1. Developmental Biology
  2. Neuroscience
Download icon

Genetic specification of left–right asymmetry in the diaphragm muscles and their motor innervation

  1. Camille Charoy
  2. Sarah Dinvaut
  3. Yohan Chaix
  4. Laurette Morlé
  5. Isabelle Sanyas
  6. Muriel Bozon
  7. Karine Kindbeiter
  8. Bénédicte Durand
  9. Jennifer M Skidmore
  10. Lies De Groef
  11. Motoaki Seki
  12. Lieve Moons
  13. Christiana Ruhrberg
  14. James F Martin
  15. Donna M Martin
  16. Julien Falk
  17. Valerie Castellani  Is a corresponding author
  1. University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, France
  2. University of Michigan Medical Center, United States
  3. Laboratory of Neural Circuit Development and Regeneration, Belgium
  4. University of Tokyo, Japan
  5. University College London, United Kingdom
  6. Baylor College of Medicine, United States
Research Article
  • Cited 1
  • Views 721
  • Annotations
Cite as: eLife 2017;6:e18481 doi: 10.7554/eLife.18481

Abstract

The diaphragm muscle is essential for breathing in mammals. Its asymmetric elevation during contraction correlates with morphological features suggestive of inherent left–right (L/R) asymmetry. Whether this asymmetry is due to L versus R differences in the muscle or in the phrenic nerve activity is unknown. Here, we have combined the analysis of genetically modified mouse models with transcriptomic analysis to show that both the diaphragm muscle and phrenic nerves have asymmetries, which can be established independently of each other during early embryogenesis in pathway instructed by Nodal, a morphogen that also conveys asymmetry in other organs. We further found that phrenic motoneurons receive an early L/R genetic imprint, with L versus R differences both in Slit/Robo signaling and MMP2 activity and in the contribution of both pathways to establish phrenic nerve asymmetry. Our study therefore demonstrates L–R imprinting of spinal motoneurons and describes how L/R modulation of axon guidance signaling helps to match neural circuit formation to organ asymmetry.

https://doi.org/10.7554/eLife.18481.001

eLife digest

The diaphragm is a dome-shaped muscle that forms the floor of the rib cage, separating the lungs from the abdomen. As we breathe in, the diaphragm contracts. This causes the chest cavity to expand, drawing air into the lungs. A pair of nerves called the phrenic nerves carry signals from the spinal cord to the diaphragm to tell it when to contract. These nerves project from the left and right sides of the spinal cord to the left and right sides of the diaphragm respectively.

The left and right sides of the diaphragm are not entirely level, but it was not known why. To investigate, Charoy et al. studied how the diaphragm develops in mouse embryos. This revealed that the left and right phrenic nerves are not symmetrical. Neither are the muscles on each side of the diaphragm. Further investigation revealed that a genetic program that establishes other differences between the left and right sides of the embryo also gives rise to the differences between the left and right sides of the diaphragm. This program switches on different genes in the left and right phrenic nerves, which activate different molecular pathways in the left and right sides of the diaphragm muscle.

The differences between the nerves and muscles on the left and right sides of the diaphragm could explain why some muscle disorders affect only one side of the diaphragm. Similarly, they could explain why congenital hernias caused by abdominal organs pushing through the diaphragm into the chest cavity mostly affect the left side of the diaphragm. Further studies are now needed to investigate these possibilities. The techniques used by Charoy et al. to map the molecular diversity of spinal cord neurons could also lead to new strategies for repairing damage to the spinal cord following injury or disease.

https://doi.org/10.7554/eLife.18481.002

Introduction

The diaphragm is the main respiratory muscle of mammalian organisms, separating the thoracic and abdominal cavities. Many diseases, including congenital hernia, degenerative pathologies and spinal cord injury, affect diaphragm function and thereby cause morbidity and mortality (Greer, 2013; McCool and Tzelepis, 2012). Despite the large interest given to diaphragm function in various physiological and pathological contexts (Lin et al., 2000; Misgeld et al., 2002; Strochlic et al., 2012), little attention has been paid to the embryological origin of left–right (L/R) asymmetries in diaphragm morphology and contraction, in part because they were inferred to be simply an adaptation to the structure of other, surrounding asymmetric organs such as the lungs (Laskowski et al., 1991; Whitelaw, 1987). In the present study, we investigated the origin and the mechanisms responsible for the establishment of the diaphragm asymmetries, including motor innervation by the left and right phrenic motoneurons that arise in the spinal cord at cervical levels C3 to C5 (Greer et al., 1999; Laskowski and Owens, 1994). Our findings show that both the diaphragm muscle and phrenic nerves have asymmetries, which are established independently of each other during early embryogenesis.

Results

As many L/R asymmetries are determined prenatally (Sun et al., 2005), we analyzed the diaphragm innervation of mouse embryos on embryonic day (E) 15.5, when synaptic contacts begin to be established in this organ (Lin et al., 2001). We observed that the phrenic nerves split into primary dorsal and ventral branches when reaching the lateral muscles, whereby the distance from the end-plate to the nerve entry point differs between the left and right side and results in a characteristic ‘T’ -like pattern on the left and ‘V’ -like pattern on the right (Figure 1A; Figure 1—figure supplement 1A,B). Similar differences in the L/R branching patterns are present in the human diaphragm (Hidayet et al., 1974) (Figure 1—figure supplement 1C). Additionally, we observed an asymmetric number of branches defasciculating from the left and right primary nerves to innervate the motor end-plates (Figure 1A; Figure 1—figure supplement 1A,B). We further found that the L/R distribution of acetylcholine receptor (AchR) clusters at the nascent neuromuscular junctions also differed, with a 2.1 ± 0.2-fold increase in the medio-lateral scattering of AchR clusters on the right side of the diaphragm compared to the left side (N = 11, p<0.001 Wilcoxon) (Figure 1B; Figure 1—figure supplement 2A,B). The time course analysis revealed that these asymmetric nerve patterns arose at E12.5, concomitantly with branch formation (Figure 1C–E; Figure 1—figure supplement 3A–C). Thus, phrenic branch patterns exhibit clear asymmetries before synapse formation and fetal respiratory movements (Lin et al., 2001, 2008), and are therefore unlikely to be induced by nerve activity or muscle contraction.

Figure 1 with 3 supplements see all
L/R asymmetries of the phrenic nerve patterns are established from the onset of diaphragm innervation.

(A) Neurofilament (NF) staining showing the branching patterns of the left and right phrenic nerves in whole-mount E15.5 mouse diaphragm. Left and right primary branches are pseudocolored (middle panel) in green and red, respectively. (See Figure 1—figure supplement 1A, for complete branch traces). L/R asymmetry is especially apparent after superimposing the left and right primary branches (right panel). Arrows point to the nerve entry points. Images are top views of the whole diaphragm, oriented as indicated in the top left hand corner of the left panel (V, Ventral; D, Dorsal; L, Left; R, Right). (B) NF and Bungarotoxin staining showing the asymmetry of acetylcholine receptor clusters and nerve domains on the left (left panel, green frame) and right (right panel, red frame) diaphragm muscles of an E15.5 embryo (see Figure 1—figure supplement 2 for quantification). (C) NF staining showing the patterns of left and right phrenic nerves at E13.5 and E14.5. Green- and red-framed panels show enlarged images of the left and right phrenic nerves, respectively. (D) Schematics showing the method used to quantify the defasciculation distance (shown in blue), from the nerve entry point to the dotted line and histogram of the defasciculation distance at E13.5, E14.5 and E15.5 (E13.5 — left 32.76 ± 11.01, right 94.82 ± 21.94, N = 9, p=0.0106; E14.5 — left 42.56 ± 4.16, right 135.71 ± 10.20, N = 8, p=0.00015; E15.5 — left 77.16 ± 7.32, right 188.51 ± 7.01, N = 18, p=4 E-10, Mann-Whitney). (E) Schematics showing the method used to quantify the secondary branch number by counting the number of NF-positive fascicles that crossed the dotted line positioned at 80% of the defasciculation distance and histogram of the secondary branch number at E13.5, E14.5 and E15.5 (E13.5 — left 5.55 ± 0.96, right 8.88 ± 0.65, N = 9, p=0.0288; E14.5 — left 7.5 ± 0.38, right 10.88 ± 0.69, N = 8, p=0.00117; E15.5 — left 5.94 ± 0.31, right 10.7 ± 0.3, N = 18, p=2.35 E-7, Mann-Whitney). Histograms show the mean ± SEM for each stage. Scale bars: 200 μm (A,C); 100 μm (B). Numerical values used to generate the graphs are accessible in Figure 1—source data 1.

https://doi.org/10.7554/eLife.18481.003

We therefore asked whether diaphragm nerve asymmetry was genetically hard-wired downstream of Nodal signaling, which initiates a left-restricted transcriptional cascade to establish visceral asymmetry (Komatsu and Mishina, 2013; Nakamura and Hamada, 2012). To answer this question, we examined two complementary types of mouse mutants that have defective Nodal signaling and ensuing lung isomerism. First, we examined Pitx2∆C/∆C embryos lacking PITX2C, a transcription factor downstream of Nodal (Essner et al., 2000; Liu et al., 2001; Schweickert et al., 2000). In the absence of PITX2C, Nodal signaling is interrupted, which causes a right pulmonary isomerism (i.e. the left lung has three main lobes like the right lung, instead of only one) (Liu et al., 2001, 2002). Second, we examined Rfx3–/– embryos lacking RFX3, which is essential for cilia function that helps to distribute Nodal to the left side of the body. As a result, some Rfx3–/– embryos exhibit bilateral Nodal expression and left pulmonary isomerism (i.e. the right lung has one lobe like the left lung) (Bonnafe et al., 2004). We found that diaphragm L/R nerve asymmetries were lost in both Pitx2∆C/∆C and Rfx3–/– embryos with impaired visceral asymmetries at E14.5 (Figure 2A–E) (number of secondary branches, Wt versus mutant with lung isomerism: PITX2C, p=4.493E-5; RFX3, p=0.002884; defasciculation distance, Wt versus mutant with lung isomerism: PITX2C, p=0.001268; RFX3, p=2.719E-6, Mann-Whitney). Thus, the Nodal pathway is essential for the establishment of diaphragm nerve asymmetry.

L/R asymmetries of the phrenic nerve patterns require Nodal signaling.

