A current paradox in our understanding of alt-EJ is that Polθ promotes non-templated (random) nucleotide insertions at DNA repair junctions in vivo, but lacks template-independent terminal transferase activity in vitro. For example, similar to previous studies (Hogg et al., 2012; Kent et al., 2015), we found that Polθ fails to extend a homopolymeric ssDNA containing deoxycytidine-monophosphates (poly-dC) in the absence of the complementary deoxyguanosine-triphosphate (dGTP) under standard buffer conditions with magnesium (Mg²⁺Figure 1D). This shows that efficient ssDNA extension by Polθ requires the complementary nucleotide, which demonstrates that the template bases facilitate the nucleotidyl transferase reactions by pairing with the incoming nucleotide. Our recent studies suggest that this template-dependent activity is due to ‘snap-back’ replication whereby the polymerase uses the template in cis (Kent et al., 2015). A separate biochemical study also indicated that Polθ lacks template-independent activity (Yousefzadeh et al., 2014). Thus, it remains unclear how Polθ facilitates random nucleotide insertions during alt-EJ which contribute to genome instability (Figure 1B).

Considering that divalent cations other than Mg²⁺ are present in cells, they may account for the discrepancy between the ability of Polθ to perform template-independent DNA synthesis in vivo but not in vitro. We therefore tested various divalent cations in a reaction including Polθ, poly-dC ssDNA and deoxythymidine-triphosphate (dTTP), in the presence and absence of Mg²⁺ (Figure 1E). The results showed that Mn²⁺, and to a lesser extent Co²⁺, activates Polθ extension of poly-dC with dTTP (Figure 1E). For example, in the absence of Mn²⁺ in Figure 1D, Polθ extended only a small fraction of substrates with dTTP (lane 4). In contrast, the addition of Mn²⁺ under the same reaction conditions promoted extension of the same substrate by Polθ even when Mg²⁺ was abundant (Figure 1E). Since thymidine cannot base pair with cytidine, these data demonstrate that Mn²⁺ activates Polθ template-independent terminal transferase activity (i.e. non-templated DNA synthesis). Since Polθ DNA synthesis activity is fully supported by Mn²⁺ (Figure 1E, lane 25), this indicates that Mn²⁺ binds to the same positions as Mg²⁺ within the polymerase active site which is necessary for the nucleotidyl transferase reaction. Consistent with this, recent structural studies show that other metals such as calcium can substitute for Mg²⁺ in the polymerase active site (Zahn et al., 2015). Furthermore, several lines of evidence show that Mn²⁺ can act as a co-factor for DNA polymerases and RNA polymerases and reduces the fidelity of these enzymes (Andrade et al., 2009; Dominguez et al., 2000; Walmacq et al., 2009). Hence, the data show that Mn²⁺ acts as a co-factor for Polθ which promotes template-independent activity and likely reduces the fidelity of the polymerase. Importantly, this template-independent activity was also stimulated 3–8 fold by relatively low concentrations of Mn²⁺ (0.2 mM) and Mg²⁺ (1–2 mM) which are found in cells (Figure 1—figure supplement 1) (MacDermott, 1990; Schmitz et al., 2003; Visser et al., 2014). Biochemical studies have also shown that Mn²⁺ is a necessary co-factor for the yeast Mre11-Rad50-Xrs2 (MRX) nuclease complex and its mammalian counterpart, MRN, which is essential for generating 3’ overhangs during alt-EJ, presumably by acting with CtIP (Lee-Theilen et al., 2011; Trujillo et al., 1998; Zhang and Jasin, 2011). Thus, these and other lines of evidence strongly indicate a physiological role for Mn²⁺ as a co-factor for DNA repair enzymes (Andrade et al., 2009; Cannavo and Cejka, 2014; Dominguez et al., 2000; Trujillo et al., 1998).

We identified optimal conditions for Polθ-Mn²⁺ template-independent terminal transferase activity in Figure 1—figure supplement 2. Using these optimal conditions at different temperatures, we found that Polθ-Mn²⁺ exhibits robust template-independent terminal transferase activity (Figure 1F). This suggests Mn²⁺ promotes the ability of Polθ to generate random nucleotide insertions during alt-EJ in cells. We further found that Mn²⁺ greatly stimulates Polθ terminal transferase activity on non-homopolymeric ssDNA substrates (Figure 1G, left and right). In contrast, in the presence of Mg²⁺ Polθ became mostly arrested after transferring ~10–20 nucleotides (nt), but also generated some larger discrete products (Figure 1G, left and right). These data along with those presented in Figure 1D indicate that Mg²⁺ promotes template-dependent activity which directs the polymerase to repeatedly synthesize a few discrete products as observed for both substrates (Figure 1G, left and right). Consistent with this, we found that Polθ-Mg²⁺ consistently generated similar DNA sequences from the RP347 ssDNA template, which is likely due to snap-back replication (Figure 1—figure supplement 3). Mn²⁺ on the other hand facilitates template-independent activity which enables Polθ to generate random products of different lengths as indicated by a smear (Figure 1G, left and right).

