1. Neuroscience
Download icon

YAP/TAZ initiate and maintain Schwann cell myelination

Research Article
  • Cited 23
  • Views 2,650
  • Annotations
Cite this article as: eLife 2017;6:e20982 doi: 10.7554/eLife.20982


Nuclear exclusion of the transcriptional regulators and potent oncoproteins, YAP/TAZ, is considered necessary for adult tissue homeostasis. Here we show that nuclear YAP/TAZ are essential regulators of peripheral nerve development and myelin maintenance. To proliferate, developing Schwann cells (SCs) require YAP/TAZ to enter S-phase and, without them, fail to generate sufficient SCs for timely axon sorting. To differentiate, SCs require YAP/TAZ to upregulate Krox20 and, without them, completely fail to myelinate, resulting in severe peripheral neuropathy. Remarkably, in adulthood, nuclear YAP/TAZ are selectively expressed by myelinating SCs, and conditional ablation results in severe peripheral demyelination and mouse death. YAP/TAZ regulate both developmental and adult myelination by driving TEAD1 to activate Krox20. Therefore, YAP/TAZ are crucial for SCs to myelinate developing nerve and to maintain myelinated nerve in adulthood. Our study also provides a new insight into the role of nuclear YAP/TAZ in homeostatic maintenance of an adult tissue.



Normal motor and sensory functions depend on myelination of peripheral axons by myelin-forming Schwann cells (ie., myelinating SCs; mSCs) that enables fast neural transmission. Failure to generate or maintain mSCs leads to life-threatening peripheral neuropathy and myelinopathy. Research over the last few decades has made great progress in identifying extra- and intracellular signals that drive SC differentiation and myelination during development, but mechanisms that maintain mSCs and myelination in adults remain unclear (recent reviews in Jessen et al., 2015; Salzer, 2015; Monk et al., 2015; Taveggia, 2016). Krox20 (also called Egr2) has been identified as the master transcription factor that drives myelin gene expression for both myelin formation and maintenance (Topilko et al., 1994; Decker et al., 2006). However, it remains unclear how extra- and intracellular signals regulate transcription of Krox20. A major gap in our knowledge concerns the nucleocytoplasmic mediator(s) that converge and deliver extra- and intracellular signals to the SC nucleus to drive Krox20. Although several transcription factors upstream of Krox20 have been identified, they either reside only in the nucleus or play uncertain roles in Krox20 regulation (Stolt and Wegner, 2016).

YAP (Yes-associated protein) and its paralogue, TAZ (Transcriptional coactivator with PDZ-binding motif), are Hippo pathway transcriptional co-activators and potent oncoproteins that shuttle between cytoplasm and nucleus (Hansen et al., 2015). When activated, YAP and TAZ (hereafter YAP/TAZ) translocate to the nucleus, where they potently induce cell proliferation. Because YAP/TAZ lack DNA binding domains, they act indirectly by binding partner transcription factors, particularly members of the TEA domain (TEAD) family (Zhao et al., 2008). Following phosphorylation by activated Hippo pathway, YAP/TAZ are inactivated through cytoplasmic retention and ubiquitin-mediated degradation. This nucleocytoplasmic shuttling of YAP/TAZ is critical for developmentally regulating cell proliferation that ensures normal tissue growth and organ size (Piccolo et al., 2014). YAP/TAZ shift to the cytoplasm concomitant with differentiation and the nuclear exclusion of YAP/TAZ is a requisite for adult tissue homeostasis (Varelas, 2014). Indeed, nuclear translocation of YAP/TAZ in differentiated adult cells is essential for cancer initiation or growth of most solid tumors (Harvey et al., 2013; Moroishi et al., 2015). Accordingly, YAP/TAZ are emerging as attractive targets for cancer therapies (Zanconato et al., 2016). YAP/TAZ also interact with other signaling pathways, including Wnt, Notch, GPCR, and mechanical signals (Yu et al., 2012; Azzolin et al., 2012; Rayon et al., 2014; Heallen et al., 2011). These findings suggest that nuclear YAP/TAZ have additional context-dependent functions besides their widely recognized role in promoting cellular proliferation and developmental differentiation.

Studies from three laboratories have recently implicated YAP/TAZ in myelination of developing peripheral nerve. Poitelon et al. showed that conditional knockout mice lacking YAP/TAZ in SCs are peripherally unmyelinated, as these SCs completely fail to sort out large-caliber axons. This is a pre-requisite step in developmental myelination known as radial or axon sorting. The authors observed no nuclear YAP/TAZ in cultured myelinating SCs, and modest, if any, regulation of Krox20 by YAP/TAZ (Poitelon et al., 2016). Two subsequent studies raised the possibility that YAP/TAZ may regulate myelination more directly: these reports showed upregulation of myelin genes, including Krox20, by TEAD1 (Lopez-Anido et al., 2016) or YAP (Fernando et al., 2016). In addition, Fernando et al. reported that viral inactivation of YAP in developing sciatic nerve reduces SC and myelin length, although myelin thickness remains unaltered (Fernando et al., 2016). How YAP/TAZ regulate developmental myelination is therefore unclear, and whether they also play a role in maintenance of myelination in adulthood is completely unknown.

In this report we first show that SCs lacking YAP/TAZ are in fact capable of sorting axons, but the process is extensively delayed and incomplete, largely due to defective SC proliferation. Sorted axons never became myelinated, however, apparently due to the failure of these SCs to upregulate Krox20 and differentiate into mSCs. We also show that adult mSCs, but not non-myelinating SCs, express nuclear YAP/TAZ, and that induced ablation of YAP/TAZ in adult SCs results in Krox20 downregulation, overt demyelination and, notably, mouse death. Lastly, we report that a YAP/TAZ-TEAD1 complex regulates both developmental and adult myelination, presumably through transcriptional regulation of Krox20. Our results clarify a developmental function of SC YAP/TAZ, and newly establish YAP/TAZ as essential regulators of both developmental and adult myelination in the peripheral nervous system. Our study also calls for caution in targeting YAP/TAZ for cancer therapy.


YAP and TAZ are expressed in proliferating, differentiating and mature myelinating Schwann cells

We began our study by testing a number of commercial antibodies for their specificity to YAP and its paralogue, TAZ. Using conditional knockout (cKO) mouse lines that selectively lack YAP, TAZ, or both YAP/TAZ in SCs, we identified an antibody that specifically recognized both YAP and TAZ (Figure 1—figure supplement 1A and B), and antibodies that bound to only YAP (Figure 1—figure supplement 1A and C). We also identified an antibody specific for phosphorylated YAP (p-YAP) preferentially present in cytoplasm (Figure 1—figure supplement 1A and D, and see also Figure 1B). During the antibody screening, we found that adult SCs expressed both YAP and TAZ, because YAP/TAZ immunoreactivity was eliminated in Yap/Taz double cKO (cDKO), but not in Yap or Taz single cKO (Figure 1—figure supplement 1B, see also Figure 2—figure supplement 1A and B).

Figure 1 with 1 supplement see all
YAP/TAZ are largely nuclear in proliferating, differentiating and mature myelinating SCs.

YAP/TAZ localization was investigated in sciatic nerve cryosections (A, B) or teased fibers (C, D). SC nuclei are marked by Sox10 (red) or DAPI (blue). (A) YAP/TAZ (green) are in SC nuclei throughout development, from E16.5 to P60. (B) YAP phosphorylated on Ser 112 (p-YAP, green) is largely absent from SC nuclei at P60. (C) Co-localization of YAP (green) in the nuclei of myelinating SCs marked by Krox20 (white) at P60. Arrows point to mSC nuclei that contain YAP and Krox20; arrowheads point to non-myelinating SC nuclei, which lack Krox20 and YAP. (D) YAP/TAZ (green) are present in the nucleus of a mSC, associated with a large axon, but is absent from the nucleus of a non-myelinating SC, marked by GFAP (red), at P60. Arrow points to myelinating SC nucleus; arrowhead points to non-myelinating SC nucleus. (E) Diagram summarizing the developmental stages in which YAP/TAZ are present or absent from the SC nucleus. The following figure supplements are available for Figure 1.


Using these antibodies and an antibody for Sox10, a specific marker of the SC nucleus, we confirmed that YAP/TAZ were strongly localized in the nuclei of immature SCs at E16.5 (Figure 1A and E), when SCs are actively proliferating and sorting out large axons (Jessen and Mirsky, 2005). Notably, YAP/TAZ continued to be expressed strongly in SC nuclei at P4, P18 and P60. YAP/TAZ have distinct functions when they are in the cytoplasm versus in the nucleus (Diepenbruck et al., 2014; Varelas, 2014): YAP/TAZ actively regulate transcription when they are localized to the nucleus. In contrast, when YAP/TAZ are phosphorylated and in the cytoplasm, they are presumed to be transcriptionally inactive. This result suggest, therefore, that YAP/TAZ act as transcriptional regulators not only in proliferating and differentiating SCs, but also surprisingly in fully mature SCs.

Immunostaining of transcriptionally inactive, phosphorylated-YAP (p-YAP) was largely cytoplasmic, as expected, indicating nucleocytoplasmic shuttling of YAP/TAZ in mature SCs (Figure 1B). Notably, not all postnatal SCs expressed YAP/TAZ: they were expressed by ~60% at P4 and ~75% at P60, approximately corresponding to the percentage of myelinating SCs (mSCs; Figure 2—figure supplement 1C). We therefore co-immunostained P60 teased sciatic nerve fibers for Sox10, Krox20 (to selectively label mSCs) and YAP. Strikingly, YAP was highly expressed in mSCs (Figure 1C; arrows), but virtually undetectable in Krox20-negative, non-myelinating SCs (Figure 1C; eg., arrowheads). We verified this result by co-immunostaining teased fibers for YAP/TAZ and for GFAP, which exclusively labels non-myelinating SCs (Figure 1D; Jessen et al., 1990) (Figure 1D). These results show that YAP/TAZ are actively regulating transcription in proliferating and differentiating SCs during development and then selectively in differentiated mSCs in the adulthood (Figure 1E). Selective expression of YAP/TAZ in mSCs raise the possibility that YAP/TAZ are directly involved in transcriptional regulation of SC differentiation and myelination.

YAP/TAZ are required for myelination of sorted axons

To investigate the roles of YAP/TAZ in developing SCs, we conditionally ablated YAP, TAZ or both selectively in SCs by breeding Yapfl/fl and Tazfl/fl mice (Xin et al., 2013) with mice carrying P0-Cre. P0-Cre is specifically active in SCs from E13.5, when SCs are at the precursor stage (Feltri et al., 1999). We also generated Yap cKO heterozygous for Taz (Yapfl/fl; Tazfl/+; P0-Cre, hereafter Yap-cKO/Taz-cHET) and Taz cKO heterozygous for Yap (Tazfl/fl; Yapfl/+; P0-Cre, hereafter Taz-cKO/Yap-cHET). Biochemical and immunohistochemical analysis of the Yap cKO, Taz cKO and Yap/Taz double cKO mice (hereafter Yap/Taz cDKO) showed efficient Cre-mediated deletion that was selective for SCs (Figure 2—figure supplement 1A and B). In our rigorous quantitative analysis, ~20% SC nuclei were YAP/TAZ+ in P20 cDKO sciatic nerves and the number was not increased at P60 (Figure 2—figure supplement 1C, and see below); notably, many of this 20% exhibited only faint or low immunoreactivity, RT-qPCR analysis of sciatic nerve RNA also showed marked reduction of Yap/Taz mRNA expression in cDKO mice (Figure 2—figure supplement 1D), though as expected, significant Yap/Taz mRNAs were still detected, most likely due to non-SCs which strongly expressed YAP/TAZ, such as perineurial cells, fibroblasts and presumably vascular cells (eg., asterisks in Figure 2—figure supplement 1B).

Consistent with a recent report (Poitelon et al., 2016), postnatal Yap/Taz cDKO developed severe peripheral neuropathy, whereas neither Yap nor Taz cKO showed an abnormal phenotype. As early as P7, cDKO mice began to develop tremor, splayed gait and hindlimb paralysis, which progressively worsened with age (data not shown). We examined Yap/Taz cDKO mice throughout adulthood, in contrast to Poitelon et al., who analyzed them up to P20 (Poitelon et al., 2016). By P60 both hindlimbs were completely paralyzed, and the forelimbs displayed obvious weakness (Figure 2A, Video 1). We euthanized cDKO mice for humane reasons at ~P90 and focused our initial study on P60 cDKO mice. Behavioral analyses of adult cDKO mice showed severely impaired motor and sensory function in forelimbs and hindlimbs (Figure 2—figure supplement 2). Sciatic nerves of P60 Yap/Taz cDKO were translucent due to virtually complete absence of myelin (Figure 2B), and compound muscle action potentials (CMAPs) were absent in footpad muscles. Much stronger stimulation elicited CMAPs only infrequently, and amplitudes were markedly delayed and dispersed (Figure 2C). Notably, spontaneous and irregular potentials occurred in P60 cDKO footpad muscles (Figure 2D). These spontaneous potentials are pathological and were likely generated by the abundant, abnormal extrasynaptic contacts in cDKO muscles that resulted from extensive intramuscular sprouting (for example, Figure 4—figure supplement 3B and C).

Figure 2 with 3 supplements see all
YAP/TAZ are required for myelination of sorted axons.

(A) Living control and Yap/Taz DKO mice, showing splayed paralyzed hindlimbs (arrows) and muscle wasting of P60 Yap/Taz cDKO mice. (B) Control sciatic nerve is white and opaque, while cDKO sciatic nerve is translucent. (C) CMAPs generated by stimulation of the sciatic nerve. (D) Spontaneously generated abnormal potentials in cDKO footpad muscles. (E1, E2) Low and high magnification views of longitudinal sections of WT and P60 cDKO sciatic nerves. Arrows denote mSCs exhibiting strong MBP and YAP/TAZ immunoreactivity. (E1) cDKO nerves rarely contain mSCs (arrows). mSCs are marked with MBP (red), and axons are marked with neurofilament (green). (E2) An example of an mSC (ie, MBP+) in P60 cDKO, which shows strong YAP/TAZ immunoreactivity (#1 SC; arrow). Note that adjacent SCs show low (#2 SC) or no YAP/TAZ immunoreactivity (#3–6 SCs), and they do not express MBP. (F) Left half panels: semi-thin transverse sciatic nerve sections showing mSCs in control but not in cDKO. Right half panels: TEM of transverse nerve sections showing myelination of large axons in control (upper panel), but many large axons arrested at the 1:1 promyelinating stage in cDKO. Lower panel: Inset of the same cDKO panel, showing two large axons surrounded by cDKO SCs arrested at the promyelinating stage. (G) Quantification of myelinating Schwann cells per field of view in WT and cDKO semi-thin sections. n = 3 mice per genotype. **p=0.0034, unpaired Student’s t-test. The following figure supplements are available for Figure 2.

Video 1
A movie showing a P60 Yap/Taz cDKO mouse.

Cellular analysis confirmed complete amyelination in P60 cDKO mice. In stark contrast to controls, myelin basic protein (MBP) was undetectable (Figure 2E1), except in the rare SCs which retained strong YAP/TAZ immunoreactivity (Figure 2E1 and E, arrows). Those SCs exhibiting low or faint YAP/TAZ immunoreactivity did not express MBP (for example, #2 SC in Figure 2E2). Semithin sections and electron microscopy provided additional evidence of the nearly complete absence of myelin (Figure 2F and G). Notably, however, although we frequently observed small bundles of unsorted axons, many axons were singled out by promyelinating SCs with thick basal lamina in P60 cDKO (Figure 2F and inset). Similarly, axons in forelimb nerves, dorsal roots and ventral roots in P60 cDKO exhibited complete amyelination, and frequently established a 1:1 relationship with promyelinating SCs (Figure 2—figure supplement 3D). We frequently observed small bundles of unsorted axons and occasionally large axon bundles (Figure 2—figure supplement 3E), but we did not observe polyaxonal myelination in which multiple axons were surrounded by a mSC (Figure 2—figure supplement 3D, arrows). These results demonstrate that SCs lacking YAP/TAZ arrest as promyelinating SCs (that is, fail to differentiate into mSCs), and are therefore unable to myelinate axons.