(A) NF staining of E14.5 diaphragms from wild-type, Pitx2∆C/ΔC and Rfx3–/– embryos with the respective superimposed L/R nerve pattern and the Nodal expression. (B–C) Schematic of the secondary branches quantification and histograms of the R/L ratios of secondary branches: Pitx2∆C/+and Pitx2+/+ 2.23 ± 0.20, versus Pitx2∆C/∆C with lung isomerism 1.09 ± 0.05, p=4.493E-5 (B); Rfx3+/+ and Rfx3–/1.75 ± 0.12, versus Rfx3–/– with lung isomerism 1.07 ± 0.10, p=0.002884, Mann-Whitney (C). (D–E) Schematic of the defasciculation distance measurements and histograms of the R/L ratios of defasciculation distance for: Pitx2∆C/+and Pitx2+/+ 4.63 ± 0.26, versus Pitx2∆C/∆C with visceral isomerism: 2.28 ± 0.59, p=0.001268, Mann-Whitney (D); Rfx3+/+ and Rfx3–/4.62 ± 0.43, versus Rfx3-/- with visceral isomerism 1.35 ± 0.19, p=2.719E-6, Mann-Whitney (E). Note that there is no lung isomerism in wild-type embryos. Histograms show the mean ± SEM. Numbers above bars indicate the number of embryos analysed. ni, non-isomeric (embryos that did not exhibit visceral isomerism); i, isomeric. Scale bars: 200 μm. Numerical values used to generate the graphs are accessible in Figure 2—source data 1.

https://doi.org/10.7554/eLife.18481.010

We next asked whether phrenic nerve asymmetry has an environmental origin, because it is conceivable that the lung buds confer L/R asymmetry-inducing signals to nerves that are navigating close by (Figure 3A,B). However, the analysis of Pitx2∆C/∆C and Rfx3–/– mutants showed that the pattern of nerve asymmetry did not always correlate with the pattern of lung asymmetry; for example, in 2/10 Pitx2∆C/∆C embryos, nerve patterns were normal even though the lungs were isomerized (20%; Figure 3C; Figure 3—figure supplement 1A,B). Moreover, 1/13 Rfx3–/– embryos exhibited nerve isomerism together with pulmonary situs inversus, and nerve patterns were reversed in 1/13 embryo with lung isomerism (7.7% and 7.7%; Figure 3C; Figure 3—figure supplement 1A,B). Alternatively, it is conceivable that muscle asymmetry controls nerve asymmetry. In agreement with this possibility, L/R asymmetry of the lateral diaphragm muscles was lost in both Pitx2∆C/∆C and Rfx3–/– mutants (Figure 3B). However, muscle width did not correlate with changes in nerve patterns in 2/10 Pitx2∆C/∆C embryos or in 6/13 Rfx3–/ embryos (20% and 46.2%, respectively). For example, muscle isomerism could be observed in 1/13 Rfx3–/– embryos that have normal nerve patterns (7.7%) or in 1/13 Rfx3–/– embryos with reversed nerve patterns (7.7%). Finally, nerves were isomerized in 2/13 Rfx3–/– embryos that exhibit normal L/R muscle asymmetry (15.4%) (Figure 3C; Figure 3—figure supplement 1C). Together, these findings raise the possibility that phrenic motoneurons possess intrinsic L/R differences that are established independently of visceral and muscle asymmetries.

Figure 3 with 1 supplement see all
The asymmetry of phrenic circuits results from an intrinsic neuronal program.

(A) Schematic representation of the organisation of the phrenic nerves as they pass through the lungs and reach the diaphragm. (B) Photomicrographs of the expected L/R asymmetry of lungs and diaphragm muscles at E14.5 in wild-type embryos and the altered L/R asymmetry observed in the Rfx3–/– and Pitx2∆C/∆C mutant embryos. Quantification of diaphragm muscle asymmetry: Pitx2+/+ and Pitx2∆C/+ 6.25 ± 0.68, N = 20, versus Pitx2∆C/∆Ciso 0.26 ± 0.6, N = 6; Rfx3 +/+ and Rfx3-/+ 7.02 ± 0.74, N = 17 versus Rfx3–/-–iso 0.72 ± 1.6, N = 7 (see methods). (C) Schematic representation of L/R asymmetries in the lungs, diaphragm muscles and phrenic nerves. A colour code is used to show the uncoupling occurring between phrenic nerve and lung asymmetries or phrenic nerve and diaphragm muscle asymmetries. Any structure represented in green is indicative of its left characteristics, whether it is observed on the left or the right side of the embryo, whereas red structures represent right characteristics. (D) Pou3f1 (Oct6) staining showing the pool of phrenic motoneurons, projection formed by serial sections of the entire cervical region of an E11.5 spinal cord embryo. (E) Histogram showing the area positive for the Pou3f1 (Oct6) labeling in the left and right cervical motoneuron domains (N = 3, p=0.5, Wilcoxon signed rank). (F) GFP staining of ventral cervical spinal cord explants from E12.5 HB9::GFP embryos; the dashed line is indicative of the explant border. (G) Quantification of the area occupied by GFP-positive axons for left and right explants (left — 100% ± 17.4; right — 214% ± 30.2, p=0.0045, Mann-Whitney). (H) Quantification of the width ratio (see Figure 3—figure supplement 1 for quantification details) (left —100% ± 7.3; right — 127% ± 8.0, p=0.0127, Mann-Whitney). Numbers above bars indicate the numbers of explants analysed. Histograms show the mean ± SEM. Scale bars: 100 μm (D), 200 μm (F). Numerical values used to generate the graphs are accessible in Figure 3—source data 1.

https://doi.org/10.7554/eLife.18481.012

3D reconstructions of cervical spinal cord tissue immunolabeled with Pou3f1/Oct6, whose expression has been reported in motoneurons (Philippidou et al., 2012), did not reveal any obvious differences in the L/R organization of the cervical motoneuron pools in the spinal cord (Figure 3D–E). We therefore explanted phrenic motoneuron-enriched Hb9::GFP spinal cord tissue (Wichterle et al., 2002) to follow the behavior of motor axons as they extended from the explants independently of the surrounding organs (Figure 3—figure supplement 1D). We observed that axons explanted from right tissue extended over longer distances and were organized differently than axons explanted from left tissue (Figure 3F–H; Figure 3—figure supplement 1E–F). This observation suggests that intrinsic factors present within the ventral spinal cord confer different behaviors to left and right motoneuron axons.

To identify molecular determinants of L/R differences in phrenic axon growth, we laser-captured left versus right GFP-positive cervical motoneurons from Hb9::GFP transgenic E11 embryos for microarray analysis (Figure 4A). The presence of several markers for phrenic motoneurons (e.g. Pou3f1/Oct6, Islet1 and ALCAM) in the microarray data demonstrated the accuracy of the dissection procedure (Figure 4—figure supplement 1A–B). Consistent with the lack of obvious anatomical differences distinguishing left and right Pou3f1/Oct6+ cervical motoneuron populations, none of these markers had asymmetric expression levels. We further observed that amongst 22,600 transcripts expressed above background, 146 were enriched on the left and 194 on the right, with a predominance of transcripts encoding nuclear proteins (differentially enriched transcripts: right 35.56% versus left 26.02%; Figure 4B; Figure 4—source data 1 and 2). Immunoblotting confirmed that Morf4l1, a protein involved in histone acetylation/deacetylation and chromatin remodeling and reported to be essential for neural precursor proliferation and differentiation (Chen et al., 2009; Boije et al., 2013), was enriched in the left cervical motoneuron domain (L/R fold-change 1.81 ± 0.163, p=0.0022, Mann-Whitney; Figure 4C–E). Xrn2, a protein regulating RNA processing and miR stability that regulates miR expression in neurons (Kinjo et al., 2013), was also enriched in the left cervical motoneuron domain (L/R fold-change 1.37 ± 0.13, p=0.028; Mann-Whitney; Figure 4—figure supplement 1C). Thus, cervical motoneurons are intrinsically L/R-specified.

Figure 4 with 1 supplement see all
L/R molecular signature of cervical motoneurons.

(A) Transverse sections of E11.5 Hb9::GFP embryo cervical spinal cord, illustrating the areas used for laser-capture microdissection. (B) Pie charts showing the proportion of left-enriched and right-enriched genes according to their Gene Ontology ‘cellular component’ terms. The ‘nucleus’ component is detached from the pie. (C) Ladder graph showing the left and right expression of Morf4l1 in three embryos. Average L/R fold-change shown in brackets. (D) Immunodetection of Morf4l1 and loading control tubulin (Tub.) in left and right ventral cervical spinal cord tissues. (E) Graph showing normalized protein levels of Morf4l1 in left and right ventral cervical spinal cords from E11.5 mouse embryos. Individual values observed for the six western-blots (dots) and mean ± SEM are represented (L/R ratio: 1.81 ± 0.163, L versus R; p=0.0022, Wilcoxon signed rank). Average L/R fold-change shown in brackets. Scale bar: 100 μm. Numerical values used to generate the graphs are accessible in Figure 4—source data 3.

https://doi.org/10.7554/eLife.18481.016

To determine whether molecular differences in L/R specification manifest themselves in differential axon guidance responses, we studied mice lacking Slit/Robo signaling, which is known to regulate the fasciculation of phrenic axons (Jaworski and Tessier-Lavigne, 2012). In agreement with prior reports, we observed defective nerve defasciculation in Robo1–/–;Robo2–/– double mutants (Figure 5A). Notably, defasciculation of the left nerve was as high as that of the right nerve and assumed a similar pattern in the left and right diaphragm, rather than adopting the normal asymmetric pattern seen in wild-type littermates (Figure 5A). Partial symmetrization was observed in double heterozygous mutants, indicating concentration-dependent sensitivity of phrenic nerve axons to Slit signals (Figure 5A).

Figure 5 with 2 supplements see all
Slit/Robo signalling and MMP2 control asymmetry of L/R phrenic nerves.

(A) NF staining of E14.5 diaphragm from Robo1+/+ and Robo2+/+ and Robo1–/– and Robo2–/–- embryos, left and right primary branches are pseudocolored in green and red,respectively, and superimposed to show the lack of asymmetry in the Robo1 and 2–/– embryos. Histogram showing the branch number and the defasciculation distance in Robo1+/+ and Robo2+/+, Robo1+/– and Robo2+/– and Robo1–/– and Robo2–/– embryos (R/L branch ratio: Robo1+/+ and Robo2+/+ 2.30 ± 0.37, versus Robo1–/– and Robo2–/– 1.06 ± 0.06; p=0.00048; R/L distance ratio: Robo1+/+ and Robo2+/+ 4.99 ± 0.89, versus Robo1–/– and Robo2–/– 1.05 ± 0.07; p=3E-6, Mann-Whitney). (B) Immunodetection of Robo1 and loading control (Tub) in left and right HB9::GFP ventral cervical spinal cord and distribution of the relative amount of the two shorter forms (pink arrowheads) to the full-length form (black arrowhead). The graph shows the normalized left and right values obtained for the five western-blots (dots, 6–8 embryos per sample) and the mean ± SEM (R versus L: p=0.01587, Wilcoxon singed rank); average fold-change is shown in brackets (1.22 ± 0.10). Normalization between lines was done on the Robo1 long form. (C) Ladder graph showing the left and right expression of Mmp2 detected by microarray in three embryos. Average Log2(R/L ratio) shown in brackets. (D) Photomicrograph of cultured ventral cervical spinal cord motoneuron. The combination of in situ zymmography with DQ-Gelatin and Islet1/2 staining enables the identification of motoneuron with MMP gelatinase activity. Histogram showing the amount of motoneuron with gelatinase activity in left and right samples (left 23.37% ± 2.7, N = 792 versus right 37.94% ± 2.1, N = 797; p=0.00109, Mann-Whitney). Histogram showing the gelatinase activity measured in cultures from Rfx3–/– embryos with symmetric lungs (Iso) and in cultures from Rfx3+/+, Rfx3+/ embryos (Rfx3 wt: — 1.4 ± 0.08; Rfx3 iso — 0.96 ± 0.08, p=0.0013, Mann-Whitney). (E) NF staining of E14.5 diaphragms from wild-type and Mmp2–/– embryos. Left (green) and right (red) primary and secondary branch traces shown in the middle panel are superimposed in the right panel to compare the left and right patterns. Histograms showing the R/L ratios of branch number and defasciculation distances. Ratio of secondary branches: Mmp2+/+ and Mmp2–/+ 1.74 ± 0.07, versus Mmp2–/– 1.21 ± 0.10; p=0.00029; defasciculation distance: Mmp2+/+ and Mmp2–/+ 5.33 ± 0.44, versus Mmp2–/– 3.49 ± 0.38; p=0.022, Mann-Whitney. Scale bar: 200 μm (A,E), 10 μm (D). Numerical values used to generate the graphs are accessible in Figure 5—source data 1.

https://doi.org/10.7554/eLife.18481.022

To determine whether differential levels of Slit/Robo signaling dictate the L/R pattern of phrenic nerve fasciculation, we examined their transcript levels, but found no evidence for lateralized expression of the transcripts for Robo1, the major regulator of diaphragm innervation (Jaworski and Tessier-Lavigne, 2012), or the ligands of Robo1: Slit1, Slit2 and Slit3 (Figure 5—figure supplement 1A–B). By contrast, we identified L/R differences in Robo1 protein by immunoblotting of phrenic motor neuron-enriched cervical spinal cord tissue. Robo1 was detected in one long and two short forms (Figure 5—figure supplement 1C), whereby the long Robo1 form migrating as a 250 kDa protein was enriched in the left samples and the short forms migrating as 120 kDa and 130 kDa proteins were enriched in the right samples (R/L ratio— 1.22 ± 0.1, p=0.01587; Mann-Whitney, Figure 5B, Figure 5—figure supplement 1D). Even though 12 alternatively spliced isoforms have been predicted for mouse Robo1, the predicted changes in protein sequence are unlikely to account for the short forms we observed in our immunoblots, because they are predicted to change the molecular weight by just 7.1 kDa. However, both human and drosophila Robo1 have been shown to be processed by metalloproteases (Seki et al., 2010; Coleman et al., 2010), and potential cleavage fragments have been reported in mouse brain tissues (Clark et al., 2002). These findings raise the possibility that differential post-translation processing of Robo proteins may be involved in creating L/R asymmetries in diaphragm innervations.

