Timing of ESCRT-III protein recruitment and membrane scission during HIV-1 assembly

  1. Daniel S Johnson
  2. Marina Bleck
  3. Sanford M Simon  Is a corresponding author
  1. The Rockefeller University, United States
  2. Hofstra University, United States


The Endosomal Sorting Complexes Required for Transport III (ESCRT-III) proteins are critical for cellular membrane scission processes with topologies inverted relative to clathrin-mediated endocytosis. Some viruses appropriate ESCRT-IIIs for their release. By imaging single assembling viral-like particles of HIV-1, we observed that ESCRT-IIIs and the ATPase VPS4 arrive after most of the virion membrane is bent, linger for tens of seconds, and depart ~20 s before scission. These observations suggest that ESCRT-IIIs are recruited by a combination of membrane curvature and the late domains of the HIV-1 Gag protein. ESCRT-IIIs may pull the neck into a narrower form but must leave to allow scission. If scission does not occur within minutes of ESCRT departure, ESCRT-IIIs and VPS4 are recruited again. This mechanistic insight is likely relevant for other ESCRT-dependent scission processes including cell division, endosome tubulation, multivesicular body and nuclear envelope formation, and secretion of exosomes and ectosomes.


eLife digest

Viruses need to be able to enter and leave the cells of their hosts to multiply and spread infections. Once inside the cell, many viruses, including the HIV virus, hijack the cell’s genetic material to produce more HIV particles and release them back into the surroundings. As the new viruses leave the cell, they wrap themselves in the membrane of their host cell.

The shell of HIV consists of thousands of copies of a protein called Gag, which helps to release the viruses. Gag aggregates inside of the host cell membrane, which then begins to bulge outwards forming a spherical bud that subsequently pinches off. These released virus particles are now able to infect other cells.

Both assembling and budding of the virus particles requires the help of specific cell proteins called ESCRTs. Cells usually use ESCRTs to cut membrane-bound compartments during cell division. HIV can control ESCRTs to separate the bud from the cell, but where and how they are involved is still not fully understood. Some models propose that the ESCRTs bend the membrane, while others suggest that the ESCRTs are required during the split, providing the force for the cutting process.

Now, Johnson et al. used fluorescent light to follow how individual viruses in human cells grown in the laboratory assemble, and polarized light to detect how the orientation of Gag changed as the membrane bends into a sphere. The experiments revealed that the virus particles started to form a sphere at the same time Gag began to gather at the cell membrane, before any ESCRTs were present. Once enough Gag proteins had accumulated, the ESCRTs were recruited to the spot and removed within tens of seconds, just before the virus was cut off from the host cell. This suggest that the ESCRTs may help prepare the membrane to split, but are not involved in the actual cutting process.

The findings of Johnson et al. will help us to better understand the behavior of HIV viruses. Knowing how they assemble and leave the host cell may help to create new strategies for disrupting these processes in particular, so stopping the virus from spreading. Moreover, ESCRTs are involved in numerous activities of a cell, such as cell division or repair of the cell surface after rupture, but little is known about how they work. For the first time, it has been shown that ESCRTs are neither the driving force for bending the membrane nor are they present when the cutting of a virus happens. This may also apply to other processes in the cell that involve membrane-splitting by ESCRT proteins, and researchers may be compelled to reevaluate their proposed role in other systems.



ESCRTs are categorized into groups −0 through -III and act in various cellular processes including cell division, multivesicular body formation, and wound repair (Hurley, 2015). An investigation of protein sorting between endosomes and lysosomes initially led to the discovery of ESCRT-I (Katzmann et al., 2001), with other ESCRTs identified soon afterwards (Babst et al., 2002a, 2002b; Katzmann et al., 2003). Sequential recruitment of the ESCRTs enables division of membrane compartments, with ESCRT-III being critical for the membrane scission process (Henne et al., 2013). ESCRT-IIIs have a five alpha-helix core structure and assemble in vitro into macromolecular rings or spirals (McCullough et al., 2015; Muzioł et al., 2006). ESCRT-IIIs are believed to polymerize in the neck of the membrane constriction to drive membrane fission (Cashikar et al., 2014; Dobro et al., 2013; Fabrikant et al., 2009; Hanson et al., 2008; Henne et al., 2012; Lata et al., 2008; McCullough et al., 2015).