In contrast to Yap/Taz cDKO, myelination appeared completely normal in the sciatic nerves of P60 Yap cKO (Figure 2—figure supplement 3B) and nearly so in those of P60 Taz cKO, except for rare small bundles of unsorted axons (Figure 2—figure supplement 3C). Sciatic nerves of P60 Yap-cKO/Taz-cHET appeared fully myelinated, whereas those of P60 Taz-cKO/Yap-cHET exhibited large bundles of unsorted axons, in addition to normal and polyaxonal myelination (Figure 3B). These observations were consistent with the behavioral phenotypes of the mice. Yap-cKO/Taz-cHET mice appeared normal, whereas Taz-cKO/Yap-cHET showed mild tremor, wide gait and progressive paralysis in adulthood. Unlike P60 cDKO mice, however, Taz-cKO/Yap-cHET mice walked on their hindlimbs, and hindlimb paralysis never became complete (data not shown). These results show that YAP and TAZ are required for SC differentiation and myelination. They also suggest that YAP/TAZ are redundant in regulating SC differentiation and myelination, and that TAZ is the more potent regulator.

YAP/TAZ are required for timely axon sorting.

(A) Left nine panels: Semi-thin transverse sections of proximal control sciatic nerve and proximal and distal cDKO nerves at P4, P18 and P60. Right four panels: TEM of transverse cDKO nerve sections at P18 and P60. At P18, some immature SCs associate with unsorted axon bundles (left panel), but other SCs are promyelinating (right panel). At P60, many large axons are sorted but arrested at the 1:1 promyelinating stage (left and right panels, marked by large ‘a’), while small axons are fully surrounded by the cytoplasm of non-myelinating SCs in extended Remak bundles. s.n. = sciatic nerve; a = axon; SC = non-myelinating SC. (B) Transverse sections of Yap-cKO/Taz-cHET and Taz-cKO/Yap-cHET sciatic nerves at P18 and P60. Left-most two small panels: Semi-thin sections of Yap-cKO/Taz-cHET. Right-most four small panels: Semi-thin sections of Taz-cKO/Yap-cHET. Large panel: TEM of Taz-cKO/Yap-cHET, showing single large axons associated with SCs transiently arrested at the promyelinating stage. (C) Quantification of myelinating vs promyelinating Schwann cells in transverse semi-thin sections of WT vs Taz cKO/Yap cHET and Yap/Taz cDKO sciatic nerves at P18 and P60. n = 3 mice per genotype, except for WT P60 (n = 2). P value significance is shown in pale green for promyelinating Schwann cells and in dark green for myelinating Schwann cells. ***p<0.001, ****p<0.0001, n.s. = non-significant, 2-way ANOVA with Sidak’s multiple comparison test.


YAP/TAZ are required for timely axon sorting

Our observation of many sorted axons in P60 cDKO contradicts a recent report of a complete failure of radial sorting in Yap/Taz cDKO mice (Poitelon et al., 2016). This is an important issue because incomplete but extensive axon sorting would suggest direct regulation of SC myelination by YAP/TAZ, whereas the complete failure would suggest that regulation is indirect and consists of blocking radial sorting, a pre-requisite step in SC differentiation and myelination. We therefore analyzed developmental patterns of radial sorting and SC differentiation in Yap/Taz cDKO mice.

At P4, cDKO sciatic nerves contained large bundles of unsorted, mixed-caliber axons, whereas many axons were already sorted and myelinating in controls (Figure 3A,P4). At P18, when myelination appeared complete in control nerves, proximal nerves of cDKO contained many large bundles of unsorted axons (Figure 3A: P18 proximal). Notably, however, the unsorted axon bundles were appreciably smaller in distal nerves than in proximal nerves (Figure 3A,P18 distal), and axons 1:1 with promyelinating SCs were present (Figure 3A,P18 EM). At P60, many axons were sorted but remained unmyelinated in proximal and distal nerves of cDKO, although small bundles of unsorted axons were frequently observed (Figure 3A,P60; see also Figure 2—figure supplement 3E). We also observed small caliber axons fully surrounded by single non-myelinating SCs (Figure 3A; marked by ‘a’ and ‘SC’). These results show that radial sorting is not blocked in Yap/Taz cDKO mice, but that it proceeds abnormally and remarkably slowly.

The discrepancy between our and Poitelon et al.’s studies is likely due to the fact that Poitelon et al. examined Yap/Taz cDKO mice up to P20 (Poitelon et al., 2016), whereas we analyzed them more thoroughly up to P60. Several considerations excluded the possibility that delayed axon sorting in our cDKO mice was due to incomplete deletion of Yap/Taz. First, we used the same P0 Cre-driver line as Poitelon et al. and observed a major block in radial sorting at P18. Second, if an allele of Yap or Taz remained undeleted, these SCs would have differentiated to mSCs and myelinated axons by P18, as in control nerves. However, we found mSCs to be rare in P18 and P60 cDKO (for example, MBP+ and YAP/TAZ+ SCs in cDKO in Figure 2E2; Figure 3C). Third, not more than ~20% SCs in cDKO were immunopositive for YAP/TAZ at P60, which is too few to explain the incomplete but extensive radial sorting and virtually complete amyelination (see below). Fourth, most of these ~20% SCs were only weakly immunopositive at P4 and did not increase at P60, indicating that they failed to proliferate vigorously. Notably, whereas an allele of Taz was sufficient to complete myelination in P60 Yap-cKO/Taz-cHET (Figure 3B; leftmost panels), an allele of Yap was insufficient as evidenced by defective sorting and myelination in P60 Taz-cKO/Yap-cHET (Figure 3B). We therefore postulate that most of the weak Yap/Taz immunoreactivity in these ~20% SCs represents an undeleted allele of Yap or non-specific antibody binding.

We frequently observed promyelinating SCs that sorted but did not myelinate axons at P18 in Taz-cKO/Yap-cHET mice (Figure 3B and C). These promyelinating SCs differentiated into mSCs, myelinated axons and disappeared by P60 (Figure 3C). This transient block in progression from pro-myelination to myelination, in Taz-cKO/Yap-cHET, is additional evidence that YAP/TAZ directly regulate SC differentiation and myelination (independently of axon sorting).

YAP/TAZ are required for proper proliferation of immature Schwann cells

Timely axon sorting requires generation of sufficient SCs (Benninger et al., 2007; Grove et al., 2007). We therefore analyzed SC proliferation and apoptosis in sciatic nerves of developing Yap/Taz cDKO mice. From E17.5 to P60, numbers of Sox10+ SCs in cDKO were reduced to half or less of those in control mice (Figure 4A, Figure 4—figure supplement 1A and B), and Ki67+ proliferating SCs were substantially reduced at P0 (Figure 4B, Figure 4—figure supplement 1B). Proliferation was reduced in WT SCs at P4, as promyelinating SCs exited the cell cycle and began to myelinate, and was maintained at similar levels in P4 cDKO SCs, presumably due to residual YAP/TAZ in some cDKO SCs.

Figure 4 with 3 supplements see all
YAP/TAZ are required for proper proliferation of immature SCs.

(A) Quantitation of total SCs (Sox10+ nuclei) per transverse sciatic nerve section in WT and Yap/Taz cDKO mice. n = 3 mice per genotype. ***p<0.001, ****p<0.0001, n.s. = non-significant, 2-way ANOVA with Sidak’s multiple comparison test. (B) Percentage of proliferating SCs as determined by co-staining for Ki67 and Sox10. n = 3 mice per genotype. **p<0.01, n.s. = non-significant, 2-way ANOVA with Sidak’s multiple comparison test. (C) Quantitation of proliferating SCs in longitudinal sciatic nerve sections at E17.5 and P4, as determined by co-staining for EdU and Sox10. n = 3 (E17.5) or 2 (P4) mice per genotype. *p=0.0192, n.s. = non-significant, 2-way ANOVA with Sidak’s multiple comparison test. (D) Quantification of proliferation of SCs in cDKO sciatic nerves at P4; SC nuclei were separately binned as containing detectable YAP/TAZ (Sox10+; Y/T+) or no detectable YAP/TAZ (Sox10+; Y/T-), before counting the % of each subset that was EdU+. n = 2 mice per genotype. **p=0.0044, unpaired Student’s t-test. (E, F) Identification of proliferating SCs in longitudinal WT and cDKO sciatic nerve sections. SC nuclei are marked by Sox10 (green), proliferating cell nuclei by EdU incorporation (red), and total cell nuclei by DAPI (blue). (F, bottom insert panel) Identification of proliferating YAP/TAZ+ and YAP/TAZ- SCs at P4, showing examples of EdU+ (proliferating) SCs with no (#3) or weak (#1,#2) YAP/TAZ immunoreactivity. The following figure supplements are available for Figure 4.


To test this possibility and to investigate further the regulation of SC proliferation by YAP/TAZ, we pulse-labeled control and Yap/Taz cDKO mice with EdU at E17.5 and P4 to selectively label dividing SCs in S phase. At E17.5, when SC proliferation peaks with active axon sorting, only ~10% SCs were dividing in Yap/Taz cDKO, compared to ~30% SCs in control mice (Figure 4C and E), concomitant with the reduced SC numbers in cDKO sciatic nerves (Figure 4A). At P4, about the same number of SCs were EdU+, and therefore in S phase, in control and cDKO (Figure 4C); however, there was weak YAP/TAZ immunoreactivity (ie., residual Yap/Taz) in most of these cDKO EdU+ SCs (for example, Figure 4F, #1, #2). We found that less than 1% of SCs completely lacking YAP/TAZ were EdU+, whereas ~15% of SCs with residual YAP/TAZ were dividing (Figure 4D and F). Taken together with the recent finding that YAP regulates S-phase entry (Cabochette et al., 2015; Shen and Stanger, 2015), this result suggests that entrance of SCs into S-phase might be markedly restricted without YAP/TAZ. Collectively, these results show that YAP/TAZ are required for proper proliferation of immature SCs, and that the subsequent reduction in SCs resulted in the failure of timely axon sorting in cDKO.

Laminin receptors, such as integrin α6β1 and dystroglycan, regulate radial sorting, in part by controlling SC number and proliferation (Pellegatta et al., 2013; Berti et al., 2011; Yu et al., 2005). An earlier analysis attributed defective radial sorting in Yap/Taz cDKO largely to downregulation of laminin receptors (Poitelon et al., 2016). We therefore examined expression of laminin receptors in our cDKO mice, particularly at P60, and focused on integrin α6 because of its obvious downregulation (Poitelon et al., 2016). Our immunohistochemical analysis revealed no integrin α6 in SCs in P60 cDKO (Figure 4—figure supplement 2A). Western blotting and RT-qPCR analysis of cDKO sciatic nerves also showed markedly reduced protein and mRNA expression of integrin α6 (Figure 4—figure supplement 2B and C). This result therefore confirms the earlier report of Poitelon et al. that YAP/TAZ regulate the expression of integrin α6 and presumably other laminin receptors. This result also suggests that radial sorting proceeds, albeit abnormally and remarkably slowly, in the absence of laminin receptors.

Failure of generated SCs to survive could also account for the reduced number in Yap/Taz cDKO. Electron microscopy, caspase-3 and TUNEL assays of sciatic nerves taken from cDKO at P4, P18 and P60 did not reveal apoptotic SCs (data not shown). In addition, intramuscular axons and axon terminals showed no axonal degeneration and we observed no denervated muscle fibers at P55 in cDKO (n > 6 muscles, >400 NMJs, Figure 4—figure supplement 3). All pre-terminal axons were associated with SC processes (Figure 4—figure supplement 3B”, inset). Peri-synaptic terminal SCs, a type of non-myelinating SC, appeared normal and were tightly associated with axon terminals. The axon terminals of P55 Yap/Taz cDKO mice frequently extended nerve terminal and SC sprouts, and formed satellite extrasynaptic contacts (Figure 4—figure supplement 3B’, arrows), a normal response of axon terminals to muscle paralysis (Son and Thompson, 1995)

YAP/TAZ are required for Krox20 upregulation

Our findings thus far indicate that SCs lacking YAP/TAZ enter S-phase with difficulty and fail to proliferate in a timely fashion, markedly delaying radial sorting in Yap/Taz cDKO mice. These SCs gradually, albeit abnormally slowly, progress through axon sorting, but arrest at the promyelinating stage and fail to initiate myelination. Sequential expression of two core transcription factors is critical for promyelinating SCs to differentiate into mSCs: Oct6 (also known as Scip, Pou3f1) upregulates Krox20/Egr2 in promyelinating SCs and Krox20 upregulates myelin genes and feeds back to turn off Oct6 (Ghislain and Charnay, 2006). To investigate the mechanism by which SCs lacking YAP/TAZ arrest as promyelinating SCs, we examined expression of Oct6 and Krox20 in developing and adult cDKO SCs (Figure 5A–D). In control nerves, the number of Oct6+ SCs peaked at P4, and then sharply declined. In striking contrast, an abnormally high number of cDKO SCs expressed Oct6 from P0 to adulthood (Figure 5A and C). Notably, cDKO SCs failed to upregulate Krox20: in control mice, ~30% of SCs were Krox20+ at P0, increasing to ~70% from P18 onwards, whereas in cDKO, ~15% of SCs were Krox20+ throughout development and adulthood (Figure 5B and D). Western blotting of P4 and P60 cDKO sciatic nerves confirmed abnormal upregulation of Oct6, in parallel with concomitant reduction in YAP/TAZ expression (Figure 5E). As expected, Krox20 mRNA expression was also greatly reduced (Figure 5F). Together, these results suggest that YAP/TAZ initiate SC differentiation and myelination, presumably by upregulating Krox20 expression in promyelinating SCs.

YAP/TAZ are required for Krox20 upregulation in differentiating Schwann cells.

(A) Identification of Oct6+ SC nuclei at P4 and P60 in WT and Yap/Taz cDKO, as determined by co-staining for Oct6 (red), Sox10 (SC nuclei; green) and DAPI (all cell nuclei; blue). (B) Identification of Krox20+ SC nuclei at P4 and P60 in WT and Yap/Taz cDKO, as determined by co-staining for Krox20 (red), Sox10 (SC nuclei, green) and DAPI (all cell nuclei). (C) Quantification of Oct6 expression in SC nuclei. n = 4 mice per genotype (WT and cDKO P4) or n = 3 mice per genotype (WT and cDKO P0, (P18 and P60). **p<0.01 (P0), ***p<0.001, ****p<0.0001, 2-way ANOVA with Sidak’s multiple comparison test. (D) Quantification of Krox20 expression in SC nuclei. n = 3 mice per genotype (WT P0, WT P4, mutant P18) or n = 2 mice per genotype (mutant P0, mutant P4, WT P18, WT and mutant P60). ****p<0.0001, n.s. = non-significant, 2-way ANOVA, with Sidak’s multiple comparison test. (E) Western blotting of P4 and P60 WT and Yap/Taz cDKO sciatic nerve lysates, using the indicated antibodies and anti-βactin as a loading control. n = 3 experiments. (F) Quantitative RT-PCR using Krox20 and β-actin-specific primers and total RNA isolated from WT and Yap/Taz cDKO P60 sciatic nerves. Expression of Krox20 is normalized to that of β-actin as an internal control, and WT expression is arbitrarily given the value 1. n = 3 mice per genotype. **p<0.01, unpaired Student’s t-test.


YAP/TAZ are required for myelin maintenance: myelinopathy and animal death

To investigate the regulation of adult myelination by YAP/TAZ, we used a tamoxifen inducible Sox10-creERT2 driver line to inactivate Yap/Taz in SCs of adult mice. Yap/Taz inducible knockout mice (Sox10-creERT2; Yapfl/fl; Tazfl/fl, hereafter Yap/Taz iDKO) were indistinguishable from control mice prior to tamoxifen administration. Recombination was induced at 2–3 months of age; efficient SC-selective cre expression was confirmed using a TdTomato reporter allele (data not shown) and YAP/TAZ immunostaining in SCs (Figure 6D and F). Within two weeks of the first tamoxifen injection, Yap/Taz iDKO, but not control, mice displayed persistent shivering, ataxia, hunched posture, weight loss and rapid shallow breathing, which progressively worsened until death within the next two weeks (Figure 6A and B, Video 2, n > 8). To exclude cre-driver dependent effects on phenotypes including mouse death, we also generated an inducible Yap/Taz iDKO with a Plp1-creERT2 driver line, which had been used in numerous earlier studies of SC myelination (Leone et al., 2003). We found that adult Plp1-creERT2; Yapfl/fl; Tazfl/fl mice exhibited a similar phenotype (eg., Figure 6E) and died with respiratory failure within one month after the first tamoxifen injection. Electrical stimulation of iDKO sciatic nerves (Sox10-creERT2; Yapfl/fl; Tazfl/fl) between 2 to 3 weeks after the first tamoxifen injection elicited CMAPs with low and dispersed potentials. Nerve conduction velocity (NCV) in iDKO was ~16 m/s, which was markedly reduced from ~50 m/s in control mice (Figure 6C).

