As previous screens have identified sleep components on the X chromosome and the second chromosome (Cirelli et al., 2005; Koh et al., 2008; Stavropoulos and Young, 2011), we sought to identify sleep-altering mutations on the third chromosome in Drosophila. To this end, we generated a stock of iso31 (Ryder et al., 2004) flies carrying a newly isogenized third chromosome and treated males of this stock with 10–25 mM ethyl-methanesulfonate (EMS). Individual male progeny were bred to achieve homozygosity of the third chromosome, and females of the F3 generation were tested for daily sleep patterns in the presence of light:dark cycles (Koh et al., 2008). As seen in previous screens (Koh et al., 2008), sleep amounts were normally distributed in the 1857 lines assayed (Figure 1A, Figure 1—source data 1). Two homozygous mutant lines showed a severe reduction of sleep length, and we focused on one of these that we named redeye (rye). rye homozygotes show a >50% reduction in both daytime and night-time sleep (Figure 1C). The activity (average number of beam crossings during periods of activity) of rye mutants is comparable with that of wild type controls, suggesting it is not a hyperactive mutant (Figure 1B). rye heterozygotes have slightly less sleep than wild type, suggesting that the rye mutation is partially dominant (Figure 1B,C). The dramatic reduction of baseline sleep results largely from a shortening of the average sleep episode duration (Figure 1D), which is indicative of a defect in sleep maintenance. The average number of sleep episodes at night is actually increased significantly in rye mutants, perhaps because the sleep homeostat senses sleep loss and compensates by initiating more bouts. We also assayed rye mutants in sleep deprivation assays and found that they did not lose much additional sleep in response to mechanical stimulation (data not shown). We surmise that an inability to sustain sleep bouts leads to the buildup of high sleep need in rye mutants, which makes them resist any further sleep loss.

Figure 1

Download asset Open asset

Figure 1—Source data 1

Measurement of sleep duration for all EMS mutants and sleep analysis of rye mutants.

https://doi.org/10.7554/eLife.01473.004

Download elife-01473-fig1-data1-v1.xlsx

As the circadian clock regulates the timing of sleep and some clock mutants show reduced sleep (Hendricks et al., 2003), we also assayed rye flies for defects in circadian rhythms. These endogenously generated rhythms are best monitored under constant conditions, in the absence of cyclic environmental cues, so we monitored behavior in constant darkness (DD). rye mutants display robust rest:activity rhythms in DD (∼62% rhythmicity) despite showing prolonged duration of activity (Figure 2A; Table 1). Of the ‘arrhythmic’ rye homozygotes detected, half (6/11) actually displayed a rhythm of ∼12 hr period length, which likely resulted from persistence of bimodal behavior (typically seen in light:dark) in DD. Thus, most rye homozygotes are rhythmic. Consistent with the intact circadian behavior, circadian cycling of the clock protein, PERIOD (PER), is normal in central clock cells of rye mutants. The peaks and troughs of expression, as well as the subcellular localization, at different times of day are similar to those in iso controls (Figure 2B). Thus, PER is largely nuclear at ZT20, entirely nuclear at ZT2, expressed at low levels at ZT8 and undetectable at ZT14. We conclude that only the homeostatic regulation of sleep is affected in rye mutants.