Scission of the membrane, even in the presence of ESCRT-IIIs, stalls in the absence of the hexameric AAA+ ATPase (Morita et al., 2010), VPS4A/B, which contains a microtubule interacting and transport (MIT) domain that binds to MIT interacting motifs (MIM) of ESCRT-IIIs (Obita et al., 2007; Stuchell-Brereton et al., 2007). The final scission process is believed to be associated with VPS4 working on ESCRT-IIIs, but the mechanism is still unresolved. In some models, the ESCRT-IIIs provide the motive force for scission and the VPS4 is required after scission to recycle the ESCRT-IIIs for subsequent scissions (Lata et al., 2008; Wollert et al., 2009). In other models, the VPS4 is actively engaging the ESCRT-IIIs prior or during scission by actively remodeling ESCRT-IIIs in order to force scission (Saksena et al., 2009), by rearranging ESCRT-IIIs as part of the pathway toward scission (Cashikar et al., 2014), or by binding to ESCRT dome structures in order to add rigidity necessary for scission (Fabrikant et al., 2009).

ESCRT complexes are hijacked by HIV to enable separation of the viral particle from the host cell plasma membrane. The production of enveloped HIV-1 at the plasma membrane occurs with the recruitment of the structural protein Gag at individual assembly sites. The carboxyl terminus of Gag has a motif that is essential for recruitment of ESCRTs. First, Gag recruits the ‘early’ factors like ESCRT-I/TSG101 and ALIX which contribute to subsequent recruitment of ESCRT-III proteins. The ESCRT-IIIs then polymerize into structures that are believed to constrict the neck and drive membrane fission. HIV release appears to require fewer members of the ESCRT family than other processes. Redundancy likely makes many variants, such as CHMP5, CHMP6 and CHMP7, only conditionally necessary (Morita et al., 2011). ESCRT-IIIs that are essential for assembly of HIV-1 include CHMP2 (either A or B variant) and CHMP4B, which are recruited to site of budding with other proteins such as ESCRT-I/TSG101 and ALIX which interact with Gag (Morita et al., 2011). The reduced number of required ESCRTs makes HIV assembly an approachable system for studying the biophysics of ESCRT-mediated membrane scission.

Prior to viral particle separation from a host cell, a roughly spherical particle is formed (Martin-Serrano et al., 2003), but the topological pathway and timing of events to reaching the Gag sphere has not previously been followed in vivo. The order of some of the events in virion assembly has been resolved by live-cell microscopy. First, the HIV- genome is recruited to the membrane, potentially with a few Gag molecules (Jouvenet et al., 2009). Then, over a 5–30 min period, the Gag accumulates around the genome (Ivanchenko et al., 2009; Jouvenet et al., 2008). Once Gag reaches a steady-state, ESCRT-III and VPS4 are transiently recruited at the site of assembly (Baumgärtel et al., 2011; Bleck et al., 2014; Jouvenet et al., 2011). The timing of some critical steps is not known impacting our understanding of the mechanism. It is not known whether bending occurs before, during, or after the transient recruitment of ESCRTs. Thus, is membrane bending driven by Gag multimerization, by Gag engagement with the HIV-1 genome or by the ESCRTs? It is also not known if scission occurs before, during, or after the transient recruitment of ESCRT-IIIs or VPS4. Do they generate the force for scission, do they prepare the membrane for scission, or does VPS4 recycle ESCRT-IIIs after scission?

Here, we investigated, during the assembly of HIV Gag, the temporal recruitment of ESCRT-III proteins and VPS4 relative to membrane scission. We also examined membrane curvature during Gag assembly to determine when a spherical particle forms relative to ESCRT-III recruitment. We find that membrane bending occurs contemporaneous with recruitment of Gag and prior to arrival ESCRT-III. The ESCRT-IIIs and the VPS4 ATPase arrive after Gag assembly has concluded, remain at the membrane for tens of seconds, and then leave tens of seconds before scission. During the period after departure of the ESCRT-IIIs, neutralizing the surface charge on the membrane accelerates the membrane scission.


