttcatctgca ccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctga cctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcag cacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcg caccatcttcttcaaggacgacggcaactacaagacccgcgccgag gtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaag ggcatcgacttcaaggaggacggcaacatcctggggcacaagct ggagtacaactacaacagccacaacgtctatatcatggccgacaa gcagaagaacggcatcaaggtgaacttcaagatccgccacaacat cgaggacggcagcgtgcagctcgccgaccactaccagcagaacac ccccatcggcgacggccccgtgctgctgcccgacaaccactacctga gcacccagtccgccctgagcaaagaccccaacgagaagcgcgatc acatggtcctgctggagttcgtgaccgccgccgggatcactctcggc atggacgagctgtacaagtaaagcgctccatggcccAACTTGTT TATTGCAGCTTATAATGGTTACAAATAAAGCAATA GCATCACAAATTTCACAAATAAAGCATTTTTTTCA CTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAA TGTATCTTATCATGTCTGGATCTCCCAACGTAAG TCCAGCCGCAGGGggatcctatgca

Oligonucleotides and gBlocks for ITGB1 gene editing

Request a detailed protocol

Name	Sequence and notes
ITGB1 sgRNA	BbsI-TARGET
ITGB1 gRNA Fw	CACCGGCGCCTTCTGTTCACGATAA
ITGB1 gRNA Rv	AAACTTATCGTGAACAGAAGGCGC
ITGB1 Genomic PCR
a	AGTAACTTCCGTAGGAGACCCC
b	CATTCTTGAGTCCTTCCTCCAC
c	AACGGCATCAAGGTGAACTTC
d	GTAGGTCAGGGTGGTCACGAG
ITGB1 cDNA PCR
a’	GTGTGGTTGCTGGAATTGTTC
b’	GTAGGTCAGGGTGGTCACGAG
ITGB1^GFP gBlock (Donor)	HindIII-PAM-TARGET-SPLICE ACCEPTOR-3’ORF-linker-GFP-stop -spacer-SV40polyA-PAM-TARGET-BamHI
	agcataaagcttCCTTTATCGTGAACAG AAGGCGCCTAATCTCCTCTCTTCTCC TCTCTCCAGGGTGAAAATCCTATTTAT AAGAGTGCCGTAACAACTGTGGTCAA TCCGAAGTATGAGGGAAAAggaggggg gggggcccggaggcggggggaggcgggggatc caccggtcgccaccatggtgagcaagggcgagg agctgttcaccggggtggtgcccatcctggtcgag ctggacggcgacgtaaacggccacaagttcagcg tgtccggcgagggcgagggcgatgccacctacgg caagctgaccctgaagttcatctgcaccaccggcaa gctgcccgtgccctggcccaccctcgtgaccaccctga cctacggcgtgcagtgcttcagccgctaccccgacca catgaagcagcacgacttcttcaagtccgccatgccc gaaggctacgtccaggagcgcaccatcttcttcaagg acgacggcaactacaagacccgcgccgaggtgaagtt cgagggcgacaccctggtgaaccgcatcgagctgaag ggcatcgacttcaaggaggacggcaacatcctggggc acaagctggagtacaactacaacagccacaacgtctat atcatggccgacaagcagaagaacggcatcaaggtg aacttcaagatccgccacaacatcgaggacggcagcg tgcagctcgccgaccactaccagcagaacacccccatcg gcgacggccccgtgctgctgcccgacaaccactacctgag cacccagtccgccctgagcaaagaccccaacgagaagcgc gatcacatggtcctgctggagttcgtgaccgccgccgggatc actctcggcatggacgagctgtacaagtaaagcgctCCAT GGCCCAACTTGTTTATTGCAGCTTATAATGG TTACAAATAAAGCAATAGCATCACAAATTTC ACAAATAAAGCATTTTTTTCACTGCATTCTAG TTGTGGTTTGTCCAAACTCATCAATGTATCTTA TCATGTCTGGATCTCCCTTTATCGTGAACAG AAGGCGCggatcctatgca

Cell lines, transfection, and infection

Request a detailed protocol

MCF10A cells were originally obtained from Dr. J. Brugge (Harvard Medical School) and confirmed by short tandem repeat (STR) profiling. Cells were cultured in Dulbecco’s modified Eagle medium, DMEM/F12 growth media (Thermo Fisher Scientific) supplemented with 5% horse serum (Thermo Fisher Scientific), 10 μg/ml insulin (Thermo Fisher Scientific), 0.1 μg/ml cholera toxin (EMD Millipore), 0.5 μg/ml hydrocortisone (Sigma-Aldrich), and 20 ng/ml epidermal growth factor (EGF) (Thermo Fisher Scientific), and passaged using trypsin/ethylenediaminetetraacetic acid (EDTA) or Accutase (Sigma-Aldrich A6964). For experiments, cells were detached with Accutase and resuspended in assay media (DMEM/F12, 2% horse serum, 0.1 μg/ml cholera toxin, 10 μg/ml insulin, 0.5 μg/ml hydrocortisone, and 0 ng/ml EGF).

HeLa (RRID:CVCL_0030) cells were initially obtained from ATCC and confirmed by STR DNA profiling. Cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin (both 100 U/ml) and passaged with trypsin/EDTA. For experiments, cells were detached using Accutase and resuspended in DMEM without serum.

HFFs were originally from Dr. Denise Galloway, Fred Hutchinson Cancer Center (Passalaris et al., 1999). They were cultured in DMEM supplemented with 10% FBS, 100× nonessential amino acids (NEAA) and penicillin/streptomycin (both 100 U/ml) and passaged using Accutase. For experiments, cells were detached using Accutase and resuspended in DMEM supplemented with NEAA without serum.

Retro- and lentiviruses were generated by transfecting 293FT cells with viral vector, pMD2.G and psPAX2 in 2:1:2 ratio with PolyJet transfection reagent (SignaGen Laboratories). Media were harvested 2 days later and added to recipient cells with 1 μg/ml polybrene (Sigma) for 8–16 hr. Expressing cells were checked visually using a Leica Stellaris 5 confocal microscope and selected using 1 μg/ml puromycin or FACS, depending on the vector.

Antibodies

Following antibodies were used: mouse anti-Cas (610271) (BD Biosciences); rabbit-phospho-Y410Cas (4011S) and phospho-Y249Cas (4014S) (Cell Signaling Technology); mouse anti-vinculin (V9131, Sigma-Aldrich); mouse anti-Crk (610035) (BD Transduction labs); mouse anti-CrkL (05-414) (Upstate); sheep anti-paxillin (AF4259, R and D Systems); rabbit anti-pY31 paxillin (44-720G, Biosource); rat anti-integrin-β1 (9EG7, 553715) and mouse anti-paxillin (610051) (BD Biosciences); rabbit anti-Talin1 (A14168-1-AP), rabbit-anti Kindlin2 (11453-1-AP), and mouse anti-FAK (66258-1-Ig) (Proteintech); rat anti-integrin-β1 (mAB13, MABT821), rabbit anti-integrin β1 (AB1952P), mouse anti-integrin β1 (12G10, MAB2247) (Millipore); rabbit-anti-integrin-β3 (A2542), rabbit-anti-integrin-αv (A2091) (abclonal); rat anti-integrin-β1 (AIIB2), mouse anti-integrin α5β1 (P8D4), and mouse anti-integrin α2β1 (P1E6) (Developmental Studies Hybridoma Bank); AlexaFluor 488 goat anti-rabbit IgG (H+L), AlexaFluor 488 goat anti-mouse IgG (H+L), AlexaFluor 647 goat anti-mouse IgG (H+L), AlexaFluor 647 goat anti-sheep IgG (H+L), and AlexaFluor 633 goat anti-rat IgG (H+L) (Invitrogen); IRDye 680RD goat anti-mouse and IRDye 800CW goat anti-rabbit (LI-COR).

Inhibitors

Inhibitor	Source	Concentration
DPI	EMD Millipore, Cat: 300260-10MG	10 μM
eCF506	Cayman Chemical, Cat: 19959	100 nM
EHT1864	ApexBio, Cat: B5487	10 μM
MLN4924	Fisher, Cat: 50161353	5 μM

siRNA transfection

Request a detailed protocol

Cells were suspended in growth media and added to dishes with 50 pmol pooled siRNA and RNAiMAX (Invitrogen) as per the manufacturer’s instructions. Transfection was repeated 2 days later and cells analyzed after a further 2 days.

Negative control siRNA	QIAGEN, Cat: 1027280	AAT TCT CCG AAC GTG TCA CGT
siFyn	Dharmacon, Cat: L-003140-00-0005	J-003140-11: CGG AUU GGC CCG AUU GAU A J-003140-12: GGA CUC AUA UGC AAG AUU G J-003140-13: GAA GCC CGC UCC UUG ACA A J-003140-14: GGA GAG ACA GGU UAC AUU C
siCrk	Dharmacon, Cat: M-010503-03-0005	D-010503-02: GGA GAC AUC UUG AGA AUC C D-010503-03: UCC CUU ACG UCG AGA AGU A D-010503-04: GGA CAG CGA AGG CAA GAG A D-010503-19: GGG ACU AUG UGC UCA GCG U
siCrkL	Dharmacon, Cat: M-012023-02-0005	D-012023-01: CCG AAG ACC UGC CCU UUA A D-012023-02: GAA GAU AAC CUG GAA UAU G D-012023-05: AAU AGG AAU UCC AAC AGU U D-012023-18: AGU AAA ACU UAA CGG ACU U
siSOCS6	QIAGEN, Cat: GS9306	SI03068359: CAG CTG CGA TAT CAA CGG TGA SI00061383: TAG AAT CGT GAA TTG ACA TAA SI00061376: CGG GTA CAA ATT GGC ATA ACA SI00061369: TTG ATC TAA TTG AGC ATT CAA
siYes1	QIAGEN, Cat: GS7525	SI02223942: GAG GCT CCT GCT TAT TTA TAA SI02223935: CCA GCC TAC ATT CAC TTC TAA SI00302218: AAT CCC TCC ATG AAT TGA TGA SI02635206: AAG TAT AAT GCA GTA CAT TAA
siBCAR1 (Cas)	QIAGEN, Cat: GS9564	SI02757741: AAG CAG TTT GAA CGA CTG GAA SI02757734: CTG GAT GGA GGA CTA TGA CTA SI04438280: CCA GGA ATC TGT ATA TAT TTA SI04438273: CAA CCT GAC CAC ACT GAC CAA
Human-specific siBCAR1 (Cas)	QIAGEN	SI00106876: TTGACTAAGAGTCTCCATTTA SI03065874: CAGCATCACGCGGCAGGGCAA SI04438273: CAACCTGACCACACTGACCAA SI04438280: CCAGGAATCTGTATATATTTA
siSrc	QIAGEN, Cat: GS6714	SI02664151: CTC CAT GTG CGT CCA TAT TTA SI02223928: CGG CTT GTG GGT GAT GTT TGA SI02223921: AAG CAG TGC CTG CCT ATC AAA SI03041605: ACG GCG CGG CAA GGT GCC AAA
siVinculin	Dharmacon, Cat: L-009288-00-0005	J-009288-05: UGA GAU AAU UCG UGU GUU A J-009288-06: GAG CGA AUC CCA ACC AUA A J-009288-07: GCC AAG CAG UGC ACA GAU A J-009288-08: CAG CAU UUA UUA AGG UUG A
siPTK2 (FAK)	Dharmacon, Cat: L-003164-00-0005	J-003164-13: GCG AUU AUA UGU UAG AGA U J-003164-14: GGG CAU CAU UCA GAA GAU A J-003164-15: UAG UAC AGC UCU UGC AUA U J-003164-16: GGA CAU UAU UGG CCA CUG U
siPaxillin	Dharmacon, Cat: L-005163-00-005	J-005163-05: CAA CUG GAA ACC ACA CAU A J-005163-06: GGA CGU GGC ACC CUG AAC A J-005163-07: CCA AAC GGC CUG UGU UCU U J-005163-08: UGA CGA AAG AGA AGC CUA A
siFERMT2 (Kindlin2)	Dharmacon, Cat: L-012753-00-0005	J-012753-05: GCC CAG GAC UGU AUA GUA A J-012753-06: CUA CAU AUU UCU CUC AAC A J-012753-07: GAA CUG AGU GUC CAU GUG A J-012753-08: AAU GAA AUC UGG CUU CGU U
siTalin1	Dharmacon, Cat: L-012949-00-005	J-012949-05: GAA GAU GGU UGG CGG CAU U J-012949-06: GUA GAG GAC CUG ACA ACA A J-012949-07: UCA AUC AGC UCA UCA CUA U J-012949-08: GAG AUG AGG AGU CUA CUA U
siITGB1	Santa Cruz, Cat: sc-35674	sc-35674A: GAGAUGAGGUUCAAUUUGATT sc-35674B: GAUGAGGUUCAAUUUGAAATT sc-35674C: GUACAGAUCCGAAGUUUCATT
siITGAV	Santa Cruz, Cat: sc-29373	sc-29373A: GCAUCUAUCUUGAAAGUAATT sc-29373B: CUGGUUUGAACGAUAGAAATT sc-29373C: GAAGCUGUGUAGUAUAUCATT

Cell lysis and immunoblotting

Request a detailed protocol

Cells were harvested after 30 min of attachment. Cells were washed three times with cold phosphate-buffered saline (PBS) followed by lysis in radioimmunoprecipitation assay (RIPA) buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 20 mM Tris–HCl pH 7.4, 150 mM NaCl, 5 mM ethylene glycol tetraacetic acid (EGTA)) with freshly added protease and phosphatase inhibitors (10 µg/ml Aprotinin, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM sodium vanadate) on ice. The lysates were collected after 30 min of incubation on ice and centrifuged at 12,000 rpm for 10 min at 4°C. Supernatants were collected and adjusted to equal protein concentration using the Pierce BCA protein assay kit.