Figure 2

Download asset Open asset

We identified the sleep-altering lesion in rye mutants through a combination of recombination mapping and deep-sequencing. Despite starting with a newly isogenized line, deep-sequencing identified many nucleotide changes in the rye background relative to the parental control and so considerable mapping was required to pinpoint the relevant mutation. Meiotic recombination analysis positioned rye between two genetic markers, thread and curled, in the centromeric region of the 3^rd chromosome. Further mapping studies, using self identified single nucleotide polymorphism (SNP) markers, narrowed it down to ∼11 mega-bases (Figure 3A, Figure 3—source data 1). For finer localization, we utilized the genome-wide sequence data, which provided 40× and 10× genomes worth of nucleotide sequence, corresponding to 95% and 88% coverage, for the rye and iso31 genomes respectively. Following alignment with the published Drosophila genome, unique nucleotide polymorphisms present in rye mutants were pooled together as potential EMS-induced mutations (n = 26,224). Within the 11 Mb region identified through recombination mapping, there were 1457 potential mutations, but only nine that produced an amino-acid change in coding regions. Sanger sequencing allowed us to exclude seven of these. Two turned out to be deep-sequencing errors and five polymorphisms were also present in the wild type iso stock but not detected due to the low coverage of deep-sequencing in this stock. One polymorphism, in a gene annotated CG7320, was at a site that was also polymorphic in iso, although the amino acid change was different in the two strains. Because of the change in iso, which does not produce a sleep phenotype, we considered CG7320 a less likely candidate for rye. The last of the nine changes identified by deep-sequencing was a C-T transition (typical for EMS-induced mutations) that leads to a threonine to methionine change in CG12414 and is present only in rye mutants (Figure 3B). CG12414 encodes an α subunit of a nicotinic acetylcholine receptor (nAchR) (Lansdell and Millar, 2000). Five alternatively spliced variants produced by this gene are predicted to generate three possible open reading frames with one (pC/pG) containing an intact ligand bind domain (LBD) (Figure 3C). The predicted protein is homologous to several nAChR subunits, including α3, α2, α6, α4 and α7 in order of similarity. Alignment of CG12414 with α3 and α7 using the ClustalW2 algorithm shows that the rye mutation is at the junction between the LBD and the trans-membrane domain (TM) (Figure 3D,E). Interestingly, this junction region is highly conserved across species and the specific threonine mutated in rye is conserved in all α7 subunits (Figure 3D).

Figure 3

Download asset Open asset

Figure 3—Source data 1

Recombination mapping of the rye mutation using a chromosome marked with visible markers h,th,cu,sr,e, and using SNP markers.

https://doi.org/10.7554/eLife.01473.008

Download elife-01473-fig3-data1-v1.xlsx

The genetic mapping and deep-sequencing data combined implicated CG12414 as a candidate gene responsible for the rye sleep phenotype. To verify this function for CG12414, we attempted to rescue rye mutants with a CG12414 transgene. To drive expression in areas that normally express this gene, we cloned the CG12414 promoter region (1.8 kb) and generated a GAL4 construct. This GAL4 is expressed broadly in the Drosophila brain (Figure 4A). We also cloned the CG12414 cDNA into a UAS construct and crossed the GAL4 and UAS transgenes into an iso³¹ stock to ensure a homogenous genetic background. These transgenes were then introduced into rye mutants. While either transgene alone did not alter the rye short sleep phenotype, the rye promoter driving RYE expression (ryeP > uas-rye) partially rescued the mutant phenotype and restored total sleep to levels seen in rye heterozygotes (Figure 4B). This is expected, given that rye^T227M is partially dominant over wild type. In a wild type background, ryeP > uas-rye does not increase sleep length (data not shown), suggesting that the increase in sleep is specific to the mutant. Thus, we identified the gene responsible for the short sleep phenotype in rye mutants, and henceforth refer to this gene CG12414, previously called nAChR-80B, as redeye.

Figure 4

Download asset Open asset

Figure 4—Source data 1

Sleep behaviour of transgenically rescued rye mutants and rye RNAi lines.

https://doi.org/10.7554/eLife.01473.010

Download elife-01473-fig4-data1-v1.xlsx

To further characterize rye function, we knocked down RYE expression through RNA interference. A rye RNAi line (#11392) from the VDRC stock center in Vienna was crossed into the ryeP-GAL4 line along with a UAS-Dicer2 transgene, included to improve efficacy of the RNAi. Levels of RYE were reduced (Figure 4D), as was the total sleep length (Figure 4C). Since rye^T227M reduces sleep as well (Figure 1), these data suggest that the T227M mutant allele causes loss of RYE function. The sleep phenotype produced by rye knock-down is rather mild in comparison with the phenotype of the homozygous rye mutant, possibly due to inefficient knockdown in relevant cells or because rye^T227M is a dominant-negative mutation. The nicotinic acetylcholine receptor forms a pentameric structure, consisting of five homo-oligomeric or hetero-oligomeric subunits (Miwa et al., 2011), so a dominant negative mutation in any one subunit may well interfere with activity of the complex.