ESCRT-IIIs appear and disappear from site of virus-like particle assembly prior to scission

To determine the timing of ESCRT recruitment relative to membrane bending and scission, we quantified ESCRT recruitment during the assembly of HIV-1 virus like particles (VLPs) while assaying membrane bending and scission. Scission was assayed by monitoring the ability of protons to flow between the cytosol and the lumen of the virion. The pH in the lumen of the virion was monitored with a pH-sensitive GFP (pHlourin) (Miesenböck et al., 1998) fused to Gag (Jouvenet et al., 2008) while modulating the cytoplasmic pH by cycling the pCO2 every 10 s between 0 and 10%, thus an average of 5% pCO2 (Figure 1—figure supplement 1). CO2 rapidly diffuses across plasma membranes (Hulikova and Swietach, 2014; Simon et al., 1994) and is converted to carbonic acid by cytoplasmic carbonic anhydrase, altering the cytoplasmic pH. We have previously observed that Gag-pHlourin in a budded VLP is less sensitive to changes of pCO2 than in the cytosol, suggesting carbonic anhydrase is excluded from VLPs (Jouvenet et al., 2008).

At sites of VLP assembly, the average Gag-pHluorin fluorescence increase was similar to the increase of Gag-mEGFP (Jouvenet et al., 2008), but the intensity oscillated in sync with switching the pCO2 (Figure 1A, Figure 1—figure supplement 2, Figure 1—video 1 and Figure 1—video 2). At various times after Gag accumulation reached a steady-state maximum the magnitude of oscillations decreased, indicating a loss of the ability of protons to move between the VLP and cytoplasm due to scission. CO2 may still cross the VLP membrane after scission and enter via gaps in the lattice of the immature Gag lattice (Briggs et al., 2009; Carlson et al., 2008; Woodward et al., 2015; Wright et al., 2007). However, the greatly reduced sensitivity to pH indicates carbonic anhydrase is not present, consistent with analysis of cellular proteins in HIV particles by mass spectrometry (Ott, 2008). Not surprisingly, scission was never observed before Gag had finished accumulating at individual VLPs. Unexpectedly, the ESCRT-III CHMP4B both appeared (Avg = 59 s, N = 30 out of 30) and disappeared (Avg = 22 s, N = 27 out of 30) prior to scission (Figure 1B).

Figure 1 with 8 supplements see all
ESCRT-IIIs and VPS4A transiently recruited prior to scission.

(A) Example trace of Gag-pHluorin assembling into single VLP while the pCO2 in the imaging media was repeatedly switched between 0% and 10% every 10 s. Moment of scission is indicated by red dashed line. CHMP4B-mCherry was temporarily recruited (indicated by grey zone) to the site of VLP assembly following the loss of pH modulation sensitivity. (B) Histograms of appearance and disappearance of CHMP4B prior to scission. (C-H) Example traces and histograms of appearance and disappearance, relative to scission of the VLP, for mCherry-CHMP2A (C and D), mCherry-CHMP2B (E and F) and mCherry-VPS4A (G and H).


CHMP4B has been proposed to form a circular/spiral structure which supports assembly of a smaller CHMP2(A/B) dome which generates fission by pulling the neck together (Fabrikant et al., 2009). Thus, it is possible that CHMP4B may be removed prior to scission leaving CHMP2A or CHMP2B present to facilitate fission. To probe the timing of CHMP2, endogenous CHMP2A and CHMP2B were lowered with siRNA (Figure 1—figure supplement 3) to facilitate observation of mCherry-CHMP2A or mCherry-CHMP2B (Figure 1C and E, Figure 1—figure supplement 2). CHMP2A and CHMP2B both appeared (Avg. = 77 s, N = 29 out of 29; and 63 s, N = 23 out of 23, respectively) and disappeared prior to scission (Avg. = 23 s, N = 26 out of 29; and 27 s, N = 23 out of 23, respectively Figure 1D,F). This observation indicates their assembly and disassembly is also not physically forcing scission.

Next the dynamics of recruitment of VPS4, the energy providing ATPase, was monitored (Figure 1G and Figure 1—figure supplement 2, Figure 1—video 3 and Figure 1—video 4). Similar to the ESCRT-IIIs, VPS4A also appeared prior to scission (Avg = 42 s, N = 28 out of 28) and disappeared prior to scission (Avg = 17 s, N = 27 out of 28, Figure 1H). On average VPS4A disappeared from the assembly site closer to the time of scission than CHMP4B (5 s), CHMP2A (6 s) or CHMP2B (10 s). A simultaneous measurement of CHMP4B and VPS4A confirmed CHMP4B was recruited ~5 s prior to VPS4A (N = 41) (Figure 1—figure supplement 4), which agrees with previous results in HeLa cells (Bleck et al., 2014).