To gain more insight into these mechanisms of Polθ terminal transferase activity, we analyzed the sequences of ssDNA extension products generated by Polθ-Mn²⁺ in the absence of Mg²⁺ and with a 10-fold excess of Mg²⁺ which models cellular conditions. As expected, most of the DNA sequence generated by Polθ-Mn²⁺ in the absence of Mg²⁺ was random and therefore due to template-independent activity (Figure 2A). This is consistent with the appearance of a smear rather than a few discrete bands as observed with Polθ-Mg²⁺ (Figure 1G). Intriguingly, some of the sequences contained short regions that were either identical or complementary to the initial ssDNA (Figure 2A, black underlines). Other sequence regions within individual molecules were complementary to one another but not to the original ssDNA template (Figure 2A, grey and colored lines). Next, we analyzed DNA sequences generated by Polθ in the presence of a ten-fold excess of Mg²⁺ relative to Mn²⁺, which more closely resembles physiological conditions (Figure 2B). Again, we observed random sequence, complementary sequences within individual products (grey and colored lines), and short sequence tracts identical or complementary to the initial template (black underlines). Interestingly, Polθ generated more complementary sequences with an excess of Mg²⁺ (compare Figure 2A and B). Furthermore, the average length of ssDNA extension products was shorter with an excess of Mg²⁺ (Figure 2E), which is consistent with the results in Figure 1G.

Figure 2 with 6 supplements see all

Download asset Open asset

Together, these data demonstrate that Polθ exhibits three distinct modes of terminal transferase activity when Mn²⁺ is present even at 10-fold lower concentrations than Mg²⁺ (Figure 2C). In the first and predominant mode, Polθ performs template-independent terminal transferase activity (Figure 2C, top). In the second mode, Polθ performs transient template-dependent extension in cis, also called snap-back replication (Figure 2C, bottom left). This mechanism accounts for the appearance of complementary sequences within individual extension products (Figure 2A,B; grey and colored lines). In the third mode, Polθ performs transient template-dependent extension in trans (Figure 2C, bottom right). This accounts for sequence tracts that are identical or complementary to the initial ssDNA substrate (Figure 2A,B; black underlines); templated extension in cis can also promote sequence complementary to the initial template (Figure 2C). Identical sequence tracts are most likely due to copying in trans of complementary sequence tracts initially formed by templated extension in cis or in trans (Figure 2—figure supplement 1). Further in vitro and in vivo evidence for these three mechanisms of terminal transferase activity is presented in Figures 3 and 4, respectively.

Figure 3 with 3 supplements see all

Download asset Open asset

Figure 4 with 2 supplements see all

Download asset Open asset

Intriguingly, many of the extension products were generated by more than one mode of terminal transferase activity (Figure 2B), which demonstrates that the polymerase oscillates between these different mechanisms (Figure 2C). We utilized product sequences to specifically trace this enzymatic switching phenomenon at near base resolution (Figure 2D). For example, sequence 8 from Figure 2B demonstrates that Polθ first performs 50 consecutive random nucleotide transfer events, then switches to a transient snap-back replication mode (templated extension in cis). Next, Polθ switches to random mode then after transferring 4 nt switches back to snap-back mode followed by another switch back to random synthesis. Next, Polθ switches to the templated extension in trans mode where it copies 7 nt, then switches back to random mode for an additional 23 nt. Finally, Polθ switches back to snap-back mode, then after transferring 8 nt it ends the reaction by randomly incorporating an additional 5 nt. Sequence 3 from Figure 2B shows similar oscillation between these different mechanisms (Figure 2D, bottom). Here, Polθ performs 55 consecutive random nucleotide transfer events then switches to snap-back mode where it incorporates another 15 nt. Since the melting temperature of this 15 bp duplex is predicted to be 50°C and the reaction was performed at 42°C, Polθ appears to be capable of unwinding duplexes formed during snap-back replication. Polθ then performs three additional switching events, ultimately generating in a 138 nt product composed of a combination of random and templated sequence.

Under these conditions, Polθ shows a preference for template-independent terminal transferase activity (Figure 2C), which is more prevalent when Mg²⁺ is omitted (compare Figures 2A and B). Thus, the ratio of Mn²⁺ to Mg²⁺ modulates the balance between these different mechanisms. For example, higher concentrations of Mn²⁺ promote template-independent transfer events, whereas lower concentrations of Mn²⁺ reduce random transferase activity while increasing template-dependent activity due to snap-back replication (compare Figures 2A and B). Higher concentrations of Mn²⁺ also promote longer extension products, which correlates with the polymerase’s preference for template-independent activity under these identical conditions (Figure 1G; Figure 2E).

To be certain Polθ-Mn²⁺ performs template-independent activity rather than highly error-prone template-dependent activity which may be perceived as template-independent, we performed multiple additional controls. First, we analyzed template- dependent and independent activities in the same reaction performed in solid-phase (Figure 2—figure supplement 2A,B). Here, a biotinylated primer-template was immobilized to streptavidin beads, then excess template strand was removed by thorough washing. Primer extension in the presence of Mn²⁺ was then performed and extension products were sequenced. The results show that the initial template-dependent activity is performed with relatively high fidelity (Figure 2—figure supplement 2B). For example, misincorporation and frameshift error rates of 5.6 x 10^–2 and 6.9 x 10^–3, respectively, were observed on this short template. On the other hand, once Polθ reaches the end of the template mostly random sequence was generated, demonstrating template-independent activity (Figure 2—figure supplement 2B). Consistent with this, we show the ability of Polθ to continue DNA synthesis far beyond the end of the template exclusively in the presence of Mn²⁺ (Figure 2—figure supplement 2C). We further show that the rate of misincorporation and mismatch extension by Polθ-Mn²⁺ on a primer-template in the presence of a single nucleotide (dATP) is dramatically slower than its activity under identical conditions without the template strand present (Figure 2—figure supplement 2D). Thus, these data demonstrate that Polθ-Mn²⁺ terminal transferase activity is not the result of misincorporation or mismatch extension. As an additional control for template-independent activity, we tested whether Polθ-Mn²⁺ performs de novo synthesis in the absence of DNA. Remarkably, Polθ-Mn²⁺ exhibits de novo DNA and RNA synthesis which unequivocally demonstrates its ability to synthesize nucleic-acids in a template-independent manner (Figure 2—figure supplement 3).