We next addressed if rye interacts with other known sleep mutants, in particular with a mutant we identified previously, sleepless (sss), that has an extreme short-sleeping phenotype (Koh et al., 2008). While transheterozygotes of rye and sss (sss/+; rye/+) showed sleep duration comparable to that of rye/+ alone (data not shown), rye heterozygotes carrying a genomic sss transgene, which increases SSS expression above that of wild type controls, showed a further reduction of sleep (Figure 5A). The effect was observed with three independent insertions of the sss transgene, indicating that it was not due to insertion site effects (Figure 5B). We note that this sss transgene does not have a significant effect on sleep in wild type flies although it completely rescues the sleep phenotype of sss mutants (Koh et al., 2008). Thus, the effect is specific to rye mutants.

Figure 5

Download asset Open asset

Figure 5—Source data 1

Sleep analysis of rye mutants overexpressing sss, and whole-cell membrane current recording of Xenopus oocytes.

https://doi.org/10.7554/eLife.01473.012

Download elife-01473-fig5-data1-v1.xlsx

SSS is a GPI-anchored protein that regulates the Shaker potassium channel and its predicted structure resembles that of a specific class of toxins (Wu et al., 2010; Dean et al., 2011). It is most similar to the mammalian Lynx-1 protein, which is known to inhibit activity of the nicotinic acetylcholine receptor (Miwa et al., 2011). The fact that SSS exacerbated the phenotype of flies heterozygous for rye, which have reduced activity of nAChR, suggested that SSS also regulates nAChRs. We tested a possible Lynx-1-like function of SSS in regulating nAChR activity by using a heterologous expression system, specifically Xenopus laveis oocytes. For functional expression of wild type RYE, we expressed it with a human β2 subunit, as insect β subunits typically do not work in heterologous systems (Millar and Lansdell, 2010). cRNAs encoding sss, wild type rye and human β2 were injected into oocytes, and 4–7 days later whole cell currents were measured following application of ACh (Kuryatov and Lindstrom, 2011). Heterologous expression of insect nAChRs has, in general, been challenging (Millar, 2009), which accounts for the low current values observed (Figure 5C). However, we still detected a significant reduction of nAChR current upon co-expression with SSS (Figure 5C). We also co-expressed in vitro transcribed sss and human α4 and β2 subunits and found that SSS also inhibits the robust current produced by the human receptor complex (Figure 5D). Thus, in addition to its sleep-promoting role reported previously, SSS may also promote wake by repressing activity of nAChRs. As discussed below, loss of the sleep-promoting role has a dominant effect in sss mutants.

We next asked if levels of rye vary over the course of the day. Groups of wild type flies were housed in a 12 hr-light and 12 hr-dark incubator and harvested at different Zeitgeber times (ZT). Zeitgeber time defines time based on the environmental stimulus, so ZT0 corresponds to light-on and ZT12 to light-off. RNA was extracted and subjected to quantitative PCR analyses. While period (per), a well-known circadian clock component, oscillates with a circadian rhythm (Zheng and Sehgal, 2012), rye mRNA levels were found to be constant (Figure 6A).

Figure 6 with 2 supplements see all

Download asset Open asset

Figure 6—Source data 1

qPCR analysis of per and rye expression during LD cycle and densitometry quantification of RYE expression.