Next, we investigated whether axon guidance effectors that were revealed by our transcriptomic analysis to exhibit asymmetric expression levels could also contribute to the L/R phrenic nerve patterns. Given that metalloproteases have emerged as important regulators of axonal behaviors during development and regeneration (Bai and Pfaff, 2011; Łukaszewicz-Zając et al., 2014; Small and Crawford, 2016; Verslegers et al., 2013b), we concentrated on these effectors. Consistent with previous expression data (GSE41013) (Philippidou et al., 2012), our transcriptome analysis indicated that cervical motoneurons express several metalloproteases. Interestingly, among the 7 Mmps and 13 ADAMs expressed by cervical motoneurons, Mmp2 and ADAM17 were expressed at higher levels in the right motoneurons. We focused on MMP2 because it was shown to control axon development in mouse and motor axon fasciculation in drosophila (Miller et al., 2011; Gaublomme et al., 2014; Zuo et al., 1998; Miller et al., 2008).

The microarray analysis showed that Mmp2 transcripts were enriched in the Hb9-positive right motoneurons, which was confirmed using qRT-PCR and quantitative in situ hybridization (log2(R/L) Embryo 1 — 0.22 ± 0.08; Embryo 2 — 0.63 ± 0.11, RNAscope) (Figure 5C; Figure 5—figure supplement 2A–D). Moreover, in situ zymography with DQ-Gelatin (Hill et al., 2012), which is effectively cleaved by MMP2 (Snoek-van Beurden and Von den Hoff, 2005), showed that gelatinase activity on the axon shaft and growth cones was 1.6 times higher in right than in left motoneuron cultures (Figure 5D; Figure 5—figure supplement 2E). Remarkably, this difference was absent in motoneuron cultures prepared from Rfx3–/– embryos with phenotypic left isomerism (Figure 5D). These results provide evidence that the differential L/R MMP activity is controlled by the Nodal pathway and further suggest that MMP2 contributes to the establishment of phrenic nerve asymmetry.

We therefore analyzed the diaphragm nerve patterns in Mmp2–/– mice (Itoh et al., 1997). At E14.5, Mmp2–/– embryos exhibited normal lung asymmetry and well-developed phrenic branches on both sides (Figure 5E). Interestingly, we observed a partial symmetrization of the phrenic branches, with a right pattern that resembled the one observed on the left in control littermates in E14.5 Mmp2–/– embryos (Figure 5E). Thus, higher right MMP2 activity could contribute to promote the right pattern of phrenic nerve defasciculation.

Discussion

Taken together, our work shows that the first asymmetry instruction in diaphragm patterning is provided by early Nodal signaling, which sets the L/R axis and visceral asymmetry of the embryo. Beyond this early mechanism, phrenic motoneurons have an intrinsic, genetically encoded L/R asymmetry that manifests itself in the differential activation of molecules that have key roles in axon guidance, including Robo1 and MMP2.

Future work should aim to address how and at which stage phrenic motoneurons are imprinted. For example, an early Nodal signal might be propagated from the lateral plate mesoderm (LPM) to the cervical spinal cord. In agreement with this idea, it has been suggested that Lefty expression in the prospective floor plate of the neural tube prevents Nodal diffusion to the left LPM (Shiratori and Hamada, 2006). Moreover, Lefty expression is confined to the left prospective floor plate and is reversed or expanded bilaterally in ‘iv’ or ‘inv’ mutants, which exhibit reverse visceral asymmetry (Meno et al., 1997). Given the key role of the floor plate in the patterning and specification of spinal cord neuronal lineages (Goulding et al., 1993; Placzek et al., 1991), left and right floor plate cells might also differently imprint left and right spinal cord. Alternatively, or additionally, endothelial cells invading the ventral spinal cord could convey early Nodal signaling from the LPM to the spinal cord. Indeed, these cells exhibit L/R asymmetries that can be preserved during their migration (Chi et al., 2003; Klessinger and Christ, 1996). The resulting L/R imprints could occur early on during neurogenesis or later on during motoneuron differentiation. The two hypothesizes might not be exclusive. Indeed, recent work in zebrafish habenula suggests that differences in both the timing of neurogenesis and exposure to lateralized signal during neuron differentiation act in parallel to set L/R asymmetries (Hüsken et al., 2014). Interestingly, early imprinting of progenitors in Caenorhabditis elegans induces an epigenetic mark for L/R identity that drives differential genetic programs during neuron differentiation (Cochella and Hobert, 2012; O'Meara et al., 2010).

Our work provides evidence to show that a L/R imprint confers specific axon behaviors to the left and right phrenic motoneurons. For example, we found that Slit/Robo signaling is required for the establishment of asymmetric nerve patterns, which suggests that left and right phrenic motoneurons have different Slit/Robo signaling levels. Interestingly, Slit/Robo signaling has previously been shown to control phrenic axon fasciculation (Jaworski and Tessier-Lavigne, 2012). Consistent with an intrinsic control of Slit/Robo signaling as the cause of this axonal asymmetry, we discovered L/R differences in Robo1 protein in motoneurons, which may arise through differential proteolysis and may help to modulate responsiveness to Slit signaling, even though Slit and Robo genes are expressed similarly in the left and right motoneuron pools. In support of the idea that differential proteolysis contributes to the emergence of different Robo1 forms in the left and right phrenic motoneuron pools, Robo processing has previously been reported in other contexts (Seki et al., 2010; Coleman et al., 2010). This Robo1 processing could have different outcomes on Slit/Robo signaling. In drosophila, cleavage of Robo by ADAM10 is required for recruitment of downstream signaling molecules and the axon guidance response (Coleman et al., 2010). Metalloproteases can also decrease the amount of available receptors and/or terminate adhesion and signaling (Bai and Pfaff, 2011; Hinkle et al., 2006; Romi et al., 2014; Hattori et al., 2000; Gatto et al., 2014).

Slit/Robo signaling can control many different aspects of axon development, such as axon growth, branching, guidance or fasciculation. As primary and secondary branches are formed by selective defasciculation and because Slit/Robo signaling controls phrenic axon fasciculation, our interpretation is that the different Slit/Robo signaling abilities of left and right phrenic axons result in different axon–axon fasciculation states, with right axons having greater defasciculation behavior than the left ones. Alternatively, the Slit/Robo pathway may differentially regulate axon and branch growth, or branch trajectories, as it does for other systems of neuronal projections (Wang et al., 1999; Brose et al., 1999; Blockus and Chédotal, 2016). These ideas have to be taken cautiously. Differential Robo forms were assessed from spinal cord tissue essentially containing neuronal soma, and not peripheral phrenic axons. Furthermore, the tissue samples, although enriched in phrenic motoneurons by the procedure, contained additional neuronal sub-types. Further investigations are thus needed to assess with more specific tools Robo protein dynamics and distribution along phrenic axons and in the growth cones. This work will provide a better characterization of the functional outcome determined by the balance of short and long Robo forms in the establishment of phrenic nerve patterns.

Asymmetries in several genes implicated in axon guidance were observed in our transcriptome analysis. In particular, we found differences in the expression of regulators of guidance receptors activities, such as metalloproteases. Mmp2 expression level and gelatinase activity were found to be higher in right cervical motoneurons. Moreover, differential gelatinase activity between left and right motoneurons was lost in cultures from Rfx3–/-– mutants with symmetrical Nodal signaling, suggesting that early Nodal signaling impacts on gelatinase activity in motoneurons. Mmp2 genetic loss reduced the asymmetry of the diaphragm branch pattern, suggesting that asymmetric expression of Mmp2 in motoneurons contributes to set phrenic nerve patterns.

However, in contrast to embryos lacking Pitx2 and Rfx3, embryos lacking Mmp2 only exhibited a partial symmetrization of the phrenic nerve branches. Rfx3 and Pitx2C transcription factors act at the onset of the left–right imprinting, and their genetic loss is therefore expected to abolish the entire program of L/R nerve asymmetry. By contrast, the subsequent construction of individual neuronal circuits relies on the concerted action of many different signaling pathways, whereby loss of a single pathway is not expected to disrupt the entire asymmetry program. The partial defect may be due to the presence of other effectors of the Nodal pathway that contribute to L/R nerve asymmetries independently of MMP processing, to the co-expression of several MMPs acting with partial redundancies with each other (Prudova et al., 2010; Kukreja et al., 2015) and to the fact that MMPs have many different substrates with potentially opposite effects on the same biological process. For example, proteomic studies have identified more than 40 secreted and transmembrane substrates for MMP2 (Dean and Overall, 2007), of which we found 32 to be expressed in cervical motoneurons including Adam17, which is enriched in right motoneurons (Figure 5—figure supplement 2F, Figure 4—source data 2).

The MMP substrates that are responsible for asymmetric phrenic nerve patterning remain to be determined, but Slit/Robo signaling appears to be an obvious candidate. First, cleavage of human Robo1 has been suggested to be MMP-dependent, although in drosophila, Robo1 is cleaved by Adam10/Kuzbanian (Coleman et al., 2010; Seki et al., 2010). Second, short forms of Robo1, lprobably generated by proteolysis, are enriched in right motoneurons, in which MMP activity is the highest. In support, incubation of cervical spinal cord tissue with active MMP2 significantly increased the short Robo1 forms (fold change: 1.60 ± 0.23, p=0.00285, Mann-Whitney, four independent western blots, Supplementary file 1). Nevertheless, the L/R ratio of Robo protein forms in cervical motoneuron tissue collected from Mmp2 null embryos, although showing a tendency towards reduction, was not statistically different from the wild-type ratio (WT: 1.22 ± 0.10, N = 5; Mmp2–/–: 1.14 ± 0.01, N = 3; p=0.78, Mann-Whitney; Supplementary file 2). This might be due to an insufficient number of tested embryos. Alternatively, because short Robo1 forms were still detected, this L/R ratio might rather reflect the activity of other proteases, either compensating for MMP2 loss or also contributing to Robo processing.