Figure 6 with 1 supplement see all
YAP/TAZ are required for myelin maintenance.

(A) Living eight week-old WT and Yap/Taz iDKO (Sox10-Cre-ERT2) mice 20 days post-first tamoxifen injection. Arrows indicate abnormal splayed gait. (B) Cartoon showing timeline of tamoxifen injection and time of sacrifice/ death of iDKO mice due to severity of symptoms. Purple dots: Sox10-creERT2; Yapfl/fl; Tazfl/fl; Orange dots: Plp1-creERT2; Yapfl/fl; Tazfl/fl iDKO mice. (C) Representative images of CMAPs generated in WT and iDKO mice. Right panel: Nerve conduction velocity, n = 3 mice per genotype. *p=0.0186, unpaired Student’s t-test. (D) Longitudinal cryosections of sciatic nerves of 11 week-old WT and iDKO (Sox10-Cre-ERT2) mice, 20 days after first tamoxifen injection, showing loss of YAP/TAZ (green) in iDKO but not WT SC nuclei, marked by Sox10 (red). All cell nuclei are marked by DAPI staining (blue). Asterisks mark lack of deletion of YAP/TAZ in non-SCs. n = 2 mice per genotype; two sections per mouse. (E) Transverse sciatic nerve (E1-3) and longitudinal ventral root (E4, E5) sections from 11 week old WT, iDKO (Sox10-Cre-ERT2; E2–E4) and iDKO (Plp1-Cre-ERT2; E5) mice, 20 days after first tamoxifen injection. (E1–E3) TEM of WT (E1) and iDKO (E2, E3) sciatic nerves. Axons with abnormal myelin profiles are marked with a yellow ‘a’; completely demyelinated axons are marked with a red ‘a’; myelin-laden macrophages are marked with a red ‘m’. n = 3 mice of each genotype. (E4–E5) Semi-thin ventral root sections, showing loss of myelin and loosened myelin sheaths in iDKO (Sox10-Cre-ERT2) and iDKO (Plp1-Cre-ERT2) mice. Demyelinated axons are marked by ‘a’ and myelin-filled macrophages are marked by ‘m’. Note the demyelinated internodes (marked by sets of ‘a’) contiguous with normally myelinated internodes. (F) Bar graph showing percentage of SCs immunopositive for YAP/TAZ 20 days after first tamoxifen injection, in WT and iDKO (Sox10-Cre-ERT2) sciatic nerve. (G) Quantification of demyelinating SC profiles 20 days after first tamoxifen injection, in transverse sections of WT and iDKO (Sox10-Cre-ERT2) sciatic nerve. n = 3 mice per genotype, ****p<0.0001, unpaired Student’s t-test. The following figure supplements are available for Figure 6.

Video 2
A movie showing an adult Yap/Taz iDKO and a control littermate mouse.

The iDKO mouse was recorded at 20 days after the first tamoxifen administration.


Electron microscopy of iDKO sciatic nerves revealed numerous demyelinating axons (Figure 6E2 and G): some were completely demyelinated (Figure 6E2 and E3; red ‘a’), others were undergoing demyelination and showed loosened or disorganized myelin sheaths (Figure 6E2 and E3; yellow ‘a’). Frequent myelin-laden macrophages were additional evidence of ongoing demyelination (Figure 6E; ‘m’). Longitudinal sections demonstrated an additional striking features of iDKO axons: segmental demyelination with adjacent myelinated or demyelinated internodes (Figure 6E4; demyelinated internodes marked by ‘a’). Non-myelinating SCs or Remak bundles were unaffected (data not shown), consistent with the absence of nuclear YAP/TAZ in non-myelinating SCs. These results show that YAP/TAZ are required for maintaining SC myelination in adult peripheral nerves.

Histological analysis of Plp1-creERT2 driven iDKO mice showed similar features of demyelination to Sox10-creERT2 iDKO (Figure 6: compare E4 to E5). We also examined the spinal cords and optic nerves of both Plp1-creERT2- and Sox10-creERT2 driven iDKO mice. Oligodendrocytes in adult WT mice did not express YAP/TAZ (Figure 6—figure supplement 1), and myelination in the optic nerves in both iDKO mice appeared normal (data not shown). Therefore, central demyelination cannot account for the iDKO phenotypes.

YAP/TAZ are required for mature Schwann cells to express Krox20

Next, we asked whether YAP/TAZ are required for Krox20 expression, as Krox20 is required for myelin maintenance (Decker et al., 2006). If so, then administration of tamoxifen should cause deletion of Yap/Taz and concomitant reduction of Krox20 in adult iDKO SCs. To test this possibility, we employed two separate assays because simultaneous immunostaining of Sox10, YAP/TAZ and Krox20 was not feasible. Notably, immunostaining of iDKO nerves revealed that many DAPI+ nuclei had only faint Krox20 immunoreactivity and, only occasional nuclei exhibited strong Krox20 immunoreactivity (Figure 7A, arrow). Moreover, YAP/TAZ were virtually undetectable in nuclei that stained weakly for Krox20 (Figure 7A, arrowheads). Lastly, Sox10+ SC nuclei in iDKO mice were frequently labeled faintly or not at all for Krox20 (Figure 7B, arrowheads; Figure 7C). These results suggest that YAP/TAZ maintain adult myelination of peripheral nerves, presumably by promoting Krox20 expression.

Inducible ablation of Yap/Taz in adult Schwann cells leads to rapid loss of Krox20.

(A, B) Immunostaining of longitudinal cryosections of sciatic nerves of WT and iDKO (Sox10-Cre-ERT2) mice 20 days after first tamoxifen injection. (A) Occasional nuclei, marked with DAPI (blue), exhibit YAP/ TAZ (green) and bright Krox20 (red) immunoreactivity (arrow), while most other nuclei show no YAP/TAZ and faint or no Krox20 immunoreactivity (arrowheads). (B) In iDKO sciatic nerves, occasional SC nuclei (Sox10+; green) contain bright Krox20 (red) immunoreactivity (arrow), but most SC nuclei exhibit faint or no Krox20 immunoreactivity (arrowheads). (C) Quantification of loss of Krox20 immunoreactivity in Schwann cell (Sox10+) nuclei 20 days after first tamoxifen injection. Both bright and faint immunoreactivity were counted as Krox20+. n = 3 mice per genotype, **p<0.01, Student’s unpaired t-test.


YAP/TAZ-TEAD1 upregulate Krox20 transcription in myelinating developing nerves

Next, we investigated whether YAP/TAZ regulate Krox20 transcription. During developmental myelination, transcription of Krox20 is mediated by its myelinating Schwann cell enhancer (MSE),~35 kb downstream of its coding region, which binds the transcriptional factors (TFs) Sox10, Oct6, NFAT3/4 and YY1 (Ghislain and Charnay, 2006; He et al., 2007; Kao et al., 2009; Reiprich et al., 2010). Because YAP/TAZ lack DNA binding domains, they act on DNA binding-TFs, most notably the TEAD family (Zhao et al., 2008). Interestingly, we identified four potential TEAD binding sites in the MSE (Figure 8A, Figure 8—figure supplement 1) (Diepenbruck et al., 2014). We therefore examined the possibility that YAP/TAZ may drive Krox20 transcription by activating TEADs or other known, MSE-binding TFs. To this end, we performed IP and ChIP-qPCR using P12-P15 and P70 sciatic nerves for developmental and adult myelination, respectively.

Figure 8 with 1 supplement see all
YAP/TAZ-TEAD1 regulate Krox20 transcription during developmental myelination and adult myelin maintenance.

(A) Schematic showing potential TEAD binding sites in the Krox20 MSE, in relation to published binding sites for known MSE-binding transcription factors. The regions of the MSE covered by primer sets E1-E6 used for ChIP-qPCR are indicated. (B, C1, C2) Immunoprecipitation of P12-P15 WT sciatic nerve lysates with anti-YAP/TAZ (B), anti-TEAD1 (C1), anti-YAP/TAZ, anti-TEAD1 and anti-TEAD3 (C2), plus control Rb IgG (B, C1, C2). Immunoprecipitates were blotted with the indicated antibodies. In (C2), upper blot was stripped and reprobed with anti-pan-TEAD (lower blot): the band in the Rb IgG lane, migrating similarly to TEAD proteins, is non-specific. n = 3 (B) or n = 2 (C1, C2) experiments. (D, E) ChIP-qPCR of P12-P15 sciatic nerves (D) or P70 sciatic nerves (E), using anti-TEAD1 antibody or control Rb IgG. Graphs show the amount of qPCR product obtained with the indicated MSE-specific primer sets or negative control primer sets after TEAD1 ChIP. Amounts are given as % of qPCR product obtained with the same primers using input chromatin. Amounts obtained with the same primer sets after control Rb IgG ChIP were all less than 0.003% of input, and are not shown. (D) n = 5 (E1, E2, E4, E6), n = 4 ((E5), n = 3 (β-actin), n = 2 (E3) independent ChIP assays. (E) n = 2 independent ChIP assays. P-values are given for TEAD1 ChIP versus Rb IgG ChIP for each primer set. ****p<0.0001, ***p=0.0001, *p=0.0498, n.s. = non-significant, 2- way ANOVA with Sidak’s multiple comparison test. Bar represents mean ± SEM. (F) Western blotting of sciatic nerve lysates from WT of P12 or P60 mice, showing persistent expression of TEAD1 and YAP/TAZ. (G) Immunostaining of longitudinal sections of WT sciatic nerves, showing that TEAD1 (green) is present in all nuclei (marked by Sox10, red) of proliferating and differentiated SCs. (H) Longitudinal nerve sections of P60 Yap/Taz cDKO, showing that TEAD1 (green) is present in all cDKO SC nuclei (marked by Sox10, red). The following figure supplements are available for Figure 8.


We first used western blots followed by immunoprecipitation with anti-YAP/TAZ antibody to study expression of these TFs in P12-P15 sciatic nerves (Figure 8B). Oct6 was undetectable, as expected (data not shown; Jessen and Mirsky, 2005; Svaren and Meijer, 2008). Sox10, YY1, NFAT3, NFAT4 and TEADs 1 and 4 were robustly expressed (Figure 8B and C1). Notably, only TEAD1 was detectable in YAP/TAZ immunoprecipitates (Figure 8B). The direct association of TEAD1 particularly with TAZ was confirmed by counter immunoprecipitation with anti-TEAD1 antibody (Figure 8C1). To investigate whether TEAD3 could be associated with YAP/TAZ, we immunoprecipitated with anti-TEAD1 and anti-TEAD3 and doubled the amount of the input. TEAD1 was present robustly in the immunoprecipitates, but TEAD3 was undetectable (Figure 8C2). Therefore, TEAD1 is a partner TF of TAZ for developmental myelination.

We then investigated binding of TEAD1 to the Krox20 MSE. We designed 6 MSE primer sets encompassing the potential TEAD1 binding sites (Figure 8A, Figure 8—figure supplement 1; E1–E6), and used them to carry out TEAD1 ChIP-qPCR on P12-15 sciatic nerves. To increase the specificity of our assay, we sonicated nerve lysates to produce chromatin fragments of 300–400 bp (data not shown). MSE regions encompassing primer sets E3, E4, and E5 showed strong association with TEAD1 (Figure 8D; >50 fold more binding than control). This region included two non-canonical TEAD binding sites and abundant binding sites for Sox10, Oct6, NFAT3/4 and YY1 (Figure 8A, Figure 8—figure supplement 1). These results suggest that YAP/TAZ-TEAD1 binds to Krox20 MSE, in order to upregulate Krox20 for SC differentiation and myelination, and are consistent with an earlier report (Lopez-Anido et al., 2016).

YAP/TAZ-TEAD1 continues to promote Krox20 transcription for myelin maintenance

Krox20 is also required for myelin maintenance (Decker et al., 2006), but whether the MSE is obligatory for Krox20 transcription in adult mSCs remains unknown (Glenn and Talbot, 2013). We therefore investigated whether TEAD1 is associated with the MSE in adult SCs. We sonicated P70 sciatic nerve lysates to generate chromatin fragments of 300–400 bp, and immunoprecipitated with anti-TEAD1 or control Rabbit IgG antibody. Purified chromatin was used for qPCR; primers were for regions E3, E4 and E5, as these regions were strongly positive for TEAD1 binding at P12–P15 (Figure 8D). In addition, we used a primer set encompassing a potential TEAD binding site in the Krox20 promoter, reasoning that TEAD1 may bind to the Krox20 promoter even if the MSE were inactive in adult SCs. Notably, TEAD1 specifically bound to regions encompassing E3, E4 and E5 (>50 fold enriched compared to control IgG), as well as the promoter region (>10 fold enriched). Similarly to P12, the E4 region bound strongly to TEAD1. In contrast to P12-P15, however, binding to the E5 region was much reduced (~20% of E4, compared to 100% of E4 at P12), suggesting differential regulation of the MSE in adult SCs (Figure 8E). These results are the first to demonstrate that the MSE is active in adult mSCs, and suggest that YAP/TAZ-TEAD1 continues to act on the MSE to drive Krox20 transcription for adult myelination.

Lastly, we investigated TEAD1 expression in SCs at various stages. TEAD1 was strongly expressed by proliferating, differentiating, and mature SCs (Figure 8F and G; P4 and P18 data not shown), suggesting that YAP/TAZ-TEAD1 drives SC proliferation, differentiation and maintenance. Non-myelinating SCs (data not shown) and cDKO SCs lacking YAP/TAZ (Figure 8H) also expressed TEAD1, suggesting that it is the presence or absence of YAP/TAZ which determines transcriptional regulation of Krox20 by TEAD1.


In this report we identify YAP/TAZ as essential regulators of SC proliferation and myelination. YAP/TAZ are required for 1) SC proliferation important for timely axon sorting, 2) SC differentiation critical for myelination, and 3) maintenance of differentiated myelinating SCs essential for myelin maintenance. Notably, transcriptionally active, nuclear YAP/TAZ have not been detected in fully differentiated cells in adult tissues, and nuclear exclusion (that is, cytoplasmic retention) of YAP/TAZ is widely regarded as requisite for maintaining homeostasis in differentiated cells and tissues (Piccolo et al., 2014; Varelas, 2014). It was therefore surprising to find that YAP/TAZ are selectively expressed in nuclei of myelinating SCs, and that eliminating them in adulthood evokes demyelination and is rapidly fatal. Our findings are the first to show that YAP/TAZ can be required for adult tissue homeostasis and suggest caution in targeting them for cancer therapy.

We found that proliferation of SCs lacking both YAP/TAZ was markedly inhibited due to repressed entry into S-phase. To match the number of SCs with that of large axons, radial sorting requires a sustained and timely increase in SC proliferation between E16.5 and ~P3 (Benninger et al., 2007; Grove et al., 2007; Webster et al., 1973). Yap/Taz cDKO, however, contained only 1/3 of the normal number of SCs at P4 (Figure 4A). This number gradually increased but remained substantially below normal. These data therefore strongly suggest that the markedly delayed radial sorting in cDKO mice was primarily due to the failure of SCs lacking YAP/TAZ to generate sufficient SCs at the appropriate time.