Lysates were adjusted to SDS sample buffer, heated at 95°C, and resolved on SDS–polyacrylamide gel electrophoresis (PAGE) using 15% polyacrylamide/0.133% bis-acrylamide or 12.5% acrylamide/0.1% bis-acrylamide gels, and transferred on to nitrocellulose membrane. Blocking was performed in Odyssey blocking buffer (LI-COR Biosciences) supplemented with 5% bovine serum albumin (BSA) for 30 min. After blocking, membrane was probed with the primary antibody overnight, washed in Tris-buffered saline 0.1% Tween 20, followed by incubation for 45 min with IRDye 800CW goat anti-rabbit or 680RD goat anti-mouse-conjugated secondary antibodies. Images were collected using the Odyssey Infrared Imaging System (LI-COR Biosciences) and quantified using ImageJ.

Cell spreading and migration assays

Request a detailed protocol

Cells were treated with siRNA using the double transfection method as described above. Cells were starved overnight in assay media (MCF10A) or DMEM (HeLa), then detached with Accutase and resuspended in assay media or DMEM. Cells were incubated for 60 min in 5% CO₂ at 37°C in suspension before adding to glass-bottom dishes (FluoroDish, FD35-100, World Precision Instruments) or 12 mm diameter coverslips (Fisherbrand 1254580) that had been previously coated with 50 μg/ml collagen-I (Advance Biomatrix, #5056) or 5 μg/ml FN (Sigma, #F1141) for at least 3 hr at 37°C and washed with PBS. Pharmacological agents were added just before seeding cells for imaging.

Live imaging

Request a detailed protocol

Dual-color imaging of live cells was performed for a 30-min time period, either immediately after plating the cells, to record attachment and spreading, or approximately 24 hr after plating, to record spontaneous lamellipodia formation. Images were recorded in 4–5 fields of view on a fully automated TIRF microscope (Nikon Ti, ×100/1.49 CFI Apo TIRF oil immersion objective) equipped with Perfect Focus, motorized x–y stage, fast piezo z stage, stage-top incubator with temperature and CO₂ control, and Andor iXon X3 EMCCD camera with 512 × 512-pixel chip (16 µm pixels). The images were acquired using Nikon NIS Elements software and processed using ImageJ. Frame rate varied between 15 and 20 s depending on the number of fields of view recorded. Slight drift in the dual color time-lapse images was corrected using ImageJ registration tool Image Stabilizer.

Cell migration was imaged once every 15 min for 12 hr using phase-contrast microscopy on an IncuCyte S3 and analyzed using ImageJ.

Immunofluorescence imaging

Request a detailed protocol

MCF10A Cas^mSc cells, either expressing YFP-vinculin or not, were plated on glass-bottom dishes or coverslips and allowed to attach for 30 min before fixation with 4% paraformaldehyde in PBS for 15 min. Cells were permeabilized with 0.1% Triton X-100 in PBS for 5 min, and blocked for an hour in 5% normal goat serum, 2% BSA in PBS, all at room temperature. The cells were incubated with different combinations of primary antibodies (1:200 dilution) for either 2–3 hr at room temperature or overnight at 4°C, then washed gently three times. Alexa Fluor-conjugated secondary antibodies were added at 1:200 dilution for 1 hr at room temperature. Alexa Fluor 488- or 647-conjugated phalloidin was used for F-actin. Glass-bottom dishes were left in PBS for TIRF microscopy as above. Coverslips were mounted in ProLong Gold (Invitrogen) for confocal microscopy using a Dragonfly 200 High-speed Spinning disk confocal imaging platform (Andor Technology Ltd) on a Leica DMi8 microscope stand equipped with a ×100/1.4 oil immersion objective, iXon EMCCD and sCMOS Zyla cameras and Fusion Version 2.3.0.36 (Oxford Instruments) software together with Imaris simultaneous deconvolution. The most ventral plane was used for quantification.

Immunofluorescence quantification

Request a detailed protocol

Macros were written in ImageJ for uniform image processing and analysis. Backgrounds were subtracted and intensities adjusted equally across each image set.

For analysis of the spatial distribution of the proteins and phosphoproteins within Cas/vinculin clusters, a line (5 × 25-pixels width × length, 0.16 µm/pixel) was plotted along the major axis of a Cas^mSc cluster, starting from the outer edge and moving inwards. The intensity profile for each antibody along this line was quantified in ImageJ and aligned using Cas^mSc as a reference point. The mean normalized intensity profile for each antibody was then calculated across 20–25 regions from several cells. A heat map for the mean intensity profile of the normalized value was generated using GraphPad Prism.

To analyze the number and intensity of clusters containing either Cas or vinculin, or both, images were first spit into individual channels and then summed using the ‘Image calculator’ command in ImageJ. This summed image was used to generate a binary image mask by applying manual threshold through the Yen method. ROIs >20 pixels (0.52 μm²) were then counted and their mean areas and mean Cas and vinculin intensities quantified. Cell area was quantified either manually by drawing around the cell or from a binary mask created by thresholding through the Triangle method, setting minimum size as 50 pixels.

Quantification of cluster kinetics from two-color TIRF videos

Request a detailed protocol

TIRF image datasets were exported as two-channel time-series hyperstacks in TIF format. Quantification of the time shift between red (Cas^mSc) and green (YFP-VCL, β1-EctopH, ITGB1^GFP or Crk^mGL) cluster formation was performed in MATLAB (R2021b). The pipeline involves the following steps: drift correction, image preprocessing and denoising, focal adhesion segmentation and tracking, intensities extraction and normalization, and signal analysis.

Drifts between time frames were corrected by registering the image of one frame to the image of the previous frame using a translation transformation. Drift corrected timeseries were then denoised with a median filter and their background was equalized with a top-hat transform. Clusters were segmented separately in each channel at each time frame by intensity thresholding and size filtering. Threshold values were arbitrarily defined as a quarter of the intensity value of the 50th brightest pixel of the dataset for each channel, and the union of the binary masks of the two channels with an area greater than 20 pixels (0.52 μm²) was used to define clusters. Clusters were tracked over time by creating a 3D stack (XYT) and by computing the resulting connected components. Only clusters tracked in three or more frames (≥40 s) were quantified. For each tracked cluster, the average mean intensity of each channel over time was extracted by first measuring the mean intensity within the mask at each time frame from time zero to the end, resulting in a number of intensity traces equal to the number of time frames where the cluster was tracked.

To calculate the time shift between the red and green channel intensity profiles for each tracked cluster, average mean intensity traces were rescaled to the [0 1] value range, and after smoothing the signal by applying a moving average filter, the time at which the rescaled intensity reaches 0.5 (t_1/2) was interpolated. The time shift was finally calculated by subtracting red (Cas) t_1/2 from green (vinculin, integrin, or Crk) t_1/2.

Adhesome isolation

Request a detailed protocol

Adhesome samples were isolated as described with minor modifications (Schiefermeier et al., 2014). MCF10A cells were detached from near-confluent 5 cm plates, resuspended in assay media, incubated in suspension for 30 min, then re-seeded onto an equal number of 5 cm plates that had been precoated with 50 μg/ml collagen. After 1 hr at 37°C, one dish was washed and lysed in 400 μl RIPA buffer to provide a sample of total protein (T) and the other dishes were washed gently with room temperature PBS and incubated with 2 ml freshly diluted 0.5 mM dithiobis(succinimidyl propionate) (EMD Millipore 322133) 0.05 mM (1,4-di [3′-(2′-pyridyldithio)propionamido] butane) (Sigma 16646) in PBS for 5 min at room temperature. Cross-linking was terminated by washing twice with 50 mM Tris 140 mM NaCl pH 7.4 before transferring to ice. 400 μl RIPA buffer was added and the plates were rocked at 4°C for 1 hr. Supernatants (S) were collected in a 2-ml microtube (Axygen MCT-200-L-C). The plates were washed twice with PBS, drained, and 400 μl RIPA buffer added. 2-Mercaptoethanol was added to 2% concentration to all samples, and all microtubes and dishes were sealed and incubated at 50°C for 1 hr. After cooling to room temperature, the dish was scraped and the adhesome (A) fraction was transferred to a 2 ml microtube. Total, supernatant, and adhesome fractions were sonicated (10 s, microtip) to shear DNA and the proteins were precipitated by adding 1.6 ml acetone and placing at −20°C for 1 hr. After centrifugation (10 min, 14,000 rpm), pellets were drained, dried in a stream of air, and incubated with 25 μl 5× concentrated SDS sample buffer at 95°C for 5 min, then 100 μl RIPA buffer was added to all tubes. Samples were centrifuged and equal volumes analyzed by SDS–PAGE, typically on 10% acrylamide/0.13% bisacrylamide gels, followed by Western blotting. The procedure was scaled up as needed to run replicate blots for probing with different antibody combinations. On occasion, dilutions of the T sample were loaded to estimate detection sensitivity.

Ratiometric FRET imaging

Request a detailed protocol

The Rac1-2G reporter was expressed in MCF10A cells by lentiviral transduction. After siRNA treatment, cells were allowed to attach to collagen for 30 min in the absence or presence of various inhibitors, then fixed and mounted. Coverslips were imaged on a Leica SP8 confocal microscope using Leica HCX Plan Apo ×63/1.40 oil immersion objective. Excitation and emission wavelengths as follows: donor (mTFP1) excitation 440 nm, emission 450–510 nm: FRET excitation 440 nm, emission 515–600 nm; acceptor (mVenus) excitation 514 nm, emission 515–600 nm. All channels were collected on the HyD detectors. Images were processed with the Lightening deconvolution (Leica LASX software) and the FRET ratio in the most ventral plane was quantified using ImageJ as described (Kardash et al., 2011).

Statistics

Data were analyzed using GraphPad Prism. Median and 95% confidence intervals were calculated for non-normal distributions of measurements from single cells. Data from multiple cells or biological replicates were assumed to follow normal distributions allowing calculation of mean and SEM in cases where data from multiple cells in biologically independent experiments were combined. Pairwise comparisons between control and experimental populations testing independent hypotheses were made using the non-parametric Mann–Whitney U-test. Experiments testing alternative hypotheses were analyzed using the non-parametric Kruskal–Wallis analysis of variance followed by Dunn’s multiple comparison test.

Data availability

All raw Western blots generated during the study have been included as source files. Matlab code used in the study is uploaded on GitHub (https://github.com/FredHutch/Cas-integrin-paper-2023-Cooper-lab, copy archived at Fred Hutchinson Cancer Center, 2023).