https://doi.org/10.7554/eLife.01473.014

Download elife-01473-fig6-data1-v1.xlsx

To examine protein levels of RYE, we generated an antibody against the cytoplasmic L3 domain of RYE (Figure 3E), which is the most variable region across all nAChR subunits (Lindstrom, 2003). On western blots, the antibody recognizes a band (or sometimes a doublet) of ∼60 Kd, which is the size predicted for the full-length isoform. Surprisingly, in contrast to the flat mRNA levels, levels of RYE protein show a robust rhythm with two peaks each day, one at around ZT6-10 and the other at ZT18-22 (Figure 6B, Figure 6—figure supplement 1). Interestingly, these correspond to the two daily times of sleep, the afternoon siesta and night-time sleep (Figure 1B), suggesting that RYE is expressed in phase with sleep. The cycling of RYE persists in constant darkness, as do rhythms of sleep (data not shown). However, RYE does not appear to be regulated like other cycling clock components, such as PER, which usually show only one peak (Figure 6B). Furthermore, we found that RYE continues to cycle in Clk^jrk flies that lack a circadian clock, although the phase of RYE expression tends to be more variable in these flies (Figure 6C, Figure 6—figure supplement 2). These data suggest that the RYE oscillation per se does not require process C of the two process model, but may depend upon process S (sleep homeostasis). However, the circadian clock may function to provide more precise timing of RYE expression, perhaps through its control of sleep onset and offset.

Increases in RYE expression could occur as a consequence of sleep, and thereby reflect the sleep state, but in that case levels should remain high throughout the sleep state. Given that RYE levels do not remain high throughout the night or through the afternoon siesta, another possibility is that elevations in RYE correspond to sleep drive and so occur at the time of sleep onset. To test this idea, we assayed RYE expression in short-sleeping mutants. These mutants have low sleep levels, but probably have high sleep drive that cannot be implemented. As shown in Figure 7, for the most part RYE expression exhibits two peaks in these mutants, but the phase is more variable (Figure 7—figure supplements 1–3), indicating that defects in sleep behavior affect the RYE expression pattern. Interestingly, overall RYE values are higher in fumin (Kume et al., 2005; Ueno et al., 2012), sss (Koh et al., 2008) and insomniac (Stavropoulos and Young, 2011) mutants than in wild type controls. As noted above, the sss mutation affects channel activity, fumin is a mutation in the dopamine transporter (short sleep is thought to result from the high levels of dopamine in the synaptic cleft) and insomniac is thought to affect protein turnover. The one feature these mutants have in common is short sleep, yet they all have elevated RYE expression during an LD cycle (Figure 7A–C). Based upon these data, we suggest that RYE reflects sleep need. It is elevated at the time of sleep onset and is further increased in short-sleeping mutants because they have high sleep need.

Figure 7 with 3 supplements see all

Download asset Open asset

Figure 7—Source data 1

Densitometry quantification of RYE expression in short sleep mutants.

https://doi.org/10.7554/eLife.01473.018

Download elife-01473-fig7-data1-v1.xlsx

If the expression of RYE changes in response to the accumulation of sleep need, it should also be affected by acute sleep deprivation. We mechanically deprived flies of sleep in the second half night (6 hr) in an LD cycle, and confirmed, through the presence of a substantial sleep rebound the following morning, that the flies were successfully deprived (Figure 8A; Koh et al., 2008). RYE levels were assayed during the 5 hr sleep rebound window. In the non-deprived control, RYE levels were low at ZT0 and high at ZT5, as noted above. Sleep-deprived flies had high levels of RYE immediately following deprivation (ZT0), but levels were low at ZT5 (Figure 8A, Figure 8—figure supplement 1). This fits the profile for sleep drive, which is expected to be high at the end of deprivation, but then dissipated over the course of rebound sleep.

Figure 8 with 1 supplement see all

Download asset Open asset

Figure 8—Source data 1

Densitometry quantification of RYE expression after SD.