An additional MMP candidate is NCAM, which is highly expressed by developing phrenic axons, controls axon-axon fasciculation, and is cleaved by MMPs (Dean and Overall, 2007; Hinkle et al., 2006). In the light of MMP redundancy and the possible involvement of other proteases in the processing of axon guidance receptors and their ligands, the in vivo assessment of these hypotheses will be challenging.

Finally, the genetic program for L/R identity in spinal cord motoneurons that we have described here may provide important insights into motoneuron development and diseases. For example, the L/R imprinting of spinal motoneuron might also explain why right-sided fetal forelimb movements are far more frequent than left-sided movements at developmental stages when motoneurons have not yet received any input from higher brain centers (Hepper et al., 1998). In addition, our description of early events controlling diaphragm formation may have broad implications for our understanding of several human conditions. Examples include congenital hernias, which generally affect the left hemi-diaphragm and can cause perinatal lethality (Pober, 2008), and some types of congenital myopathies that impair diaphragm function only on one side (Grogan et al., 2005). Our data thus provide a novel basis for investigations of molecular diversity in spinal cord neurons and for functional studies of diaphragm physiology and pathology.

Materials and methods

Genotyping of mouse lines

This work was conducted in accordance with the ethical rules of the European community and French ethical guidelines. Genotyping of transgenic mouse lines was performed as described in Liu et al. (2001) for Pitx2∆C (original line: RRID:MGI:3054744), in Bonnafe et al. (2004) for Rfx3 (RRID:MGI:3045845), in Delloye-Bourgeois et al. (2015) for Robo1 and Robo2 (RRID:MGI:5522691), in Verslegers et al. (2013b) for Mmp2 (RRID:MGI:3577310) and in Huber et al. (2005) for the HB9::GFP (RRID:IMSR_JAX:005029).

Diaphragm immunolabeling

Diaphragms were dissected from embryos fixed overnight in 4% paraformaldehyde. After permeabilization and blocking in PBS with 5% BSA with 0.5% Triton X-100, diaphragms were incubated overnight at room temperature with the primary antibody, Neurofilament 160 kDa (1/100, RMO-270, Invitrogen, France; RRID:AB_2315286). Diaphragms were then incubated with the secondary antibody, α-mouse Alexa-555 (1/400, Invitrogen, France) with or without Alexa488-coupled α-BTX (1/50, Molecular probes, ThermoFischer Scientific, France; RRID:AB_2313931), for 4 hr at room temperature in blocking solution. The procedure was performed entirely on freely floating diaphragms. Diaphragm imaging was then performed under an inverted microscope and a montage was constructed using the metamorph software (Molecular device, Sunnyvale, CA).

Immunofluorescent labeling and in situ hybridization

Cryosections (20 µm) were obtained from embryos fixed overnight in 4% paraformaldehyde, embedded in 7.5% gelatin with 15% sucrose. For immunolabeling, embryonic sections or cultured neurons were incubated overnight at 4°C with Oct6 antibody (1/50; Santa Cruz, Germany) and then for 2 hr at room temperature with anti-goat secondary antibody, Alexa-488 (1/400; Invitrogen, France). Nuclei were stained with bisbenzimide (Promega, Madison, WI). In situ hybridization was performed as described previously (Moret et al., 2007). The probes were synthetized from the Mmp2 IMAGEclone plasmid (n6813184). Mmp2 in situ hybridization and Pou3f1 (Oct6) immunolabeling were performed on adjacent sections because the antibody could no longer recognize the Oct6 epitope after in situ hybridization.

Images processing and quantifications

Serial Pou3f1/Oct6-labeled sections were imaged using a confocal microscope. Series of images were converted into a single stack using the ImageJ plugin Stack Builder. Images were aligned manually using morphological structures and labeled nuclei were extracted. A three-dimensional reconstruction of the Pou3f1 (Oct6) labeling from the cervical to the brachial part of the embryos was then generated in ImageJ (3D Project command). All quantifications were done using ImageJ. For quantification of defasciculation distance, we first traced the tangential straight line of the endplate (Figure 1—figure supplement 1B). We then traced a perpendicular line to the tangent that goes through the nerve entry point. Finally, we measured the distance from the entry point to the intersection of both lines. For branch number quantification, we traced a parallel to the tangential straight line of the endplate. The line was placed at a distance of one quarter of the defasciculation distance. We then counted the number of secondary branches that crossed the line. The endplate thickness was evaluated from the α-Btx staining. The α-Btx-positive region was outlined and divided into 30 rectangles. The average width of the rectangles was calculated. Width evaluation of endplate from the plot profile of α-Btx staining gave similar values.

Western blot

Cervical ventral spinal cords were dissected from E11.5 HB9::GFP embryos in cold HBSS with 6% glucose (as shown in Figure 4—figure supplement 1D) and directly frozen in dry-ice cooled eppendorf tubes. Typically, left and right dissected tissues from 6–8 embryos were pooled and lysed in RIPA buffer with protease inhibitors for 30 min at 4°C. Western blots were performed using primary antibody (Anti-Morf4l1 (1:1000, Abcam, France – ab183663), anti-Xrn2 (1:1000, Abcam, France – ab72181, RRID:AB_2241927), anti-Robo1 (1:500 [Seki et al., 2010]) and secondary antibody (Anti-goat or -mouse HRP [A5420 and A4416, Sigma-Aldrich, France] at 1/5000). Image quantification was done with Image Lab4.0 software (Bio-Rad, France). Left and right data were normalized to the tubulin level for Morf4l1 and Xrn2 and to Robo1 full-length or tubulin for Robo1 short forms. To allow comparison between replicates left and right values were then normalized to have the same left plus right sum for all western blots.

Motoneuron explant culture

E12.5 GFP-positive mouse embryos (4–6 per experiment) from HB9::GFP transgenic mice were selected and dissected using the fluorescence GFP-positive pool. Ventral cervical spinal cords were isolated (left and right parts separated) and cut into explants. Explants were cultured as described in Moret et al. (2007). Immunohistochemistry was performed using Anti-Tuj1 (1:100, Millipore, France – MAB1637, RRID:AB_2210524) and anti-GFP (1:100, Invitrogen, France – A11122, RRID:AB_221569). Axon outgrowth was calculated using the ImageJ plugin NeuriteJ (Torres-Espín et al., 2014), which creates regions of interest (ROI) corresponding to radial concentric rings separated by 25 pixels. NeuriteJ extracted the signal from GFP-positive axons and measured the labeled surfaces between two ROIs. To quantify the total area occupied by GFP-positive axon, we summed the surface of all ROIs. To calculate the proximo-distal index, the width of the labeled axons was calculated in the second ROI (proximal ring) and in the ROI at 30% of the maximal distance of growth (distal ring) (see Figure 4—figure supplement 1F). The index was calculated by dividing the width of the proximal fascicles by the width of the distal fascicles.

Dissociated motoneuron culture and in situ zymography assay

For dissociated motoneuron culture, left and right cervical ventral spinal cord tissues were dissected from E12.5 OF1 or Rfx3 pregnant mice. Neurons were dissociated and cultured as described previously (Charoy et al., 2012; Cohen et al., 2005). After 24 hr in vitro, neurons were incubated for 10 min at 37°C with DQ-Gelatin 20 μg/mL (Invitrogen, France). Cells were washed twice with warm PBS and fixed in 4% paraformaldehyde both containing 25 μM of GM6001 MMP inhibitor (Millipore, France-CC1100). The cultures were incubated with Islet 1/2 antibody (1/50; DSHB, Iowa, USA – 39.4D5) overnight at 4°C then for 2 hr with α-mouse Alexa-555 (1/400; Invitrogen, France) to detect motoneurons. Nuclei were counter-stained with bisbenzimide (Promega). For quantification, the number of cells expressing Islet1/2 with gelatinase activity is reported realtive to the total number of Islet-1/2-positive cells.

Microarray analysis and quantitative real-time PCR

The GFP+ motor pool was laser-captured from E11.5 GFP+ mouse embryos from HB9::GFP transgenic mice frozen in −45°C isopentane. Captured tissues were lysed in the lysis buffer provided with the RNA purification kit (RNAeasy microkit, Qiagen, France ). RNA quality was assessed on an Agilent 2100 bioanalyser (Agilent Technologies, USA). L/R matching samples that had a RNA integrity number (RIN) above 9 were amplified (ExpressArt PICO mRNA amplification kit, Amp-tec-Exilone, France) and reverse transcribed (BioArray HighYield RNA Transcript Labeling, ENZO, France). cDNA quality was assessed on an Agilent 2100 bioanalyser before fragmentation and hybridization on an Affymetrix microarray (GeneChip Mouse 430 2.0, Affymetrix, ThermoFischer scientific, France). Expression normalizations and present or absent calls were performed in Affymetrix Expression Console Software. Fold change and filtering were performed in Excel. Transcripts were considered as being expressed if scored as present in at least one sample of each embryo. Transcripts were classified as differentially expressed if the fold change (FC) between left and right samples had the same trend for all embryos (same sign for log2 ratio) and was over 1.5 (FC > 0.58 or FC < −0.58 in log2) on average and for at least two of the embryos. Transcripts with very low expression (maximal normalized expression <200) were removed. Raw data are available on GEO under the accession number GSE84778.

Real-time PCR was performed using MIQE pre-validated Mmp2 (qMmuCID0021124) and Mnx1 (qMmuCED0040199) primers (BioRad, france). Data were normalized to GAPDH expression values (primers Fw: AGAACATCATCCCTGCATCC; Rv: ACACATTGGGGCTAGGAACA). Real time PCRs were performed in duplicate on amplified RNA prepared as described for the microarray. Laser-capture microdissection, RNA preparation, microarray and qPCR were performed at the ProfileXpert core facility (France).

RNAscope in situ hybridization

RNAscope in situ hybridization (Advanced Cell Diagnostic, Ozyme, France) was performed on 14–20-µm cryosections according to the manufacturer's recommendations for fresh frozen samples, using Mmp2 C3 and C1 proprietary probes (references 315937 and 315931-C3, ACD, Ozyme, France). Both probes gave the same pattern, which mirror the distribution observed using the conventional in situ procedure. UBC and DapB probes were used as positive and negative controls, respectively (references 310777 and 312037, ACD, Ozyme, France). All incubations were performed in the HyBez hybridation system (ACD, Ozyme, France). Sections were fixed in 4% paraformaldehyde for 15 min before dehydratation and incubated in pretreat buffer 4 (Advance Cell Diagnostic, Ozyme, France) for 15 min at room temperature. DAPI staining was performed at the end of the procedure. The left and right side of the cervical spinal cord were imaged at 20x on a FV1000 confocal microscope (Olympus, France) using the same acquisition parameters. Labeled surfaces were quantified in ImageJ in ROI drawn from the DAPI staining. The threshold calculated on the sum of the Z-stack image of one side was applied to the other side. Surface ratios were calculated after normalization to the selection area.

Statistical analyses

Control and mutant embryos were from the same litters. All analyzable samples (diaphragm, western blots, cells or explants) were included, no outliers were removed. Left and right samples were from the same embryos. Analyses of the diaphragm innervation and Mmp2 quantitative in situ were performed blind. No blinding was done on other data collections or analyses. Sample sizes, statistical significance and tests are stated in each figure and figure legend. All statistical analyses were done using Biostat-TGV (CNRS). Mann-Whitney (method: Wilcoxon rank sum) or Wilcoxon signed rank were used for small-sized samples or when distributions were not normal. Wilcoxon signed rank was used when paired analysis was needed (left versus right from the same embryo).