SCs lacking both YAP and TAZ were completely arrested at the promyelination stage, like SCs lacking Krox20 (Decker et al., 2006; Topilko et al., 1994). Furthermore, mRNA and protein levels of Krox20 were concomitantly reduced in SCs of Yap/Taz cDKO mice. These results suggest that YAP/TAZ directly regulate SC myelination primarily by activating transcription of Krox20. In addition, in our ChIP protocol, we increased specificity by preparing chromatin fragments ~300 bp. in length. This protocol allowed us to pinpoint binding of TEAD1 to specific Krox20 MSE regions. It also allowed us to show much stronger binding of TEAD1 to the MSE in developing SCs (>50 fold increase compared to control) than that recently reported in P15 rat sciatic nerves (Lopez-Anido et al., 2016). Our preliminary data also showed that YAP/TAZ bind to the same region of the MSE as TEAD1 (data not shown). Our evidence therefore strongly suggests that a YAP/TAZ-TEAD1 complex initiates SC differentiation and myelination by directly binding to the Krox20 MSE.

Perhaps the most exciting finding of the present study is that YAP/TAZ-TEAD1 mediate Krox20 transcription selectively in myelinating SCs. The mechanisms by which adult SCs maintain Krox20 transcription and thus myelination remain unclear (Salzer, 2015). It has been suggested that, once developmental myelination is completed, the Krox20 MSE becomes inactive, and regulation of TFs that maintain myelination, including Krox20, becomes cell-autonomous, presumably via a feedforward cascade that does not depend on extra- and intracellular signals (Ghislain et al., 2002; Glenn and Talbot, 2013; Salzer, 2015). Our findings, however, strongly imply that signals in adult mSCs regulate nucleocytoplasmic shuttling of YAP/TAZ to maintain activation of Krox20 via its MSE. The MSE region to which TEAD1 binds is enriched with binding sites for TFs, including Sox10, Oct6, NFAT3/4 and YY1 (Ghislain and Charnay, 2006; He et al., 2007; Kao et al., 2009; Reiprich et al., 2010). Although our assays indicated no direct interaction between YAP/TAZ and these factors, it is possible that YAP/TAZ-TEAD1 synergize with them by binding to the Mediator complex (Galli et al., 2015; Vogl et al., 2013). Notably, these TFs are expressed in oligodendrocytes as well as SCs (He et al., 2007; Hornig et al., 2013; Schreiber et al., 1997), whereas YAP/TAZ and Krox20 are exclusively expressed in myelinating SCs, consistent with a critical requirement for YAP/TAZ in Krox20 expression. It is also interesting that non-myelinating SCs and Yap/Taz cDKO SCs express TEAD1, despite absence of YAP/TAZ. TEADs can repress transcription in the absence of YAP/TAZ (Koontz et al., 2013; Zhang et al., 2014). It is conceivable, therefore, that TEAD1 actively represses Krox20 transcription in these SCs, consequently maintaining amyelination.

It is also possible that YAP/TAZ regulate myelination by additional pathways unrelated to Krox20. For example, YAP/TAZ might positively regulate Zeb2 transcription, which was recently shown to promote SC differentiation by inactivating repressors of differentiation (Quintes et al., 2016; Wu et al., 2016). Against this possibility, however, Zeb2 is downregulated when SCs initiate myelination and it is absent in adult SCs. Another possibility is that YAP/TAZ may activate the mTORC1 pathway to promote myelination (Kim et al., 2015; Norrmén et al., 2014). In light of the reports that YAP/TAZ are required for Dicer expression (Chaulk et al., 2014; Mori et al., 2014) and that Dicer ablation blocks SC differentiation (Pereira et al., 2010), it is also plausible that YAP/TAZ regulate myelination, at least in part, by regulating miRNA expression.

Yap/Taz iDKO mice died as early as 20 days after the first tamoxifen injection, which was unexpected because inducible deletion of neither Krox20 (Decker et al., 2006) nor Sox10 in SCs (Bremer et al., 2011) was lethal. Respiratory failure was the apparent cause of death, which coincided with progressively more shallow and rapid breathing. One speculative explanation is that YAP/TAZ have other transcriptional targets in iDKO mice and/or a cytoplasmic function in adult SCs (Piccolo et al., 2014; Varelas, 2014; Yu et al., 2015), which, when lost, increases the deficits of the iDKO. Alternatively, inducible ablation of YAP/TAZ in adult SCs might have been more successful than that of Krox20 or Sox10 (Figure 6F and, Decker et al., 2006, Bremer et al., 2011).

Our findings show that YAP/TAZ regulate not only proliferation but also differentiation of SCs, driving radial sorting, developmental myelination and myelin maintenance. Notably, YAP/TAZ are present in both nucleus and cytoplasm throughout the stages observed, suggesting that nuclear localization of YAP/TAZ is both inhibited and promoted and, therefore, both positive and negative regulators tightly control their transcriptional activity. In other cell types, Hippo-kinase pathway and F-actin cytoskeleton strongly regulate transcriptional activity of YAP/TAZ and their nucleocytoplasmic shuttling (Varelas, 2014). Cell stretching or stiff ECM promotes F-actin- or actomyosin-mediated nuclear entry of YAP/TAZ (Dupont, 2016). Similarly, in SCs in vitro, high ECM stiffness (to levels seen in adult sciatic nerve in vivo) or cell stretching, in combination with high concentrations of laminin, promotes nuclear localization of YAP/TAZ and SC differentiation (Poitelon et al., 2016; Urbanski et al., 2016). Therefore, actin polymerization or actomyosin contractility could conceivably promote transcriptional activity of YAP/TAZ that leads to SC differentiation and myelination. In contradiction to this idea, inhibition of actomyosin contractility promotes SC differentiation in vitro (Grove and Brophy, 2014; Leitman et al., 2011). In addition, our results show that YAP/TAZ are localized to the nucleus during radial sorting, when ECM stiffness and laminin concentration are low (Grove and Brophy, 2014; Urbanski et al., 2016). Therefore it is likely that additional pathways are also involved in YAP/TAZ regulation. An intriguing possibility is that YAP/TAZ are downstream of regulators of developmental myelination, including Neuregulin 1-type III, integrin α6β1, G-protein coupled receptor Gpr126 and Wnt (Feltri et al., 2002; Monk et al., 2011; Pereira et al., 2009; Petersen et al., 2015; Taveggia et al., 2005; Azzolin et al., 2014). Future efforts to identify the upstream and downstream mediators of YAP/TAZ are likely to generate important basic scientific insights and clinical applications.

Materials and methods

Animals and genotyping

Request a detailed protocol

All surgical procedures and animal maintenance complied with the National Institute of Health guidelines regarding the care and use of experimental animals and were approved by the Institutional Animal Care and Use Committee of Temple University, Philadelphia, PA, USA. All mice were of either sex, and were on the C57/Bl6 background. Generation of mice carrying targeted loxP sites in the Yap and Taz genes and the genotyping of these mice have been described previously (Xin et al., 2013) (MGI:5446483 and MGI:5544289). Targeted ablation of Yap and Taz in Schwann cells of embryonic mice was achieved by crossing Yapfl/fl, Tazfl/fl or Yapfl/fl; Tazfl/fl mice with mice heterozygous for Yap and/ or Taz and transgenic for Cre driven by the P0 promoter (Feltri et al., 1999) (MGI:2450448). Targeted ablation of Yap and Taz in Schwann cells of adult mice was by doing the above crosses of Yapfl/fl and Tazfl/fl mice with mice transgenic for the inducible Cre recombinase Cre-ERT2 under control of either the Plp1 promoter (Pereira et al., 2009) (MGI:2663093) or the Sox10 promoter. The Sox10-CreERT2 BAC Tg mice were generated with the homologous recombination method (Yang et al., 1997) (MGI:5634390) by Dr. Shin Kang at Temple University. Control mice contained floxed Yap and/or Taz alleles but were not transgenic for Cre. Genotyping of Plp1-CreERT2 mice used Plp1-Cre primers (Pereira et al., 2009) and of Sox10-CreERT2 mice used the following primers: CACCTAGGGTCTGGCATGTG and ATCGCGAACATCTTCAGG.

Tamoxifen administration

Request a detailed protocol

Tamoxifen or 4-hydroxy tamoxifen (4-HT; Sigma, St. Louis, MO) was injected into 6–8 week old iDKO mice. Tamoxifen was prepared and injected intraperitoneally (i.p.) at 0.2 mg/g body weight/d, as described (Grove and Brophy, 2014). A 20 mg/ ml stock of 4-hydroxy tamoxifen (4-HT) in 100% ethanol was prepared by sonication, and a 1 mg aliquot mixed 1:5 with sunflower oil. After evaporation of the ethanol by speedvac, 1 mg of 4-HT in sunflower oil was injected i.p. twice daily for three days, followed by once daily for two days. Five days later, mice were injected i.p. once daily for five consecutive days.

Western blotting and immunoprecipitation

Request a detailed protocol

For Western blotting and immunoprecipitation, epineurium and perineurium were removed from sciatic nerves, which were then snap-frozen in liquid nitrogen and stored at −80°C. For Western blotting, sciatic nerves were lysed in RIPA buffer (25 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 1 mM EDTA, 0.1% SDS), and for immunoprecipitation, lysis was in co-IP buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.5% Triton X-100, 10% glycerol, 1 mM EDTA), both containing protease and phosphatase inhibitors. Lysis was for 40 min on ice, followed by microcentrifugation at 14,000 rpm for 20 min. Protein concentration was determined using the BCA assay (Thermo Fisher, Waltham, MA).

Immunoprecipitation was overnight at 4°C, followed by 1 hr with protein A sepharose (pre-blocked with 1% BSA), both with constant rotation. Lysates and immunoprecipitated complexes in 1x Laemmli buffer were resolved on 8 or 10% SDS-PAGE gels, transferred to nitrocellulose and blotted with the appropriate antibodies. Primary antibodies were used at the following concentrations for Western blots or (if indicated) immunoprecipitations: rabbit anti-Krox20 (Covance, San Diego, CA; 1:400), rabbit anti-Oct6 (Abcam, United Kingdom, ab126746; 1:1000), mouse anti-Myelin Basic Protein (Covance SMI94; 1:1000), mouse anti-beta actin (SIGMA-Aldrich A5441; 1:5000), rabbit anti-Sox10 (Abcam ab155279; 1:20,000), rabbit anti-TEAD1 (Cell Signaling, Danvers, MA, D9 × 2L, #12292; 1:1000; 1:100 for immunoprecipitation), rabbit anti-TEAD3 (Cell Signaling #13224; 1:1000; 1:100 for immunoprecipitation), rabbit anti-pan-TEAD (Cell Signaling D3F7L, #13295; 1:1000; 1:100 for immunoprecipitation), rabbit anti-YAP/TAZ (Cell Signaling D24E4, #8418; 1:1000), rabbit anti-phospho-YAP (Cell Signaling D9W2I #13008; 1:1000), mouse anti-YAP1 (Abcam ab56701; 1: 400), rabbit anti-NFAT3 (Cell Signaling 23E6, #2183; 1:1000), rabbit anti-NFAT4 (Cell Signaling #4998; 1:1000), rabbit anti-YY1 (Abcam ab12132; 1:500). Control whole rabbit IgG for immunoprecipitations was from Jackson Laboratories (Bar Harbor, ME, 011-000-003) and was used at 1 μg/ml, which was several-fold excess over all antibodies used for immunoprecipitations. Secondary antibodies for Westerns were HRP-linked sheep anti-mouse IgG and donkey anti-rabbit (both GE Healthcare, United Kingdom; 1:5000) and HRP-linked mouse anti-rabbit, light-chain specific (Jackson ImmunoResearch, West Grove, PA, 211-032-171; 1:20,000). Blots were developed using ECL, ECL Plus (GE Healthcare) or Odyssey (LiCor).

Immunohistochemistry, confocal and widefield fluorescence microscopy

Request a detailed protocol

For immunostaining, sciatic nerves were removed and immediately fixed in 4% paraformaldehyde (Pfa)/phosphate buffer for 1 hr. The method for preparation of 7 μm cryosections, and for immunostaining of longitudinal and transverse sciatic nerve sections was as previously described (Grove et al., 2007), except that blocking was in 2% BSA/ PBS rather than fish gelatin. For teased fiber preparation, epineurium was removed from fixed sciatic nerves, before teasing of fibers as described (Sherman et al., 2012). For whole mount immunostaining of extensor digitorum longus (EDL) and soleus muscles, mice were perfused with 4% Pfa/ PBS, muscle removed, then post-fixed for 20 mins at room temperature. Processing and immunostaining of muscle fibers was as previously described (Son and Thompson, 1995). Axons and nerve terminals were labeled with anti-neurofilament and anti-SV2, respectively, while Schwann cells in muscles were labeled with anti-S100 plus anti-p75, in order to detect both intact and denervated Schwann cells. Acetylcholine receptors in muscle were detected using Alexa 647-conjugated a-bungaratoxin (Molecular Probes, Eugene, OR, B35450).

Schwann cells in sciatic nerve cryosections and teased fibers were identified by immunostaining with anti-Sox10. For comparison of total Schwann cell numbers (that is, total Sox10+ nuclei) in sciatic nerves of different genotypes, transverse sections were taken from proximal-, mid- and distal regions of the tibial nerve (three sections per region; nine total), and average Schwann cell number per cross-section was calculated. For calculation of the fraction of Schwann cells expressing a particular protein, longitudinal sections were used, and the fraction of Sox10+ cells expressing that protein was averaged over three sections.

Primary antibodies were used at the following concentrations for immunostaining of cryosections: guinea pig anti-Sox10 (kind gift from Michael Wegner, University of Erlangen, Bavaria, Germany; 1:1000), rabbit anti-Krox20 (Covance; 1:400), rabbit anti-Oct6 (Abcam ab31766; 1:800), rabbit anti-Ki67 (Novocastra NCL-Ki67p; 1:200), rabbit anti-Neurofilament 200 (SIGMA-Aldrich N4142; 1:500), mouse anti-Neurofilament (Covance SMI 312; 1:1000), mouse anti-SV2 (Developmental Studies Hybridoma Bank, Iowa; 1:10), rabbit anti-S100 (DAKO; 1:600), mouse anti-Myelin Basic Protein (Covance SMI 94; 1:2000), goat anti-p75 (Neuromics, Minneapolis, MN, GT15057; 1:500), rabbit anti-TEAD1 (Cell Signaling D9 × 2L, #12292; 1:200), rabbit anti-pan-TEAD (Cell Signaling D3F7L, #13295; 1:200), rabbit anti-YAP/TAZ (Cell Signaling D24E4, #8418; 1:200), rabbit anti-phospho-YAP (Cell Signaling D9W2I #13008; 1:200), mouse anti-YAP1 (Abcam ab56701; 1: 200), mouse anti-GFAP (SIGMA-Aldrich G3893; 1:500), rabbit anti-cleaved caspase 3 (Cell Signaling #9661; 1:400), anti-CC1. Conventional fluorescence microscopy was performed using Olympus BX53 and Zeiss Axio Imager two microscopes. Images were captured using Hamamatsu ORCA R2 C10600 or Zeiss Axiocam HRm Rev three digital cameras, respectively, and Metamorph software. For confocal microscopy, we used a Leica SP8 confocal microscope, with either a 40 × 1.3 NA or 63 × 1.4 NA objective and Leica proprietary software. Acquired stacks were assembled using the maximum projection tool, and figures were prepared using Adobe Photoshop.

Electron microscopy, histology and morphometry

Request a detailed protocol

Mice were perfused intravascularly with 2.5% glutaraldehyde and 4% paraformaldehyde in 0.1M cacodylate buffer pH 7.4. Sciatic nerves and nerve roots were removed and incubated in the same buffer for 90 min at room temperature then overnight at 4°C, with rotation. Specimens were post-fixed for 1 hr with OsO4, dehydrated then embedded in araldite. Semi-thin (0.5 μm) and ultrathin (70 nm) section were cut using an ultramicrotome, and stained with toluidine blue or uranyl acetate and lead citrate, respectively. Semi-thin sections were examined using bright-field on an Olympus BX53 microscope, and images captured using Hamamatsu ORCA R2 C10600 digital camera and Metamorph software.

For analysis of the number of myelin profiles in control vs mutant sciatic nerves, semi-thin sections from proximal-, mid- and distal regions of the sciatic nerve were taken, and two non- overlapping images of each section were taken using the 60x objective: these images were termed ‘field of view’ (FOV). The average number of myelin profiles in each FOV was calculated, using ImageJ software. For electron microscopy, stained ultrathin sections were examined using a JEOL 1010 electron microscope fitted with a Hamamatsu digital camera and AMT Advantage image capture software.