https://doi.org/10.7554/eLife.01473.023

Download elife-01473-fig8-data1-v1.xlsx

We suggest that RYE represents a molecular correlate of delta power, a characteristic of an electroencephalogram (EEG) that reflects sleep drive. Recently, a few other molecules were reported to change with sleep drive, but the effects were at the level of the mRNA, the magnitude of the increase was less than we report here for RYE and loss of the molecules did not affect baseline sleep duration (Seugnet et al., 2006; Maret et al., 2007; Naidoo et al., 2007). In addition, only one is expressed cyclically (Nelson et al., 2004), indicating that others reflect sleep drive only under pathological conditions of sleep deprivation. RYE levels oscillate robustly in a daily cycle, although the phase is not as coherent as seen for circadian clock proteins. The timing of the peak varies within a temporal range, such that there is almost always a daytime peak and a night-time peak but not necessarily at the exact same time (Figure 6—figure supplement 1). We suggest that RYE cycles under control of the sleep homeostat, which may not time behavior as precisely as the circadian clock, perhaps because sleep can be influenced by many factors. The variability in RYE cycling is particularly pronounced in short-sleeping mutants and in the Clk^Jrk circadian clock mutant (Figure 6—figure supplement 2, Figure 7—figure supplements 1–3), suggesting that the clock does influence RYE expression although it is not required for its cycling in an LD cycle. Interestingly, RYE cycles exclusively at the level of the protein, indicating translational or post-translational mechanisms. It is worth noting that a recently identified sleep regulator, Insomniac, is a component of specific protein degradation pathways in the cell (Stavropoulos and Young, 2011). Although our study indicates that RYE cycling does not require Insomniac (Figure 7C), it is possible that it is regulated by other protein turn-over machinery. Thus, translational/posttranslational regulation appears to be part of the mechanism of sleep homeostasis.

We show that RYE not only reflects sleep drive, but is also required for sleep maintenance (Figures 1, 4 and 8). Given that RYE is induced by sleep deprivation and it promotes sleep, one might expect over-expression of the protein to increase sleep. However, transgenic expression of rye in a wild type background does not increase sleep, suggesting that while rye is necessary, it is not sufficient for sleep onset. We cannot exclude the possibility that RYE functions together with other signals as part of the sleep-inducing homeostatic drive. On the other hand, it is also possible that transgenic expression does not produce adequate amounts of RYE protein in relevant cells. This might be the case if RYE is tightly regulated at the level of protein stability. For the moment, though, we prefer the parsimonious explanation noted above, that RYE is not part of the homeostat, but immediately downstream of it.

Acetylcholine signaling has been long proposed as an arousal factor, as the nAChR complex is a cation channel that normally promotes neuronal activity and ACh is released during wakefulness in mammals (Platt and Riedel, 2011). In contrast, our study indicates that at least one nAChR subunit (RYE) promotes sleep in the fly. There are more than 10 paralogs of nAChR subunits in the fly genome. One possibility is that RYE is expressed specifically in sleep promoting neurons, while other subunits of AChRs are in wake-promoting cells. An increase in ACh during wakefulness may contribute to the accumulation of sleep drive and to the increase in RYE (Lindstrom, 2003). Alternatively, sleep drive may increase RYE independently of ACh, but in either scenario, RYE then promotes sleep. The precise site of RYE action is currently not known. rye-gal4 driven GFP is expressed widely in the brain (Figure 4A), but we cannot be sure that endogenous RYE is as widespread, as our antibody was not effective in immunohistochemistry experiments, and we find that GAL4 drivers are often quite promiscuous (unpublished observations).

SSS was previously identified as a sleep promoting factor, essential for maintaining baseline sleep and for homeostatic rebound (Koh et al., 2008). An interaction between rye and sss is therefore not surprising. What is surprising is that overexpression of SSS promotes wakefulness in rye^T227M heterozygotes (Figure 5A,B). SSS is a GPI-anchored protein that functions as a neuronal modulator. Previous studies indicate that SSS promotes activity of the voltage-gated potassium channel, Shaker (Wu et al., 2010). In this study, we report that SSS acts like a brake on nAChR (RYE) activity (Figure 5C,D), as does Lynx-1, a SSS-like molecule, in mammals (Miwa et al., 2011). Although the data we show for Drosophila receptors used only the RYE α subunit, it is likely that SSS also inhibits activity of other Drosophila nAChR receptors. As both sss^P1 (a null mutation) and sss^P2 (a hypomorphic allele) are short-sleeping mutants (Koh et al., 2008), we propose that the overall effect of SSS is to promote sleep. The reduced sleep in sss mutants probably results from an increase of neuronal excitability, through inactivation of potassium channels (Shaker) (Dean et al., 2011), or from hyperactivity of nAChR channels in wake-promoting neurons. Thus, typically the sleep-inhibiting effect of SSS, mediated through RYE, is masked by these other more dominant influences. However, in a sensitized background (i.e., rye/+), this effect is evident. RYE promotes sleep, and so loss of RYE results in a decrease in sleep, which is further impacted by SSS overexpression (Figure 8B).