Acidification of cytosol accelerates scission

Our results indicate that the ESCRT-IIIs and the ATPase VPS4 leave the membrane prior to scission. It is possible that the ESCRT-IIIs play an essential role in tightening the membrane neck, but then need to be cleared away to allow for the opposing membranes to come closer for the scission reaction. The specific lipid composition in the neck is not known. However, both HIV-1 Gag and the ESCRT complexes are recruited to regions rich in phosphatidylinositol-4,5-bisphosphate (PIP2), which has four negative charges at pH 7 (Kooijman et al., 2009), with the net negative charge being the critical parameter for engaging ESCRTs (Lee et al., 2015). Thus, ESCRTs at the neck may bias the composition toward more negatively charged lipids (Chiaruttini et al., 2015). The pKa values for the two phosphate groups on the inositol of PIP2 are 6.5 and 7.7 (van Paridon et al., 1986). The change in pHluorin intensity from 0 and 10% pCO2, indicates the cytosolic pH ranges from ~7.5 to ~6.5. Therefore, lowering the pH by raising the pCO2 to 10% should protonate and reduce the charge of these negatively charged lipids thus reducing the repulsive force between the membranes. To test if scission was affected by changes in cytosolic pH, we switched the pCO2 at a slower rate, every 120 s (Figure 2, Figure 2—video 1 and Figure 2—video 2). Scission was ~3X more likely when the cytoplasm was in the low pH state (10% pCO2) than the high pH state (0% pCO2) (Figure 2F) consistent with the idea that scission is more likely when the net negative charge on phospholipids in the viral neck is reduced by protonation. Other common phospholipids like phosphatidic acid (PA), phosphatidylethanolamine (PE), phosphatidylcholine (PC), phosphatidylserine (PS), and phosphatidylglycerol (PG), have pKa values outside the pH range used in these experiments so are not expected to be as sensitive to charge modulation during pH switching as PIP2. However, other lipids or components with pH-dependent charge sensitivity might also or alternatively result in these observations.

Figure 2 with 2 supplements see all
Scission more likely at lower cytoplasmic pH.

(A) Example traces of Gag-pHluorin assembly while pCO2 was switched every 120 s between 0% (red dashed line, greater fluorescence emission) and 10% (black dashed line, lower fluorescence emission). In these traces the fluorescence intensity became fixed in the low pH state (10% pCO2) after reaching an assembly plateau. VPS4A appeared and disappeared during the first low pH state. (B) Examples in which fluorescence intensity became fixed in the high pH state (0% pCO2). VPS4A appeared and disappeared during the first trapped high pH state. (C) Example in which fluorescence became fixed in low pH state. VPS4A disappeared during the first trapped low pH state, but appeared during the previous high pH state. (D) Example in which fluorescence became fixed in high pH state. VPS4A disappeared during the first trapped high pH state, but appeared during the previous low pH state. (E) Example trace in which fluorescence intensity because fixed in an intermediate state. (F) Bar graph of cytoplasmic pH condition in which scission occurs (N = 45). Scission is ~3-fold more likely at low pH (10% pCO2) compared to high pH (0% pCO2) condition. A small percentage of VLPs were trapped in an intermediate state.


Additional rounds of ESCRT-III/VPS4 recruitment occur following failed scission

Multiple rounds of ESCRT-III/VPS4 recruitment were previously observed following completion of Gag accumulation (Baumgärtel et al., 2011; Jouvenet et al., 2011). It is possible that the first wave of ESCRT-III/VPS4 led to productive scission and the subsequent rounds are inconsequential. Alternatively, the initial waves could be non-productive, perhaps a consequence of a failure to recruit both ESCRT-IIIs and VPS4A concurrently, necessitating additional rounds. While simultaneously imaging Gag-pHluorin, CHMP4B and VPS4A, when there were multiple waves, both CHMP4B and VPS4A were recruited (Figure 3). Multiple waves of recruitment were observed in ~20% of traces, consistent with our previous observations of repeat rounds of recruitment of CHMP1B, CHMP4B, CHMP4C and VPS4A during assembly of HIV-1 and EIAV (Jouvenet et al., 2011). Scission was only observed after the final wave of recruitment of ESCRT-III/VPS4 (Figure 3B,C). Thus, not every cycle of arrival and then dispersal of ESCRT-III/VPS4 leads to subsequent scission. If scission does not occur then a subsequent cycle of recruitment and dispersal of the ESCRT-III/VPS4 is required to complete the process. If the function of VPS4A is to recycle ESCRT-IIIs after scission then only a single wave would be expected since ESCRT-IIIs would not be removed until after the single scission event has occurred.