Next, we examined whether Polθ-Mn²⁺ acts processively during ssDNA extension and whether the polymerase can switch between the three different modes of terminal transferase activity without dissociating from the initial ssDNA template. We tested the processivity of Polθ-Mn²⁺ on ssDNA by allowing the polymerase to extend the ssDNA for an initial 5 min followed by the addition of a 150-fold excess of unlabeled ssDNA which sequesters the polymerase if it dissociates from the initial radio-labeled ssDNA during the reaction (Figure 2—figure supplement 4B). Remarkably, addition of the ssDNA trap had no effect on Polθ-Mn²⁺ terminal transferase activity, demonstrating that the polymerase performs ssDNA extension with high processivity. As a control, we show that 150-fold excess of unlabeled ssDNA effectively sequesters the polymerase from solution (Figure 2—figure supplement 4A). Since Polθ-Mn²⁺ exhibits three different modes of terminal transferase activity under the same conditions (Figure 2A), these results indicate the polymerase switches between these distinct activities without dissociating from the initial ssDNA.

To further test the processivity of this switching mechanism, we performed ssDNA extension in the presence and absence of a ssDNA trap in solid-phase which enabled removal of excess unbound polymerase from solution (Figure 2—figure supplement 5). For example, Polθ was first allowed to bind ssDNA immobilized to streptavidin beads. Then, excess unbound Polθ was removed by thorough washing of the beads. Next, the reaction was initiated by the addition of dNTPs in buffer containing 10 mM Mn²⁺ and 1 mM Mn²⁺. After 15 s, a 150-fold excess of ssDNA trap was added, whereas the negative control reaction contained no trap. Following completion of the reactions, the immobilized ssDNA was isolated and sequenced. Consistent with the results obtained in Figure 2—figure supplement 4, the ssDNA trap did not suppress Polθ terminal transferase activity. In fact, the data indicate that the addition of excess ssDNA increases the length of ssDNA extension products generated by Polθ in solid-phase (Figure 2—figure supplement 5, panels B–D). This suggests that use of a template in trans enables Polθ terminal transferase activity rather than suppressing it. Consistent with this, sequence analysis shows that Polθ frequently utilizes the ssDNA trap as a template in trans (Figure 2—figure supplement 5, red underlines, panel D). The polymerase also performs template-independent and snap-back replication activities when the ssDNA trap is present (panel D). Since Polθ is highly processive during ssDNA extension (Figure 2—figure supplement 4), these data provide strong support for a model whereby a single polymerase oscillates between the three different modes of teminal transferase activity without dissociating from the initial ssDNA template. Importantly, using intracellular concentrations of Mg²⁺ (1 mM) and Mn²⁺ (50 µM), Polθ remains effective in extending ssDNA and utilizes a combination of templated and non-templated mechanisms during this activity (Figure 2—figure supplement 6).

Next, we examined Polθ terminal transferase activity in the context of alt-EJ. Although cellular studies have shown that Polθ expression is required for the appearance of non-templated and templated insertions at alt-EJ repair junctions, it remains unknown whether additional factors or co-factors facilitate these insertion events. For example, Polθ has been shown to promote what appears to be random nucleotide insertion tracts at alt-EJ repair junctions in mice and flies (Figure 1B) (Chan et al., 2010; Mateos-Gomez et al., 2015). Evidence in flies, mice and worms also indicates that Polθ promotes templated nucleotide insertions, which are proposed to be due to a template copy mechanism in trans (Figure 1C) (Chan et al., 2010; Koole et al., 2014). To determine whether Polθ is solely responsible for these insertions, and whether the three mechanisms of terminal transferase activity identified herein facilitate these insertions, we reconstituted a minimal alt-EJ system in vitro. Here, two DNA substrates containing a 3’ overhang, herein referred to as partial ssDNA (pssDNA), and a single base pair of microhomology (G:C) at their 3’ termini were incubated with Polθ, Lig3, ATP, and dNTPs in buffer containing a high ratio of Mg²⁺ to Mn²⁺ which models cellular conditions (Figure 3A, top). Although Polθ can perform MMEJ without Lig3 by promoting templated extension in trans (Figure 1A) (Kent et al., 2015), the pssDNA substrates in the current assay lack sufficient microhomology for MMEJ, but contain a 5’ phosphate on their short strands which can support ligation of the opposing 3’ overhang that is extended by the polymerase (Figure 3A, top). Control experiments show that the addition of Polθ and Lig3 is required for efficient alt-EJ, and that insertions depend on Polθ (Figure 3—figure supplement 1C). These results are expected since Lig3 is required for most alt-EJ in cells and therefore likely functions with Polθ which facilitates insertions (Audebert et al., 2004; Simsek et al., 2011). Following termination of the reaction by EDTA, DNA was purified then end-joining products were amplified by PCR and individually sequenced from cloning vectors (Figure 3—figure supplement 1A,B).