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
    Mesendoderm and left-right brain, heart and gut development are differentially regulated by pitx2 isoforms
    1. JJ Essner
    2. WW Branford
    3. J Zhang
    4. HJ Yost
    (2000)
    Development 127:1081–1093.
  16. 16
  17. 17
  18. 18
  19. 19
    An overview of phrenic nerve and diaphragm muscle development in the perinatal rat
    1. JJ Greer
    2. DW Allan
    3. M Martin-Caraballo
    4. RP Lemke
    (1999)
    Journal of Applied Physiology 86:779–786.
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
    Regulation of left-right asymmetry by thresholds of Pitx2c activity
    1. C Liu
    2. W Liu
    3. MF Lu
    4. NA Brown
    5. JF Martin
    (2001)
    Development 128:2039–2048.
  41. 41
    Pitx2c patterns anterior myocardium and aortic arch vessels and is required for local cell movement into atrioventricular cushions
    1. C Liu
    2. W Liu
    3. J Palie
    4. MF Lu
    5. NA Brown
    6. JF Martin
    (2002)
    Development 129:5081–5091.
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
    Control of dorsoventral pattern in vertebrate neural development: induction and polarizing properties of the floor plate
    1. M Placzek
    2. T Yamada
    3. M Tessier-Lavigne
    4. T Jessell
    5. J Dodd
    (1991)
    Development (Cambridge, England). Supplement Suppl 2:105–122.
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
    Shape and size of the human diaphragm in vivo
    1. WA Whitelaw
    (1987)
    Journal of Applied Physiology 62:180–186.
  69. 69
  70. 70
    Neuronal matrix metalloproteinase-2 degrades and inactivates a neurite-inhibiting chondroitin sulfate proteoglycan
    1. J Zuo
    2. TA Ferguson
    3. YJ Hernandez
    4. WG Stetler-Stevenson
    5. D Muir
    (1998)
    Journal of Neuroscience 18:5203–5211.

Decision letter

  1. Carol A Mason
    Reviewing Editor; Columbia University, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Genetic specification of left-right asymmetry in the diaphragm muscles and their motor innervation" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom, Carol A Mason (Reviewer #2), is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Reviewing Editor and K VijayRaghavan as the Senior Editor.

The reviewers have discussed the reviews with one another and find the study of great value. The Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

Charoy et al. address the question of the development of left-right asymmetry of motor neuron innervation patterns in the phrenic nerves innervating the diaphragm, with the right nerve exhibiting longer and more extensive branching compared to the left. Left-right asymmetric patterning in the embryo as a whole has been linked to early morphogen gradient asymmetry, and left-right asymmetry of individual neuronal cell identity has been analyzed in C. elegans but how such asymmetry is translated into asymmetric innervation patterns is poorly understood.

They first use two genetic models deficient for factors controlling Nodal signaling and that impact asymmetry of visceral organs, and find that the patterning of diaphragm muscles or organs that constitute intermediate targets of phrenic motor neurons do not obviously influence L-R phrenic nerve differences. The authors argue that instead this could be due to a distinct genetic program operating within phrenic motor neurons on each side of the spinal cord. Explants containing phrenic motor neurons display differential outgrowth patterns, and together with the preceding genetic manipulations lead the authors to conclude that there must be intrinsic L-R molecular differences inherent to phrenic motor neurons.

They confirm these L-R molecular differences by expression profiling experiments that reveal L-R differentially expressed genes. Several of these genes are involved in chromatin modification and RNA processing, but these were not pursued except as evidence that there is L/R asymmetry in intrinsic "imprinting" of phrenic motor neurons. They go on to focus on Robo-Slit signaling because of previous published work (Tessier-Lavigne lab) and nicely show that while there was no lateralized expression of Robo1 transcript, there is localized expression of the short form of Robo1 in the right population of motor neurons. Associated with this post-translational modification are MMP2 transcripts enriched in the right hand population, as was metalloprotease activity measured by other means. Importantly, in line with these conclusions, mutation of Robo1, MMP2 and Abl1, a Robo1 effector, in mice appears to alter the outgrowth and/or branching pattern of the phrenic nerves such that their left-right asymmetry is reduced.

Thus, they conclude that a 1.15 fold enrichment of the short Robo1 isoform in R phrenic motor neurons is the main determinant of L-R asymmetry of phrenic innervation pattern. Overall, the study makes a compelling case that there are indeed gene expression differences within motor neurons on the left and right sides of the spinal cord that impact the asymmetry of phrenic axon outgrowth and branching patterns.

These findings are novel and interesting, as they provide some of the first mechanistic insights into this phenomenon. The manuscript is well supported by the data, which are convincing and clear, and the study has relevance for numerous labs in the field revisiting pre-target organization in tracts.

Nevertheless, there are a number of major concerns that need to be addressed, and several minor points that can be addressed textually. The suggested revisions are easily doable considering the authors have the mice at hand, and some of these deal with already generated data.

Essential revisions:

1) Addition of supplemental imaging controls to demonstrate the reproducibility and quantification schemes used to assess L-R asymmetry of the phrenic nerves across animals:

a) Some of the left-right traces do not incorporate all of the projection data, which may inflate the matches/discrepancies in the overlay of L vs R nerves. Showing sample variability would strengthen the rigor of the analyses.

b) The methods used to score the branching patterns of phrenic axons are not consistent. The red-green trace projections lack branches and details that are visible in the primary data images (e.g., the control nerves in with Figure 4G). It would be helpful to see more examples of the raw and "traced" data that were used to generate the data plots, as supplemental data. One suggestion for appreciating the stereotypy of projections of left and right nerves from embryo to embryo is to overlay the traces from multiple specimens. This would help readers assess the background level of deviation from nerve to nerve.

2) Mechanisms of how enrichment of the short isoform of Robo 1 specifies a different phrenic nerve pattern on the right side:

a) An important further inquiry, which could be done with the mice in hand, is to determine whether cleavage of Robo1 on the left vs. right populations of motor neurons altered in MMP2 mutants. This would bolster the conclusion that differential levels of MMP2 are crucial for setting the L-R differences in Robo1 processing. As they currently stand, the data connecting MMP2 to Robo1 is based solely on the MMP2 expression pattern and gain of function experiments, which are suggestive yet not definitive.

b) The authors should more directly state how they envision the signaling to work. Is asymmetry, as presented in the quantification, a reflection of left-right differences in branching and outgrowth? Robo1 has previously been implicating in branching/outgrowth. They might comment on how their results compare to data in "Biochemical purification of a mammalian slit protein as a positive regulator of sensory axon elongation and branching", Cell 96, 771-784 (1999). This study is in line with the descriptive observations in the present manuscript.

c) Comment on the fact that there seem to be no L-R Robo1 ligand differences.

3) One of the interesting aspects is analysis of differences in fasciculation and growth behavior of phrenic motor neurons; unfortunately, these data are relegated to Figure 3—figure supplement 1. The methods are given only in the Figure legend and not at all in the Methods for the Supplementary Figures but are quite unintelligible. The differences seem to be great, and although it is unclear whether Robo-Slit signaling would be involved in fasciculation as proposed by Jaworski and Tessier-Lavigne in their earlier study, these data are of interest given the L/R asymmetry issue and are therefore important data for the present study. Even if the data stay in Supplementary data, issues include: why do axons extend only from one aspect of the explant? In f. why was only one aspect of the explant measured for bundle width, and what is the genotype of the explant? Also statistical analysis is not well stated for this aspect of the study.

4) There is a noticeable gap in connecting the very apt initial observations of changes in phrenic nerve asymmetry in Pitx2 and Rfx3 mutants to the later findings of changes in motor neuron expression of MMP2, Robo1 processing, etc. Assessment of changes in the L-R differences in MMP2 and Robo1 processing in Pitx2 and Rfx3 mutants would improve the cohesion of the studies. If MMP2/Robo1 processing are involved, there should be an equilibration of MMP2/Robo1 levels in left vs right phrenic motor neurons in Pitx2 and Rfx3 mutants.

[Editors' note: further revisions were requested, as described below.]

Thank you for submitting your work entitled "Genetic specification of left-right asymmetry in the diaphragm muscles and their motor innervation" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Bennett G Novitch.

As you can see in the attached reviews, both reviewers found the requested revisions of the original manuscript satisfactory. Reviewer 2 (called reviewer 5) indicates that the revision is a more balanced presentation of results supporting the conclusions that L-R asymmetry in innervation of the diaphragm is due to intrinsic differences in phrenic motor neurons and subtle differences in Slit-Robo1 signaling. The reviewers also agree that the data and narrative are well presented, and the story is novel and interesting, as few studies have approached the question of laterality in mammalian motor innervation, and thus they considered the message of the study a valuable contribution to the field.

Nonetheless, reviewer 1 has pointed to a lack of statistical significance in experiments on the cleavage of Robo1 between L and R motor neuron explants and on the impact of MMP2 treatment on the enrichment of the short Robo1 isoform. We appreciate that you have gone to great lengths in the resubmission to perform experiments on immunoblotting/inhibition of MMP activity, and dissection/enrichment of motorneurons and western blotting to detect the differential MMP levels that reflect a different pattern of Robo processing in the left and in the right cervical motoneuron population. However, after posting their reviews, the reviewers and Reviewing Editor engaged in much discussion (not included here): reviewer 2 saw that reviewer 1 identified the lack of statistical significance, then re-ran your statistical analyses and found that they indeed do not reach significance. Reviewer 2 also arrayed the data in different graphical formats such as columns/box and whiskers. These showed little difference in the mean beyond individual sample variability. This reviewer suggested that you might consider showing whiskers for these graphs, as it might more fairly represent whether or not there are L-R differences.

You state that MMP2 activity is higher in Right motoneurons, accounting for Robo1 isoform enrichment, and cite statistics in the figure legends, but do not overtly cite the lack of significance in the text. Indeed, the results as they are written appear convincing but then appear tenuous when the statistics in the Figure legends are considered. The reviewers now conclude that any in vivo differences in Robo1 processing between L and R phrenic motor neurons may be very minor.

Thus, your hypothesis that cleavage of Robo1 to the short isoform is through MMP2, resulting in R-L differences in symmetry in phrenic nerve innervation of the diaphragm, is not robustly supported. To increase the n for analyses of mutant tissue, and to reach statistical significance, you indicate that you would have to "replicate these experiments at least 10 times, especially tricky as these experiments are performed on knockout tissue". This effort would indeed be long and arduous; we do not ask at this point that you do this simply to add more n's.

The reviewers, Reviewing Editor, and Senior Editors agree that valuable observations are presented in the first part in Figures 1–4 – on patterns of branching, that asymmetry is controlled by Nodal signaling and seen in "intrinsic" differences in phrenic motoneurons, with the short isoform of Robo enriched on the right side to presumably control fasciculation differently than on the left. These are data well worth publishing and have merit even if the mechanistic aspect is unclear. Ordinarily, as with many of the other prominent journals, for the manuscript is to be acceptable, the authors would need to additionally provide mechanism. We understand that not all studies can end with a definitive mechanism. In repeated consultation with the reviewers, the Reviewing Editor, and the Senior Editor, we initially considered recommending that you either omit the experiments that are not substantiated by the statistical analyses, or describe the results as evidence that your hypothesis was not supported by the data. In either case, this would diminish the offering of the study for eLife, and we imagine would not be agreeable to you. Thus, the end, we have decided that the paper with its current components and incomplete outcome of analyses is not acceptable for publication in eLife. Instead, we encourage that you rethink the study with sufficient statistical power to ensure that you will have adequate sample size for a strong conclusion on L-R differences in Robo1 processing through MMP2, the proposed route through which L-R axon asymmetry could be achieved, either way.