A new round of ESCRT-III recruitment required following failed scission event.

(A) Example traces of multiple waves of VPS4A and CHMP4B recruited following cessation of Gag accumulation. (B) Example trace of multiple recruitments of VPS4A prior to scission (red dashed line). (C) Example traces of multiple recruitments of CHMP4B prior to scission (red dashed line).


Membrane bending occurs throughout assembly of virus-like particle

Next, we set out to determine when membrane bending occurs relative to the assembly of Gag and recruitment of ESCRT-IIIs. We expressed a fluorescent protein (either EGFP or one of two circularly permutated superfolder variants, sf3 or sf11 (Pédelacq et al., 2006) as a fusion to Gag (at the carboxyl terminus, p6-GFP, or in the matrix protein of Gag, MA-sf3 or MA-sf11) to be able to follow membrane bending in live-cell imaging via changes in anisotropy of the GFP tag.

The orientation of the chromophore was characterized with a custom built polarized total internal reflection fluorescence (TIRF) illuminator (Johnson et al., 2014). During accumulation of Gag at VLPs, the emission of the GFP was quantified while excitation alternated with polarization perpendicular (p^ polarized) followed by parallel (s^ polarized) to the glass surface. Orientation was characterized by the ratio of emission intensities (P/S) and total Gag was monitored by P+2S (Figure 4A and Figure 4—figure supplement 1, Figure 4—video 1 and Figure 4—video 2) (Anantharam et al., 2010). As Gag accumulated, the ratio of P/S dropped from ~2 to ~1.4, with little variation (±0.1) between the Gag-GFP versions (Figure 4B). The drop in P/S correlated with the increase in Gag as would be expected if the plasma membrane was bending during Gag assembly. The halfway decrease of P/S occurred prior to the halfway increase of the total Gag fluorescence (Figure 4C). Following Gag recruitment, as indicated by a plateau in Gag signal, there was no transition in P/S. This observation is inconsistent with the subsequent recruitment of the ESCRT-IIIs facilitating the transition from a flat lattice to a spherical particle.

Figure 4 with 4 supplements see all
Structural changes in VLPs throughout Gag accumulation.

(A) Example traces of wild-type Gag-GFP (black line, sf3 in Matrix of Gag) and Gag-∆p6 (grey line, missing ESCRT-I recruiting p6 domain) assembling into single VLPs. Images were collected every 30 s with excitation illumination polarized either perpendicular (p^) or parallel (s^) to the glass surface. Total Gag characterized by P+2S (top) and relative average dipole orientation by P/S (bottom). P+2S from wild-type Gag was fit to an exponential and used to predict an expected P/S (blue dashed line) assuming membrane bending throughout assembly. (B) Comparison of average P/S from all traces before VLP assembly (membrane background) and after VLP assembly (plateau region) for three different tagged versions of wild-type Gag. p6-GFP (N = 8), MA-sf3 (N = 9), and MA-sf11 (N = 7). Error bars represent s.d. (C) To compare the evolution of VLP structure to the assembly of Gag the time for each assembly trace was normalized from 0 (beginning of Gag assembly) to 1 (end of Gag assembly). A normalized time difference for each trace between Gag half assembly [½ (P+2S)max] and the dipole half drop [½ (P/S)max] was found and all normalized differences were compiled into a histogram. (D) Illustration of sphere budding from flat membrane. (E) Illustration of coordinate system with θ and ϕ representing position on the sphere and β and ψ representing orientation of excitation dipole. (F) Predicted P/S when β = 45°, background intensity is 45% of full assembly intensity, and evanescent field penetration depth is the same as the radius of the VLP.


Bending was also investigated during the assembly of a Gag that is missing its carboxyl terminal p6 domain which functions to recruit early acting proteins like ESCRT-I/TSG101 or ALIX. A similar drop in P/S during assembly of Gag was observed with Gag-∆p6 (Figure 4A, Figure 4—figure supplement 2) indicating that the ESCRTs recruited via p6 are also not necessary for the transition from a flat lattice to a spherical particle.