To gain significant insight into the mechanisms of Polθ terminal transferase activity during alt-EJ, we chose to analyze insertion tracts greater than 2 nt in length which reveal information regarding template dependency. Remarkably, we found that Polθ generated both random and templated nucleotide insertions at repair junctions (Figure 3A), which is similar to the results obtained in Figure 2. In the case of templated insertions, we observed sequence tracts that appear to be due to both templated extension in cis (snap-back replication; red underlines) and in trans (grey underlines). A median insertion length of 7 bp was observed (Figure 3B), and cumulative analysis of individual nucleotide insertion events reveals a roughly equal proportion of insertions due to the three modes of terminal transferase activity identified in Figure 2, for example non-templated extension, templated extension in cis, and templated extension in trans (Figure 3C). We again modeled Polθ switching activity based on the sequence generated, in this case during alt-EJ (Figure 3D). Consistent with the mechanism identified in Figure 2, sequence traces strongly suggest spontaneous and rapid switching between the three different terminal transferase activities (Figure 3D).

We next examined whether the polymerase acts processively to generate insertions during alt-EJ. To test this, we repeated the alt-EJ reaction in vitro, but added a 150-fold excess of ssDNA trap 15 s after the reaction was initiated. The results show that Polθ generates similar insertion tract lengths in the presence and absence of the ssDNA trap (compare Figure 3 and Figure 3—figure supplement 2). Thus, these data also indicate that Polθ acts processively during alt-EJ which provides further support for a model whereby a single polymerase oscillates between the different terminal transferase activities prior to dissociating from the initial substrate. Importantly, further alt-EJ experiments show that Polθ generates similar size insertions by a combination of templated and non-templated mechanisms in the presence of 1 mM Mg²⁺ and 50 µM Mn²⁺ which model intracellular concentrations (Figure 3—figure supplement 3).

To test whether Polθ uses this switching mechanism to generate insertions during alt-EJ in cells, we analyzed insertion tracts synthesized by Polθ during alt-EJ in vivo (Figure 4). Here, Polθ dependent alt-EJ in mouse embryonic stem cells promotes translocations between sequence specific DSBs generated in chromosomal DNA by the CRISPR/Cas9 system, as shown in previous studies (Figure 4A, topMateos-Gomez et al., 2015). To distinguish between the different Polθ mediated activities during chromosomal translocation, we carefully analyzed junctions of events resulting from the cleavage of chromosomes 6 and 11, and subsequent formation of Der (6) and (11). Similar to Figure 3, we chose to analyze junctions containing insertions >2 bp in length. Remarkably, in the cellular alt-EJ system we also observed insertion tracts that appear to be due to all three modes of Polθ terminal transferase activity (Figure 4A). For example, similar to the results obtained in the in vitro alt-EJ system (Figure 3), cumulative analysis of individual nucleotide insertion events produced in vivo demonstrates that Polθ generates a roughly equal proportion of insertion events due to the three different modes of terminal transferase activity (Figure 4A–C). Templated extension in trans accounts for short sequence duplications (black and grey underlines), whereas templated extension in cis (snap-back replication) accounts for the appearance of short complementary sequence tracts (red and blue underlines) (Figure 4A). Individual nucleotide insertion events due to non-templated extension appear to be slightly lower in the in vivo system (33.2%) compared to the in vitro system (39%), which is likely due to a lower proportion of Mn²⁺ to Mg²⁺ in cells. Consistent with this, events due to templated extension in cis (snap-back replication) appear slightly higher in the in vivo system (37.2%) compared to the in vitro system (28.8%). We note that DNA deletions were observed in both systems, albeit more frequently in cells which is likely due to nuclease activity. Deletions in the in vitro system likely result from Polθ mediated end-joining at internal sites within the 3’ overhang, as shown previously (Kent et al., 2015). This mechanism may also contribute to deletions observed in vivo. Regardless of the specific mechanisms underlying deletion formation in each system, the insertion tracts observed in vitro and in vivo appear similar in nature in regards to template dependency (compare Figures 3C and 4C). Furthermore, the median insertion tract length (7 bp) generated by Polθ in vitro and in vivo was identical (compare Figures 3B and 4B). Thus, these data demonstrate that the reconstituted alt-EJ system closely resembles the mechanism of alt-EJ in cells. We note that some large (>30 bp) insertions copied from remote chromosome sites and the CRISPR/Cas9 vector were also observed in the in vivo system (Figure 4—figure supplement 1). However, these insertions are likely due to a different mechanism such as strand invasion into duplex DNA. Additional analysis of end-joining products generated in vivo demonstrates that Polθ preferentially produces insertions >2 bp in length, and occasionally generates relatively long insertions (i.e. >25 bp) (Figure 4—figure supplement 2). Importantly, sequences of end-joining products generated in vivo support the same mechanism of Polθ switching observed in vitro (Figure 4D). Altogether, the results presented in Figures 3 and 4 along with previous studies showing the requirement for Polθ in forming insertions indicate that Polθ is the main enzyme involved in generating insertions during alt-EJ. These results also indicate that Polθ oscillates between three different modes of terminal transferase activity to generate insertion mutations, and that Mn²⁺ likely acts as a co-factor for Polθ in vivo.