TUNEL and proliferation assays

Request a detailed protocol

The percentage of Schwann cells in S-phase at E17.5 and P4 was measured by EdU incorporation. Timed pregnant females and P4 pups were respectively injected intraperitoneally and subcutaneously with 80 μg/ g body weight of EdU dissolved in PBS. Eighty minutes later, E17.5 embryos and P4 pups were sacrificed, and sciatic nerves removed and fixed for 1 hr in 4% Pfa; longitudinal 7 μm cryosections were used for analysis. EdU incorporation was identified using the Click-iT EdU Alexa Fluor 555 labeling kit (Molecular Probes); the recommended protocol was followed, and labeling was for 1 hr. After EdU labeling, sections were immunostained with anti-Sox10 to identify Schwann cells (notably, many proliferating cells in the sciatic nerves were not Schwann cells). The percentage of Schwann cells (Sox10+ nuclei) that were EdU+ was determined by counting of confocal images using ImageJ software. The Promega Deadend TUNEL assay kit was used to investigate Schwann cell apoptosis in longitudinal and transverse 7 μm cryosections. The recommended protocol was followed, with the following modification: after rehydration in PBS, sections were treated with L.A.B. retrieval solution for 5 min (Polysciences, Inc 24310–500), then washed 3x in PBS, prior to permeabilization in 0.2% Triton-X-100 for 10’, as per the recommended protocol. As a positive control, sections were treated with 7.5 U/ml DNase1 for 10’ prior to the TUNEL assay; as a negative control, TdT enzyme was omitted from the assay. After the TUNEL assay, sections were immunostained with anti-Sox10 to identify Schwann cells, and TUNEL+ Schwann cells in confocal images were counted using ImageJ software.

Real-time quantitative RT-PCR

Request a detailed protocol

Sciatic nerves were removed from P60 control and cDKO mice, and total RNA extracted using an RNeasy Lipid Tissue Mini Kit (Qiagen). RT-qPCR was performed using the Power SYBR Green RNA-to-CT one-step kit (Applied Biosystems), specific primers, plus 20 ng RNA per reaction. β-actin was used as an endogenous reference gene, and relative expression of Krox20 in control and cDKO samples was calculated according to the Comparative Ct method (Livak and Schmittgen, 2001), using StepOne Software (V 2.3). Primer sets used were as follows: 5’-AGGCCCCTTTGACCAGATGA-3’ and 5’-AAGATGCCCGCACTCACAAT-3’ for Krox20 (Bremer et al., 2011); 5’-CTCCCCGAAGTTCTTCCCAT-3’ and 5’TAAGGTTGCTGTTACAGACATTG-3’ for ITGA6; 5’-ACCCTAAGGCCAACCGTGA-3’ and 5’-ATGGCGTGAGGGAGAGCATA-3’ for β-actin; 5’-GACATCTTCTGGTCAAAGATACTTC-3’ and 5’-GCAGGAACGTTCAGTTGCG-3’ for Yap; 5’-GTCCATCACTTCCACCTCGG-3’ and 5’-CGACTTGCTGGTGTTGGTGA-3’ for Taz. Samples were run in triplicate, and experiments performed three times.

ChIP assay

Request a detailed protocol

ChIP assays were done using eight sciatic nerves from P12-P15 wild-type mice per immunoprecipitation, using a modified version of a published protocol (Pal et al., 2004). Sciatic nerves were collected in PBS on ice. The PBS was replaced by PBS/1% formaldehyde containing protease inhibitors, and nerves were rapidly diced using scissors. Nerves were crosslinked for 10’ with rotation at room temperature, washed with PBS/0.15M glycine for 5’ with rotation at room temperature, then washed 3x with ice-cold PBS. Nerves were lysed using ChIP lysis buffer (50 mM Tris pH 8.1, 100 mM NaCl, 5 mM EDTA, 0.5% SDS plus protease inhibitors) for 30’ at 4°C, then pelleted by microfugation at 14K for 15’. Supernatant was removed, and pellets were resuspended in 1 ml of ChIP IP buffer (50 mM Tris pH 8.6, 0.3% SDS, 1.7% Triton X-100, 5 mM EDTA plus protease inhibitors). Chromatin was sheared in an ice water bath by sonication using a Fisher Scientific FB120 sonic dismembrator set at 75% amplitude, with 10 cycles of 10’’ on/50” off. After shearing, chromatin was clarified by microcentrifugation at 14K for 20 min, snap-frozen in liquid nitrogen and stored at −80°C. 1 ml aliquots of chromatin were pre-cleared using pre-blocked PAS (Millipore 16–157), then 50 μl removed and stored as ‘input’ chromatin. The remaining chromatin was immunoprecipitated overnight with 0.4 μg rabbit anti-TEAD1 (Cell Signaling #12292), 4 μg rabbit anti-TAZ (Cell Signaling #4883) and 0.5 μg or 5 μg of whole rabbit IgG, respectively (Jackson Laboratories 011-000-003). Immune complexes were collected using pre-blocked PAS (for 2 hr, then washed x2 sequentially with: low salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris pH 8.0); high salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl, 20 mM Tris pH 8.0); LiCl buffer (1% NP40, 1% Na deoxycholate, 1 mM EDTA, 250 mM LiCl, 10 mM Tris pH 8.0); TE (10 mM Tris, 1 mM EDTA, pH 8.0), all containing protease inhibitors. After the final TE wash, chromatin was eluted from the beads 2x for 20’ with gentle vortexing in 150 μl Elution buffer (1% SDS, 0.1M NaHC03) at room temperature. 0.2M NaCl was added, and chromatin de-crosslinked overnight at 65°C. Samples were treated with RNase A (0.3 mg/ml) at 37°C for 1 hr, then proteinase K (0.6 mg/ml) at 55°C for 1 hr, before purification of immunoprecipitated chromatin using QIAquick columns (Qiagen). Chromatin was eluted in 25 μl 10 mM Tris pH 8.0, and stored at −20°C. qPCR reactions were in 10 μl, using Power SYBR green PCR mastermix (Applied Biosystems # 4367659), 4 μl of sample (1:80 dilution of input and 1:20 dilution of IPs) and the following primers: Krox20 MSE: E1 forward: CCTCTCCGGGGTTGGACTA; E1 reverse: GGGCCACCCACAGTTACCTT; E2 forward: GGCCCTCCATTTATTTCCCTG; E2 reverse: TGCTGGAAACGAAACAACAAACT; E3 forward: TGTGACAAACCCATCTCGCA; E3 reverse: TCAGCTTTGTGAAGGGCTCA; E4 forward: CGGACTTGCATTGCACAGAA; E4 reverse: CCCGTACATCCACTCACACA; E5 forward: CCTTCACAAAGCTGAAATCCTG; E5 reverse: CATTTCGTCTTTGGGCTCAT; E6 forward: CATGGTTAGGAGGAACAAACTG; E6 reverse: CTATCTCAACCTGCCAATCCA. Negative Controls: Miro1 forward 1: GCAATTTCTTGGGCTGTGATATAG; Miro1 reverse 1: GCTCTTAGAGGCACTTTGGAT; β-actin forward: GGCTGTATTCCCCTCCATCG; β-actin reverse: CGTCCCAGTTGGTAACAATGCC; MBP forward 1: TCTGAGCAAATGCTTCTAAGCTG; MBP reverse 1: CTAGAGCAGAAAGTGAGCTTCC.


Request a detailed protocol

The procedure for measuring nerve conduction velocity was an adaption of a previously used protocol (Schulz et al., 2014). Mice were deeply anaesthetized, and hair completely removed from the hindquarters. A 27g percutaneous needle electrode was inserted subcutaneously over the femur to stimulate the sciatic nerve at two locations: one proximal to the spinal cord, at the hip joint, and the other 1 cm distal to this site. The stimulation reference electrode (26G percutaneous needle) was inserted over the back. Bipolar EMG electrodes were inserted subcutaneously in the digital interosseous muscles, to record compound action potentials in response to activation of the sciatic nerve. Stimulation and recording were conducted on both hindlimbs. The muscle response was first tested with single pulses (100 μs duration) to determine the threshold and level of activation producing a stable compound action potential in the muscle. The level of stimulation which produced stable responses was then used for two series of stimulations with 2–20 s long trains of biphasic square wave pulses (100 μs duration) delivered at 1–5 Hz. The nerve was rested for 2 min between runs. Stimulation was delivered via an isolated pulse stimulator (A-M Systems Model 2100, A-M Systems Inc, Carlsborg, WA). EMG compound muscle action potential (CMAP) responses were recorded with a differential AC amplifier (A-M Systems Model 1700; gain 1 k– 10 k; pass band 10–50 KHz). Data was sampled at 50 KHz using LabVIEW (National Instruments Corporation, Austin, TX) running on a personal computer. Multiple recordings were taken at each location to ensure a minimum of 10 quality responses for each location and animal. Electrophysiological data was analyzed using Igor Pro (Wavemetrics Inc, Lake Oswego, OR).

Behavioral tests

Request a detailed protocol

Foot printing gait analysis: Mouse paws were dipped in non-toxic water-based paints: forepaws: pink; hindpaws: blue. Mice were then allowed to walk along an 80 cm x 10 cm white paper runway. Grip strength test: Mice were allowed to grip the grid of a BIO-GS3 grip strength testing device (Biosep, France), using both fore- and hindpaws, then were gently pulled by the tail, parallel to the grid. The maximum force prior to the release of all of the mouse’s paws from the grid was recorded. This was repeated with forepaws alone, and grip strength of hindpaws was calculated by subtraction of the forepaw measurement from the total grip strength measurement. The apparatus was cleaned using alcohol between trials. Temperature preference/ aversion test: Two-choice temperature preference/ aversion assays were used to determine hot and cold thermal thresholds, using methods essentially, as described (Fisher et al., 2015). Briefly, mice were placed in a Plexiglass chamber containing a reference plate fixed at 25°C plus an adjacent variable temperature test plate (Bio-T2CT, BioSeb, France). Mice were allowed to habituate to the chamber for 3 min with both plates at 25°C, then the test plate temperature was increased to 49°C or decreased to 10°C in 3°C increments, at 3 min intervals. Movement of mice between reference and test plates was recorded using a video tracking system, and percentage of time at each temperature calculated. Preference/ aversion to cold vs hot temperatures was assayed on separate days.

Data analysis

Request a detailed protocol

In each experiment, data collection and analysis was performed identically, regardless of mouse genotype. Data is presented as mean +/- SEM. Statistical analysis was done using unpaired Student’s t-test or 2-way ANOVA with either Sidak’s or Tukey’s multiple comparison tests, according to the number of samples and the analysis of mice at multiple ages. Sample sizes were similar to those employed in the field and are indicated in main text, methods or figure legends. Data distribution was assumed to be Gaussian, but was not formally tested, and p<0.05 was considered significant.

P values, differences between means (DM), 95% confidence intervals (CI) of differences between mean, t-distributions and degrees of freedom (df) were as follows: Figure 2 (G): unpaired Student’s t-test. Yap/Taz cDKO myelinating Schwann cells per FOV, p=0.0034, DM = −358.7 + /−54.54, CI = −518.4 to −198.9, t = 6.233, df = 4. Figure 3C: 2-way ANOVA, with Sidak’s multiple comparison test. Taz cKO/Yap cHET and Yap/Taz cDKO myelinating and promyelinating Schwann cells per FOV, Taz-cKO/Yap-cHET P18: promyelinating, p=0.0002, DM = −144.0, CI = −208.2 to −79.82, t = 6.306, df = 11; P18 myelinating, p<0.0001, DM = 667.8, CI = 541.3 to 794.4, t = 14.83, df = 11; P60 promyelinating: p>0.9999, DM = 0, CI = −71.76 to+71.76, t = 0, df = 11; P60 myelinating: p=0.2271, DM = 96.25, CI = −45.25 to 237.8, t = 1.912, df = 11. YAP/TAZ-cDKO, P18 promyelinating: p=0.0569, DM = −62.5, CI = −126.7 to 1.68, t = 2.737, df = 11; P18 myelinating: p<0.0001, DM = 778.7, CI = 652.1 to 905.2, t = 17.29, df = 11; P60 promyelinating: p<0.0001, DM = −210.3, CI = −274.5 to −146.2, t = 9.211, df = 11; P60 myelinating: p<0.0001, DM = 377, CI = 250.4 to 503.6, t = 8.372, df = 11. Figure 4: (A-C) 2-way ANOVA, with Sidak’s multiple comparison test. (A) Yap/Taz cDKO total Sox10+ Schwann cells per sciatic nerve, E17.5: p=0.3244, DM = 35.67, CI = −18.57 to 89.9, t = 1.887, df = 18; P0: p=0.0009, DM = 98.95, CI = 38.31 to 159.6, t = 4.682, df = 18; P4: p<0.0001, DM = 224.2, CI = 169.9 to 278.4, t = 11.86, df = 18; P18: p=0.0008, DM = 100.5, CI = 39.86 to 161.1, t = 4.755, df = 18; P60: p<0.0001, DM = 116.2, CI = 61.96 to 170.4, t = 6.147, df = 18. (B) Yap/Taz cDKO Ki67+ Schwann cells, P0: p=0.0025, DM = 11, CI = 3.733 to 18.27, t = 4.244, df = 16; P4: p=0.9235, DM = −1.9, CI = −9.167 to 5.367, t = 0.7331, df = 16; P18: p=0.3356, DM = −4.567, CI = −11.83 to 2.7, t = 1.762, df = 16; P60: p=0.9995, DM = −0.5, CI = −7.767 to 6.767, t = 0.1929, df = 16. (C) Yap/Taz cDKO EdU+ Schwann cells, E17.5: p=0.0192, DM = 15.03, CI = 3.133 to 26.93, t = 3.738, df = 6; P4: p=0.8322, DM = −2.8, CI = −17.38 to 11.78, t = 0.5684, df = 6. (D) Unpaired t-test. Yap/Taz cDKO, YAP/TAZ+ vs YAP/TAZ- EdU+ Schwann cells at P4, p=0.0044, DM = −14.73 + /- 0.9772, CI = −18.93 to −10.53, t = 15.07, df = 2. Figure 5: (C, D) 2-way ANOVA, with Sidak’s multiple comparison test. (C) Yap/Taz cDKO Oct6+ Schwann cells in sciatic nerve, P0: p=0.0027, DM = −29.24, CI = −48.94 to −9.545, t = 4.106, df = 18; P4: p=0.0001, DM = −30.68, CI = −45.93 to −15.42, t = 5.56, df = 18; P18: p<0.0001, DM = −55.26, CI = −88.79 to −53.55, t = 9.272, df = 18; P60: p<0.0001, DM = −71.17, CI = −88.79 to −53.55, t = 11.17, df = 18. (D) Yap/Taz cDKO Krox20+ Schwann cells in sciatic nerve, P0: p=0.1146, DM = 15.13, CI = −2.908 to 33.17, t = 2.491, df = 11; P4: p<0.0001, DM = 44.62, CI = 26.58 to 62.65, t = 7.347, df = 11; P18: p<0.0001, DM = 56.06, CI = 38.02 to 74.1, t = 9.231, df = 11; P60: p<0.0001, DM = 48.35, CI = 28.59 to 68.11, t = 7.268, df = 11. (F) Unpaired t-test. Yap/Taz cDKO, Krox20 mRNA in Schwann cells at P60. p=0.0213, DM = −0.695 + /- 0.1031, CI = −1.139 to −0.2515, t = 6.742, df = 2. Figure 6: (C) Unpaired t-test. Nerve conduction velocity in iDKO mice. p=0.0186, DM = −34.4` ± 8.984, CI = −59.36 to −9.468, t = 3.83, df = 4. (F) Unpaired t-test. YAP/TAZ+ Schwann cells in iDKO mice. p=0.0018, DM = −62.55 + /- 5.872, CI = −81.24 to −43.86, t = 10.65, df = 3. (G) Unpaired t-test. Demyelinating Schwann cells in iDKO mice. p<0.0001, DM = 21.77 + /- 0.9387, CI = 19.16 to 24.37, t = 23.19, df = 4. Figure 7: (C) Unpaired t-test. Krox20+ Schwann cells in iDKO mice. p=0.0038, DM = −37.02 + /- 4.497, CI = −51.33 to −22.71, t = 8.232, df = 3. Figure 8: (D, E) 2-way ANOVA with Sidak’s multiple comparison test. (D) TEAD1 ChIP from P12-P15 sciatic nerves. E1 primers: p=0.9997, DM = 0.0294, CI = −0.1733 to 0.2321, t = 0.408, df = 44; E2 primers: p=0.9498, DM = 0.0684, CI = −0.1343 to 0.2711, t = 0.9492, df = 44; E3 primers: p=0.1994, DM = 0.2535, CI = −0.06706 to 0.5741, t = 2.225, df = 44; E4 primers: p<0.0001, DM = 0.5356, CI = 0.3329 to 0.7383, t = 7.432, df = 44; E5 primers: p<0.0001, DM = 0.5335, CI = 0.3068 to 0.7602, t = 6.622, df = 44; E6 primers: p=0.9966, DM = 0.0428, CI = −0.1599 to 0.2455, t = 0.5939, df = 44; beta actin primers: p>0.9999, DM = 0.001333, CI = −0.2604 to 0.2631, t = 0.01433, df = 44. (E) TEAD1 ChIP from P70 sciatic nerves. E3 primers: p=0.0001, DM = 0.1019, CI = 0.05544 to 0.1484, t = 6.89, df = 12; E4 primers: p<0.0001, DM = 0.234, CI = 0.1875 to 0.2805, t = 15.82, df = 12; E5 primers: p=0.0498, DM = 0.0465, CI = 4.058e-005 to 0.09296, t = 3.144, df = 12; Krox20 promoter primers: p=0.8830, DM = 0.016, CI = −0.03046 to 0.06246, t = 1.082, df = 12; beta actin primers: p>0.9999, DM = 0.0005, CI = −0.04596 to 0.04696, t = 0.03381, df = 12; Miro1 primers: p>0.9999, DM = 0.001, CI = −0.04546 to 0.04746, t = 0.06761, df = 12. Figure 2—figure supplement 1: (C) 2-way ANOVA, with Sidak’s multiple comparison test. Yap/Taz cDKO, percentage of Schwann cells containing residual YAP/TAZ, P4: p=0.0007, DM = 45.7, CI = 28.87 to 62.53, t = 8.559, df = 5; P60: p=0.0003, DM = 61.5, CI = 43.06 to 79.94, t = 10.51, df = 5. (D) Unpaired t-test. Yap/Taz cDKO vs WT, relative Yap and Taz mRNA levels. Yap: p=0.0009, DM = −0.8333 + /- 0.09428, CI = −1.095 to −0.5716, t = 8.839, df = 4; Taz: p=0.0215, DM = −0.45 + /- 0.1458, CI = −0.8067 to −0.0933, t = 3.087, df = 6. Figure 2—figure supplement 2: (B) 2-way ANOVA, with Sidak’s multiple comparison test. Yap/Taz cDKO fore- and hindlimb grip strength. Forelimb, 10 week: p=0.0028, DM = 47.57, CI = 20.23 to 74.9, t = 4.774, df = 8; 16 week: p=0.0030, DM = 47.01, CI = 19.67 to 74.34, t = 4.718, df = 8. Hindlimb, 10 week: p=0.0105, DM = 96.98, CI = 26.93 to 167.0, t = 3.798, df = 8; 16 week: p=0.0113, DM = 95.68, CI = 25.64 to 165.7, t = 3.747, df = 8. (D) 2-way ANOVA, with Tukey’s multiple comparison test. Yap/Taz cDKO, mice weights, P60: WT female vs Yap/Taz cDKO female, p=0.0005, DM = 4.7, CI = 2.158 to 7.242, q = 7.599, df = 14; WT male vs Yap/Taz cDKO male, p<0.0001, DM = 9.75, CI = 6.636 to 12.86, q = 12.87, df = 14. Figure 2—figure supplement 3. (E) 2-way ANOVA with Sidak’s multiple comparison test. Number of small and large axon bundles containing large axons in Yap/Taz cDKO sciatic nerve. Small bundles (2–5 axons) p<0.0001, DM = −86.1, CI = −105.9 to −66.27, t = 11.91, df = 8; Large bundles (>5 axons) p=0.7342, DM = −5.3, CI = −25.13 to 14.53, t = 0.7331, df = 8. Figure 4—figure supplement 2: (C) Unpaired Student’s t-test. Integrin α6 mRNA levels in Yap/Taz cDKO P60 sciatic nerve. p=0.039, DM = −0.533 + /- 0.1764, CI = −1.023 to −0.04361, t = 3.024, df = 4.