References

(2003) Integrin alpha5beta1 supports the migration of Xenopus cranial neural crest on fibronectin
Developmental Biology 260:449–464.
https://doi.org/10.1016/s0012-1606(03)00277-x
- PubMed
- Google Scholar
(2010) Structural diversity in integrin/talin interactions
Structure 18:1654–1666.
https://doi.org/10.1016/j.str.2010.09.018
- PubMed
- Google Scholar
(2003) Src kinase activation by direct interaction with the integrin beta cytoplasmic domain
PNAS 100:13298–13302.
https://doi.org/10.1073/pnas.2336149100
- PubMed
- Google Scholar
(2005) Specification of the direction of adhesive signaling by the integrin beta cytoplasmic domain
The Journal of Biological Chemistry 280:29699–29707.
https://doi.org/10.1074/jbc.M503508200
- PubMed
- Google Scholar
(2004) Rap1 promotes cell spreading by localizing Rac guanine nucleotide exchange factors
The Journal of Cell Biology 167:111–122.
https://doi.org/10.1083/jcb.200404068
- PubMed
- Google Scholar
1. Bachir AI
2. Zareno J
3. Moissoglu K
4. Plow EF
5. Gratton E
6. Horwitz AR
(2014) Integrin-associated complexes form hierarchically with variable stoichiometry in nascent adhesions
Current Biology 24:1845–1853.
https://doi.org/10.1016/j.cub.2014.07.011
- PubMed
- Google Scholar
1. Bachmann M
2. Su B
3. Rahikainen R
4. Hytönen VP
5. Wu J
6. Wehrle-Haller B
(2023) ConFERMing the role of talin in integrin activation and mechanosignaling
Journal of Cell Science 136:jcs260576.
https://doi.org/10.1242/jcs.260576
- PubMed
- Google Scholar
(2002) The integrin beta tail is required and sufficient to regulate adhesion signaling to Rac1
Journal of Cell Science 115:4285–4291.
https://doi.org/10.1242/jcs.00109
- PubMed
- Google Scholar
1. Bockholt SM
2. Burridge K
(1995) An examination of focal adhesion formation and tyrosine phosphorylation in fibroblasts isolated from src-, fyn-, and yes- mice
Cell Adhesion and Communication 3:91–100.
https://doi.org/10.3109/15419069509081279
- PubMed
- Google Scholar
(2001) A functional comparison of mutations in integrin beta cytoplasmic domains: effects on the regulation of tyrosine phosphorylation, cell spreading, cell attachment and beta1 integrin conformation
Journal of Cell Science 114:2795–2807.
https://doi.org/10.1242/jcs.114.15.2795
- PubMed
- Google Scholar
1. Brandman O
2. Meyer T
(2008) Feedback loops shape cellular signals in space and time
Science 322:390–395.
https://doi.org/10.1126/science.1160617
- PubMed
- Google Scholar
(2003) Detection of integrin alpha IIbbeta 3 clustering in living cells
The Journal of Biological Chemistry 278:15217–15224.
https://doi.org/10.1074/jbc.M213234200
- PubMed
- Google Scholar
1. Burridge K
2. Chrzanowska-Wodnicka M
(1996) Focal adhesions, contractility, and signaling
Annual Review of Cell and Developmental Biology 12:463–518.
https://doi.org/10.1146/annurev.cellbio.12.1.463
- PubMed
- Google Scholar
1. Campbell BC
2. Nabel EM
3. Murdock MH
4. Lao-Peregrin C
5. Tsoulfas P
6. Blackmore MG
7. Lee FS
8. Liston C
9. Morishita H
10. Petsko GA
(2020) mGreenLantern: a bright monomeric fluorescent protein with rapid expression and cell filling properties for neuronal imaging
PNAS 117:30710–30721.
https://doi.org/10.1073/pnas.2000942117
- PubMed
- Google Scholar
(1990) The role of integrins alpha 2 beta 1 and alpha 3 beta 1 in cell-cell and cell-substrate adhesion of human epidermal cells
The Journal of Cell Biology 110:1387–1404.
https://doi.org/10.1083/jcb.110.4.1387
- Google Scholar
(2022) Synergistic phase separation of two pathways promotes integrin clustering and nascent adhesion formation
eLife 11:e72588.
https://doi.org/10.7554/eLife.72588
- PubMed
- Google Scholar
1. Chodniewicz D
2. Klemke RL
(2004) Regulation of integrin-mediated cellular responses through assembly of a CAS/Crk scaffold
Biochimica et Biophysica Acta 1692:63–76.
https://doi.org/10.1016/j.bbamcr.2004.03.006
- PubMed
- Google Scholar
(2008) Actin and alpha-actinin orchestrate the assembly and maturation of nascent adhesions in a myosin II motor-independent manner
Nature Cell Biology 10:1039–1050.
https://doi.org/10.1038/ncb1763
- PubMed
- Google Scholar
1. Connelly S
2. Manley JL
(1988) A functional mRNA polyadenylation signal is required for transcription termination by RNA polymerase II
Genes & Development 2:440–452.
https://doi.org/10.1101/gad.2.4.440
- PubMed
- Google Scholar
(2012) Nanopatterning Reveals an ECM Area Threshold for Focal Adhesion Assembly and Force Transmission that is regulated by Integrin Activation and Cytoskeleton Tension
Journal of Cell Science 125:5110–5123.
https://doi.org/10.1242/jcs.108035
- Google Scholar
(2002) Mesendoderm extension and mantle closure in Xenopus laevis gastrulation: combined roles for integrin alpha(5)beta(1), fibronectin, and tissue geometry
Developmental Biology 242:109–129.
https://doi.org/10.1006/dbio.2002.0537
- PubMed
- Google Scholar
1. Debnath J
2. Brugge JS
(2005) Modelling glandular epithelial cancers in three-dimensional cultures
Nature Reviews. Cancer 5:675–688.
https://doi.org/10.1038/nrc1695
- PubMed
- Google Scholar
(2010) Dynamics and mechanism of p130Cas localization to focal adhesions
The Journal of Biological Chemistry 285:20769–20779.
https://doi.org/10.1074/jbc.M109.091207
- PubMed
- Google Scholar
1. Eliceiri BP
2. Puente XS
3. Hood JD
4. Stupack DG
5. Schlaepfer DD
6. Huang XZ
7. Sheppard D
8. Cheresh DA
(2002) Src-mediated coupling of focal adhesion kinase to integrin alpha(v)beta5 in vascular endothelial growth factor signaling
The Journal of Cell Biology 157:149–160.
https://doi.org/10.1083/jcb.200109079
- PubMed
- Google Scholar
(1999) Selective regulation of integrin--cytoskeleton interactions by the tyrosine kinase Src
Nature Cell Biology 1:200–206.
https://doi.org/10.1038/12021
- PubMed
- Google Scholar
1. Fraser C
2. Dawson JC
3. Dowling R
4. Houston DR
5. Weiss JT
6. Munro AF
7. Muir M
8. Harrington L
9. Webster SP
10. Frame MC
11. Brunton VG
12. Patton EE
13. Carragher NO
14. Unciti-Broceta A
(2016) Rapid Discovery and Structure-Activity Relationships of Pyrazolopyrimidines That Potently Suppress Breast Cancer Cell Growth via SRC Kinase Inhibition with Exceptional Selectivity over ABL Kinase
Journal of Medicinal Chemistry 59:4697–4710.
https://doi.org/10.1021/acs.jmedchem.6b00065
- PubMed
- Google Scholar
Software
1. Fred Hutchinson Cancer Center
(2023) Cas-integrin-Paper-2023-Cooper-lab, version swh:1:rev:711fead18db44936ae550658f377d0a1bafef6e2
Software Heritage.

https://archive.softwareheritage.org/swh:1:dir:811baa8c228710fd06b5129e2e78e91e94a95d5a;origin=https://github.com/FredHutch/Cas-integrin-paper-2023-Cooper-lab;visit=swh:1:snp:8df81619607e367d11858ba6bd6b7d82c8a7d689;anchor=swh:1:rev:711fead18db44936ae550658f377d0a1bafef6e2
1. Fritz RD
2. Menshykau D
3. Martin K
4. Reimann A
5. Pontelli V
6. Pertz O
(2015) SrGAP2-Dependent Integration of Membrane Geometry and Slit-Robo-Repulsive Cues Regulates Fibroblast Contact Inhibition of Locomotion
Developmental Cell 35:78–92.
https://doi.org/10.1016/j.devcel.2015.09.002
- PubMed
- Google Scholar
1. Gailit J
2. Ruoslahti E
(1988)
Regulation of the fibronectin receptor affinity by divalent cations

The Journal of Biological Chemistry 263:12927–12932.
- PubMed
- Google Scholar
(1996) Identification of p130(cas) as a substrate for the cytosolic protein tyrosine phosphatase PTP-PEST
Molecular and Cellular Biology 16:6408–6418.
https://doi.org/10.1128/MCB.16.11.6408
- PubMed
- Google Scholar
(2005) Intracellular reactive oxygen species activate Src tyrosine kinase during cell adhesion and anchorage-dependent cell growth
Molecular and Cellular Biology 25:6391–6403.
https://doi.org/10.1128/MCB.25.15.6391-6403.2005
- PubMed
- Google Scholar
1. Gotoh T
2. Hattori S
3. Nakamura S
4. Kitayama H
5. Noda M
6. Takai Y
7. Kaibuchi K
8. Matsui H
9. Hatase O
10. Takahashi H
(1995) Identification of Rap1 as a target for the Crk SH3 domain-binding guanine nucleotide-releasing factor C3G
Molecular and Cellular Biology 15:6746–6753.
https://doi.org/10.1128/MCB.15.12.6746
- PubMed
- Google Scholar
(2018) CRISPR-Cas9 genome editing induces a p53-mediated DNA damage response
Nature Medicine 24:927–930.
https://doi.org/10.1038/s41591-018-0049-z
- PubMed
- Google Scholar
1. Han SJ
2. Azarova EV
3. Whitewood AJ
4. Bachir A
5. Guttierrez E
6. Groisman A
7. Horwitz AR
8. Goult BT
9. Dean KM
10. Danuser G
(2021) Pre-complexation of talin and vinculin without tension is required for efficient nascent adhesion maturation
eLife 10:e66151.
https://doi.org/10.7554/eLife.66151
- PubMed
- Google Scholar
1. Hasegawa H
2. Kiyokawa E
3. Tanaka S
4. Nagashima K
5. Gotoh N
6. Shibuya M
7. Kurata T
8. Matsuda M
(1996) DOCK180, a major CRK-binding protein, alters cell morphology upon translocation to the cell membrane
Molecular and Cellular Biology 16:1770–1776.
https://doi.org/10.1128/MCB.16.4.1770
- PubMed
- Google Scholar
(2020) Recent advances and prospects in the research of nascent adhesions
Frontiers in Physiology 11:574371.
https://doi.org/10.3389/fphys.2020.574371
- PubMed
- Google Scholar
1. Honda H
2. Oda H
3. Nakamoto T
4. Honda Z
5. Sakai R
6. Suzuki T
7. Saito T
8. Nakamura K
9. Nakao K
10. Ishikawa T
11. Katsuki M
12. Yazaki Y
13. Hirai H
(1998) Cardiovascular anomaly, impaired actin bundling and resistance to Src-induced transformation in mice lacking p130Cas
Nature Genetics 19:361–365.
https://doi.org/10.1038/1246
- PubMed
- Google Scholar
1. Honda H
2. Nakamoto T
3. Sakai R
4. Hirai H
(1999) p130Cas, an Assembling Molecule of Actin Filaments, Promotes Cell Movement, Cell Migration, and Cell Spreading in Fibroblasts
Biochemical and Biophysical Research Communications 262:25–30.
https://doi.org/10.1006/bbrc.1999.1162
- Google Scholar
1. Hotta K
2. Ranganathan S
3. Liu R
4. Wu F
5. Machiyama H
6. Gao R
7. Hirata H
8. Soni N
9. Ohe T
10. Hogue CWV
11. Madhusudhan MS
12. Sawada Y
(2014) Biophysical properties of intrinsically disordered p130Cas substrate domain--implication in mechanosensing
PLOS Computational Biology 10:e1003532.
https://doi.org/10.1371/journal.pcbi.1003532
- PubMed
- Google Scholar
(2017) Novel ecto-tagged integrins reveal their trafficking in live cells
Nature Communications 8:570.
https://doi.org/10.1038/s41467-017-00646-w
- PubMed
- Google Scholar
1. Humphries JD
2. Byron A
3. Bass MD
4. Craig SE
5. Pinney JW
6. Knight D
7. Humphries MJ
(2009) Proteomic analysis of integrin-associated complexes identifies RCC2 as a dual regulator of Rac1 and Arf6
Science Signaling 2:ra51.
https://doi.org/10.1126/scisignal.2000396
- PubMed
- Google Scholar
1. Hynes RO
(2002) Integrins: bidirectional, allosteric signaling machines
Cell 110:673–687.
https://doi.org/10.1016/s0092-8674(02)00971-6
- PubMed
- Google Scholar
1. Ihry RJ
2. Worringer KA
3. Salick MR
4. Frias E
5. Ho D
6. Theriault K
7. Kommineni S
8. Chen J
9. Sondey M
10. Ye C
11. Randhawa R
12. Kulkarni T
13. Yang Z
14. McAllister G
15. Russ C
16. Reece-Hoyes J
17. Forrester W
18. Hoffman GR
19. Dolmetsch R
20. Kaykas A
(2018) p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells
Nature Medicine 24:939–946.
https://doi.org/10.1038/s41591-018-0050-6
- PubMed
- Google Scholar
1. Ilić D
2. Furuta Y
3. Kanazawa S
4. Takeda N
5. Sobue K
6. Nakatsuji N
7. Nomura S
8. Fujimoto J
9. Okada M
10. Yamamoto T
(1995) Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice
Nature 377:539–544.
https://doi.org/10.1038/377539a0
- PubMed
- Google Scholar
1. Iwamoto DV
2. Calderwood DA
(2015) Regulation of integrin-mediated adhesions
Current Opinion in Cell Biology 36:41–47.
https://doi.org/10.1016/j.ceb.2015.06.009
- PubMed
- Google Scholar
1. Janoštiak R
2. Brábek J
3. Auernheimer V
4. Tatárová Z
5. Lautscham LA
6. Dey T
7. Gemperle J
8. Merkel R
9. Goldmann WH
10. Fabry B
11. Rösel D
(2014a) CAS directly interacts with vinculin to control mechanosensing and focal adhesion dynamics
Cellular and Molecular Life Sciences 71:727–744.
https://doi.org/10.1007/s00018-013-1450-x
- PubMed
- Google Scholar
(2014b) Mechanosensors in integrin signaling: the emerging role of p130Cas
European Journal of Cell Biology 93:445–454.
https://doi.org/10.1016/j.ejcb.2014.07.002
- PubMed
- Google Scholar
(2010) Nanoscale architecture of integrin-based cell adhesions
Nature 468:580–584.
https://doi.org/10.1038/nature09621
- PubMed
- Google Scholar
1. Kanchanawong P
2. Calderwood DA
(2022) Organization, dynamics and mechanoregulation of integrin-mediated cell-ECM adhesions
Nature Reviews. Molecular Cell Biology 24:142–161.
https://doi.org/10.1038/s41580-022-00531-5
- PubMed
- Google Scholar
(2011) Imaging protein activity in live embryos using fluorescence resonance energy transfer biosensors
Nature Protocols 6:1835–1846.
https://doi.org/10.1038/nprot.2011.395
- PubMed
- Google Scholar
1. Klemke RL
2. Leng J
3. Molander R
4. Brooks PC
5. Vuori K
6. Cheresh DA
(1998) CAS/Crk coupling serves as a “molecular switch” for induction of cell migration
The Journal of Cell Biology 140:961–972.
https://doi.org/10.1083/jcb.140.4.961
- PubMed
- Google Scholar
(1994)
Four proline-rich sequences of the guanine-nucleotide exchange factor C3G bind with unique specificity to the first Src homology 3 domain of Crk