We next further characterized Polθ-Mn²⁺ terminal transferase activity on a variety of DNA substrates. For example, we further tested Polθ-Mn²⁺ on homopolymeric ssDNA composed of either deoxythymidine-monophosphates (poly-dT) or deoxycytidine-monophosphates (poly-dC), and ssDNA containing variable sequences. The polymerase preferentially extended all of the substrates by more than 100 nt in the presence of deoxyadenosine-triphosphate (dATP), regardless of the sequence context (Figure 5A,B). Polymerases are known to preferentially incorporate deoxyadenosine-monophosphate (dAMP) when template base coding is not available, which is referred to as the A-rule. For example, polymerases preferentially incorporate a single dAMP opposite an abasic site or at the end of a template. Thus, the observed preferential incorporation of dAMP by Polθ-Mn²⁺ is consistent with the A-rule and template-independent activity. Polθ also extended ssDNA in the presence of dTTP, dCTP, and dGTP, however, the lengths of these products were shorter than with dATP (Figure 5A,B). For example, in the case of non-homopolymeric ssDNA, Polθ-Mn²⁺ transferred ~30–70 nt in the presence of dTTP, dCTP, or dGTP (Figure 5B), which demonstrates that Polθ-Mn²⁺ terminal transferase activity is relatively efficient even in the absence of the preferred dATP. Notably, the non-homologous end-joining (NHEJ) X-family polymerase, Polμ, exhibited minimal terminal transferase activity compared to Polθ under identical conditions (Figure 5—figure supplement 1). Previous studies similarly demonstrated limited terminal transferase activity by Polμ which is most closely related to TdT (Andrade et al., 2009). Thus, to date the data presented insofar indicate that, aside from TdT, Polθ possesses the most robust terminal transferase activity for the polymerase enzyme class.

Figure 5 with 1 supplement see all

Download asset Open asset

We next examined the ability of Polθ-Mn²⁺ to extend blunt-ended double-strand DNA (dsDNA). The results show that Polθ efficiently extends duplex DNA, however, this is limited to only 1–2 nucleotides which may be due to a lower affinity of the polymerase for blunt-ended DNA (Figure 5C). Interestingly, Polθ efficiently extended a primer-template far beyond the downstream end of the template (Figure 5D, left). Thus, the polymerase performs efficient long-range extension of dsDNA when given a running start (Figure 5D, right schematic).

Considering that Polθ is thought to act on DSBs partially resected by MRN and CtIP during MMEJ/alt-EJ (Kent et al., 2015), we examined its terminal transferase activity on pssDNA. Remarkably, Polθ-Mn²⁺ exhibited the most efficient terminal transferase activity on pssDNA (Figure 5E). For example, the polymerase extended the pssDNA substrates to longer lengths with dTTP and dCTP, whereas dGTP was still limiting (compare Figure 5E with Figure 5B).

Consistent with its role in promoting alt-EJ of telomeres in cells deficient in telomere protection and NHEJ factors (Mateos-Gomez et al., 2015), we found that Polθ exhibits efficient terminal transferase activity on ssDNA modeled after telomeres which are known to contain stable G-quadruplex (G4) secondary structures (Figure 5F). Here again, extension in the presence of dGTP was suppressed. Considering that consecutive dGMP incorporation events limit Polθ terminal transferase activity, we presume the multiple guanosines present in telomere repeats cause a similar inhibitory effect. All other nucleotides were efficiently transferred to the telomeric ssDNA substrate (Figure 5F). Taken together, the results in Figure 5 show that Polθ exhibits the most robust terminal transferase activity on pssDNA which is consistent with its role in MMEJ/alt-EJ, and that the polymerase is also efficient in extending various ssDNA substrates and dsDNA when given a running start.

Next, we sought to identify structural motifs that promote Polθ terminal transferase activity. Polθ is a unique A-family polymerase since it contains three insertion loops, and previous studies have shown that loop 2 is necessary for Polθ extension of ssDNA (Hogg et al., 2012; Kent et al., 2015). The position of this motif is conserved in Polθ and is located immediately downstream from a conserved positively charged residue, arginine (R) or lysine (K), at position 2254 (Figure 6A). Recent structural studies of Polθ in complex with a primer-template and incoming nucleotide show that loop 2 lies relatively close to the 3’ terminus of the primer, but is likely flexible in this conformation due to a lack of resolution (Figure 6B) (Zahn et al., 2015). Considering that Polθ ssDNA extension with Mg²⁺ is likely related to its activity with Mn²⁺, we predicted that loop 2 would also confer template-independent terminal transferase activity. Indeed, a loop 2 deletion mutant of Polθ (PolθL2) failed to extend ssDNA under optimal template-independent terminal transferase conditions with Mn²⁺ (Figure 6C). Similar to previous results, PolθL2 fully extended a primer-template (Figure 6D). Here, PolθWT extension continued beyond the template due to the polymerase’s robust terminal transferase activity with Mn²⁺ (Figure 6D).

Figure 6

Download asset Open asset

Structural studies showed that two conserved positively charged residues, R2202 and R2254, bind to the phosphate backbone of the 3’ portion of the primer (Figure 6A,B) (Zahn et al., 2015). Since these positively charged residues are conserved in Polθ but not other A-family members (Figure 6A), we envisaged that they might contribute to Polθ terminal transferase activity. We first tested primer-extension of a double mutant version of Polθ in which R2202 and R2254 were changed to alanine (A) and valine (V), respectively (PolθRR). Recent studies showed that single R2202A and R2254V Polθ mutants were slightly defective in translesion synthesis (Zahn et al., 2015). PolθRR extended the primer in a similar manner to PolθWT (Figure 6E). Yet, PolθRR showed a severe defect in template-independent terminal transferase activity compared to PolθWT under identical conditions with Mn²⁺ (Figure 6F). Since PolθWT performs terminal transferase activity with high processivity, we wondered whether PolθRR exhibits reduced processivity. Indeed, PolθRR showed a significant deficiency in primer extension compared to PolθWT when a large excess of DNA was present, confirming a reduction in processivity (Figure 6G). These data also suggest that PolθWT exhibits lower processivity during primer-template extension compared to ssDNA extension (compare Figure 6G and Figure 2—figure supplement 4). Since PolθRR is defective in processivity and template-independent terminal transferase activity, this suggests that the polymerase must be processive on ssDNA to effectively perform template-independent terminal transferase activity. Together, these data identify conserved residues that contribute to Polθ terminal transferase activity by conferring processivity onto the enzyme through binding the 3’ primer terminus.