A simulation of spherical budding reproduced the time course of the P/S ratio relative to P+2S

In order to better understand the observed P/S ratio, we formulated an expected P/S ratio for a spherical cap growing out of a flat membrane (Figure 4D). Briefly, we assumed the growing bud consisted of excitation dipoles uniformly distributed across the surface, with the dipoles oriented an angle β relative to the surface normal. A predicted P/S with respect to β and the normalized budded surface area (area from 0 to 1) was then found by integrating over all defined dipole orientations and the extent budded surface area.

More specifically, using coordinates described previously (Anantharam et al., 2010), position on the surface of the sphere was given in terms of a polar angle θ and an azimuthal angle ϕ, and the current extent budded was defined by θ (Figure 4E). Thus, when θ=0 there was no budding, when θ=90 the sphere was half budded with dipoles from θ=090, and when θ=180 the sphere was fully budded with dipoles from θ=0180. A uniform distribution of excitation dipoles was assumed on the bud (no dependence on ϕ or θ); however, at any given position these dipoles had an angular distribution that depended on the polar angle β relative to the surface normal: ρ(β). For instance, if all dipoles were oriented at β=45 then ρ(β)=δ(β45) where δ(x) is a delta function. The angular distribution was assumed to be uniform relative to the surface azimuthal angle ψ and the sphere was assumed to be smaller than the optical resolution of the microscope.

A predicted P/S (ρ(β)) relative to extent budded θ was found by determining the average component of the dipole excitation in y^ (parallel to glass surface) and in z^ (normal to glass surface). Note: Experimentally due to azimuthal scanning we excited in both x^ and y^, each 50% the time, but for simplicity in this analysis 100% excitation in y^ was assumed since x^ and y^ are symmetric. The total collected fluorescence, S and P, in y^ and z^ were predicated by:

(1) S=0θ02π0π02πQEy^μy^2 sin(θ) sin(β) dψdβdϕdθ
(2) P=0θ02π0π02πQEz^μz^2 sin(θ) sin(β) dψdβdϕdθ

where μy^ and μz^ are the components of the excitation dipole in y^ and z^ with respect to positon on the bud surface, Ey^ and Ez^ are the excitation electric field components in y^ and z^, and Q and Q are the light collection efficiencies of the microscope objective for dipoles parallel and perpendicular to the glass surface. The excitation field intensity in y^ and z^ were assumed to be the same, though this was an approximation since in reality p^ had a small component of s^ (Sund et al., 1999). In addition, in TIR the excitation field decayed exponentially with distance from the glass surface, Ey^ or y^=Eez/2d=Ee(1cos(θ))/2d where the characteristic decay constant was defined in terms of a fraction of the radius of the VLP. The collection efficiency for emission parallel Q versus perpendicular Qwere also assumed to be the same (Q=Q), which was an approximation based on the use of a high numerical aperture objective (Anantharam et al., 2010). From coordinate transforms described previously (Anantharam et al., 2010; Sund et al., 1999), the components of the dipoles in y^ and z^ are given by:

(3) μy^=ρ(β)[cos(θ)sin(ϕ)sin(β)cos(ψ)+cos(ϕ)sin(ψ)sin(β)+sin(θ)sin(ϕ)cos(β)]
(4) μz^=ρ(β)[sin(θ)sin(β)cos(ψ)+cos(θ)cos(β)]

P/SVLP(θ,ρ(β)) was solved computationally (Mathematica, Wolfram) with θ parameterized in terms of normalized surface area (A:01) as θ=cos1(12A). In addition, contribution from fluorescence outside of the puncta was accounted for as follows:

(5) P/S(A,ρ(A),Cback)=AP/SVLP(A,ρ(A))+CbackP/SBackgroundA+Cback

where Cback was the background intensity relative to final VLP intensity and P/SBackground was the ratio of fluorescence when puncta A=0, that is P/SBackground=P/SVLP(0,ρ(0)).

We found an angle β=45,Cback=0.45, and d=1 approximately replicated the observed results (Figure 4A and F), reproducing the t1/2 of P+2St1/2 of P/S of 0.16 (normalized time) (Figure 4B). In Figure 4A an exponential fit to P+2S was assumed in order to directly equate the VLP area to the predicted P/S. Similar results were obtained by using a uniform distribution of dipoles over an angular range, such as β between 0° to 68.5° or 20° to 63.5°. Thus, our observation is consistent with formation of a spherical bud throughout the recruitment and multimerization of Gag (Woodward et al., 2015; Carlson et al., 2008), and is independent of the presence of early acting factors like ESCRT-I/TSG101 or ALIX (Figure 4—figure supplement 2). The bending also occurs many minutes before the recruitment of ESCRT-IIIs.