The Journal of Biological Chemistry 269:32781–32787.
- PubMed
- Google Scholar
1. Kostic A
2. Sheetz MP
(2006) Fibronectin rigidity response through Fyn and p130Cas recruitment to the leading edge
Molecular Biology of the Cell 17:2684–2695.
https://doi.org/10.1091/mbc.e05-12-1161
- PubMed
- Google Scholar
(2019) CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing
Nucleic Acids Research 47:W171–W174.
https://doi.org/10.1093/nar/gkz365
- PubMed
- Google Scholar
(2001) Differential dynamics of alpha 5 integrin, paxillin, and alpha-actinin during formation and disassembly of adhesions in migrating cells
The Journal of Cell Biology 153:1427–1440.
https://doi.org/10.1083/jcb.153.7.1427
- PubMed
- Google Scholar
(2022) New insights into FAK structure and function in focal adhesions
Journal of Cell Science 135:jcs259089.
https://doi.org/10.1242/jcs.259089
- PubMed
- Google Scholar
1. Legerstee K
2. Houtsmuller AB
(2021) A layered view on focal adhesions
Biology 10:1189.
https://doi.org/10.3390/biology10111189
- PubMed
- Google Scholar
1. Lenter M
2. Uhlig H
3. Hamann A
4. Jenö P
5. Imhof B
6. Vestweber D
(1993) A monoclonal antibody against an activation epitope on mouse integrin chain beta 1 blocks adhesion of lymphocytes to the endothelial integrin alpha 6 beta 1
PNAS 90:9051–9055.
https://doi.org/10.1073/pnas.90.19.9051
- PubMed
- Google Scholar
1. Lietha D
2. Izard T
(2020) Roles of membrane domains in integrin-mediated cell adhesion
International Journal of Molecular Sciences 21:5531.
https://doi.org/10.3390/ijms21155531
- PubMed
- Google Scholar
1. Lu Z
2. Mathew S
3. Chen J
4. Hadziselimovic A
5. Palamuttam R
6. Hudson BG
7. Fässler R
8. Pozzi A
9. Sanders CR
10. Zent R
(2016) Implications of the differing roles of the β1 and β3 transmembrane and cytoplasmic domains for integrin function
eLife 5:e18633.
https://doi.org/10.7554/eLife.18633
- PubMed
- Google Scholar
1. Ly T
2. Endo A
3. Brenes A
4. Gierlinski M
5. Afzal V
6. Pawellek A
7. Lamond AI
(2018) Proteome-wide analysis of protein abundance and turnover remodelling during oncogenic transformation of human breast epithelial cells
Wellcome Open Research 3:51.
https://doi.org/10.12688/wellcomeopenres.14392.1
- PubMed
- Google Scholar
1. Mitra SK
2. Schlaepfer DD
(2006) Integrin-regulated FAK-Src signaling in normal and cancer cells
Current Opinion in Cell Biology 18:516–523.
https://doi.org/10.1016/j.ceb.2006.08.011
- PubMed
- Google Scholar
1. Miyamoto S
2. Teramoto H
3. Coso OA
4. Gutkind JS
5. Burbelo PD
6. Akiyama SK
7. Yamada KM
(1995) Integrin function: molecular hierarchies of cytoskeletal and signaling molecules
The Journal of Cell Biology 131:791–805.
https://doi.org/10.1083/jcb.131.3.791
- PubMed
- Google Scholar
1. Moser M
2. Legate KR
3. Zent R
4. Fässler R
(2009) The tail of integrins, talin, and kindlins
Science 324:895–899.
https://doi.org/10.1126/science.1163865
- Google Scholar
1. Mould AP
2. Askari JA
3. Byron A
4. Takada Y
5. Jowitt TA
6. Humphries MJ
(2016) Ligand-induced epitope masking: Dissociation of integrin α5β1-fibronectin complexes only by monoclonal antibodies with an allosteric mode of action
The Journal of Biological Chemistry 291:20993–21007.
https://doi.org/10.1074/jbc.M116.736942
- PubMed
- Google Scholar
1. Nakamoto T
2. Sakai R
3. Honda H
4. Ogawa S
5. Ueno H
6. Suzuki T
7. Aizawa S
8. Yazaki Y
9. Hirai H
(1997) Requirements for localization of p130cas to focal adhesions
Molecular and Cellular Biology 17:3884–3897.
https://doi.org/10.1128/MCB.17.7.3884
- PubMed
- Google Scholar
(2003) Redox-dependent downregulation of Rho by Rac
Nature Cell Biology 5:236–241.
https://doi.org/10.1038/ncb938
- PubMed
- Google Scholar
1. Nobes CD
2. Hall A
(1995) Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia
Cell 81:53–62.
https://doi.org/10.1016/0092-8674(95)90370-4
- PubMed
- Google Scholar
1. Onesto C
2. Shutes A
3. Picard V
4. Schweighoffer F
5. Der CJ
(2008) Characterization of EHT 1864, a novel small molecule inhibitor of Rac family small GTPases
Methods in Enzymology 439:111–129.
https://doi.org/10.1016/S0076-6879(07)00409-0
- PubMed
- Google Scholar
(2008) Quantification of integrin receptor agonism by fluorescence lifetime imaging
Journal of Cell Science 121:265–271.
https://doi.org/10.1242/jcs.018440
- PubMed
- Google Scholar
(2010) Cell adhesion: integrating cytoskeletal dynamics and cellular tension
Nature Reviews. Molecular Cell Biology 11:633–643.
https://doi.org/10.1038/nrm2957
- PubMed
- Google Scholar
(1999) The G(2) checkpoint is maintained by redundant pathways
Molecular and Cellular Biology 19:5872–5881.
https://doi.org/10.1128/MCB.19.9.5872
- PubMed
- Google Scholar
1. Pellicena P
2. Miller WT
(2001) Processive phosphorylation of p130Cas by Src depends on SH3-polyproline interactions
The Journal of Biological Chemistry 276:28190–28196.
https://doi.org/10.1074/jbc.M100055200
- PubMed
- Google Scholar
(1995) Adhesion-induced tyrosine phosphorylation of the p130 src substrate
Journal of Cell Science 108 (Pt 4):1371–1379.
https://doi.org/10.1242/jcs.108.4.1371
- PubMed
- Google Scholar
1. Polte TR
2. Hanks SK
(1995) Interaction between focal adhesion kinase and Crk-associated tyrosine kinase substrate p130Cas
PNAS 92:10678–10682.
https://doi.org/10.1073/pnas.92.23.10678
- PubMed
- Google Scholar
1. Reis J
2. Massari M
3. Marchese S
4. Ceccon M
5. Aalbers FS
6. Corana F
7. Valente S
8. Mai A
9. Magnani F
10. Mattevi A
(2020) A closer look into NADPH oxidase inhibitors: Validation and insight into their mechanism of action
Redox Biology 32:101466.
https://doi.org/10.1016/j.redox.2020.101466
- PubMed
- Google Scholar
1. Resh MD
(1999) Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins
Biochimica et Biophysica Acta 1451:1–16.
https://doi.org/10.1016/s0167-4889(99)00075-0
- PubMed
- Google Scholar
1. Sanders MA
2. Basson MD
(2005) p130 but Not Paxillin Is Essential for Caco-2 Intestinal Epithelial Cell Spreading and Migration on Collagen IV
Journal of Biological Chemistry 280:23516–23522.
https://doi.org/10.1074/jbc.M413165200
- Google Scholar
(2006) Force sensing by mechanical extension of the Src family kinase substrate p130Cas
Cell 127:1015–1026.
https://doi.org/10.1016/j.cell.2006.09.044
- PubMed
- Google Scholar
1. Schiefermeier N
2. Scheffler JM
3. de Araujo MEG
4. Stasyk T
5. Yordanov T
6. Ebner HL
7. Offterdinger M
8. Munck S
9. Hess MW
10. Wickström SA
11. Lange A
12. Wunderlich W
13. Fässler R
14. Teis D
15. Huber LA
(2014) The late endosomal p14–MP1 (LAMTOR2/3) complex regulates focal adhesion dynamics during cell migration
Journal of Cell Biology 205:525–540.
https://doi.org/10.1083/jcb.201310043
- Google Scholar
(2011) Quantitative proteomics of the integrin adhesome show a myosin II-dependent recruitment of LIM domain proteins
EMBO Reports 12:259–266.
https://doi.org/10.1038/embor.2011.5
- PubMed
- Google Scholar
(2019) Efficient and flexible tagging of endogenous genes by homology-independent intron targeting
Genome Research 29:1322–1328.
https://doi.org/10.1101/gr.246413.118
- PubMed
- Google Scholar
1. Smith DJ
(1997) Mini-exon epitope tagging for analysis of the protein coding potential of genomic sequence
BioTechniques 23:116–120.
https://doi.org/10.2144/97231st01
- Google Scholar
(2021) A Cas-BCAR3 co-regulatory circuit controls lamellipodia dynamics
eLife 10:e67078.
https://doi.org/10.7554/eLife.67078
- PubMed
- Google Scholar
(2004) Regulation of actin dynamics by WASP and WAVE family proteins
Trends in Cell Biology 14:303–311.
https://doi.org/10.1016/j.tcb.2004.04.007
- PubMed
- Google Scholar
1. Su Y
2. Xia W
3. Li J
4. Walz T
5. Humphries MJ
6. Vestweber D
7. Cabañas C
8. Lu C
9. Springer TA
(2016) Relating conformation to function in integrin α5β1
PNAS 113:E3872–E3881.
https://doi.org/10.1073/pnas.1605074113
- PubMed
- Google Scholar
1. Takenawa T
2. Suetsugu S
(2007) The WASP-WAVE protein network: connecting the membrane to the cytoskeleton
Nature Reviews. Molecular Cell Biology 8:37–48.
https://doi.org/10.1038/nrm2069
- PubMed
- Google Scholar
1. Tanaka S
2. Morishita T
3. Hashimoto Y
4. Hattori S
5. Nakamura S
6. Shibuya M
7. Matuoka K
8. Takenawa T
9. Kurata T
10. Nagashima K
(1994) C3G, a guanine nucleotide-releasing protein expressed ubiquitously, binds to the Src homology 3 domains of CRK and GRB2/ASH proteins
PNAS 91:3443–3447.
https://doi.org/10.1073/pnas.91.8.3443
- PubMed
- Google Scholar
1. Teckchandani A
2. Laszlo GS
3. Simó S
4. Shah K
5. Pilling C
6. Strait AA
7. Cooper JA
(2014) Cullin 5 destabilizes Cas to inhibit Src-dependent cell transformation
Journal of Cell Science 127:509–520.
https://doi.org/10.1242/jcs.127829
- PubMed
- Google Scholar
1. Teckchandani A
2. Cooper JA
(2016) The ubiquitin-proteasome system regulates focal adhesions at the leading edge of migrating cells
eLife 5:e17440.
https://doi.org/10.7554/eLife.17440
- PubMed
- Google Scholar
1. Tonks NK
(2005) Redox redux: revisiting PTPs and the control of cell signaling
Cell 121:667–670.
https://doi.org/10.1016/j.cell.2005.05.016
- PubMed
- Google Scholar
(1995) Integrin alpha 2 I-domain is a binding site for collagens
Journal of Cell Science 108 (Pt 4):1629–1637.
https://doi.org/10.1242/jcs.108.4.1629
- PubMed
- Google Scholar
1. Ushio-Fukai M
(2006) Localizing NADPH oxidase-derived ROS
Science’s STKE 2006:re8.
https://doi.org/10.1126/stke.3492006re8
- PubMed
- Google Scholar
1. von Wichert G
(2003) Force-dependent integrin-cytoskeleton linkage formation requires downregulation of focal complex dynamics by Shp2
The EMBO Journal 22:5023–5035.
https://doi.org/10.1093/emboj/cdg492
- Google Scholar
1. Vuori K
2. Ruoslahti E
(1995) Tyrosine phosphorylation of p130Cas and cortactin accompanies integrin-mediated cell adhesion to extracellular matrix
The Journal of Biological Chemistry 270:22259–22262.
https://doi.org/10.1074/jbc.270.38.22259
- PubMed
- Google Scholar
1. Webb DJ
2. Donais K
3. Whitmore LA
4. Thomas SM
5. Turner CE
6. Parsons JT
7. Horwitz AF
(2004) FAK-Src signalling through paxillin, ERK and MLCK regulates adhesion disassembly
Nature Cell Biology 6:154–161.
https://doi.org/10.1038/ncb1094
- PubMed
- Google Scholar
(2020) ORANGE: A CRISPR/Cas9-based genome editing toolbox for epitope tagging of endogenous proteins in neurons
PLOS Biology 18:e3000665.
https://doi.org/10.1371/journal.pbio.3000665
- PubMed
- Google Scholar
(2019) Steps in mechanotransduction pathways that control cell morphology
Annual Review of Physiology 81:585–605.
https://doi.org/10.1146/annurev-physiol-021317-121245
- PubMed
- Google Scholar
1. Yano H
2. Uchida H
3. Iwasaki T
4. Mukai M
5. Akedo H
6. Nakamura K
7. Hashimoto S
8. Sabe H
(2000) Paxillin alpha and Crk-associated substrate exert opposing effects on cell migration and contact inhibition of growth through tyrosine phosphorylation
PNAS 97:9076–9081.
https://doi.org/10.1073/pnas.97.16.9076
- PubMed
- Google Scholar
(2003) Early molecular events in the assembly of matrix adhesions at the leading edge of migrating cells
Journal of Cell Science 116:4605–4613.
https://doi.org/10.1242/jcs.00792
- Google Scholar
(2014) N-WASP-directed actin polymerization activates Cas phosphorylation and lamellipodium spreading
Journal of Cell Science 127:1394–1405.
https://doi.org/10.1242/jcs.134692
- PubMed
- Google Scholar
1. Zhang C
2. Miller DJ
3. Guibao CD
4. Donato DM
5. Hanks SK
6. Zheng JJ
(2017) Structural and functional insights into the interaction between the Cas family scaffolding protein p130Cas and the focal adhesion-associated protein paxillin
Journal of Biological Chemistry 292:18281–18289.
https://doi.org/10.1074/jbc.M117.807271
- Google Scholar
1. Zhong H
2. Ceballos CC
3. Massengill CI
4. Muniak MA
5. Ma L
6. Qin M
7. Petrie SK
8. Mao T
(2021) High-fidelity, efficient, and reversible labeling of endogenous proteins using CRISPR-based designer exon insertion
eLife 10:e64911.
https://doi.org/10.7554/eLife.64911
- PubMed
- Google Scholar
1. Zhu L
2. Plow EF
3. Qin J
(2021) Initiation of focal adhesion assembly by talin and kindlin: A dynamic view
Protein Science 30:531–542.
https://doi.org/10.1002/pro.4014
- PubMed
- Google Scholar