Importantly, terminal transferase activity is widely used to modify ssDNA ends for various types of applications including biotechnology, biomedical research, and synthetic biology. Currently, the only enzyme developed and marketed for these applications is terminal deoxynucleotidyl transferase (TdT) whose cellular function is to promote antibody diversity by transferring non-templated nucleotides to V, D and J exon regions during antibody gene maturation (Motea and Berdis, 2010). We compared the activities of Polθ and TdT in Figure 7A. Remarkably, Polθ exhibited a similar ability to extend ssDNA as TdT assayed under optimal conditions recommended by the supplier (Figure 7A). The results also show that in this reaction Polθ and TdT preferentially utilize dATP and dTTP, respectively, which suggests different mechanisms of action (Figure 7A).

Figure 7

Download asset Open asset

Many biotechnology and biomedical research applications require ssDNA substrates modified with fluorophores or other chemical groups, such as those that enable DNA attachment to solid surfaces. We therefore examined the ability of Polθ to transfer deoxyribonucleotides and ribonucleotides conjugated with different functional groups to the 3’ terminus of ssDNA. Again, using the supplier’s recommended assay conditions for TdT, and identical concentrations of Polθ under its optimal conditions, we unexpectedly found that Polθ-Mn²⁺ is more effective in transferring ribonucleotides to ssDNA compared to TdT (Figure 7B). Although previous studies have shown that Polθ strongly discriminates against ribonucleotides (Hogg et al., 2012), this fidelity mechanism is largely compromised under our conditions used for terminal transferase activity. Again, using the respective optimal conditions for Polθ and TdT at identical concentrations, we also found that Polθ-Mn²⁺ is more proficient in transferring most modified deoxy-ribonucleotides and ribonucleotides to ssDNA than TdT (Figure 7C,D). For example, Polθ more efficiently transferred eight out of ten modified nucleotides tested. In some cases, Polθ produced longer extension products than TdT (Figure 7C). In other cases, Polθ transferred nucleotides that TdT was unable to incorporate (Figure 7C, black boxes). For instance, Polθ efficiently transferred a nucleotide containing a linker attached to an azide group which is widely used for “click chemistry” applications (Figure 7C, lane 6). In contrast, TdT failed to transfer this nucleotide altogether (Figure 7C, lane 17). Moreover, TdT failed to transfer nucleotides containing a modified sugar and a linker attached to Texas Red, whereas these substrates were efficiently incorporated by Polθ (Figure 7C, nucleotide analogs 4 and 9). These results show that Polθ efficiently transfers ribonucleotides and deoxyribonucleotides containing modifications on their base moieties, such as fluorophores and functional groups including biotin and digoxigenin, as well as nucleotides containing sugar modifications (i.e. ganciclovir mono-phosphate). Considering that Polθ also exhibits translesion synthesis activity, these results may be attributed to its natural ability to accommodate non-canonical nucleotides in its active site (Hogg et al., 2011; Yoon et al., 2014).

Lastly, we investigated whether Polθ exhibits terminal transferase activity on RNA. Surprisingly, Polθ transferred both canonical and modified nucleotides to RNA, albeit less efficiently than to DNA (Figure 7E). Together, the results presented in Figure 7 characterize Polθ as among the most proficient terminal transferases identified and demonstrate that Polθ is more effective than TdT in modifying nucleic-acid substrates for biomedical research and biotechnology applications.

500 nM Polθ was incubated with 50 nM of the indicated 5’ ³²P-labeled DNA for 120 min at 42°C (or other indicated time intervals and temp) in the presence of 0.5 mM of indicated dNTPs in a 10 µl volume of buffer A (20 mM TrisHCl pH 8.2, 10% glycerol, 0.01% NP-40, 0.1 mg/ml BSA) with indicated divalent cations; optimal Polθ terminal transferase activity was performed with 5 mM MnCl₂. Reactions were terminated by the addition of 20 mM EDTA and 45% formamide and DNA was resolved by electrophoresis in urea polyacrylamide gels then visualized by autoradiography. Polm terminal transferase reactions were performed using the same conditions as Polθ. 50 nM Polθ was used in experiments employing ssDNA traps. 150-fold excess of unlabled ssDNA trap was added to reactions at indicated time points where indicated. Polθ terminal transferase activity in solid-phase. 50 nM RP347B was immobilized to magnetic streptavidin beads (Dynabeads M-270, Invitrogen) in buffer A supplemented with 100 mM NaCl. Excess unbound DNA was then removed by washing beads 3x with buffer A with 100 mM NaCl. Next, the bead-DNA mixture was washed and resuspended in buffer A containing 10 mM MgCl and 1 mM MnCl. 500 nM Polθ was then added for 10 min to allow for ssDNA binding. Excess unbound Polθ was then removed by washing the beads 4x with 200 µl buffer A supplemented with 10 mM MgCl and 1 mM MnCl. Beads were resuspended in buffer A supplemented with 10 mM MgCl and 1 mM MnCl, then 0.5 mM dNTPs were added at 42°C. After 15 s, either dH₂0 or 7.5 µM RP427 was added and the reaction was terminated after 120 min by addition of EDTA. The beads were thoroughly washed to remove excess ssDNA trap. The beads were then resuspended in dH₂0 followed by boiling for 1–2 min. The supernatant was collected, then another cycle of boiling and supernatant collection was performed. The DNA from the supernatant was purified using Zymo DNA Clean and Concentrator-5 kit. Purified DNA was then ligated to RP430P overnight at room temp using T4 RNA ligase (New Englan Biolabs). RNA ligase was denatured at 65°C, then the DNA was purified using Zymo DNA Clean and Concentrator-5 kit. The ligated DNA was then amplified via PCR using GoTaq Green (Promega) and primers RP347 and RP431. PCR products were purified using QIAquick PCR purification kit (Qiagen). Pure PCR products were then cloned into E. coli plasmid vectors using TOPO TA cloning (Invitrogen). Individual plasmids containing PCR products were amplified in E. coli, isolated, then sequenced.