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
    Characterisation of cis-acting sequences reveals a Biphasic, axon-dependent regulation of Krox20 during Schwann cell development
    1. J Ghislain
    2. C Desmarquet-Trin-Dinh
    3. M Jaegle
    4. D Meijer
    5. P Charnay
    6. M Frain
    Development 129:155–166.
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
    Three markers of adult non-myelin-forming schwann cells, 217c(Ran-1), A5E3 and GFAP: development and regulation by neuron-Schwann cell interactions
    1. KR Jessen
    2. L Morgan
    3. HJ Stewart
    4. R Mirsky
    Development 109:91–103.
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
    Schwann cell myelination
    1. JL Salzer
    Cold Spring Harbor Perspectives in Biology 7:a020529.
  52. 52
  53. 53
    In vivo electrophysiological measurements on mouse sciatic nerves
    1. A Schulz
    2. C Walther
    3. H Morrison
    4. R Bauer
    Journal of Visualized Experiments, 10.3791/51181, 24747166.
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74

Decision letter

  1. Klaus-Armin Nave
    Reviewing Editor; Max Planck Institute for Experimental Medicine,, Germany

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Yap/Taz directly regulate myelin formation and maintenance by upregulating Krox20" for consideration by eLife. Your article has been favorably evaluated by Anna Akhmanova (Senior Editor) and five reviewers, one of whom, Klaus-Armin Nave (Reviewer #1), is a member of our Board of Reviewing Editors. The following individual involved in review of your submission has agreed to reveal their identity: Michael Wehr (Reviewer #5).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


Grove et al. study Schwann cell-specific Yap and Taz cKO and DKO mice and show that these Hippo signaling transcriptional coactivators factors are essential regulators for PNS myelination. Overall, this study is important as it further reveals a key function of the Yap/Taz signaling system in Schwann cell differentiation and myelination. The paper extends and partly corrects findings by the Swaren and Feltri labs that reported a block of axonal sorting in essentially the same double mutant mice. The authors identify a strong delay (but not a block) of axonal sorting. Instead the authors make a subsequent failure of Krox20 upregulation in the "promyelinating" SC responsible for the myelination defect. They discover TEAD1 as a critical cofactor of Taz to directly regulate Krox20 transcription. The authors also report the requirement of continued Yap/Taz expression in adult Schwann cells to maintain myelin. The overall technical quality of the data is high, and presentation is clear and convincing. Although the concept of Yap/Taz regulation is not entirely novel, they provide additional Yap/Taz functions in Schwann cell development and myelin maintenance.

Essential revisions:

1) An important point in the paper is the efficient recombination achieved in all generated mutants. Nevertheless, both western blotting analyses and immunohistochemistry in Figure 2—figure supplement 1, have residual Yap/Taz expression in the cDKO. They should perform qPCR analyses for Yap/Taz mRNA to confirm efficient ablation in cDKO.

2) The paper by Poitelon et al. presented convincing data that the axonal sorting defects in the Yap/Taz conditional mutants are primarily caused by downregulation of laminin receptors α6β1 integrin and dystroglycan (with minor differences in proliferation), whereas Grove et al. argue equally convincingly that delayed S phase entry and reduced proliferation are the main reasons. It would be important to know whether Grove et al. also see the downregulation of laminin receptors.

3) Radial sorting impairment is present at all time points analyzed and to corroborate the delay the authors should calculate the number of SC in 1:1 association with axons at all time points analyzed.

4)Subsection “Yap/Taz are required for timely axon sorting”, third paragraph: It is troubling to read that some 20% of DKO SC remain Yap/Taz positive, although "weakly", with this staining remaining constant between P4 and P20 (the data are not shown, except for Figure 4F which shows a lot of residual non-nuclear Yap/Taz). This suggests that even after successful recombination these proteins remain quite stable, possibly due to their physical anchorage in the cells (yet at a different level than the compensatory expression in heterozygous mice). It also brings up the question how early both genes are expressed (i.e. prior to P0-Cre expression) and could different turnover rates of Yap/Taz (possibly related to environmental/nutritional/stress factors) relate to phenotypical differences of DKO mice in different labs.

Related issues raised:

In the third paragraph of the subsection “Yap/Taz are required for myelination of sorted axons”, the authors claim (with reference to Figure 2) that the remaining MBP staining in Yap/Taz cDKO is from "rare SCs which retained strong Yap/Taz immunoreactivity".

Subsection “Yap/Taz are required for myelination of sorted axons”, first paragraph and Figure 2—figure supplement 1B: what could be the reason for "faint signals" in 20% of cells at that adult age? Cre – recombination is early and should be all or none.

Also, the IHC of Figure 6D shows SC expressing low levels of Yap/Taz.

5) The authors conclude that the reduction of Krox20 expression (see title) causes the myelination delay, but also report that ~15% of SCs are Krox20+ throughout development and adulthood (subsection “Yap/Taz are required for Krox20 upregulation”). If failing Krox20 expression were the only problem, shouldn't these SC proceed to myelination? Here also the conclusions should be more precise.

6) The fact that tamoxifen-dependent Yap/Taz deletion in the adult by Sox10-CreERT2 or Plp-CreERT2 leads to an astonishingly rapid death is attributed to the observed changes in peripheral myelin and the PNS. The PNS defects are clearly shown, and it is equally obvious that there is no major structural alteration in CNS myelin. Nevertheless, one should be more cautious in claiming that the PNS defects are the cause of death.

Given that Sox10 is expressed in other neural crest-derived cell types, does Yap/Taz deletion in other Sox10-expressing cells in Sox10- creERT2-driven iDKO mice cause acute mouse death? The authors mentioned as data-not-shown that Plp-creERT2-driven iDKO mice gave a similar phenotype in demyelination, it would be important to show the data to confirm the demyelination or axonal loss phenotype.

7) Figure 1—figure supplement 1C: why is Yap localized in nuclei of Taz KO samples, unlike the control? This is an important point as validation of these antibodies is crucial for the entire study.

8) The authors claim that at P60 the majority of fibers reach a 1:1 association (subsection “Yap/Taz are required for timely axon sorting”, first paragraph), despite the significant impairments in overall SC number and proliferation. Is there an effect on axon numbers in mutant nerves?

9) Figure 4: cDKO nerves have an important reduction in SCs number throughout development (Figure 4A). Surprisingly this reduction is not corroborated by a substantial defect in SCs proliferation. The graph in Figure 4B shows a significant decrease in SC proliferation at P0, but normal or even increased levels at P4, P18 and P60. How do the authors reconcile these results given that there is no effect on apoptosis? The experiments supporting these conclusions, in particular the IHC in Figure 4—figure supplement 1B at P18 do not show colocalization between Sox10 and Ki67.

10) In Figure 4F the staining for Yap/Taz is not clear. It seems that all SC are Yap/Taz positive, but this is in sharp contrast with Figure 2—figure supplement 1C, where only 60% of cells are Yap/Taz+.

11) In Figure 6, Yap/Taz iDKO mice exhibit a strong slowing of nerve conduction from ~50 m/s to ~15 m/s, which would suggest the loss of many large diameter axons. However, this phenomenon does not match the morphological features of the mutant nerves where many large diameter axons remain present. The authors should provide quantification data showing the degree of demyelination, axonal loss and reduction of Krox20 in SCs to reflect the remarkable decrease in conduction velocity. Is it possible that the phenotype in Figure 6 is due to a reduced numberof SC as in development? Have the authors checked for SC numbers, survival and proliferation in iDKO?

12) The authors show that Tead1 binds the MSE element of the Krox20 gene by ChIP-PCR, and claim that Yap/Taz interaction of Tead1 regulates Krox20 gene expression. However, Tead1 transcription factor can bind to many elements and its binding may not necessarily alter Krox20 gene expression. The Yap/Taz regulation of Krox20 may not even be direct. The authors should mutate the putative Tead1 binding sites to demonstrate that Krox20 transcription is inhibited. It would be also important to know whether Yap/Taz interaction with Tead1 is required for activating Krox20 expression and/or the MSE element activity.

13) The authors do not present any mechanisms of upstream Hippo signalling, independent or dependent on Lats and Mst kinases, mechanical forces, involvement of actin cytoskeleton, etc.. Therefore, the authors should at least discuss these aspects and reference relevant work.

[Editors' note: further revisions were requested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Yap/Taz initiate and maintain Schwann cell myelination by upregulating Krox20" for further consideration at eLife. Your article has been favorably evaluated by Anna Akhmanova (Senior Editor) and five reviewers, one of whom is a member of our Board of Reviewing Editors.

The authors have carefully addressed all comments and questions that were raised by the referees. We acknowledge that this was a relatively long list that was contributed by several experts in the field, who now had a chance to study the revised manuscript. Before eLife can accept the paper, the authors should address a few remaining points that mainly require rewording of text.

1) While it has been clearly stated in the rebuttal letter that the main discrepancy between the present study and that of Poitelon et al. is due to a more thorough analysis of YAP/TAZ in adulthood, this is less evident in the manuscript itself (Results section, subsection “Yap/Taz are required for timely axon sorting”, third paragraph). Please adjust.

2) We are not convinced that there is "better axon sorting in distal nerves of cDKO at P18" (subsection “Yap/Taz are required for timely axon sorting”, third paragraph), a conclusion based merely on low magnification semi-thin sections. Please be more cautious.

3) The correlation of "weak staining in YAP/TAZ" and the failure of mutant SC to enter S phase is too speculative. Unless the expression of cyclins is provided, this conclusion should be softened (subsection “Yap/Taz are required for S-phase entry and proper proliferation of immature Schwann cells”, second paragraph).

4) There is no strong evidence of TAZ/YAP directly activating Krox20 in Schwann cells and the authors themselves stated "These results suggest that Yap/Taz directly regulate Schwann cell myelination most likely by activating transcription of Krox20" (Discussion, third paragraph). Thus, the paper's title ("Yap/Taz initiate and maintain Schwann cell myelination by upregulating Krox20") appears too strong of a statement. YAP/TAZ may regulate many other factors required for Schwann cell myelination. In the absence of evidence demonstrating the ability of TAZ/YAP to upregulate Krox20, e.g. by overexpression studies, the title should be adjusted.

5) The authors added "new data" for the iDKO/PlpCreERT phenotype as a single image in Figure 6E5. However, the same image was shown in the previous manuscript (Figure 6E3 in the first submission), where it was labeled as iDKO/Sox10-CreERT. Please check and correct.

6) The authors had been asked to provide data for SC numbers, survival and proliferation in iDKO. In their response, the authors claim to have performed these experiments but do not provide data ("Lastly, as suggested by the reviewer, we have carried out a small number of additional experiments to check SC numbers and proliferation in iDKO: We have found that SCs are not reduced and that proliferation appears only marginally above background. We plan to provide these data when we report the results of our ongoing study."). For a convincing statement, the authors should at least provide a figure for the referees.


Author response

Essential revisions:

1) An important point in the paper is the efficient recombination achieved in all generated mutants. Nevertheless, both western blotting analyses and immunohistochemistry in Figure 2—figure supplement 1, have residual Yap/Taz expression in the cDKO. They should perform qPCR analyses for Yap/Taz mRNA to confirm efficient ablation in cDKO.