Decision letter

Anna Akhmanova

Reviewing Editor; Utrecht University, Netherlands
David Ron

Senior Editor; University of Cambridge, United Kingdom

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting the paper "Cas phosphorylation regulates focal adhesion assembly" for consideration by eLife. We sincerely apologise for the delay in reviewing your manuscript, which was due to the fact that it was difficult to find peer reviewers. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individual involved in the review of your submission has agreed to reveal their identity: Mike Sheetz (Reviewer #3).

Comments to the Authors:

We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife. All three reviewers found that the work is potentially novel and important, and would be interesting to the field. However, very significant concerns were raised. Specifically, reviewers would like to see stronger proof that b1 integrin is the only relevant β integrin in the system you use; they would like to see controls excluding the potential involvement of b6 integrin, as well as experiments in fibroblasts knockout for b3 integrin. There were also concerns about the choice of the integrin antibodies used, the small number of cells analyzed, and some important controls of the tagging strategies missing. Addressing all these concerns is likely possible but will also be laborious and will take more time and effort than can be expected from a normal revision at eLife. We, therefore, return the paper to you so that you can send it to another journal if you seek rapid publication. However, we will be prepared to reconsider the manuscript if you can thoroughly address the reviewers' comments. In this case, we will do our best to send the paper to the same reviewers.

Reviewer #1 (Recommendations for the authors):

The authors have investigated the role of the p130-cas/crk complex in cell spreading and the hierarchy of adhesion formation in epithelial cells. The authors propose a model whereby phosphorylated Cas (p130Cas, BCAR1), its binding partner, Crk, and inactive FAK and inactive b1-integrins cluster together at the leading edge of the cell protrusion. This they suggest precedes focal adhesions formation with F-actin, active integrins, active FAK, vinculin, and talin. They show convincingly that p130cas depletion severely impairs cell spreading downstream of integrin activation, as integrin activation with Mn²⁺ fails to rescue the spreading defect. The model is attractive; however, it does not seem to be supported fully by the data. The biggest problem is the unfortunate choice of the integrin antibodies used in the paper. Unfortunately, the authors have been misinformed in their choice of the antibodies used (Please see Byron et al., JCS PMID: 19910492). They indicate that they have chosen an antibody that specifically recognizes the active ligand-bound state of integrins. However, the 9EG7 antibody does not recognize the open conformation but it is specific to the extended primed state. Instead, 12G10 for example would recognize this state. They also indicate that they have used an antibody that recognizes the bent inactive state that is not ligand bound. Unfortunately, AIIB2 is not conformation-specific but rather blocks directly the ligand binding to the integrins and thus does not stain inactive integrins. This in fact is obvious from looking at the example stainings provided where their inactive beta1 staining is clearly in adhesions. In most epithelial cells, inactive b1-integrin (detected with Mab13, PIH5, or 4B4 antibodies specifically recognizing inactive integrins) localise primarily to membrane ruffles above the FA staining detected by TIRF.

A big part of the data included in the main figures describes the approaches the authors have used to generate endogenously tagged cell lines for some of the components investigated. This is commendable but as such genomic editing is an established methodology, these details could be moved to the supplements.

Throughout the manuscript, the quantifications are based on rather low numbers of cells, and for some experiments, it is not clear if these are from a single experiment or from biologically independent experiments. In addition, there are several instances where the authors show just a small magnified area of the cells. Smaller magnification images should be provided as well to help the reader to evaluate the quality of the staining overall and how representative the chosen areas are.

Specific points:

1) For endogenous tagging of Cas, the authors employed the insertion of an artificial exon containing mScarlet (mSc) into the first intron of the Cas gene. In the resulting protein, mSc is inserted between Pro4 and Asn5 of Cas without any further linker sequence, thus potentially affecting some of the functions of the Cas SH3 domain. Moreover, phosphorylation of Tyr12 in the Cas SH3 domain has been reported to regulate interaction with several SH3-binding proteins, including vinculin (PMID: 21937722, PMID: 28808245, PMID: 23974298). The authors should provide evidence that inserting mSc in close proximity to the Cas SH3 domain and an important regulation site (Y12) does not affect downstream signalling of the endogenously tagged Cas. For instance, the authors should analyse the interaction of Cas and CasmSc with SH3 domain-binding proteins or analyse Y12 phosphorylation levels of Cas and CasmSc in cells with and without Src expression.

2) In Figure 1B authors show levels of Cas in the CasmSc cells. While most of the Cas in CasmSc cells is tagged, the phosphorylation pattern as shown by pY410 Ab does not replicate the pattern of the total Cas antibody, suggesting phosphorylation of the tagged Cas is substantially weaker than that of the remaining untagged Cas. Authors should provide further evidence that their tagging strategy does not influence Cas substrate domain phosphorylation and thus signalling downstream of the phosphorylated SD (such as interaction with Crk) when compared to untagged Cas.

3) In Figure 2C the authors show data points of 11 cells on Fn and 7 cells on collagen (although the legend indicates n=7-13). Measurement of more cells should be provided in order to strengthen this observation, given the median Δt_1/2 (VCL^-Cas) ranges from less than 0s to more than 120s. Moreover, based on this data authors suggest that "Cas clusters may specify localization of integrin α5β1 and α2β1 adhesions", however, this is not obvious from the data provided in this section.

4) Figure 3. Please show the overall distribution of the tagged integrins in the cell. How well do the tagged integrins overlap with the endogenous ones? Please show b1-integrin blots alongside the GFP in the WB.

5) Figure 5. The authors need to provide representative images (lower and higher mag) of all the antibody stainings they have quantified in 5C. How has the specificity of the antibodies/staining been determined? Please see above the comments related to the integrin antibodies used.

6) Figure 6 and 7. How have the authors controlled for off-target effects of their siRNAs? The vinculin silencing efficacy in Figure 6 is poor and precludes making any conclusions on the role of vinculin.

In Figure 6C the authors analyse the role of Cas depletion on the regulation of Mn²⁺-dependent spreading. As a further control, the authors could include a rescue experiment with Cas WT and Cas lacking the CCH domain in Cas-depleted cells.

7) The results in Figure 7A suggest that the interaction of Crk with phosphorylated Cas accelerates the recruitment of Vinculin to the Cas-Crk clusters. Do the authors have a mechanistic explanation of how this could be regulated? Also, to support this data, the authors should perform a Crk rescue experiment in Crk-depleted cells to see whether recruitment of Vinculin to Cas clusters will be rescued to control levels.

8) In Figure 8D, the fluorescence intensity of CasmSc seems to be lower in siSOCS6 than in siCtrl cells. This is rather counterintuitive since the depletion of SOCS6 should stabilize Cas levels. Could the authors comment on this?

Other points:

1) In the introduction, the authors mention the mechanoresponsive roles of talin in adhesion maturation and assembly. It would be beneficial to mention in this context also the effect of the force-mediated extension of the Cas substrate domain on its downstream signalling (PMID: 17129785, reviewed in PMID: 25062607).

2) Figure 1 supplement 2. What is the difference between Hela panels E and F?

3) It is not clear, whether the cells measured in Figure 3 are seeded on Fn or Col-I. If on Fn – would the delay in ITGB1 arrival to Cas clusters be different on Col-I, since authors show there are more 9EG7-positive ITGB1 clusters in cells seeded on collagen (Figure 2B)?

4) This study is in line with previous work (PMID: 30639111), where pY410 Cas has been shown to co-localize with Crk in filopodia tips in a CCH domain-dependent manner and extends these observations to the edge of spreading/migrating MCF10A and HeLa cells. This could perhaps be discussed.

Reviewer #2 (Recommendations for the authors):

The manuscript "Cas phosphorylation regulates focal adhesion assembly" by Kumar et al. investigates the role of Cas in cell spreading and finds that Cas, Crk, and FAK cluster together at the cell periphery to initiate focal adhesion formation. In contrast to the previous understanding, they suggest that Cas clustering happens before integrin clustering and hence is the initial step in adhesion formation. This notion is the key novel aspect of the study, however, it is based on the assumption that b1 integrin is the only relevant integrin in the system, which at this point is not supported by the data.

Specific comments:

– The central finding of the study (i.e. that Cas clusters before integrin) is based solely on the study of b1-integrin and hence on the assumptions that it is the only integrin that is relevant for adhesion formation in the cells used here. To this end, the authors cite work by Kulak, 2014 and Ly, 2018 that MCF10A and HELA cells express 10-fold less b3 integrin compared to b1 integrin. While b3 is indeed found at lower levels in these studies it might be (a) nonetheless present at sufficient levels to initiate adhesion formation (as it was picked up by mass-spec analysis); (b) the authors discuss that b1 integrin is 10fold higher expressed compared to Cas ( based on same studies) meaning that Cas and b3 integrin would be expressed at comparable levels, further supporting point (a) above; lastly, (c) the studies by Kulak and Ly find other β-integrins at high levels – Kulak: ITGB5 and ITGB8; Ly: ITGB5, ITGB6, ITGB8, which are all RGD receptors and can complex with ITGAV which is also found at high levels in both studies, consistent with the general understanding of αvβ6 being a major fibronectin receptor in cancer cells. Mechanosensing and binding properties are different for these integrins (e.g. PMID: 24793358, 22328497), but especially the binding to Cas, or their involvement in early adhesion formation have not been characterised to my knowledge. As such the fact that Cas clusters before b1 integrin does not suggest that it is integrin independent, but might only associate with clusters of other integrins (e.g. αvβ6) that then mature into b1 integrin-containing adhesions.

– Apart from this central point, the authors show that phosphorylated Cas is enriched at the adhesome, knockdown of Cas leads to cell spreading and migration defects, that Cas is upstream of vinculin recruitment and that Cas is phosphorylated by Yes1, which are all points that have been described in the past. Especially, inwards movement of Cas dependent on phosphorylation: PMID 24928898; the role of Cas in spreading: PMID 10448062; also here: PMIDs 23974298, 21937722; 15817476;

– The authors find phosphorylation through Yes, but not fyn or src, although PMID 17129785 previously demonstrated that Yes, Src, and Fyn can phosphorylate Cas; whereas PMID 11604500 finds that Src can phosphorylate Cas. The discrepancy here should be explored.