Reviewer #1:

In the revised manuscript eLife"Genetic specification of left-right asymmetry in the diaphragm muscles and their motor innervation", the authors extend their study by attempting to address some of the criticisms raised in the eLife consensus review. The authors address satisfactorily the criticisms raised in review point 1 re: quantification of defective L-R asymmetry of diaphragm innervation. However, the authors fail to address point 2 regarding the impact of MMP2 levels on the enrichment of the short Robo1 isoform, and the mechanism of Robo1 specification of L-R phrenic asymmetry. Here the experiments comparing Robo cleavage between left and right side do not reveal a statistically significant difference (Figure 5B, p=0.187), and MMP inhibition does not result in significant changes in Robo1 cleavage asymmetry (Figure 5F). Importantly, as already shown in the original manuscript, the treatment of motor neuron explants with MMP2 also fails to significantly change the ratio (Figure 5C, p=0.125).

Furthermore, since normal embryos do not show significant left-right differences in Robo1 cleavage (Figure 5B, p=0.187), it is difficult to interpret the observation that explants from MMP2 mutant embryos do not display significant changes in L-R differences in Robo1 cleavage abundance (Figure 5—figure supplement 1K p=0.25). I am also confused about this experiment since in the rebuttal letter the authors mention that they examine "2 independent littermates of 5 embryos", compared to wild types, yet in the data table they mention an n of 3 replicates. The comment about the difficulty of extending these to a robust number of replicates makes me doubt whether additional experiments are feasible. Although other major comments are addressed in a satisfactory manner, the critical link between MMP2, Robo1 cleavage and diaphragm innervation asymmetry remains tenuous.

Reviewer #2:

The revision has addressed most of my concerns, and presents a much more balanced presentation of results supporting the conclusions that L-R asymmetry in diaphragmatic innervation is due to intrinsic differences in phrenic motor neurons including subtle differences in Slit-Robo1 signaling. The data and narrative are well presented, and the story as a whole is novel and interesting. Few studies have approached the question of laterality in mammalian motor innervation, so it is a valuable contribution to the field.

[Editors' note: further revisions were requested, as described below.]

Thank you for resubmitting your work entitled "Genetic specification of left-right asymmetry in the diaphragm muscles and their motor innervation" for further consideration at eLife. Your revised article has been favorably evaluated by K VijayRaghavan (Senior editor), a Reviewing editor, and two reviewers.

The reviewers, both new, feel that your presentation in this third submission is much improved over the previous two versions, which they have viewed. The reviewers thought your findings on left-right asymmetry in phrenic nerve innervation of the mouse diaphragm are important, particularly the nodal-mediated signaling of the asymmetry, the anatomical differences in the fasciculation differences in vitro, and the molecular screen pinpointing MMP processing of the Robo receptor to effect the l-r differences. However, there are several issues that need to be addressed before acceptance, as outlined below and in the appended reviews:

In your last rebuttal and in the text, you explain two major amendments: First, you state that you addressed the lack of statistical significance in the L/R difference in Robo forms in immunoblots, and we acknowledge your efforts. However, one of the present reviewers criticized the western blot analysis with the new statistical test used (based on the Degaspari method) and considered the normalization strategy invalid. Upon normalizing the levels of the short band to the full length band, one would predict that if the short form derives from the long form, the levels of the long form would decrease and the short form would increase. Please comment.

Second, your previous analysis of Robo processing by MMP2 in spinal cord tissue did not reach statistical significance. As with the previous reviewers, the present reviewers stressed that analyzing the mutants is a key experiment, and that it is crucial to your argument as such data would demonstrate a biochemical link between MMP2 activity and Robo1 receptor cleavage. Increasing the "n" would strengthen your case, but in a potentially "dangerous' direction, one of seeking the desired result and this route would be a lengthy as well.

You observed a partial symmetrization of the phrenic branches, with a right pattern that resembles the left pattern in control littermates in E14.5 Mmp2-/- embryos. But now you take the stance that the defect observed with MMP2 genetic deletion might affect alternative, or additional signaling pathways in axon guidance and that MMP2 may be one of several proteases, and thus chose to present the findings on the Robo and MMP2 pathways in phrenic nerve left-right asymmetries "independently" from each other, suggesting but not concluding that this relationship may be linked. While this does not solidify "mechanism", given the rounds of work you have done to improve the manuscript, we now feel that your revision is acceptable. However, we request that you acknowledge overtly that your attempts to demonstrate Robo1 processing in MMP2 mutants lacked significance, and shorten the text in the Discussion where you discuss multiple MMP2 targets and proteases.

In addition to these two major points of contention by the various the reviewers, as often happens with re-review by a new set of reviewers, additional experiments were suggested. One suggestion is to determine whether the cleaved Robo1 receptors have any guidance or fasciculation function. Your explant system would be ideal to investigate how MMP2 mutant motor neurons respond to Slits compared to wild type neurons after bath application or by co-culture with Slit-expressing cells, an analysis that would strengthen your hypothesis and data on the asymmetric axon innervation patterns in vivo. However, this would also take time and hopefully could be the basis of "next-step" experiments.

Reviewer #3:

I have carefully read all the different versions of the manuscript. I believe the authors have made a huge effort to improve the manuscript along the revision period. The last version is a compelling piece of work that, through many different approaches, demonstrates that right and left phrenic motor neurons have different intrinsic genetic profiles. In general, the way they present these data in the last version is much better and clear than in previous versions and, in my opinion, this manuscript deserves to be published in eLife.

However, I also believe that there is an important issue raised by previous reviewers that has not been yet addressed in the last version: The detection of the different forms of Robo1 by WB in the L/R sides of MMP2 mutants. In the second point-to-point letter to the reviewers (point 2) the authors state they attempted to address this issue by conducting a pilot experiment using 2 littermates of 5 embryos each and found a reduction in the L/R ratio in the MMP2 mutants compared to the controls, but the difference was not significant. They then stressed that, given the nature of the samples, it would be necessary to pool a higher number of embryos to reach statistical significance and that, constraints in the time of revision limited their capability to get the necessary amount of tissue. I believe this is a key experiment they need to complete no matter how long it takes to get the tissue, specially since they got promising results in the pilot experiment.

Reviewer #4:

Overall, this paper makes several important findings, but a set of major concerns suggest a reanalysis is needed of the Robo1 western blot experiment, and that a new set of experiments are needed for the axon explants. Key strengths of the study include interesting results that document a left-right asymmetry in phrenic nerve innervation of the embryonic mouse diaphragm, which would be a new system for left-right asymmetries in brain development. Their evidence indicates that Nodal signaling mediators are required for this asymmetry. A particularly significant finding that left and right motor axons have differences in their in vitro outgrowth behavior (area covered, fasciculation), as this suggests that intrinsic left-right specification, and a molecular screen has identified a large number of molecular differences, including asymmetries in MMP expression and activity. Also interesting is that mutations in the Robo receptors causes a switch to symmetrical innervation in the diaphragm, which suggests a molecular mechanism to explain at least part of the innervation asymmetries.

A key but problematic set of evidence is a potential asymmetry in Robo1 protein, which appears to derive from increased level of cleavage of Robo1 protein on the right side of the spinal cord. This result is important because it would be significant to find asymmetry in receptor processing, and to correlate this with altered axon pathfinding or fasciculation. However, several concerns arise about these experiments.

a) The material comes from dissected halves of the spinal cord, tissue lysates followed by Western blotting. However, Robo1 expression is widespread among many neuron types in the spinal cord, and so is not specific for motor neurons. So, while an asymmetry in Robo1 cleavage could be consistent with the motor neuron pathfinding differences, this result is limited in that it does not show where the cleaved receptors are. This is not a fault of the authors, because tools to map the distribution of cleaved Robo1 protein in tissue are not available. This point should be discussed as a caveat.

b) A related concern is that whether or not Robo1 receptor proteins are cleaved in the spinal cord does not provide any evidence about Robo cleavage in the site of Robo1 action in the peripheral axons. Again, this seems impossible to assess currently, but should be discussed as a caveat.

c) The Robo1 Western blot experiment has been revised to normalize the levels of the short band to the full length band, according to Figure 5B label on the second graph. This normalization strategy does not seem valid, because the short form is hypothesized to be derived from the long form. This leads to the prediction that the right side increase in the short form should accompanied by a decrease in full length. If so, then the normalization strategy would inappropriately exaggerate the increase in the short form. The paper cited for normalization strategies (Despagari 2014) does not provide an obvious justification for this short/long normalization, either. Therefore, serious doubts are raised about the validity of this important claim, which undercuts a major strength.

d) It is not clear whether cleaved Robo1 receptors have altered or indeed any guidance or fasciculation function in this system, such as decreased Slit responses or increased fasciculation. With the explant outgrowth system, it should be within the expertise of the investigators to directly test responses of motor neurons to Slits applied in the culture bath or by co-culture with Slit-expressing cells. This new experiment would significantly strengthen the paper by testing the prediction of altered axon responses in culture that might correlate with the in vivo axon projection patterns.

https://doi.org/10.7554/eLife.18481.032

Author response

Essential revisions:

1) Addition of supplemental imaging controls to demonstrate the reproducibility and quantification schemes used to assess L-R asymmetry of the phrenic nerves across animals:a) Some of the left-right traces do not incorporate all of the projection data, which may inflate the matches/discrepancies in the overlay of L vs R nerves. Showing sample variability would strengthen the rigor of the analyses.

b) The methods used to score the branching patterns of phrenic axons are not consistent. The red-green trace projections lack branches and details that are visible in the primary data images (e.g., the control nerves in with Figure 4G). It would be helpful to see more examples of the raw and "traced" data that were used to generate the data plots, as supplemental data. One suggestion for appreciating the stereotypy of projections of left and right nerves from embryo to embryo is to overlay the traces from multiple specimens. This would help readers assess the background level of deviation from nerve to nerve.

We fully understand these concerns. It is effectively a major point to make it clear to the referees and the readers that all our quantifications were done on immunolabeled diaphragms, and not based on the traces that we showed in the pictures. Indeed, the traces were thought to help the reader identifying the branches of interest and to better appreciate the general phrenic nerve pattern of the primary and secondary order branches that innervate the lateral muscles. We thought that simplified traces also nicely highlight the different angles by which left and right primary nerves split into dorsal and ventral branches (T and V shapes).

In the revised version, we rearranged the Figure 1 and its supplements to provide additional illustrations to clarify these points.

To better explain which branches were considered, we included an image of the color-coded traces of lateral and crural branches drawn from Neurofilament staining of wholemount diaphragm (Figure 1—figure supplement 1A). We also added an image describing the method used for quantification in Figure 1—figure supplement 1B.

To demonstrate the stereotypy of the left-right asymmetry that we measured, we incorporated in Figure 1D-E the histograms showing the average value measured for L and R phrenic nerves together with the SEM, which illustrates the variation observed between individual embryos for the 2 parameters measured. In addition, we added in Figure 1—figure supplement 3B a ladder graph showing the paired left and right values of the defasciculation distance for eight E14.5 embryos. As suggested, we now provide several examples of wholemount diaphragms labeled with neurofilament with their respective branch traces (Figure 1—figure supplement 3C). We hope this will better document the stereotypy of the asymmetry.