Equimolar concentrations (100 nM) of pssDNA substrates RP429/RP430-P and RP434-P/RP408 were mixed with 50 nM Polθ and 88.5 nM Lig3 in buffer A supplemented with 1 mM ​MnCl₂, 10 mM ​MgCl₂ and 1mM ATP. Next, 10 μM dNTPs were added for 120 min at 37°C in a total volume of 100 μl. Reactions were terminated by incubation at 80°C for 20 min. (Negative control reactions included: omission of Lig3, and; omission of Polθ and Lig3). DNA was purified using QIAquick Nucleotide Removal kit (QIAGEN) then amplified using PCR Master Mix (Promega) and end-joining specific primers RP431 and RP435. PCR products were purified using GeneJET PCR Purification Kit (ThermoScientific) then cloned into the pCR2.1-TOPOvector (Invitrogen). DNA was transformed into E. coli DH5α cells, and individual plasmids from single colonies were purified and sequenced. Polθ mediated alt-EJ in Figure 3—figure supplement 3 was performed as described above, however, 1 mM MgCl₂, 50 μM MnCl₂ and 100 μM dNTPs were used. Where indicated, 150-fold excess (15 µM) of ssDNA trap (RP347) was added to the reaction at the indicated time point.

Polθ mediated alt-EJ involving chromosomal translocation was performed as previously described (Mateos-Gomez et al., 2015). Briefly, mouse Embryonic Stem (ES) cells were transfected with 3 µg of Cas9-gRNA(Rosa26;H3f3b) (Mateos-Gomez et al., 2015). After transfection, 5 × 10⁴ cells were seeded per well in a 96-well plate, and lysed 3 days later in 40 µl lysis buffer (10 mM Tris pH 8.0, 0.45% Nonidet P-40, 0.45% Tween 20). The lysate was incubated with 200 µg/ml of Proteinase K for 2 hr at 55°C. Translocation detection was performed using nested PCR. The primers used in the first PCR reaction include Tr6-11-Fwd:5′-GCGGGAGAAATGGATATGAA-3′; Tr6-11-Rev: 5′- TTGACGCCTTCCTTCTTCTG -3′, and Tr11-6-Fwd: 5′-AACCTTTGAAAAAGCCCACA-3′ and Tr11-6-Rev:5′-GCACGTTTCCGACTTGAGTT-3′, for Der(6) and Der (11) respectively. For the second round of PCR amplification, the following primers were used: Tr6-11NFwd: 5′-GGCGGATCACAAGCAATAAT-3′; Tr6-11NRev: 5′-CTGCCATTCCAGAGATTGGT-3′ and Tr11-6NFwd:5′-AGCCACAGTGCTCACATCAC-3′ and Tr11-6NRev:5′TCCCAAAGTCGCTCTGAGTT-3′. Amplified products corresponding to translocation events were subject to Sanger sequencing to determine the junction sequences.

TdT terminal transferase reactions were performed on indicated 5’ ³²P-labeled DNA using conditions recommended by New England Biolabs: 50 mM potassium acetate, 20 mM Tris acetate, 10 mM magnesium acetate, pH 7.9, with 0.25 mM cobalt and incubated at 37°C. Incubation times and DNA concentrations were identical as experiments with Polθ. TdT was either used at concentrations recommended by New England Biolabs (0.2 units/µl) or equimolar concentrations as Polθ as indicated in text. DNA products were resolved as indicated above.

Polθ (500 nM) was incubated with 50 nM RP347 ssDNA along with 0.5 mM dNTPs in 100 μl of buffer A supplemented with either 5 mM MnCl₂ or 1 mM ​MnCl₂ and 10 mM ​MgCl₂ for 120 min at 42°C. Reactions were terminated by the addition of 25 μl of 5X non-denaturing stop buffer (0.5 M ​Tris-HCl, pH 7.5, 10 mg/ml proteinase K, 80 mM ​EDTA, and 1.5% ​SDS). This was followed by phenol-chlorophorm extraction, ethanol precipitation, then ligation to 5’-phosphorylated RP359-P ssDNA using T4 RNA ligase (NEB). DNA products were ethanol precipitated then dissolved in water. Next, PCR amplification of ligation products was performed using primers RP347 and RP359C and Taq Master Mix (Promega). PCR products were purified using GeneJET PCR Purification Kit (ThermoScientific) then cloned into the pCR2.1-TOPO vector (Invitrogen). DNA was transformed into E. coli DH5α cells, and individual plasmids from single colonies were purified and sequenced.