– Also the lack of effect of Src and Fyn knockdown in the current study is in apparent contrast to the existing literature, e.g. PMID 16597701, and should be explored further.

– Similarly the question about the recruitment of vinculin downstream of Cas seems to be in disagreement with the literature reporting that vinculin is upstream of FAK dynamics – i.e. since adhesion localisation of Cas is less pronounced in absence of Vinculin (PMID 23974298).

The authors should expand the investigation to other integrins; in order to exclude that the change in adhesion localisation (i.e. distance from cell edge; e.g. Figure 5C) is not affected by the different penetration depth of the green and red light in the dual color TIRF experiments, the authors should investigate as a control green Cas vs CasmSc.

Reviewer #3 (Recommendations for the authors):

The findings of this paper show that epithelial cell adhesion to fibronectin or collagen involves a novel adhesion site assembly process that relies on clusters of Cas at the cell edge. Further, an SFK-Cas-Crk-Rac1 pathway is linked to spreading and further adhesion maturation through vinculin recruitment. The MCF10A and HeLa lines that are used in this study have very low levels of β 3 integrin and the β 1 integrin is the primary integrin involved but Mn activation does not rescue spreading in the absence of Cas.

The mechanism of Cas concentration at the leading is not determined but there are many other findings that support the major hypothesis.

An experiment that would test the hypothesis that the major difference between the adhesion formation in fibroblasts and these epithelial cells is the level of β 3 integrins would be to overexpress β 3 and/or deplete β 1 in the MCF10A cells. If β 3 integrin would be processed and reach the cell surface, then the process of adhesion formation may change.

I liked this paper and it was very thorough in documenting the pathway for adhesion formation. My major suggestion is to try to increase β 3 integrin levels in the epithelial cells or alternatively, deplete them in the fibroblasts while increasing β 1 levels. This may not work for a variety of reasons but it would be spectacular if it did.

https://doi.org/10.7554/eLife.90234.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Reviewer #1 (Recommendations for the authors):

The authors have investigated the role of the p130-cas/crk complex in cell spreading and the hierarchy of adhesion formation in epithelial cells. The authors propose a model whereby phosphorylated Cas (p130Cas, BCAR1), its binding partner, Crk, and inactive FAK and inactive b1-integrins cluster together at the leading edge of the cell protrusion. This they suggest precedes focal adhesions formation with F-actin, active integrins, active FAK, vinculin, and talin. They show convincingly that p130cas depletion severely impairs cell spreading downstream of integrin activation, as integrin activation with Mn²⁺ fails to rescue the spreading defect. The model is attractive; however, it does not seem to be supported fully by the data. The biggest problem is the unfortunate choice of the integrin antibodies used in the paper. Unfortunately, the authors have been misinformed in their choice of the antibodies used (Please see Byron et al., JCS PMID: 19910492). They indicate that they have chosen an antibody that specifically recognizes the active ligand-bound state of integrins. However, the 9EG7 antibody does not recognize the open conformation but it is specific to the extended primed state. Instead, 12G10 for example would recognize this state.

We thank the reviewer for the supportive comments and apologize for our poor choice of antibodies to characterize integrin activation state. We had mistakenly used 9EG10 to profile active integrin β1, but, as the reviewer points out, 9EG10 actually binds both extended-closed (EC, primed) and extended-open (EO, active) conformations (Su et al. 2016 PMC4941492). We therefore repeated our analysis using 12G10, which is specific for the EO conformation (Su et al. 2016). The 12G10 (EO) and 9EG7 (EO+EC) profiles are very similar, suggesting that levels of EC are low relative to EO (Figure 4D). The results confirm that active (EO) integrin is enriched towards the inner end of each cluster, coinciding with the peak of vinculin, kindlin, talin, and other focal adhesion markers, consistent with our interpretation that this part of the cluster is attached to the ECM.

They also indicate that they have used an antibody that recognizes the bent inactive state that is not ligand bound. Unfortunately, AIIB2 is not conformation-specific but rather blocks directly the ligand binding to the integrins and thus does not stain inactive integrins. This in fact is obvious from looking at the example stainings provided where their inactive beta1 staining is clearly in adhesions. In most epithelial cells, inactive b1-integrin (detected with Mab13, PIH5, or 4B4 antibodies specifically recognizing inactive integrins) localise primarily to membrane ruffles above the FA staining detected by TIRF.

We regret the error. As the reviewer points out, AIIB2 recognizes both active and inactive integrin β1 (Mold et al. 2016, PMC5076510). The AIIB2 profile showed a prominent peak near the outer edge of the cluster, co-localizing with phospho-Cas, and a lower, broad peak overlapping with vinculin. We interpreted these peaks as inactive and active integrin respectively. As the reviewer recommended, we have now used mAb13, which binds both bentclosed (BC) and EC integrin β1 (Su et al. 2016). mAb13 only shows the first peak, co-localizing with phospho-Cas (Figure 4D). Inactive integrin was also detected on the upper cell surface but was out of the plane of focus and was not quantified.

Comparing the profiles obtained with mAb13 (BC+EC), 9EG7 (EO+EC), 12G10 (EO) and AIIB2 (total) suggests that inactive (BC) integrin β1 peaks with Cas and pYCas near the cell edge, while active (EO) β1 peaks with vinculin and other focal adhesion markers further from the edge (Figure 4E). Minimal overlap between mAb13 and 9EG7 profiles implies that the level of primed (EC) integrin β1 is low.

Please note also that the spatial distribution of total integrin β1 (all conformations) across the adhesion is difficult to assess by immunostaining, which is influenced by antibody affinity and accessibility. However, live imaging showed that integrin β1 clustering is delayed relative to Cas (Figure 2), suggesting that immunostaining underestimates the amount of active EO integrin under the cell body relative to inactive BC integrin near the edge.

A big part of the data included in the main figures describes the approaches the authors have used to generate endogenously tagged cell lines for some of the components investigated. This is commendable but as such genomic editing is an established methodology, these details could be moved to the supplements.

We have moved details of cell line construction to the methods.

Throughout the manuscript, the quantifications are based on rather low numbers of cells, and for some experiments, it is not clear if these are from a single experiment or from biologically independent experiments. In addition, there are several instances where the authors show just a small magnified area of the cells. Smaller magnification images should be provided as well to help the reader to evaluate the quality of the staining overall and how representative the chosen areas are.

We have increased cell numbers and added low and high magnification images as needed.

Specific points:

1) For endogenous tagging of Cas, the authors employed the insertion of an artificial exon containing mScarlet (mSc) into the first intron of the Cas gene. In the resulting protein, mSc is inserted between Pro4 and Asn5 of Cas without any further linker sequence, thus potentially affecting some of the functions of the Cas SH3 domain.

We apologize for our poor description of the construct. We omitted the important point that the mScarlet PCR product used to generate the targeting construct included 24 nucleotides of vector sequence. This introduces an 8-residue linker (GGMDELYK) between the folded structure of mScarlet and residue 5 of Cas. This makes our construct more similar to the viral constructs used by others. For example, inserting Cas at the BglII site in pEGFP-C1 introduces a 5-residue linker (SGLRS) between EGFP and the first residue of Cas (Janostiak et al. 2011, PMID: 21937722; Branis et al. 2017, PMC 5390273). The reviewer may also be concerned about possible functions of first four residues of Cas (MNHL), which now separated from residue 5 by mScarlet and the linker. In principle, these four residues could be important for Cas function. This seems unlikely because MNHL is just one of seven different alternative first coding exons that all splice into the same second exon (Uniprot P56945). The alternative first exons range in length from 2 to 50 residues and end in various residues – L, W, K, E, P (twice) and R – suggesting that the protein must tolerate a variety of N-terminal sequences. We have modified the Results and Figures to indicate that Cas^mSc contains a linker between mScarlet and the SH3 domain.

Even with the linker, mScarlet tagging may affect Cas function. Therefore, we performed additional controls, comparing parental and Cas^mSc MCF10A cells. First, we plated parental MCF10A cells on collagen for 30 min and immunostained for phospho-Cas and vinculin. Cell spread area and the areas and intensities of pYCas and vinculin clusters were the same as for Cas^mSc MCF10A cells analyzed in parallel (new Figure 1 —figure supplement 2). Second, we analyzed the spatial distribution of endogenous Cas and vinculin in parental MCF10A cells (new Figure 4 —figure supplement 1). The untagged proteins are organized spatially in the same pattern as Cas^mSc and EYFP-vinculin (Figure 4). Thus, mScarlet tagging appears not to affect Cas function or spatial organization.

Moreover, phosphorylation of Tyr12 in the Cas SH3 domain has been reported to regulate interaction with several SH3-binding proteins, including vinculin (PMID: 21937722, PMID: 28808245, PMID: 23974298). The authors should provide evidence that inserting mSc in close proximity to the Cas SH3 domain and an important regulation site (Y12) does not affect downstream signalling of the endogenously tagged Cas. For instance, the authors should analyse the interaction of Cas and CasmSc with SH3 domain-binding proteins or analyse Y12 phosphorylation levels of Cas and CasmSc in cells with and without Src expression.

pY12 was identified in a shotgun pTyr proteomics experiment on SrcYF-transformed mouse fibroblasts (Luo et al. 2008, PMC2579752). The investigators then developed a pY12 antibody and found that the site is phosphorylated in some cancer cells and in SrcYF-transformed but not control fibroblasts (Janostiak et al. 2011, PMID: 21937722). However, pY12 has not been noted by other investigators. It has only been detected in three high-throughput phosphoproteomics experiments, compared with 10’s to 100’s of detections of other Cas pY sites (Phosphosite). We suspect that Cas Y12 may only be phosphorylated when Src is highly active. We contacted Dr. Rosel requesting the pY12 Cas antibody used in PMID: 21937722, 28808245 and 23974298.

However, Dr. Rosel declined to send the antibody, stating that it is not very specific and partially recognizes Y12F Cas. There is no commercial source for a pY12 Cas antibody and it would be difficult for us to perform the analysis.

Functional studies implicating Y12 in signaling made use of a vector expressing wildtype or mutant GFP-mCas (mouse Cas) (Janostiak et al. 2011, PMID: 21937722; Janostiak et al. 2014, PMID: 23974298; Gemperle et al. 2017, PMID: 28808245). The Y12E mutation inhibited localization to focal adhesions and binding to FAK, PTP-PEST and vinculin. We transduced MCF10A cells with a similar retroviral construct (EYFP-mCas) in rescue experiments to control for off-target effects of Cas siRNA (see below, Reviewer 1, point 6). The kinetics of EYFP-mCas relative to mCherry-vinculin (new Figure 5 —figure supplement 2A-C) were very similar to the kinetics of Cas^mSc and EYFP-vinculin (Figure 1). Moreover, the spatial distribution of EYFPmCas and mCherry-vinculin in adhesions again showed Cas distal to vinculin, as with Cas^mSc and EYFP-vinculin or untagged Cas and vinculin in parental cells. If the mScarlet tagging affected Y12 phosphorylation, we would have expected Cas^mSc to behave differently from EYFP-mCas or endogenous Cas. Thus we feel that it is unlikely that the tag affects Y12 phosphorylation.

2) In Figure 1B authors show levels of Cas in the CasmSc cells. While most of the Cas in CasmSc cells is tagged, the phosphorylation pattern as shown by pY410 Ab does not replicate the pattern of the total Cas antibody, suggesting phosphorylation of the tagged Cas is substantially weaker than that of the remaining untagged Cas. Authors should provide further evidence that their tagging strategy does not influence Cas substrate domain phosphorylation and thus signalling downstream of the phosphorylated SD (such as interaction with Crk) when compared to untagged Cas.

Thank you for pointing out the unexpected low stoichiometry of phosphorylation of Cas^mSc relative to untagged Cas in Figure 1B. These were not typical blots: there may have been a problem with transfer of the upper band. In most blots the phosphorylation stoichiometries of Cas and Cas^mSc are equal. We have replaced the panel with blots from a more representative experiment. This result and other controls mentioned in our response to Point 1 (above) lend confidence that tagging Cas does not affect its phosphorylation or function.

3) In Figure 2C the authors show data points of 11 cells on Fn and 7 cells on collagen (although the legend indicates n=7-13). Measurement of more cells should be provided in order to strengthen this observation, given the median Δt_1/2 (VCL^-Cas) ranges from less than 0s to more than 120s.

We increased the number of replicates in Figure 2C (now Figure 6C). There is still no significant difference in Cas-vinculin recruitment kinetics on collagen or fibronectin.

Moreover, based on this data authors suggest that "Cas clusters may specify localization of integrin α5β1 and α2β1 adhesions", however, this is not obvious from the data provided in this section.