2) Mechanisms of how enrichment of the short isoform of Robo 1 specifies a different phrenic nerve pattern on the right side:

a) An important further inquiry, which could be done with the mice in hand, is to determine whether cleavage of Robo1 on the left vs. right populations of motor neurons altered in MMP2 mutants. This would bolster the conclusion that differential levels of MMP2 are crucial for setting the L-R differences in Robo1 processing. As they currently stand, the data connecting MMP2 to Robo1 is based solely on the MMP2 expression pattern and gain of function experiments, which are suggestive yet not definitive.

We fully understand the relevance of this concern and agree on the fact that we did not provide a direct link between Robo protein forms and MMP2. We worked in two directions to strengthen our conclusions. We first thought that a quite feasible way to document this link would be to show that manipulating endogenous MMP activity in the Left and Right motoneuron fraction impacts on Robo processing. To do so, we dissected cervical ventral spinal cord tissue enriched in phrenic motoneurons from HB9+ embryos. First Left and Right tissues were let for two hours in zymography buffer which preserves MMP activity and then processed for immunoblot to compare Robo protein forms. First, we found that the Right/Left ratio of Robo cleaved form was maintained during the incubation, further supporting that higher MMP activity in the Right population results in higher rate of Robo processing. Second, we inhibited endogenous MMP activity in the motoneuron tissues using GM6001. Under this condition, short forms of Robo1 are not anymore Right-enriched. We hope that these experiments further show that differential MMP activity can generate a different pattern of Robo processing in the left and in the right cervical motoneuron population.

The second direction, suggested by the referees, was to examine whether the L/R ratio of Robo processing is modified in MMP2 mutants. Although very pertinent, we anticipated that it would be highly challenging to provide significant conclusion, using western blot approach, which is the only way for distinguishing long and short Robo forms. First, the amplitude of the L/R difference is narrow. Second MMP mutants are reported to show high levels of compensation (Holmbeck et al., 2004; Kukreja et al., 2015) and we have observed during the analysis that levels of phrenic nerve symmetrization in MMP2 mutants is variable. Nevertheless, we conducted these experiments and crossed MMP2 and HB9+ lines to highlight the motoneuron population for our dissection procedure. Two independent littermates of 5 embryos each were analyzed and L/R ratio was reduced, compared to wild- types. This analysis thus provides additional support for linking MMP activity and Robo processing. We would like to stress that given the nature of the samples, it is necessary to pool a substantial number of embryos. Reaching statistical significance would mean replicating these experiments at least 10 times, which was not feasible during the revision timing and indeed incompatible with the fact that these experiments are performed on knockout tissue.

Nevertheless all together, we are convinced that these additional results strengthen our interpretation and hope they now provide convincing support for contribution of MMP2 to the differential processing of Robo1 in left and right motoneurons.

b) The authors should more directly state how they envision the signaling to work. Is asymmetry, as presented in the quantification, a reflection of left-right differences in branching and outgrowth? Robo1 has previously been implicating in branching/outgrowth. They might comment on how their results compare to data in "Biochemical purification of a mammalian slit protein as a positive regulator of sensory axon elongation and branching", Cell 96, 771-784 (1999). This study is in line with the descriptive observations in the present manuscript.

We agree that several properties have been assigned to Slits, which need to be considered in our interpretation of the Slit/Robo function in the setting of Left and Right phrenic innervation and are now discussed in the revised manuscript (Discussion section). Indeed, when reaching the diaphragm, the phrenic nerves undergo successive defasciculations, leading to the individualization of axonal bundles, referred to as “branches”. This term gives confusion because these bundles are not “branches per see” meaning produced by sprouting of novel axon from pre-existing one. In the terminal step of the innervation, individual axons undergo branching, but this is a stage that we did not investigate in our study, concentrating on the initial defasciculation processes. Therefore, we believe that the asymmetry of phrenic patterns reported here result from differential regulation of axon defasciculation and growth, rather than branching per se. This interpretation is coherent with the study by Jaworski and Tessier-Lavigne (Jaworski and Tessier-Lavigne, 2012), reporting that defasciculation is affected by loss of Slit-Robo function, both receptors and ligands being produced by the motoneurons themselves. The simplest mechanistic model would be that Slit-Robo interactions between phrenic axons promote fasciculation. This signaling is higher in the Left than in the Right population, due to higher Abl activity and lower Robo processing in the Left than in the Right. We do not exclude that the Slit-Robo signaling could also regulate other aspects, such as axon speed, orientation of growth in the target, and terminal branching, but studying these contributions were the main focus of the present study.

c). Comment on the fact that there seem to be no L-R Robo1 ligand differences.

We now introduced a section of discussion in our manuscript, in which we quote that an asymmetric signaling can be generated with equivalent initial levels of Slits.

3) One of the interesting aspects is analysis of differences in fasciculation and growth behavior of phrenic motor neurons; unfortunately, these data are relegated to Figure 3—figure supplement 1. The methods are given only in the Figure legend and not at all in the Methods for the Supplementary Figures but are quite unintelligible. The differences seem to be great, and although it is unclear whether Robo-Slit signaling would be involved in fasciculation as proposed by Jaworski and Tessier-Lavigne in their earlier study, these data are of interest given the L/R asymmetry issue and are therefore important data for the present study.

Additional information has been added in the method section, in a separate paragraph, so the reader can easily have access to our method of quantification.

Even if the data stay in Supplementary data, issues include: why do axons extend only from one aspect of the explant? In f. why was only one aspect of the explant measured for bundle width, and what is the genotype of the explant? Also statistical analysis is not well stated for this aspect of the study.

Our figure was unclear since it induced confusions. Indeed, quantifications have been made on the whole explants, without any bias of choices. The magnified panels showing only part of the explants were presented to more clearly illustrate the different fasciculation aspect, which was not visible in pictures of whole explants. We now clarified the figure legend and stated in the experimental procedure that measures were done all around the explants. The statistics have been inserted in the corresponding figure legend (and the transparent form).

4) There is a noticeable gap in connecting the very apt initial observations of changes in phrenic nerve asymmetry in Pitx2 and Rfx3 mutants to the later findings of changes in motor neuron expression of MMP2, Robo1 processing, etc. Assessment of changes in the L-R differences in MMP2 and Robo1 processing in Pitx2 and Rfx3 mutants would improve the cohesion of the studies. If MMP2/Robo1 processing are involved, there should be an equilibration of MMP2/Robo1 levels in left vs right phrenic motor neurons in Pitx2 and Rfx3 mutants.

Unfortunately, we have no access anymore to the Pitx2 colony. Fixed embryos were provided by our collaborator, Dr D. Martin, who did not maintain the colony in her lab. Nevertheless, to address this point, we concentrated on RFX3 mutant embryos. We had to consider several constraints. First, due to the partial penetrance of the phenotype, embryos must be considered individually. Second, we need to focus on MMP activity in motoneurons, excluding MMP activity in other populations of the ventral spinal cord, such as the progenitors that express it at high levels. This excludes the approaches of western blot and RTPCR because we cannot separate progenitors and motoneurons in the dissection procedure.

We therefore selected the technique of in situ zymography, that is very sensitive, in dissociated motoneuron cultures, that allow assessing MMP activity of motoneurons isolated from embryos that we previously identified as affected, based on their lung isomerism. The analysis demonstrated that L/R difference of MMP activity is gone in these embryos. These data have been inserted in Figure 5E.

These new data thus establish a link between early L/R specification and the molecular effectors of L/R asymmetry in phrenic motoneurons, which we hope meets the expectation of the referees.

[Editors' note: further revisions were requested, as described below.]

[…] The reviewers, Reviewing Editor, and Senior Editors agree that valuable observations are presented in the first part in Figures 1–4 – on patterns of branching, that asymmetry is controlled by Nodal signaling and seen in "intrinsic" differences in phrenic motoneurons, with the short isoform of Robo enriched on the right side to presumably control fasciculation differently than on the left. These are data well worth publishing and have merit even if the mechanistic aspect is unclear. Ordinarily, as with many of the other prominent journals, for the manuscript is to be acceptable, the authors would need to additionally provide mechanism. We understand that not all studies can end with a definitive mechanism. In repeated consultation with the reviewers, the Reviewing Editor, and the Senior Editor, we initially considered recommending that you either omit the experiments that are not substantiated by the statistical analyses, or describe the results as evidence that your hypothesis was not supported by the data. In either case, this would diminish the offering of the study for eLife, and we imagine would not be agreeable to you. Thus, the end, we have decided that the paper with its current components and incomplete outcome of analyses is not acceptable for publication in eLife. Instead, we encourage that you rethink the study with sufficient statistical power to ensure that you will have adequate sample size for a strong conclusion on L-R differences in Robo1 processing through MMP2, the proposed route through which L-R axon asymmetry could be achieved, either way.

Two major issues were raised by the referees: i) lack of statistical significance for the L/R difference in Robo forms observed in immunoblots of motoneuron-containing tissue, and ii) lack of statistical significance for the analysis of Robo processing by MMP2. We have addressed these concerns as follows.

i) Lack of statistical significance for the L/R difference in Robo forms observed in immunoblots of motoneuron-containing tissue.

The data presented in our prior manuscript were not statistically significant and therefore did not support our conclusion of a L/R difference in Robo forms in spinal cord motor neurons. We have now recognized that this was due to an inadequate method of analysis. To address this issue, and as recommended in the literature (Degasperi et al., 2014), we have now normalized the L/R data for comparison of L/R data between different western-blots and obtained statistical significance. The source data file provided with the new version of the manuscript contains the raw and normalized data. To consider that data obtained by immunoblotting may not follow the normal distribution assumption required for the t-test that is classically used (Kreutz et al., 2007), we also performed a Mann-Whitney test. Both tests yielded similar and significant p values (p= 0.016200 t-test; p=0.015873 Mann-Whithey). Thus, we believe that the statistical analysis of our data now supports the conclusion that Robo forms differ in left and right motoneuron-containing spinal cord tissue.

ii) Lack of statistical significance for the analysis of Robo processing by MMP2.

Even though MMP can process Robo (Seki et al., 2010), our analysis of Robo processing by MMP2 in spinal cord tissue did not reach statistical significance. This may have several reasons, including the likely possibility that MMP2 is not the only protease involved in generating left-right asymmetries of Robo forms in spinal cord tissue. Accordingly, our microarray analysis showed that the genes for 7 MMPs and 13 ADAMs metalloproteinases are expressed in left and right motoneuron-containing spinal cord tissue. This includes Adam10, whose homolog in Drosophila, Kusbanian, has been implicated in Robo processing (Coleman et al., 2010). Moreover, different MMPs can cleave the same protein (Kukreja et al., 2015; Prudova et al., 2010) and some of the short Robo form is preserved in MMP2 mutant tissue.

Finally, we had not previously explained the consideration that MMP2 has several known targets in addition to Robos (Dean and Overall, 2007), and several of these are also expressed by phrenic motoneurons and involved in their patterning, such as NCAM (Allan and Greer, 1998; Dean and Overall, 2007). Accordingly, the defect observed after MMP2 genetic deletion might affect alternative, or additional signaling pathways involved in axon guidance.

For this reason, we have revised our manuscript to present the findings on the Robo and MMP2 pathways in phrenic nerve left-right asymmetries independently from each other and only discussed a possible link. Accordingly, we have presented two examples of signaling pathways that contribute to the generation of left-right asymmetries in motor neurons. This revised format should better reflect the complexity of the signaling mechanisms underlying the establishment of left and right phrenic nerve patterns and whilst opening up the field to further investigation into the mechanisms underlying Robo processing (Blockus and Chédotal, 2016).

In summary, we have revised our manuscript substantially to underscore how a left-right genetic program initiated by Nodal sets into motion a complex signaling network that controls a range of events required for the stereotypic and asymmetric pattern diaphragm innervation.