We note that there are some caveats to these data. For instance, the rye^T227M allele could confer a neomorphic function that accounts for the interaction with sss. Likewise, the effects in oocytes could be non-physiological, not necessarily reflecting what happens in the fly brain. However, given that we observe interactions in these two very different types of assays, and both assays indicate repression of nAchR function by SSS, which is the effect predicted from the role of the mammalian SSS-like protein, Lynx1, we believe SSS does indeed regulate nAchRs such as RYE. Interactions between SSS and nicotinic acetylcholine receptors are also reported by recent work from another laboratory (W Joiner, personal communication).

It is interesting that genes identified through independent genetic screens in Drosophila are turning out to interact with one another. SSS and Shaker were isolated independently as sleep-regulating genes (Cirelli et al., 2005; Koh et al., 2008), and subsequently shown to interact, and now we find that RYE interacts with SSS. Given that each of these genes represents a relatively infrequent hit in an unbiased screen, the interactions suggest that genetic approaches are converging upon specific sleep-regulating pathways. Interestingly, a recent GWAS study for sleep-altering loci in humans identified significant effects of SNPs in an nAchR subunit as well as in a regulatory subunit of Shaker, suggesting that these mechanisms are also conserved across species (Allebrandt et al., 2013).

Wild type iso³¹ (Ryder et al., 2004) was crossed with TM2/TM6C, Sb (Bloomington stock #5906), and a single male progeny was selected and crossed with #5906 to balance the 3^rd chromosome and generate a line isogenic for this chromosome.

Flies were housed in Percival incubators (Perry, IA) and beam–break activity was recorded with the Trikinetics DAM system (http://www.trikinetics.com/). Pysolo (Gilestro and Cirelli, 2009) software was used to analyze and plot sleep patterns. Sleep deprivation was achieved through repeated mechanical shaking (2 s randomized shaking in every 20-s interval).

A 3^rd chromosome marker line h, th, cu, sr, e (Bloomington stock #576) was crossed to rye/TM6C, Sb, and heterozygote female progeny (h, th, cu, sr, e/rye) were further crossed to TM2/TM6C, Sb (#5906). A single recombinant male offspring was back-crossed to #576 to score the genotype of recessive markers and also back-crossed to rye for behavioral analysis to score the rye genotype. Overlap in the genotypes of recombinants narrowed down the location of the rye mutation to the region between markers th and cu.

Genomic DNA of homozygous recombinants was subject to SNP analysis. The primer set 5′TGTTTAGTGGTGTTGTGTGAGC3′ and 5′GCCGAGTGTCATCGCCTTTG3′ for SNP_L and the primer set 5′AAAGGTCATCTTGCTTCGGAGTTG3′ and 5′GGAGTGGCTTCCTCGTCATC3′ for SNP_R were used for PCR amplification. Nucleotide polymorphisms were identified between iso and #576. Thus, those recombinants were scored accordingly and rye was further narrowed down to a region between those two SNP markers.

Fragmented genomic DNA (∼400 bp in size) obtained through the Covaris instrument (Woburn, MA) was subjected to Illumina paired-end DNA library preparation. The libraries were amplified for 10 PCR cycles prior to Illumina Hi-Seq analyses. SNP calling analyses identified nucleotide polymorphisms in both rye mutants and iso flies.

The primer set 5′GGCTCGATGTGCTTTCAAGAGTTC3′ and 5′CATGCCAGATGAGTGCGTTTC3′ was used to clone the rye promoter region from genomic DNA derived from the iso stock. The primer set 5′TTTAGGCTTAGTCCGCTACC 3′ and 5′AATGTCGTGGTTTGAAGTGC 3′ was used to clone the full length rye cDNA. The PhiC31 integration system was used for injection. The rye promoter construct was specifically inserted onto the 2^nd chromosome and the Uas-rye construct was integrated on the 3^rd chromosome.