Polθ-Mg²⁺ primer-extension was performed as described (Kent et al., 2015) with either 10 mM MgCl or 5 mM MnCl and indicated dNTPs and time intervals. Primer-extension in solid-phase was performed as follows. A 2:1 ratio of template (RP409) to biotinylated primer (RP25B) was annealed then immobilized to magnetic streptavidin beads (Dynabeads M-270, Invitrogen) pre-washed with buffer A supplemented with 100 mM NaCl. Excess unbound DNA was then removed by washing beads 3x with 200 µl of buffer A with 100 mM NaCl. Next, the bead-DNA mixture was washed and resuspended in buffer A containing 5 mM MnCl and 0.5 mM dNTPs. 500 µM Pol was then added for 120 min at 42°C. The reaction was then terminated by the addition of 20 mM EDTA followed by boiling for 1–2 min. The supernatant was collected, then another cycle of boiling and supernatant collection was performed. The DNA from the supernatant was purified using Zymo DNA Clean and Concentrator-5 kit. Purified DNA was then ligated to RP430P overnight at room temp using T4 RNA ligase (New Englan Biolabs). RNA ligase was denatured at 65°C, then the DNA was purified using Zymo DNA Clean and Concentrator-5 kit. The ligated DNA was then amplified via PCR using GoTaq Green (Promega) and primers RP25 and RP431. PCR products were purified using QIAquick PCR purification kit (Qiagen). Pure PCR products were then cloned into E. coli plasmid vectors using TOPO TA cloning (Invitrogen). Individual plasmids containing PCR products were amplified in E. coli, isolated, then sequenced. Where indicated primer-extension was performed with either a 1:1 ratio of PolθWT or PolθRR to primer-template (50 nM), or a 1:25 ratio of PolθWT or PolθRR to primer-template (50 nM). A 150-fold excess of ssDNA trap (7.5 µM RP316) was added 1 min after initiation of primer-extension where indicated.

500 nM Polθ was incubated with the indicated nucleotides at the following concentrations (500 nM ATP,UTP,GTP,dATP,dTTP,dGTP; 97 nM dCTP, [α-32P]- 6000 Ci/mmol 20 mCi/ml(Perkin Elmer)) for the indicated time intervals at 42°C in buffer A supplemented with 5 mM MnCl. Nucleic acid products were resolved in denturing polyacrylamide gels and visualized by autoradiography.

PolθWT and mutant proteins PolθL2 and PolθRR were purified as described (Kent et al., 2015). Site-directed mutagenesis was performed using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). TdT was purchased from New England Biolabs (NEB). Polμ and Lig3 were purchased from Enzymax.

pssDNA, dsDNA and primer-templates were assembled by mixing equimolar concentrations of ssDNA substrates together in deionized water, then heating to 95–100°C followed by slow cooling to room temp. ssDNA was 5’ ³²P-labeled using ³²P-γ-ATP (Perkin Elmer) and T4 polynucleotide kinase (NEB).

DNA (Integrated DNA technologies (IDT)) and RNA (Dharmacon) oligonucleotides (5’-3’).

RP25: CACAGATTCTGGCAGGCTGCAGATCGC

RP25B: Biotin-CACAGATTCTGGCAGGCTGCAGATCGC

RP347: CACTGTGAGCTTAGGGTTAGAGATAC

RP348: CACTGTGAGCTTAGGGTTAGAGCCGG

RP63: CGAAATAGACAGATCGCTGAGGATAGGTGCCTCACTG

RP63C: CAGTGAGGCACCTATCCTCAGCGATCTGTCTATTTCG

RP271: CATCTTTTACTTCCACCAGCGTTTCTGGG

RP271C: CCCAGAAACGCTGGTGGAAGTAAAAGATG

RP359: GTGGATGAATTACACATGCTGGGAGACTC

RP359C: GAGTCTCCCAGCATGTGTAATTCATCCAC

RP266: TTTTTTTTTTTTTTTTTTGCGATCTGCAGCCTGCCAGAATCTGTG

RP331: ACTGTGAGCTTAGGGTTAGGGTTAGGGTTAGGGTTAG

RP340: CACTGTGAGCTTAGGGTTAGAGATCG

RNA-2: AUCGAGAGG

RP343-P: /5Phos/CTAAGCTCACAGTG

RP429: GGAGGTTAGGCACTGTGAGCTTAGGGTTAGAGATAC

RP430-P: /5Phos/CTAAGCTCACAGTGCCTAACCTCC

RP434-P: /5Phos/GAGCACGTCCAGGCGATCTGCAGCCTG

RP408: GAGCACGTCCAGGCGATCTGCAGCCTGCCAGAATCTGTG

RP427: CGCCACCTCTGACTTGAGCG

RP409: GAGCACGTCCACGCGATCTGCAGCCTGCCAGAATCTGTG

RP347B: Biotin-CACTGTGAGCTTAGGGTTAGAGATAC

pssDNA substrates: RP347/RP343-P, RP348/RP343-P, RP340/RP343-P, RP429/RP430-P, RP434-P/RP408. Telomeric ssDNA, RP331. Primer-templates, RP25/RP266, RP25/409, RP25B/409.

1, cy3-dUTP (Santa Cruz Biotech.); 2, Digoxigenin-11-dUTP (Sigma); 3, Biotin-16AA-dUTP (TriLink Biotech.); 4, Texas Red-5-dCTP (PerkinElmer); 5, N6 -(6-Azido)hexyl-ATP (Jena Bioscience); 6, Cyanine 3-AA-UTP (TriLink Biotech.); 7, 4-Thio-UTP (TriLink Biotech.); 8, Biotin-16-AACTP (TriLink Biotech.); 9, Ganciclovir Triphosphate (TriLink Biotech.); 10, 5-Hydroxymethyl-2’-deoxyuridine-5’-Triphosphate (TriLink Biotech.).

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Research was funded by National Institutes of Health grant 1R01GM115472-01 and in part by grant 4R00CA160648-03 awarded to RTP, and Temple University School of Medicine start-up funds to RTP. We thank S Wallace (University of Vermont) for PolθWT and PolθL2 expression vectors.

© 2016, Kent et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.