Previous Figure 1 showed that Cas clustered in membrane regions that developed into focal adhesions when cells were plated on collagen, with a time delay between Cas clustering and vinculin recruitment of about a minute. Previous Figure 2 reported similar findings when cells were plated on fibronectin, and used blocking antibodies to show the importance of integrin α2β1 for collagen adhesion and α5β1 for fibronectin adhesion. Based on this, we speculated that Cas may specify localization of vinculin clusters. However, Cas siRNA results were not shown until later and did not use fibronectin. In response to this comment and comments from Reviewer 2, we have investigated focal adhesion assembly on different ECMs in more detail. The new results are in Figure 6 and Figure 6 —figure supplement 1. Briefly, we found that (a) Both MCF10A epithelial cells and human foreskin fibroblasts (HFFs) require Cas to spread and assemble focal adhesions on both collagen and fibronectin; (b) Cas clusters develop into vinculin clusters after ~1 min delay on both collagen and fibronectin, implying a similar mechanism; (c) Cas-dependent attachment to collagen and fibronectin is inhibited by integrin β1 knockdown or by α2β1-blocking antibody; (d) Cas-dependent attachment to fibronectin is inhibited by either β1 or αv knockdown or α5β1-blocking antibody. Taken together, these results suggest that Cas is required for adhesion formation through different integrin heterodimers on different ECM and in different cell types.

4) Figure 3. Please show the overall distribution of the tagged integrins in the cell. How well do the tagged integrins overlap with the endogenous ones?

We have added lower magnification time-lapse images of a spreading Cas^mSc β1ecto-pH MCF10A cell to Figure 2. The tagged integrin distribution is very similar to the endogenous integrin immunostaining (Figure 4 —figure supplement 2).

Please show b1-integrin blots alongside the GFP in the WB.

Figure 3E (now Figure 2E) showed a GFP Western blot of ITGB1^GFP cells. It would be ideal to also probe with β1 antibody. We would expect to see a single band in control cells and two bands in ITGB1^GFP cells. Unfortunately, after testing two monoclonals and two rabbit antibodies, the only antibody that worked on a Western (AB1952P, Millipore) did not detect the β1-GFP fusion protein. Instead, the amount of untagged integrin β1 was decreased in ITGB1^GFP cells (see Author response image 1, black arrowhead). This suggests that one allele has been tagged and is not detected by this antibody. AB1952P was raised to the C terminus of integrin β1, where the tag is attached. Rather than showing this Western, we feel that showing the cDNA sequence, the GFP blot, and GFP in focal adhesions is sufficient evidence that the gene is tagged correctly.

Author response image 1

Download asset Open asset

5) Figure 5. The authors need to provide representative images (lower and higher mag) of all the antibody stainings they have quantified in 5C. How has the specificity of the antibodies/staining been determined? Please see above the comments related to the integrin antibodies used.

We have added low and high magnification images for all immunostaining quantified in Figure 4C. Please see new supplements to Figure 4 —figure supplement 1 (Cas and vinculin), figure supplement 2 (integrin β1 conformation epitopes) and figure supplement 3 (CrkL, paxillin, talin1, kindlin2, Yes1, FAK, pY397FAK and pY861FAK). Cas and vinculin antibodies were validated by immunofluorescence and Western blotting of corresponding knockdown cells (Figure 5A and B and Figure 5 —figure supplement 1A). The CrkL, paxillin, talin1, kindlin2, Yes1 and FAK antibodies were validated by Western blot of cells treated with the corresponding siRNAs (Figure 5 —figure supplements 4 and 5).

6) Figure 6 and 7. How have the authors controlled for off-target effects of their siRNAs?

We have not controlled for off-target effects of siRNAs against FAK, Kindlin2 or Talin1 because they had little effect on Cas clustering and their effect on vinculin recruitment agrees with published studies. Regarding SFK siRNAs, we note that the pan-SFK allosteric inhibitor eCF506 inhibited vinculin recruitment to Cas clusters, suggesting that one or more SFKs is required. When we knocked down Src, Fyn and Yes we surprisingly found that only Yes was required, despite good knock down in all cases. We discuss the possibility that Yes has a special role based on its trafficking or preference for membrane microdomains. We did not control for off target effects of Yes siRNA but in view of the eCF506 result it seems likely that the effect of Yes siRNA is on-target.

The vinculin silencing efficacy in Figure 6 is poor and precludes making any conclusions on the role of vinculin.

We agree that vinculin silencing is poor despite use of a double knockdown protocol (Figure 5 —figure supplement 1A). Vinculin may have a longer half life than the other proteins we studied. However, imaging shows that vinculin siRNA caused a ~50% decrease in vinculin mean intensity but no decrease in Cas intensity, while Cas siRNA caused a ~50% decrease in Cas intensity and a ~60% decrease in vinculin intensity. Thus Cas appears to be quantitatively limiting for vinculin clustering but vinculin is not limiting for Cas clustering.

In Figure 6C the authors analyse the role of Cas depletion on the regulation of Mn²⁺-dependent spreading. As a further control, the authors could include a rescue experiment with Cas WT and Cas lacking the CCH domain in Cas-depleted cells.

To control for off-target effects of Cas siRNA, we have now generated cells expressing EYFPmCas (mouse Cas) and mCherry-vinculin, treated with control or human Cas siRNA, and measured cell spread area and the number, areas and intensities of Cas-vinculin clusters in absence and presence of Mn²⁺. Wildtype EYFP-mCas fully rescued all effects of Cas siRNA (Figure 5 —figure supplements 2D and 5). We did not try a CCH domain mutant, but a 15F mutant, lacking the 15 YxxP phosphorylation sites, failed to rescue focal adhesion formation in the absence or presence of Mn²⁺. Clustering of the 15F mutant was also defective, consistent with the importance of Cas phosphorylation for clustering. These results control for off-target effects of siCas and for possible issues of use of red and green fluorophores on detection by TIRF, as well as showing the importance of Cas phosphorylation.

7) The results in Figure 7A suggest that the interaction of Crk with phosphorylated Cas accelerates the recruitment of Vinculin to the Cas-Crk clusters. Do the authors have a mechanistic explanation of how this could be regulated?

Our two-step model is presented in Figure 8E and the Discussion. We propose that SFK-CasCrk/CrkL complexes first activate a Rac1 positive-feedback loop to build cluster size and incorporate inactive integrin. Cluster growth may be driven by the formation of protein networks between multiply phosphorylated Cas bridged by Crk/CrkL to proteins containing multiple SH3 binding sites, such as DOCK180. These protein networks interact with integrins through an unknown mechanism, perhaps bridged by membrane microdomains or Yes1-integrin binding. In a second step, the integrin is activated and structural components such as talin and vinculin are recruited. However, it is unclear how the transition from step 1 to step 2 is regulated. There may be lateral interactions between integrin heterodimers, membrane microdomains and other components that lead to adhesion maturation; Cas may need to be inactivated; or some kind of critical size may need to be reached for force application.

Also, to support this data, the authors should perform a Crk rescue experiment in Crk-depleted cells to see whether recruitment of Vinculin to Cas clusters will be rescued to control levels.

We have not performed the suggested rescue experiment but we have added results of single and double knockdowns of Crk and CrkL (Figure 5 —figure supplement 3A-C). Neither single knockdown had much effect but the double knockdown reduced the number, areas and intensities of Cas-vinculin clusters. This suggests functional redundancy between Crk and CrkL. If there the Crk and CrkL siRNAs have off-target effects, they would also have to be functionally redundant, which seems improbable.

8) In Figure 8D, the fluorescence intensity of CasmSc seems to be lower in siSOCS6 than in siCtrl cells. This is rather counterintuitive since the depletion of SOCS6 should stabilize Cas levels. Could the authors comment on this?

Figure 8D shows that either siSOCS6 or the Neddylation inhibitor MLN4924 shortens the time interval between Cas arrival and vinculin arrival. However, as the reviewer notes, the fluorescence intensity of Cas^mSc is decreased, not increased as might be expected if Cas was less degraded. We have performed immunofluorescence and find that pY410Cas is unchanged (i.e., the pYCas/Cas ratio is increased). This is consistent with SOCS6 targeting pYCas for degradation. However, why is total Cas^mSc decreased? We note that vinculin intensity also decreased. We know that siSOCS6 stimulates Cas-dependent adhesion disassembly as well as assembly (Teckchandani et al. 2016 PMC5092051). Thus we suspect that the decreased intensities of Cas and vinculin at the 30 min time point may be due to quicker turnover.

To explore this possibility further, we have re-analyzed the time-lapse imaging of Cas^mSc YFP-VCL cells treated with SOCS6 siRNA (see Author response image 2). The time delay between Cas departure and vinculin departure is decreased when SOCS6 is depleted. Thus, faster turnover of adhesions in SOCS6-depleted cells may mean that more adhesions are undergoing disassembly when Cas and vinculin intensities were measured at the 30 min time point. We feel that fully understanding this aspect would take more analysis and prefer to leave it for follow up study.

Author response image 2

Download asset Open asset

Other points:

1) In the introduction, the authors mention the mechanoresponsive roles of talin in adhesion maturation and assembly. It would be beneficial to mention in this context also the effect of the force-mediated extension of the Cas substrate domain on its downstream signalling (PMID: 17129785, reviewed in PMID: 25062607).

The role of force in Cas substrate domain phosphorylation is unclear. Unlike talin, very little energy is needed to extend the Cas substrate domain and it is unlikely to be structured in cells (Hotta et al. 2014, PMID: 24722239). However, allosteric regulation may be important and we have added the Sawada paper to the Introduction.

2) Figure 1 supplement 2. What is the difference between Hela panels E and F?

Now Figure 1 —figure supplement 3, panel E shows the half-maximum Cas-vinculin time delays for 37 clusters in a single spreading HeLa cell. The data are not normally distributed, so we calculate a median time delay (66.2 s in this cell) and variance (95% CI 21-114 s). Panel F shows the median time delays clusters in each of n=13 cells, from which mean time interval (48.08 s) and variance (SEM + 9s) can be calculated. Similar comparison of single and multiple cell data are shown for spreading and migrating MCF10A cells in Figure 1 G and H and Figure 1 —figure supplement 3C and D.

3) It is not clear, whether the cells measured in Figure 3 are seeded on Fn or Col-I. If on Fn – would the delay in ITGB1 arrival to Cas clusters be different on Col-I, since authors show there are more 9EG7-positive ITGB1 clusters in cells seeded on collagen (Figure 2B)?

All experiments in the initial submission except Figure 2 were done on collagen. We’ve expanded our studies of adhesion assembly on different ECM and moved the relevant section later in the paper. The new Figure 6 shows that both epithelial and fibroblast cells require Cas to assemble adhesions on fibronectin and collagen. Cas clusters are precursors for vinculin clusters after a similar time delay on both matrix proteins. Attachment to collagen is inhibited by β1 siRNA or α2β1-blocking antibody, but not by αv siRNA. Attachment to fibronectin is inhibited by αv or β1 siRNA or by α5β1-blocking antibody. Thus, the role of Cas in focal adhesion assembly extends to different cell types, integrins, and matrix proteins. Please also see Reviewer 2, point 1.

4) This study is in line with previous work (PMID: 30639111), where pY410 Cas has been shown to co-localize with Crk in filopodia tips in a CCH domain-dependent manner and extends these observations to the edge of spreading/migrating MCF10A and HeLa cells. This could perhaps be discussed.

In separate experiments, we are analyzing Cas mechanism in regulating filopodia dynamics induced by cell attachment. Since this work is unfinished, we would prefer to leave comparisons between adhesions and filopodia to a future publication.

Reviewer #2 (Recommendations for the authors):

The manuscript "Cas phosphorylation regulates focal adhesion assembly" by Kumar et al. investigates the role of Cas in cell spreading and finds that Cas, Crk, and FAK cluster together at the cell periphery to initiate focal adhesion formation. In contrast to the previous understanding, they suggest that Cas clustering happens before integrin clustering and hence is the initial step in adhesion formation. This notion is the key novel aspect of the study, however, it is based on the assumption that b1 integrin is the only relevant integrin in the system, which at this point is not supported by the data.

The reviewer’s main concern is that a different integrin may be present and induce Cas phosphorylation before integrin β1 is activated. However, most of our experiments were done on collagen, and, to the best of our knowledge, all collagen receptors contain β1 with various α chains. Adhesion assembly on collagen was inhibited by blocking antibody to α2β1. Therefore, we did not explore possible roles of other integrins. However, we realize that other integrins may be important during attachment to other ECM. In the revision, we have expanded our study to investigate the roles of other integrins and other ECM. We note that all integrins expressed by MCF10A cells form heterodimers with either β1 or αv, so we have used siRNA to inhibit expression of these integrins and studies cell spreading and adhesion formation. We found that collagen adhesion was inhibited by β1 but not by αv siRNA. Therefore it seems unlikely that a different integrin induces Cas phosphorylation before β1 is activated on collagen. In addition, we found that adhesion to fibronectin requires Cas, αv and β1. We have not tagged αv to follow its clustering kinetics, but immunofluorescence of spreading cells revealed β1 adhesions nearer the edge and adhesions containing both β1 and αv further back, suggesting that αv comes later. Therefore, the evidence points to Cas-dependent collagen attachment through integrins containing β1, and Cas-dependent fibronectin attachment through dimers containing αv and β1, with αv unlikely to precede β1.