In retroviral assembly, the late domains of Gag are believed to indirectly recruit ESCRT-IIIs which then polymerize into ring or spiral structures at the bud neck to drive bending and scission of the neck membrane (Cashikar et al., 2014; Fabrikant et al., 2009; Hanson et al., 2008). However, our observations compel a new formulation of the role of ESCRTs in bending and scission. First, the initial bending of the membrane from a flat sheet to a spherical bud occurs during Gag assembly and does not require factors recruited by the late domains like ESCRT-1/TSG101 or ALIX. This bending also occurs prior to the arrival of ESCRT-IIIs and thus ESCRT-IIIs are also not required to initiate curvature. Instead, this process may be encouraged by Gag multimerization (Briggs et al., 2009; Wright et al., 2007). Second, the ESCRT-IIIs are only recruited after the accumulation of Gag is complete, indicating that Gag is not sufficient for recruitment. Third, the ESCRT-III/VPS4 are only recruited for tens of seconds and can no longer be detected at the moment of scission. While the ESCRTs and VPS4 cannot be detected in the tens of seconds prior to scission, it does not eliminate the possibility that a subpopulation of fewer than 20% of the ESCRT-III/VPS4, which are not detectable in the background fluctuations, stay around for a longer period of time (further discussed in Materials and methods).

Factors beyond the late domains which might assist ESCRT-III recruitment include activation through ubiquitination or phosphorylation of Gag or one of the early ESCRTs, such as ESCRT-II (Meng et al., 2015) or ESCRT-I/TSG101, which is co-recruited along with Gag (Bleck et al., 2014; Jouvenet et al., 2011). Additionally, ESCRT-III recruitment might be facilitated by high curvature in the neck or specific lipids recruited to these regions (Lee et al., 2015). These conditions may also facilitate recruitment of ESCRT-IIIs even in the absence of ESCRT-I or ESCRT-II, although likely at lower rates, potentially accounting for the much slower viral particle release rates (Bendjennat and Saffarian, 2016; Meng et al., 2015). The observation that the bulk of measured curvature of the nascent virion occurs prior to the recruitment of ESCRT-IIIs does not rule out any role for ESCRTs in membrane curvature. Indeed, the transient recruitment of ESCRT-IIIs may further constrict the neck linking the virion to the cell to prepare it for scission. The ESCRT-IIIs might facilitate scission by polymerizing into a spiral structure to constrict the neck (‘polymerization constriction’) (Cashikar et al., 2014; Wollert et al., 2009) or into a ring which when removed constricts the neck (‘purse string constriction’, Figure 5) (Saksena et al., 2009). The VPS4 may remove the ESCRT-IIIs potentially acting as a unfoldase (Yang et al., 2015). VPS4 may also remodel the ESCRT-IIIs throughout polymerization, potentially rearranging or tightening the structure (Cashikar et al., 2014). Remodeling is consistent with our observation that recruitment of VPS4 was virtually contemporaneous with the ESCRT-III, with a slight 5 s lag in HEK293T cells and 10 s in HeLa cells (Bleck et al., 2014).

Proposed temporal model of ESCRT-III-mediated scission of HIV from cell plasma membrane.

(I) The viral particle structure changes throughout accumulation of Gag until (II) a spherical topology prevents incorporation of additional Gags. (III) ESCRT-IIIs (examples: CHMP2, CHMP4) are recruited to the neck and polymerize, with (IV) removal by VPS4 resulting in constriction of the neck. (V) After removal of all ESCRT-IIIs the narrow neck undergoes spontaneous fission, (VI) freeing the virus. If membrane fission does not occur a new round of ESCRT-III recruitment is required (VII).


We suggest that fission can only occur when the neck is narrow and after the ESCRT-IIIs are removed (Figure 5). What is driving the scission event if ESCRT-IIIs are gone? When the neck is sufficiently narrow (a few nm) fission may be a spontaneous event, possibly through a hemifission intermediate (Fabrikant et al., 2009; Kozlovsky and Kozlov, 2003; Liu et al., 2006). Narrowing of the neck by ESCRT-IIIs may allow additional Gag molecules adjacent to the neck to oligomerize, thereby keeping the constricted structure stable while the ESCRTs are displaced. However, cryo-EM images indicate a gap in the Gag lattice might be present at the site of the neck (Carlson et al., 2008). Alternatively, constriction might encourage exchange or modification of phospholipids with shapes and charges that help to retain a narrow neck following ESCRT-III disappearance. The ESCRT-IIIs are dependent on phospholipids with negative charges. This could explain the greater than three fold increased scission rate at a lower pH (10% pCO2), which would raise the proton concentration to that of the pKa (6.5 and 7.7) (van Paridon et al., 1986), thereby reducing the surface charges (Figure 2F). If scission does not occur sufficiently soon after removal of ESCRT-IIIs, a new round of ESCRT-III recruitment and assembly is required to achieve scission (Figure 3).