We observed that, in addition to myelinating SCs, fibroblasts, perineurial cells and presumably also vascular cells strongly express Yap/Taz both in developing and mature sciatic nerves (e.g., asterisks in Figure 2—figure supplement 1B, Figure 6D). Therefore, we primarily used immunohistochemistry with a SC specific Sox10 antibody to evaluate SC-selective deletion of Yap/Taz in cDKO mice (see also our response to #4). Nonetheless, as suggested, we have carried out RT-qPCR for Yap/Taz mRNA. Total RNA was extracted from P60 sciatic nerves of 3 WT and 3 cDKO mice and used for RT-qPCR with primers in exons 2 and 3 of Yap or exons 3 and 4 of Taz, because exon 3 is deleted in both Yap and Taz knockout mice (Xin et al., 2011). We detected ~22% of Yap mRNA and ~48% of Taz mRNA in the cDKO, compared to WT. These results are now provided as Figure 2—figure supplement 1D. These results are comparable to those we obtained with Western blotting of Yap and Taz at P60 (see Figure 5E). The reason for the apparently small decrease in Taz mRNA at P60 is not inefficient recombination; Taz recombination is efficient, as evident from the large decrease in Taz protein levels at P4 in cDKO compared to WT (Figure 5E). Please note that there is residual background Taz protein at P4 in cDKO, which is maintained at similar levels at P60 in cDKO. Please also note that at P60, WT Taz protein levels are much reduced compared to P4, and are only ~2-fold higher than background; hence it is not surprising that at P60, WT Taz mRNA is similarly only ~2-fold over background. We attribute the background levels of Yap mRNA, Taz mRNA and protein to a combination of perineurial cells, fibroblasts, vascular cells and residual partially recombined SCs (i.e., <20% SCs; see our response to #4).

2) The paper by Poitelon et al. presented convincing data that the axonal sorting defects in the Yap/Taz conditional mutants are primarily caused by downregulation of laminin receptors α6β1 integrin and dystroglycan (with minor differences in proliferation), whereas Grove et al. argue equally convincingly that delayed S phase entry and reduced proliferation are the main reasons. It would be important to know whether Grove et al. also see the downregulation of laminin receptors.

We thank the reviewer for this important point. First, it is important to note that Poitelon et al. analyzed mainly Taz-cKO/Yap-cHET mice, whereas we used Yap/Taz cDKO mice. Although Poitelon et al. reported no reduction in total SCs in Taz-cKO/Yap-cHET (despite the much reduced SC proliferation at P3 that they observed), they commented that “…by P20 the total number of SCs was decreased in double-cKO mice, which were not used in subsequent studies…”. Thus, Poitelon et al. also observed a reduction in number of SCs in Yap/Taz cDKO mice.

Second, as suggested, we have now examined laminin receptor expression in Yap/Taz cDKO sciatic nerves (Figure 4—figure supplement 2). We concentrated on integrin α6, which appeared most strongly downregulated in Taz-cKO/Yap-cHET, whereas downregulation of dystroglycan or other laminin receptors seemed less obvious (Poitelon et al., 2016). We used immunohistochemistry, Western blotting, and RT-qPCR to show that integrin α6 is indeed strongly downregulated in Yap/Taz cDKO sciatic nerves at P4 and P60; this new data appears in Figure 4—figure supplement 2. Residual integrin α6 observed in cDKO in Westerns and RT-qPCR is likely due to strong expression of integrin α6 in perineurial cells (asterisks in Figure 4—figure supplement 2A, and Poitelon et al., 2016). Notably, in the P60 cDKO, no integrin α6 is associated with single axons or with axons in small bundles (Figure 4—figure supplement 2A); i.e., radial sorting is able to proceed (abnormally slowly) in the absence of integrin α6 in Yap/Taz cDKO SCs.

Lastly, earlier studies showed that integrin α6β1 and dystroglycan synergize to increase SC number and proliferation, thereby regulating radial sorting, and that ablation of laminin prevents radial sorting due to reduced SC number and proliferation (Pellegatta et al., 2013, Berti et al., 2011, Yu et al., 2005). It is therefore possible that downregulation of laminin receptors in Yap/Taz cDKO SCs contributes to reducing SC proliferation, thereby contributing to delaying, but not preventing, radial sorting.

3) Radial sorting impairment is present at all time points analyzed and to corroborate the delay the authors should calculate the number of SC in 1:1 association with axons at all time points analyzed.

As suggested, we have calculated the number of SCs in 1:1 association with axons at P18 and P60. We calculated the number of 1:1s per field of view in 3 WT, 3 Taz-cKO/Yap-cHET and 3 Yap/Taz cDKO mice; we counted the number of promyelinating- and the number of myelinating 1:1s at each time point. The data is newly presented in Figure 3C. This shows that at P18, there is a significant delay at the promyelination stage in Taz-cKO/Yap-cHET sciatic nerves, as we described in the original submission. Furthermore, while WT and Taz-cKO/Yap-cHET sciatic nerves have no promyelinating SCs at P60, Yap/Taz cDKO sciatic nerves have a significant number, ~210 promyelinating SCs per FOV. Hence, Yap/Taz cDKO SCs gradually (abnormally slowly) sort large-caliber axons, but there is a block in progression from promyelination to myelination.

4) Subsection “Yap/Taz are required for timely axon sorting”, third paragraph: It is troubling to read that some 20% of DKO SC remain Yap/Taz positive, although "weakly", with this staining remaining constant between P4 and P20 (the data are not shown, except for Figure 4F which shows a lot of residual non-nuclear Yap/Taz). This suggests that even after successful recombination these proteins remain quite stable, possibly due to their physical anchorage in the cells (yet at a different level than the compensatory expression in heterozygous mice). It also brings up the question how early both genes are expressed (i.e. prior to P0-Cre expression) and could different turnover rates of Yap/Taz (possibly related to environmental/nutritional/stress factors) relate to phenotypical differences of DKO mice in different labs.

Related issues raised:

In the third paragraph of the subsection “Yap/Taz are required for myelination of sorted axons”, the authors claim (with reference to Figure 2) that the remaining MBP staining in Yap/Taz cDKO is from "rare SCs which retained strong Yap/Taz immunoreactivity".

Subsection “Yap/Taz are required for myelination of sorted axons”, first paragraph and Figure 2—figure supplement 1B: what could be the reason for "faint signals" in 20% of cells at that adult age? Cre – recombination is early and should be all or none.

Also, the IHC of Figure 6D shows SC expressing low levels of Yap/Taz.

We understand the concerns of the reviewer regarding the ~20% SCs that we counted as Yap/Taz positive in Yap/Taz cDKO. We have carried out additional analyses to confirm efficient recombination/deletion in our Yap/Taz cDKO and iDKO mice. These include new qRT-PCR (Figure 2—figure supplement 1D, Figure 5F), counting axon bundles (Figure 2—figure supplement 3E), counting SC profiles (Figure 3C), additional immunostaining (Figure 2E2, 4F), additional Western blotting (Figure 5E), counting Yap/Taz+, Krox20+ SCs and SC profiles in iDKO (Figure 6F, 6G, 7C). We also strengthen our statements in the text about the reasons for excluding the possibility that the delayed radial sorting that we report is due to incomplete deletion of Yap/Taz in our cDKO mice.

First, Figure 4F, to which the reviewer refers, was adjusted for greater overall brightness with the intention of making these small magnification images more visible. In addition, the buffer in the Click-It kit that we used to identify EdU+ nuclei seemed to increase background in subsequent immunostaining with other antibodies. We have now replaced these images with images in which brightness has not been adjusted. Yap/Taz immunoreactivity in both the nucleus and cytoplasm of cDKO SCs is either completely undetectable (e.g., #3 SC) or low (e.g., #1, 2) compared to WT SCs. Please also note that the newly provided Figure 2E2 shows two types of SCs that we counted as Yap/Taz positive in cDKO: #1 SC, which retains “strong Yap/Taz immunoreactivity” and is also MBP+; and #2 SC, which is MBP-negative and only weakly immunopositive for Yap/Taz. Because we also observed many more SCs (e.g., #3, 4, 5, 6 SCs) that exhibit absolutely no Yap/Taz immunoreactivity in cDKO, we counted #2 type SCs as Yap/Taz-positive although they exhibit very low or “faint signals”. These weakly labeled SCs represent most of the ~20% SCs that we considered to have “residual Yap/Taz” in our rigorous quantitative analysis.

We are not certain, however, of the specificity of this residual Yap/Taz immunoreactivity and we speculate that the weak immunoreactivity at least in part may be non-specific background labeling of some SC nuclei. We have screened more commercial antibodies but cannot find additional antibodies that specifically recognize both Yap and Taz (e.g., Figure 1—figure supplement 1B). Please also note that, because non-SCs (presumably perineurial cells and fibroblasts) strongly express Yap/Taz both in developing and mature sciatic nerves, we primarily rely on SC-selective immunohistochemistry, rather than Western blotting or qRT-PCR to evaluate recombination/deletion in our cDKO and iDKO mouse lines. Another speculative explanation, which we have now described better in the result section, is that most of the residual Yap/Taz immunoreactivity in ~20% SCs may represent an undeleted allele of Yap, which we found to be insufficient to complete myelination (Figure 3B; P60 Taz-cKO/Yap-cHET).

Another possibility, which the reviewer raised, is that these “residual Yap/Taz” are proteins that remain stably in the SC nuclei, even after extended periods. Yap/Taz are expressed in Sox10+ neural crest derived cells at E10.5 (Serinagaoglu et al., 2015); hence Yap/Taz are indeed expressed prior to when P0-Cre drives SC-selective deletion of Yap/Taz. However, we think it unlikely that residual Yap/Taz would remain in cDKO SCs even at P60. This is based on our finding that most adult SCs lack Yap/Taz 3 weeks after inducible ablation; i.e., nuclear Yap/Taz does not appear to be exceptionally stable in adult Schwann cells.

We agree with the reviewer that it is important to consider whether different turnover rates of Yap/Taz could explain phenotypic differences between cDKO mice in our study and that of Poitelon et al., but we do not think that there is a phenotypic difference. Poitelon et al. examined cDKO mice up to P20, and most of their data was from Taz-cKO/Yap-cHET mice. The phenotypes of our and Poitelon et al.’s Yap-cKO, Taz-cKO, Yap-cKO/Taz-cHET and Taz-cKO/Yap-cHET mice are all quite similar up to ~P20. For example, Poitelon et al. reported that cDKO mice had a complete block in radial sorting at P20. Similarly, we observed a major block in radial sorting at P18 in the proximal sciatic nerves. Notably, however, we found that more sorting had occurred at P18 in distal nerves. Poitelon et al. did not examine cDKO mice after P20, whereas we examined them up to P60, when we observed more advanced radial sorting.

Lastly, regarding Figure 6D, we now provide new quantification data (Figure 6F) to show that our iDKO mice lines effectively induced deletion of Yap and Taz.

5) The authors conclude that the reduction of Krox20 expression (see title) causes the myelination delay, but also report that ~15% of SCs are Krox20+ throughout development and adulthood (subsection “Yap/Taz are required for Krox20 upregulation”). If failing Krox20 expression were the only problem, shouldn't these SC proceed to myelination? Here also the conclusions should be more precise.

Please note that the percentage of Krox20+ SCs (~15%) is similar to that of Yap/Taz+ SCs (~20%) in Yap/Taz-cDKO sciatic nerves. Moreover, similar to our procedure for counting of Yap/Taz+ SCs in the cDKO, we included those SCs that were only weakly immunopositive as Krox20+ SCs. Figure 5B shows that few SCs have high levels of Krox20, and that most have lower levels or do not express it. Notably, Le et al., (Le et al., 2005) have generated hypomorphic Krox20 mice (Egr2lo/lo) that express mRNA and protein levels of Krox20 that are reduced 3-fold compared to WT sciatic nerves. SCs in these Egr2lo/lo mice are arrested at the promyelination stage, similar to Krox20-KO SCs. Therefore, we would not anticipate that Yap/Taz cDKO SCs expressing low levels of Krox20 would proceed to myelination. As suggested, we have modified conclusive statements.

6) The fact that tamoxifen-dependent Yap/Taz deletion in the adult by Sox10-CreERT2 or Plp-CreERT2 leads to an astonishingly rapid death is attributed to the observed changes in peripheral myelin and the PNS. The PNS defects are clearly shown, and it is equally obvious that there is no major structural alteration in CNS myelin. Nevertheless, one should be more cautious in claiming that the PNS defects are the cause of death.

Given that Sox10 is expressed in other neural crest-derived cell types, does Yap/Taz deletion in other Sox10-expressing cells in Sox10- creERT2-driven iDKO mice cause acute mouse death? The authors mentioned as data-not-shown that Plp-creERT2-driven iDKO mice gave a similar phenotype in demyelination, it would be important to show the data to confirm the demyelination or axonal loss phenotype.

We agree with the reviewer that the causes of Yap/Taz iDKO mouse death should be interpreted cautiously and analyzed further. We have amended related statements. Our response to #11 comment offers one possible explanation (see below). We were also surprised that both lines of Yap/Taz iDKO mice driven by Sox10-creERT2 or Plp-creERT2 died within a month after the 1st tamoxifen injection, exhibiting similar segmental demyelination phenotypes in the peripheral nerve. We are currently examining whether induced deletion of Yap/Taz in SCs has more detrimental effects besides segmental demyelination and whether it acutely paralyzes neuromuscular functions. We also plan to examine other cell types potentially affected in both lines of iDKO mice. As suggested, we now provide a semi-thin image of Plp-creERT2 driven iDKO sciatic nerve (Figure 6E5), which shows a demyelination phenotype similar to that in Sox10-creER iDKO nerves (Figure 6E1-E4).

7) Figure 1—figure supplement 1C: why is Yap localized in nuclei of Taz KO samples, unlike the control? This is an important point as validation of these antibodies is crucial for the entire study.

Yap is localized in the nuclei of both control and Taz cKO sciatic nerves. Arrows in the figure now mark examples of SC nuclei in the control. It is also noteworthy that Yap is present in both the cytoplasm and nucleus, but not in all nuclei, in the control. Other figures show that Yap is expressed in myelinating, but not in non-myelinating, SCs (Figure 1D).

8) The authors claim that at P60 the majority of fibers reach a 1:1 association (subsection “Yap/Taz are required for timely axon sorting”, first paragraph), despite the significant impairments in overall SC number and proliferation. Is there an effect on axon numbers in mutant nerves?

We regret the confusing statements. We did not mean that radial sorting was almost complete in cDKO at P60 and now corrected this misconception in the Results section. We also provide new data consisting of counts of axon bundles of unsorted axons and promyelinating SCs in P60 cDKO (Figure 2—figure supplement 3E, Figure 3C). Although we observed many sorted axons in Yap/Taz cDKO at P60, we frequently observed small bundles of unsorted axons (e.g., Figure 2—figure supplement 3D, Figure 3A) and occasionally large axon bundles (e.g., Figure 2—figure supplement 3D; low magnification image of ventral root). More specifically, at P60, while there are no bundles of unsorted axons in WT, cDKO sciatic nerves contain 86.1 small bundles (2-5 axons; ****P<0.0001) and 5.3 large axon bundles (>5 axons) per field of view (Figure 2—figure supplement 3E). This compares to 210 promyelinating SCs per field of view in the cDKO at P60 (Figure 3C). Therefore, a considerable number of axons remained unsorted in cDKO mice at P60 (Figure 2—figure supplement 3), consistent with their markedly reduced number of SCs (Figure 4A).

There are several reasons why we did not count axon numbers in P60 cDKO nerve, for which extensive quantitative EM analysis would be required for accurate counting of amyelinated atrophied axons, including unsorted axons tightly packed in small bundles. First, our finding that a considerable number of axons remained unsorted precludes having to postulate that substantial axon death occurred in cDKO nerves. Second, our EM analysis of cDKO nerves revealed no signs of axon degeneration. This result is consistent with earlier studies of developmental amyelination that reported no axon loss. Third, our comprehensive analysis of muscle innervation in P55 cDKO mice did not show degeneration of intramuscular axons or axon terminals; all muscle fibers remained innervated by single axons, exhibiting no abnormal patterns of innervation or denervation (n>6 muscles, >400 NMJs, Figure 4—figure supplement 3). In summary, we are quite confident suggesting that axons in cDKO do not degenerate at least up to P60.