List of major changes in the revised manuscript:

1) Improved statistical analysis of left and right differences in Robo forms detected by immunoblotting, including corresponding revision of the results and experimental procedures as well as data representation (Figure 5B).

2) Differences in the MMP and Robo pathways are now presented independently, and the wording that bridges the Robo and MMP2 studies has accordingly been modified.

3) The Discussion has been modified in several ways. Firstly, the paragraph on Slit/Robo signaling was changed to better discuss potential roles of Robo1 asymmetric processing. Secondly, a new section has been added to discuss the role of MMP2, including its several substrates, and to explain why MMP2 genetic loss is expected to lead to only a partial symmetrisation.

4) The analysis of ABL1 levels and Abl1 mutant phenotype has been removed, as ABL1 is not a mediator only of the Slit-Robo pathway, but operates downstream of several signaling receptors.

[Editors' note: further revisions were requested, as described below.]

The reviewers, both new, feel that your presentation in this third submission is much improved over the previous two versions, which they have viewed. The reviewers thought your findings on left-right asymmetry in phrenic nerve innervation of the mouse diaphragm are important, particularly the nodal-mediated signaling of the asymmetry, the anatomical differences in the fasciculation differences in vitro, and the molecular screen pinpointing MMP processing of the Robo receptor to effect the l-r differences. However, there are several issues that need to be addressed before acceptance, as outlined below and in the appended reviews:

In your last rebuttal and in the text, you explain two major amendments: First, you state that you addressed the lack of statistical significance in the L/R difference in Robo forms in immunoblots, and we acknowledge your efforts. However, one of the present reviewers criticized the western blot analysis with the new statistical test used (based on the Degaspari method) and considered the normalization strategy invalid. Upon normalizing the levels of the short band to the full length band, one would predict that if the short form derives from the long form, the levels of the long form would decrease and the short form would increase. Please comment.

We understand the concern of the referee. A normalization is obligatory to eliminate the experimental variability. Normalization to the full-length form is classically used for assessing protein processing (Gatto et al., 2014; Lin et al., 2008). Nevertheless, another option is to normalize to the tubulin. We obtained the same ratio when the normalization is done using the tubulin. Therefore, the variability of the long form between lines is mainly due to differences of loading. We thus kept in the principal figure the normalization on the protein of interest, and present the normalization to tubulin in the associated supplemental figure (Figure 5—figure supplement 1D).

More generally we agree with the referee that the short Robo forms might derive from the long Robo form. Nevertheless, we would like to highlight that such linear relationship between long and short forms cannot be deduced from western blot analysis. Indeed, it is not known whether the short and long forms have the same stability and half-life. Moreover, it is not known whether the Robo1 antibody recognizes with the same efficiency the long and the short forms.

Here are some additional elements on the western blot normalization. We normalized the lines within for each blot to take into account the variability of samples and deposition. This normalization enable comparison between left and right samples, but the normalized values vary between different Western blots for several reasons, which explains why a normalization between different blots is needed. First each western blot represents about 7 different embryos, individually dissected. This might generate some heterogeneity in the biological samples. Second, the re-use of antibodies and reagents to reveal the proteins might induce differences of band intensity between different western blots. Normalizing the western blots do not change the left-right ratio but allowed taking into account in the determination of the variability the heterogeneity between samples and reagents.

Second, your previous analysis of Robo processing by MMP2 in spinal cord tissue did not reach statistical significance. As with the previous reviewers, the present reviewers stressed that analyzing the mutants is a key experiment, and that it is crucial to your argument as such data would demonstrate a biochemical link between MMP2 activity and Robo1 receptor cleavage. Increasing the "n" would strengthen your case, but in a potentially "dangerous' direction, one of seeking the desired result and this route would be a lengthy as well.

You observed a partial symmetrization of the phrenic branches, with a right pattern that resembles the left pattern in control littermates in E14.5 Mmp2-/- embryos. But now you take the stance that the defect observed with MMP2 genetic deletion might affect alternative, or additional signaling pathways in axon guidance and that MMP2 may be one of several proteases, and thus chose to present the findings on the Robo and MMP2 pathways in phrenic nerve left-right asymmetries "independently" from each other, suggesting but not concluding that this relationship may be linked. While this does not solidify "mechanism", given the rounds of work you have done to improve the manuscript, we now feel that your revision is acceptable. However, we request that you acknowledge overtly that your attempts to demonstrate Robo1 processing in MMP2 mutants lacked significance, and shorten the text in the Discussion where you discuss multiple MMP2 targets and proteases.

We understand that the referees wish that we mention in the manuscript our attempt to link MMP2 and Robo1 and the lack of statistical significance of the data. We have now added in the Discussion a paragraph stating:

– First that incubation of cervical spinal cord tissue with active MMP2 significantly increased the short Robo1 forms (using the same normalization method as for assessing the left-right differences) (Supplementary File 1)

– And second that however, our analysis of Robo1 in cervical motoneuron tissue from Mmp2 mutants did not allow to detect a significant difference. (Supplementary File 2)

We also shortened our Discussion on the contribution of other protease pathways.

In addition to these two major points of contention by the various the reviewers, as often happens with re-review by a new set of reviewers, additional experiments were suggested. One suggestion is to determine whether the cleaved Robo1 receptors have any guidance or fasciculation function. Your explant system would be ideal to investigate how MMP2 mutant motor neurons respond to Slits compared to wild type neurons after bath application or by co-culture with Slit-expressing cells, an analysis that would strengthen your hypothesis and data on the asymmetric axon innervation patterns in vivo. However, this would also take time and hopefully could be the basis of "next-step" experiments.

We fully agree that investigating the functional properties of the balance of short and long Robo forms is an important step towards understanding the Slit-Robo signaling. Effectively this is tricky because MMP2 loss of function does not produce an optimal outcome on the balance. We have no entry point, neither from our own data nor from the literature, into how the Robo forms are produced and regulated, that would allow a straightforward investigation. This is also an additional reason for why this investigation certainly requires a fully dedicated investigation program.

https://doi.org/10.7554/eLife.18481.033

Article and author information

Author details

  1. Camille Charoy

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    CC, performed the experiments, analyzed the results and contributed to writing the manuscript
    Competing interests
    The authors declare that no competing interests exist.
  2. Sarah Dinvaut

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    SD, performed the experiments and analyzed the results
    Competing interests
    The authors declare that no competing interests exist.
  3. Yohan Chaix

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    YC, performed the experiments and analyzed the results
    Competing interests
    The authors declare that no competing interests exist.
  4. Laurette Morlé

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    LMor, provided embryos and provided information for protocols
    Competing interests
    The authors declare that no competing interests exist.
  5. Isabelle Sanyas

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    IS, performed the experiments and analyzed the results
    Competing interests
    The authors declare that no competing interests exist.
  6. Muriel Bozon

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    MB, performed the experiments and analyzed the results
    Competing interests
    The authors declare that no competing interests exist.
  7. Karine Kindbeiter

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    KK, performed the experiments and analyzed the results
    Competing interests
    The authors declare that no competing interests exist.
  8. Bénédicte Durand

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    BD, provided embryos and provided information for protocols
    Competing interests
    The authors declare that no competing interests exist.
  9. Jennifer M Skidmore

    1. Department of Pediatrics, University of Michigan Medical Center, Ann Arbor, United States
    2. Department of Communicable Diseases, University of Michigan Medical Center, Ann Arbor, United States
    Contribution
    JMS, provided embryos and provided information for protocols
    Competing interests
    The authors declare that no competing interests exist.
  10. Lies De Groef

    Animal Physiology and Neurobiology Section, Department of Biology, Laboratory of Neural Circuit Development and Regeneration, Leuven, Belgium
    Contribution
    LDG, provided embryos and information for protocols
    Competing interests
    The authors declare that no competing interests exist.
  11. Motoaki Seki

    Research Center for Advanced Science and Technology, University of Tokyo, Tokyo, Japan
    Contribution
    MS, provided antibodies and information for protocols
    Competing interests
    The authors declare that no competing interests exist.
  12. Lieve Moons

    Animal Physiology and Neurobiology Section, Department of Biology, Laboratory of Neural Circuit Development and Regeneration, Leuven, Belgium
    Contribution
    LMoo, provided embryos and information for protocols
    Competing interests
    The authors declare that no competing interests exist.
  13. Christiana Ruhrberg

    UCL Institute of Ophthalmology, University College London, London, United Kingdom
    Contribution
    CR, provided embryos and information for protocols and wrote the manuscript
    Competing interests
    The authors declare that no competing interests exist.
  14. James F Martin

    Baylor College of Medicine, Houston, United States
    Contribution
    JFM, provided embryos
    Competing interests
    The authors declare that no competing interests exist.
  15. Donna M Martin

    1. Department of Pediatrics, University of Michigan Medical Center, Ann Arbor, United States
    2. Department of Communicable Diseases, University of Michigan Medical Center, Ann Arbor, United States
    3. Department of Human Genetics, University of Michigan Medical Center, Ann Arbor, United States
    Contribution
    DMM, provided embryos, provided information for protocols and contributed to writing of the manuscript
    Competing interests
    The authors declare that no competing interests exist.
  16. Julien Falk

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    JF, performed the experiments, analyzed the results, designed the experimental plan and supervised the study and wrote the manuscript
    Contributed equally with
    Valerie Castellani
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon 0000-0001-8590-5615
  17. Valerie Castellani

    University of Lyon, Claude Bernard University Lyon 1, INMG UMR CNRS 5310, INSERM U1217, Lyon, France
    Contribution
    VC, designed the experimental plan, supervised the study and wrote the manuscript
    Contributed equally with
    Julien Falk
    For correspondence
    valerie.castellani@univ-lyon1.fr
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon 0000-0001-9623-9312

Funding

Fondation pour la Recherche Médicale (FDT20130928196)

  • Camille Charoy

International Brain Research Organization (Post-doctoral fellowship)

  • Camille Charoy

Labex (Labex Cortex and Labex DevWeCan, ANR-11-IDEX-0007)

  • Valerie Castellani

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We gratefully acknowledge L Schaeffer, M Carl and V Bertrand for helpful discussions and M Tata for proofreading the manuscript. We thank S Croze and C Rey (ProfileXpert, Lyon, France) for Microarray and qRT-PCR analyses. We thank A Huber (Neuherberg, Germany) for the Hb9::GFP mouse line and A Chédotal (Paris, France) and M Tessier-Lavigne (New-York, USA) for the Robo1/Robo2 mouse lines. This work was performed within the framework of the Labex CORTEX and Labex DevWeCAN of the Université de Lyon, within the program ‘Investissements d'Avenir’ (ANR-11-IDEX-0007) operated by the French National Research Agency (ANR). CC was funded by a doctoral fellowship from the Fondation pour la Recherche Médicale (FRM FDT20130928169) and a postdoctoral fellowship from the International Brain Research Organisation (IBRO). DMM was supported by R01 DC009410.

Ethics

Animal experimentation: This work was conducted in accordance with ethical rules of the European community and French ethical guidelines.

Reviewing Editor

  1. Carol A Mason, Columbia University, United States

Publication history

  1. Received: June 5, 2016
  2. Accepted: May 24, 2017
  3. Version of Record published: June 22, 2017 (version 1)

Copyright

© 2017, Charoy et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 721
    Page views
  • 157
    Downloads
  • 1
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Developmental Biology
    Neus Martínez-Abadías et al.
    Research Article
    1. Developmental Biology
    Joseph Pickering et al.
    Research Article Updated