Specific comments:

– The central finding of the study (i.e. that Cas clusters before integrin) is based solely on the study of b1-integrin and hence on the assumptions that it is the only integrin that is relevant for adhesion formation in the cells used here. To this end, the authors cite work by Kulak, 2014 and Ly, 2018 that MCF10A and HELA cells express 10-fold less b3 integrin compared to b1 integrin. While b3 is indeed found at lower levels in these studies it might be a) nonetheless present at sufficient levels to initiate adhesion formation (as it was picked up by mass-spec analysis); (b) the authors discuss that b1 integrin is 10fold higher expressed compared to Cas ( based on same studies) meaning that Cas and b3 integrin would be expressed at comparable levels, further supporting point (a) above; lastly, (c) the studies by Kulak and Ly find other β-integrins at high levels – Kulak: ITGB5 and ITGB8; Ly: ITGB5, ITGB6, ITGB8, which are all RGD receptors and can complex with ITGAV which is also found at high levels in both studies, consistent with the general understanding of αvβ6 being a major fibronectin receptor in cancer cells. Mechanosensing and binding properties are different for these integrins (e.g. PMID: 24793358, 22328497), but especially the binding to Cas, or their involvement in early adhesion formation have not been characterised to my knowledge. As such the fact that Cas clusters before b1 integrin does not suggest that it is integrin independent, but might only associate with clusters of other integrins (e.g. αvβ6) that then mature into b1 integrin-containing adhesions.

We focused on Cas role in integrin β1 adhesion assembly because most of our experiments used cells spreading or migrating on collagen. To our knowledge, all collagen-binding integrins contain integrin β1. We confirmed β1 dependence using blocking antibody P1E6 to α2β1, which inhibited MCF10A cell adhesion to collagen (previous Figure 2A, now Figure 6 —figure supplement 2A). To further confirm the importance of integrin β1 for collagen adhesion, we have now knocked down β1 in epithelial and fibroblast cells and found that cell spreading and formation of Cas-vinculin clusters was inhibited (new Figure 6 —figure supplement 1B and C). Since other integrins are not known to bind collagen, we think it is unlikely that Cas clusters with other integrins during adhesion assembly on collagen.

We also investigated Cas role in fibronectin adhesion, where αvβ3/β6 and α5β1 may both be important. We previously reported that Cas clustering preceded vinculin clustering by a similar time delay on fibronectin as on collagen, and that attachment and spreading on fibronectin were inhibited by blocking antibody P8D4 to α5β1 (previous Figure 2, now Figure 6B and Figure 6 – supplement 2A). We now show that both epithelial and fibroblast cells require Cas, β1 and αv for attachment and spreading on fibronectin (Figure 6 – supplement 1B and C). This implies that Cas regulates assembly of adhesions containing β1 or αv (or both) on fibronectin.

Immunofluorescence of spreading cells did not reveal any αv clusters that do not also contain β1. Early β1 clusters at the edge lack αv. Therefore, it seems unlikely that an αv integrin induces Cas clustering before β1 recruitment.

– Apart from this central point, the authors show that phosphorylated Cas is enriched at the adhesome, knockdown of Cas leads to cell spreading and migration defects, that Cas is upstream of vinculin recruitment and that Cas is phosphorylated by Yes1, which are all points that have been described in the past. Especially, inwards movement of Cas dependent on phosphorylation: PMID 24928898; the role of Cas in spreading: PMID 10448062; also here: PMIDs 23974298, 21937722; 15817476;

We acknowledge that there have been many previous studies of Cas in focal adhesions but our results shed new light on the role of Cas in adhesion assembly, which has been controversial. Previous adhesome studies were not designed to measure the proportion of a specific protein or phosphoprotein in the adhesome, just whether they were detectable. Our semi-quantitative Western blot analysis shows that pY410Cas, pY249Cas and pY861FAK are highly enriched in the adhesome fraction relative to their non-phosphorylated (or in the case of FAK, pY397 phosphorylated) forms (Figure 4 —figure supplement 4). This suggests that these phosphorylations occur locally within adhesions and are rapidly lost when Cas or FAK dissociate.

Other studies have shown that Cas is required for cell spreading and migration, but we are not aware of other studies investigating how Cas regulates adhesion assembly.

Machiyama et al. (2014) (PMID 24928898) reported that Cas molecules within adhesions sites move inwards dependent on actomyosin contraction and Cas phosphorylation and that Src-Cas dissociation is important for adhesion disassembly. They inferred that Cas may become more phosphorylated towards the inner end of an adhesion, the inverse of what we see. Honda et al. (1999) (PMID 10448062) first reported that cas-/- MEFs spread and assembled the actin cytoskeleton slowly. Janostiak et al. (2014) (PMID 23974298) and 2011 (PMID 2193772) detected direct Cas-vinculin interaction and concluded that vinculin regulates Cas localization, rather than vice versa, as we report. Sanders and Basson (2005) (PMID 15817476) showed that Cas but not paxillin knockdown inhibited Caco2 cell spreading but did not look at adhesion assembly. The Honda and Janostiak contributions were cited in the previous submission and we have added Sanders and Basson to the new submission.

– The authors find phosphorylation through Yes, but not fyn or src, although PMID 17129785 previously demonstrated that Yes, Src, and Fyn can phosphorylate Cas; whereas PMID 11604500 finds that Src can phosphorylate Cas. The discrepancy here should be explored.

– Also the lack of effect of Src and Fyn knockdown in the current study is in apparent contrast to the existing literature, e.g. PMID 16597701, and should be explored further.

We agree that a special role for Yes was unexpected. Sawada et al. (2006) (PMID 17129785) stated (but did not show) that Cas phosphorylation in SYF (src-/- fyn-/- yes-/-) MEFs was restored by expressing cSrc, cYes or Fyn and showed that recombinant cSrc or FynT could phosphorylate Cas in vitro. Ruest et al. (2001) (PMID 11604500) is one of several publications reporting that SFKs phosphorylate Cas with FAK as a scaffold. Kostic and Sheetz (2006) (PMID 16597701) showed Fyn dependent phosphorylation of Cas in αvβ3 adhesions forming at the edge of fibroblasts spreading on fibronectin. We have added Discussion of how differences in affinity for integrin tails or for lipid microdomains may explain the unexpected role for Yes.

– Similarly the question about the recruitment of vinculin downstream of Cas seems to be in disagreement with the literature reporting that vinculin is upstream of FAK dynamics – i.e. since adhesion localisation of Cas is less pronounced in absence of Vinculin (PMID 23974298).

As stated above, Janostiak et al. (2014) (PMID 23974298) concluded that vinculin regulates Cas localization, rather than vice versa, as we report. They measured the % of paxillin-positive focal adhesions that contained GFP in GFP-Cas-expressing control and vinculin-/- MEFs. The focal adhesions in vinculin-/- MEFs were smaller than in control MEFs which may have made it harder to detect co-localization of GFP-Cas against the cytoplasmic background. Given the importance of vinculin in reinforcing talin-actin connections, vinculin-/- MEFs may have upregulated compensatory pathways during selection for growth in culture.

The authors should expand the investigation to other integrins.

Please see response to comment 1 above for discussion of other integrins.

In order to exclude that the change in adhesion localisation (i.e. distance from cell edge; e.g. Figure 5C) is not affected by the different penetration depth of the green and red light in the dual color TIRF experiments, the authors should investigate as a control green Cas vs CasmSc.

Regarding choice of red and green fluorophores: we obtain similar results from studies of EYFPmCas and mCherry-VCL (Figure 5 —figure supplement 2).

Reviewer #3 (Recommendations for the authors):

The findings of this paper show that epithelial cell adhesion to fibronectin or collagen involves a novel adhesion site assembly process that relies on clusters of Cas at the cell edge. Further, an SFK-Cas-Crk-Rac1 pathway is linked to spreading and further adhesion maturation through vinculin recruitment. The MCF10A and HeLa lines that are used in this study have very low levels of β 3 integrin and the β 1 integrin is the primary integrin involved but Mn activation does not rescue spreading in the absence of Cas.

The mechanism of Cas concentration at the leading is not determined but there are many other findings that support the major hypothesis.

An experiment that would test the hypothesis that the major difference between the adhesion formation in fibroblasts and these epithelial cells is the level of β 3 integrins would be to overexpress β 3 and/or deplete β 1 in the MCF10A cells. If β 3 integrin would be processed and reach the cell surface, then the process of adhesion formation may change.

I liked this paper and it was very thorough in documenting the pathway for adhesion formation. My major suggestion is to try to increase β 3 integrin levels in the epithelial cells or alternatively, deplete them in the fibroblasts while increasing β 1 levels. This may not work for a variety of reasons but it would be spectacular if it did.

We thank the reviewer for their kind comments.

Many previous studies of focal adhesion assembly mechanism and kinetics have made use of fibroblasts attaching to fibronectin through αvβ3 as well as α5β1. Formation of tension-sensitive, αvβ3 adhesions on fibronectin requires Fyn and Cas (von Wichert et al., 2003; Kostic and Sheetz, 2006). However, our experiments were done on collagen and β3 integrins are not known to mediate adhesion to collagen. Moreover, our new siRNA experiments show that β1 but not αv is needed for Cas-dependent epithelial or fibroblast cell attachment to collagen. Together with our finding that α2β1 antibody blocks adhesion, the results suggest that Cas is working through β1 without participation by other integrins on collagen.

The situation is more complicated on fibronectin. We find that β1 siRNA or α5β1-blocking antibody inhibits Cas-dependent adhesion of epithelial cells or fibroblasts to fibronectin. However, siRNA against αv is also inhibitory, suggesting a requirement for αvβ3/6 as well as α5β1. The αv partner may be β6 in epithelial cells since β3 was not detected. The αv partner in fibroblasts may be β3, since we detected β3, αv and β1 in fibroblast focal adhesions. Thus Cas may regulate focal adhesion assembly through integrin dimers containing αv as well as β1. We have not tagged αv so do not know whether it clusters before or after Cas, but we suspect it clusters after Cas and after β1 because immunofluorescence of spreading cells shows αv adhesions further from the cell edge than β1 adhesions.

We are presently investigating how phospho-Cas/Crk clusters nucleate integrin clusters, focusing on β1. For the present paper, we hope the reviewers will agree that showing the Cas requirement for focal adhesion formation on different ECMs, through different integrins, and in two cell types, is sufficiently interesting for publication in eLife.

https://doi.org/10.7554/eLife.90234.sa2

Article and author information

Author details

Saurav Kumar

Fred Hutchinson Cancer Center, Seattle, United States

Contribution
Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing – review and editing

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-0992-589X
Amanda Stainer

Fred Hutchinson Cancer Center, Seattle, United States

Contribution
Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0001-7068-2658
Julien Dubrulle

Fred Hutchinson Cancer Center, Seattle, United States

Contribution
Data curation, Software, Methodology

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-4186-7749
Christopher Simpkins

Fred Hutchinson Cancer Center, Seattle, United States

Present address
BCMB Program, Johns Hopkins University School of Medicine, Baltimore, United States

Contribution
Formal analysis, Investigation, Visualization, Methodology, Writing – review and editing

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-3174-6609
Jonathan A Cooper

Fred Hutchinson Cancer Center, Seattle, United States

Contribution
Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing – review and editing

For correspondence
jcooper@fhcrc.org

Competing interests
Senior editor, eLife

"This ORCID iD identifies the author of this article:" 0000-0002-8626-7827

Funding

Fred Hutchinson Cancer Center

Saurav Kumar
Amanda Stainer
Christopher Simpkins
Jonathan A Cooper

National Institutes of Health (R01 GM109463)

Saurav Kumar
Amanda Stainer
Christopher Simpkins
Jonathan A Cooper

National Institutes of Health (P30 CA015704)

Julien Dubrulle

Fred Hutch/University of Washington Cancer Consortium

Jonathan A Cooper

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Acknowledgements

We are very grateful to Lena Schroeder, Peng Guo, and Jin Meng for training and use of equipment in the Cellular Imaging Shared Resource and Luna Yu for computational assistance. We thank Dorus Gadella, Harold MacGillavry, Shinya Yamanaka, Olivier Pertz, Gregory Petsko, and Didier Trono for Addgene plasmids, David Calderwood and Susumu Antoku for additional constructs, and Denise Galloway for cells. Reinhard Faessler provided a detailed protocol for adhesome isolation. We are very grateful for helpful discussions with Matt Berginski and Matthew Kutys. Dayoung Kim, Jihong Bai, Cecilia Moens, Susan Parkhurst, and other colleagues provided useful feedback during development of the project. This research was supported by institutional funds from Fred Hutch and National Institutes of Health grant R01 GM109463 from the US Public Health Service. The Cellular Imaging and Flow Cytometry Shared Resources of the Fred Hutch/University of Washington Cancer Consortium is supported by P30 CA015704.

Senior Editor

David Ron, University of Cambridge, United Kingdom

Reviewing Editor

Anna Akhmanova, Utrecht University, Netherlands

Version history

Preprint posted: December 19, 2022 (view preprint)
Received: June 16, 2023
Accepted: July 19, 2023
Accepted Manuscript published: July 25, 2023 (version 1)
Version of Record published: August 17, 2023 (version 2)

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.