9) Figure 4: cDKO nerves have an important reduction in SCs number throughout development (Figure 4A). Surprisingly this reduction is not corroborated by a substantial defect in SCs proliferation. The graph in Figure 4B shows a significant decrease in SC proliferation at P0, but normal or even increased levels at P4, P18 and P60. How do the authors reconcile these results given that there is no effect on apoptosis? The experiments supporting these conclusions, in particular the IHC in Figure 4—figure supplement 1B at P18 do not show colocalization between Sox10 and Ki67.

Because non-SCs, in addition to Sox10+ SCs, proliferate, there are Ki67+ but Sox10- cells in P4 WT, P4 cDKO and P18 cDKO. These proliferating non-SCs might have given the erroneous impression to the reviewer that there is no Sox10/ Ki67 colocalization in the figure. We have now specifically marked Sox10+ and Ki67+ cells in the Figure 4B. The unique strength of our studies of Yap/Taz cDKO and iDKO mice is in our use of SC-specific Sox10 antibody, which enabled us to exclude the responses of non-SCs in our analyses.

In WT sciatic nerves, SC proliferation peaks between E16.5 and P0, and then decreases as radial sorting comes to an end and SCs initiate myelination (Jessen and Mirsky, Nature Rev. Neurosci. 2005). Our data show markedly impaired SC proliferation in cDKO during the peak period (E17.5 and P0; Figure 4B and 4C). Consistent with this finding, we observed markedly reduced numbers of SCs in P4 cDKO mice (Figure 4A). We believe that the “…normal or even increased levels of SC proliferation” in P4 cDKO is largely due to residual Yap/Taz in cDKO SC nuclei (Figure 4D). The “…normal or even increased levels of proliferation” in P18 and P60 cDKO is highly likely because radial sorting continues abnormally and SCs fail to differentiate (i.e., to initiate myelination) in Yap/Taz cDKO mice. It is important to note, however, that, although cDKO SCs continue to proliferate, their proliferation sharply decreases to insignificant levels by P18. Consistent with this result, we observed only a slight increase in SC number in cDKO after P4 (Figure 4A). Therefore, we consider cDKO SC proliferation after P4 to be only minimal and think that there is no discrepancy in SC proliferation and number in our analysis of cDKO mice, which showed no SC apoptosis at least up to P60.

10) In Figure 4F the staining for Yap/Taz is not clear. It seems that all SC are Yap/Taz positive, but this is in sharp contrast with Figure 2—figure supplement 1C, where only 60% of cells are Yap/Taz+.

In addition to myelinating SCs, we frequently observed non-SCs (presumably fibroblasts, perineurial and vascular cells) that strongly express Yap/Taz both in developing and mature sciatic nerves (e.g., asterisks in Figure 2—figure supplement 1B, Figure 6D). These Yap/Taz+ non-SCs often give the mistaken impression, particularly at low magnifications such as in Figure 4F, that all SCs are Yap/Taz positive. In addition, the buffer in the Click-It kit that we used to identify EdU+ nuclei seemed to increase background in subsequent immunostaining, which might have caused some background-stained SC nuclei to appear Yap/Taz positive. We have now replaced Figure 4F with an image that better displays SCs not expressing Yap/Taz (i.e., non-myelinating SCs) even at low magnifications. We used high magnifications and a SC specific, Sox10 antibody, to count Yap/Taz+ SCs in Figure 2—figure supplement 1C. The Click-It kit was not used in this analysis.

11) In Figure 6, Yap/Taz iDKO mice exhibit a strong slowing of nerve conduction from ~50 m/s to ~15 m/s, which would suggest the loss of many large diameter axons. However, this phenomenon does not match the morphological features of the mutant nerves where many large diameter axons remain present. The authors should provide quantification data showing the degree of demyelination, axonal loss and reduction of Krox20 in SCs to reflect the remarkable decrease in conduction velocity. Is it possible that the phenotype in Figure 6 is due to a reduced number of SC as in development? Have the authors checked for SC numbers, survival and proliferation in iDKO?

We respectfully disagree with the reviewer that demyelination alone cannot explain markedly decreased nerve conduction velocity and that it is necessary to postulate additional massive loss of large-caliber axons. It is our understanding that demyelination of an axon at the level of one internode may even cause conduction block along the axon: “In paranodal demyelination, the initial outward current at the next node is dissipated over a larger area. If the next node can be depolarized to threshold after a larger duration current, saltatory conduction is slowed but preserved; with more severe demyelination insufficient current is available to depolarize the next node to threshold and the action potential will extinguish” (Franssen and van den Bergh, 2006). In addition, earlier studies have commonly reported slow components (<5 m/s) of dispersed nerve conduction, as we observed in iDKO mice, and attributed them to unmyelinated large-caliber axons (e.g., Bremer et al., 2011).

As suggested, we have examined more semithin and EM sections of both lines of iDKO mice at 20 days after 1st tamoxifen injection, and observed no evidence of substantial axon loss (data not shown, see below). We have also quantified Yap/Taz+ SCs (Figure 6F), demyelinating profiles (Figure 6G) and Krox20+ SCs (Figure 7C), as requested by the reviewer. Notably, we found that ~22% of axons were demyelinating or demyelinated on analyses of transverse sections (i.e., at the level of one internode). Although demyelination seems only partial (i.e., ~22%), axons that appear normal at one internode may have multiple demyelinated internodes at other locations along the entire length of sciatic nerve. This notion is strongly supported by our images of longitudinal sections of both lines of iDKO mice, wherein along a single axon, demyelinated internodes are adjacent to myelinated internodes (e.g., demyelinated internodes marked by red ‘a’ in Figure 6E4, 6E5). Therefore, it is quite possible, in our opinion, that segmental (not uniform) demyelination that is widespread among the axons of iDKO mice can markedly reduce nerve conduction and be fatal.

Nonetheless, as mentioned above in comment #6, we do not exclude the possibility that induced ablation of Yap/Taz not only causes demyelination but also affects myelinating SCs in additional harmful ways. This is the focus of our ongoing study, which we hope will soon provide additional insights into the robust phenotype and acute death of Yap/Taz iDKO mice. Lastly, as suggested by the reviewer, we have carried out a small number of additional experiments to check SC numbers and proliferation in iDKO: We have found that SCs are not reduced and that proliferation appears only marginally above background. We plan to provide these data when we report the results of our ongoing study.

12) The authors show that Tead1 binds the MSE element of the Krox20 gene by ChIP-PCR, and claim that Yap/Taz interaction of Tead1 regulates Krox20 gene expression. However, Tead1 transcription factor can bind to many elements and its binding may not necessarily alter Krox20 gene expression. The Yap/Taz regulation of Krox20 may not even be direct. The authors should mutate the putative Tead1 binding sites to demonstrate that Krox20 transcription is inhibited. It would be also important to know whether Yap/Taz interaction with Tead1 is required for activating Krox20 expression and/or the MSE element activity.

The fact that TEAD1 binds to the MSE in vivo makes it highly unlikely that TEAD1 may have no role in regulating Krox20 expression. TEADs bind two families of transcriptional cofactors: Yap/Taz and Vgll proteins; interestingly, Yap/Taz and Vgll compete for binding to TEAD, but regulate different sets of genes (Pobbati et al., 2012); hence, as we found that Yap/Taz are required for Krox20 expression, it suggests that Yap/Taz complex with TEAD1 to regulate Krox20. In support of this, Svaren’s group recently reported that TEAD1 siRNA led to downregulation of Krox20 expression in primary rat SCs (Lopez-Anido et al., 2016). Also, Tricaud’s group reported that co-expressing Yap and TEAD1 constructs induced maximal Krox20 promoter activity in primary rat SCs (Fernando et al., 2016), strongly suggesting that Yap directly regulates Krox20 transcription, through TEAD1. Notably, our ChIP analysis also shows that TEAD1 binds to the Krox20 promoter 10-fold over control levels, and our preliminary ChIP data shows Yap/Taz binding to the same region of the Krox20 MSE as TEAD1. These data therefore provide additional support for the notion that TEAD1 mediates Krox20 upregulation by Yap/Taz.

We completely agree with the reviewer, however, that TEAD1 is highly unlikely to be the sole transcriptional factor with which Yap/Taz interacts, and that more direct evidence is required to establish Yap/Taz-TEAD1 regulation of Krox20. We have begun comprehensive in vitro and in vivo studies to learn how Yap/Taz regulates Krox20 transcription, which will include mutating putative TEAD1 binding sites in the Krox20 MSE and promoter and use of TEAD binding mutants of Yap/Taz, as the reviewer suggested. In addition, we plan in vivo pharmacological and genetic approaches targeting TEAD1 (Liu-Chittenden et al., 2012). We appreciate the reviewer’s valuable comments. We have now toned down our statements related to the claim.

13) The authors do not present any mechanisms of upstream Hippo signalling, independent or dependent on Lats and Mst kinases, mechanical forces, involvement of actin cytoskeleton, etc.. Therefore, the authors should at least discuss these aspects and reference relevant work.

As requested, we now provide the following paragraph as a discussion of potential upstream signals regulating Yap/Taz in SCs.

“Our findings show that Yap/Taz regulate not only proliferation but also differentiation of SCs, driving radial sorting, developmental myelination and myelin maintenance. […] Therefore, it is likely that additional pathways are also involved in Yap/Taz regulation. An intriguing possibility is that Yap/Taz are downstream of regulators of developmental myelination, including Neuregulin 1-type III, integrin α6β1, G-protein coupled receptor Gpr126 and Wnt (Feltri et al., 2002, Monk et al., 2011, Pereira et al., 2009, Petersen et al., 2015, Taveggia et al., 2005, Azzolin et al., 2014)…”

[Editors' note: further revisions were requested prior to acceptance, as described below.]

The authors have carefully addressed all comments and questions that were raised by the referees. We acknowledge that this was a relatively long list that was contributed by several experts in the field, who now had a chance to study the revised manuscript. Before eLife can accept the paper, the authors should address a few remaining points that mainly require rewording of text.

1) While it has been clearly stated in the rebuttal letter that the main discrepancy between the present study and that of Poitelon et al. is due to a more thorough analysis of YAP/TAZ in adulthood, this is less evident in the manuscript itself (Results section, subsection “Yap/Taz are required for timely axon sorting”, third paragraph). Please adjust.

We now explicitly stated in the third paragraph of the subsection “YAP/TAZ are required for timely axon sorting” that “The discrepancy … due to the fact that Poitelon et al. examined Yap/Taz cDKO up to P20 …whereas we analyzed them more thoroughly up to P60.”.

2) We are not convinced that there is "better axon sorting in distal nerves of cDKO at P18" (subsection “Yap/Taz are required for timely axon sorting”, third paragraph), a conclusion based merely on low magnification semi-thin sections. Please be more cautious.

We have removed the statement.

3) The correlation of "weak staining in YAP/TAZ" and the failure of mutant SC to enter S phase is too speculative. Unless the expression of cyclins is provided, this conclusion should be softened (subsection “Yap/Taz are required for S-phase entry and proper proliferation of immature Schwann cells”, second paragraph).

We have softened the statement referred by the reviewer and also amended title of the subsection (“YAP/TAZ are required for proper proliferation of immature Schwann cells”, second paragraph).

4) There is no strong evidence of TAZ/YAP directly activating Krox20 in Schwann cells and the authors themselves stated "These results suggest that Yap/Taz directly regulate Schwann cell myelination most likely by activating transcription of Krox20" (Discussion, third paragraph). Thus, the paper's title ("Yap/Taz initiate and maintain Schwann cell myelination by upregulating Krox20") appears too strong of a statement. YAP/TAZ may regulate many other factors required for Schwann cell myelination. In the absence of evidence demonstrating the ability of TAZ/YAP to upregulate Krox20, e.g. by overexpression studies, the title should be adjusted.

‘[…]by upregulating Krox20’ is removed in the new title.

5) The authors added "new data" for the iDKO/PlpCreERT phenotype as a single image in Figure 6E5. However, the same image was shown in the previous manuscript (Figure 6E3 in the first submission), where it was labeled as iDKO/Sox10-CreERT. Please check and correct.


6) The authors had been asked to provide data for SC numbers, survival and proliferation in iDKO. In their response, the authors claim to have performed these experiments but do not provide data ("Lastly, as suggested by the reviewer, we have carried out a small number of additional experiments to check SC numbers and proliferation in iDKO: We have found that SCs are not reduced and that proliferation appears only marginally above background. We plan to provide these data when we report the results of our ongoing study."). For a convincing statement, the authors should at least provide a figure for the referees.

Author response image 1: The results are obtained from 3 control and 3 Plp-CreERt2-Yapf/f/Tazf/f mice, 18 days after 1st tamoxifen injection. This time point was chosen because it is just prior to the 3rd week after injection, when iDKO mice begin to die. Schwann cell number is not different between WT and iDKO mice (A, see also B for SCs labeled by Sox10). We also observed neither proliferating (B; EdU staining) nor apoptotic SCs (C; TUNEL staining) in iDKO sciatic nerves.


Article and author information

Author details

  1. Matthew Grove

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    MG, Conceptualization, Data curation, Formal analysis, Methodology, Writing—original draft, Writing—review and editing
    Competing interests
    The authors declare that no competing interests exist.
  2. Hyukmin Kim

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    HK, Data curation, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  3. Maryline Santerre

    FELS Institute for Cancer Research and Molecular Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    MS, Formal analysis, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  4. Alexander J Krupka

    Department of Bioengineering, Temple University, Philadelphia, United States
    AJK, Data curation, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  5. Seung Baek Han

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    SBH, Data curation, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  6. Jinbin Zhai

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    JZ, Data curation, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  7. Jennifer Y Cho

    Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    JYC, Data curation, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  8. Raehee Park

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    RP, Resources, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  9. Michele Harris

    Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    MH, Formal analysis, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  10. Seonhee Kim

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    SK, Conceptualization, Resources, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  11. Bassel E Sawaya

    FELS Institute for Cancer Research and Molecular Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    BES, Resources, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  12. Shin H Kang

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    SHK, Resources, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  13. Mary F Barbe

    Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    MFB, Resources, Formal analysis, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  14. Seo-Hee Cho

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    S-HC, Conceptualization, Resources, Methodology
    Competing interests
    The authors declare that no competing interests exist.
  15. Michel A Lemay

    Department of Bioengineering, Temple University, Philadelphia, United States
    MAL, Resources, Data curation, Formal analysis
    Competing interests
    The authors declare that no competing interests exist.
  16. Young-Jin Son

    1. Shriners Hospitals Pediatric Research Center, Center for Neural Repair, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    2. Department of Anatomy and Cell Biology, Lewis Katz School of Medicine, Temple University, Philadelphia, United States
    Y-JS, Conceptualization, Formal analysis, Writing—original draft, Writing—review and editing
    For correspondence
    Competing interests
    The authors declare that no competing interests exist.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-5725-9775


National Institute of Neurological Disorders and Stroke (NS079631)

  • Young-Jin Son

Shriners Hospitals for Children (86600)

  • Young-Jin Son

National Institute of Neurological Disorders and Stroke (NS076401)

  • Bassel E Sawaya

National Institute of Mental Health (MH093331)

  • Bassel E Sawaya

National Institute of Neurological Disorders and Stroke (NS095070)

  • Young-Jin Son

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Alan Tessler and members of Son laboratory for critical reading of the earlier versions of the manuscript. We thank Dr. Eric Olson for Yap and Taz floxed mice, and Drs. Ueli Suter and Kelly Monk for Plp1-creERT2 mice, and Dr. Michael Wegner for Sox10 antibody. Plp1-creERT2 mice were generated by Dr. Ueli Suter using patented Cre-ERT2 construct developed by Dr. Pierre Chambon at GIE-CERBM.


Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols (#4254, #4255) of the Temple University.

Reviewing Editor

  1. Klaus-Armin Nave, Max Planck Institute for Experimental Medicine,, Germany

Publication history

  1. Received: August 26, 2016
  2. Accepted: January 22, 2017
  3. Accepted Manuscript published: January 26, 2017 (version 1)
  4. Version of Record published: February 1, 2017 (version 2)


© 2017, Grove et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 2,650
    Page views
  • 635
  • 23

Article citation count generated by polling the highest count across the following sources: Crossref, Scopus, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Neuroscience
    Hong-Viet Ngo et al.
    Research Article Updated
    1. Neuroscience
    Lili X Cai et al.
    Research Article Updated