The primer set 5′ATGCATCATCACCATCACCATAGTATCTGCGTGACGGTTGTTG3′ and 5′GTGGTGGTGCACAACTGCCAACGTGAATATCC 3′ was used to clone the L3 epitope of RYE. A GST-RYE^L3 fusion protein was expressed in Escherichia coli, excised from a PAGE gel and injected into rats for antibody generation.

Drosophila genomic DNA: flies (3–15) were frozen and homogenized in DNA extraction buffer. After LiCl/KAc precipitation, supernatants were subject to isopropanol precipitation. DNA pellets were dissolved in TE for sequencing analyses and PCR amplification.

RNA: adult flies were collected at indicated time points and fly heads (10∼20) were subject to Trizol extraction (Ambion, Life Technologies, Grand Island, NY). cDNA libraries were made through high-capacity cDNA reverse transcription kits (Applied Biosystems, Life Technologies, Grand Island, NY). Quantitative PCR analysis was performed using SYBR green reagents in the Applied Biosystems 7000 sequence detection system. The primer set 5′AGTTGAATGGAAGCCACCAGC3′ and 5′TGTTCATCCATGTGCCTCAG3′ was used for qPCR analysis of rye expression.

Protein: flies were collected at indicated time points and fly heads (∼5) were prepared for protein extraction and for Western analyses as previously described (Luo and Sehgal, 2012).

Adult fly brains were dissected in cold PBS buffers at indicated CT time points. Brains were fixed in 4% PFA for 30 m and incubated with 5% Normal Donkey Serum (NDS) for 1 hr at the blocking step. Incubation with primary rabbit anti-PER (1:1000), mouse anti-PDF (1:1000) and rabbit anti-GFP, mouse anti nc82 was performed overnight in the cold room. After extensive washing, brains were incubated with the donkey anti-rabbit or anti-mouse secondary antibody (1:1000) for 2 hr. Images were taken under a Leica confocal microscope.

Oocytes were removed surgically from Xenopus laevis and placed in an OR-2 solution containing 82.5 mM NaCl, 2 mM KCl, 1 mM MgCl₂, 5 mM HEPES, and pH 7.5. They were defolliculated in this buffer containing 2 mg/ml collagenase type IA (Sigma, St. Louis, MO) for 1.5 hr. After defolliculation, oocytes were incubated at 18°C in 50% L15 (Invitrogen, Carlsbad, CA) 10 mM HEPES, pH 7.5, 10 units/ml penicillin, and 10 g/ml streptomycin at 18°C. 3–6 days after injection, whole-cell membrane currents evoked by acetylcholine were recorded in oocytes at room temperature with a standard two-electrode voltage-clamp amplifier (Oocyte Clamp OC-725; Warner Instrument, Hamden, CT). Recordings were performed at a holding potential of −50 mV. All perfusion solutions contained 0.5M atropine to block responses of endogenous muscarinic AChRs that might be present in oocytes. Acetylcholine was applied by means of a set of 2-mm glass tubes directed to the animal pole of the oocytes. Application was achieved by manual unclamping/clamping of a flexible tube connected to the glass tubes and to reservoirs with the test solutions. The recording chamber was perfused at a flow rate of 15–20 ml/min. cRNAs for human AChR subunits 4 and 2 and Drosophila sss were synthesized in vitro using SP6 RNA polymerase (mMESSAGEmMACHINETM, Ambion). Oocytes were injected with 5 ng of cRNA of each of the subunits.

The funder had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

We are grateful to Christine Quake for technical support of this project, Matt Kayser, Dan Cavanaugh, Katarina Moravcevic and Christine Dubowy for critical reading of the manuscript and other members of the laboratory for useful discussions. We thank William Joiner for communicating results prior to publication. We also thank Natania Field for suggesting the name, redeye. AS is an Investigator of the HHMI.

© 2014, Shi et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.