Materials and methods

Key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
Cell line (H. sapiens)HEK-293TBieniasz Lab
Cell line (H. sapiens)HeLaATCC
Transfected construct
(HIV-1, A. victoria)
Gag-mEGFPBleck et al. (2014)
Transfected construct
(HIV, A. macrodactyla)
Gag-mTagBFPBleck et al. (2014)
Transfected construct
(A. victoria, H. sapiens)
pLNCX2-mEGFP-VPS4ABleck et al. (2014)
Transfected construct
(A. marginale, H. sapiens)
pLNCX2-mCherry-CHMP4BBleck et al. (2014)
Transfected construct
Gag∆p6Bleck et al. (2014)
Transfected construct
pCR3.1/Syn-GagJouvenet et al. (2008)
Transfected construct
(HIV, A. victoria)
pCR3.1/Syn-Gag-pHluorinJouvenet et al. (2008)
Transfected construct
(A. marginale, H. sapiens)
pLNCX2-mCherry-CHMP2AThis studyCHMP4B in pLNCX2-mCherry-
CHMP4B was replaced by CHMP2A
from HEK293T cDNA library
Transfected construct
(A. marginale, H. sapiens)
pLNCX2-mCherry-CHMP2BThis studyCHMP4B in pLNCX2-mCherry-
CHMP4B was replaced by CHMP2B
from HEK293T cDNA library
Transfected construct
(A. marginale, H. sapiens)
This studyadded six silent point mutations
to pLNCX2-mCherry-CHMP2A
using site directed mutagenesis
Transfected construct
(A. marginale, H. sapiens)
This studyadded six silent point mutations
to pLNCX2-mCherry-CHMP2B
using site directed mutagenesis
Transfected construct
(A. marginale, H. sapiens)
pLNCX2-mEGFP-CHMP2AThis studyreplaced mCherry in pLNCX2-
mCherry-CHMP2A with EGFP
(pEGFP-N1, Clontech)
Transfected construct
(A. marginale, H. sapiens)
pLNCX2-mEGFP-CHMP2BThis studyreplaced mCherry in pLNCX2-
mCherry-CHMP2B with EGFP
(pEGFP-N1, Clontech)
Transfected construct
(A. marginale, H. sapiens)
pLNCX2-mCherry-VPS4AThis studyreplaced mEGFP in pLNCX2-
mCherry-VPS4A (Bleck et al., 2014)
with mCherry (pmCherry- N1, Clontech)
Transfected construct
(HIV, A. victoria)
Gag-∆p6-mEGFPThis studyp6 domain removed from Gag-mEGFP
using site directed mutagensis
Transfected construct
(HIV, A. victoria)
Gag-MA-sf3This studysf3 GFP (Pédelacq et al., 2006)
inserted in pCR3.1/Syn-Gag
Transfected construct
(HIV, A. victoria)
Gag-MA-sf11This studysf11 GFP (Pédelacq et al., 2006)
inserted in pCR3.1/Syn-Gag
CHMP2A DsiRNAIntegrated DNA
CHMP2A DsiRNA (reverse)Integrated DNA
CHMP2B DsiRNAIntegrated DNA
CHMP2B DsiRNA (reverse)Integrated DNA
Chemical compound,
DMEMThermo Fisher
Chemical compound,
Chemical compound,
Software, algorithmMetamorphMolecular Devicesversion 7.8.10
Software, algorithmImageJSchneider et al. (2012)version Fiji
Software, algorithmLabViewNational Instrumentsversion 2013
Software, algorithmMicroscope-ControlJohnson, 2018c)LabView Code
Software, algorithmAverage-puncta-centerJohnson, 2018a)LabView Code
Software, algorithmPuncta-FitJohnson, 2018d)LabView Code
Software, algorithmCO2-switch-analysisJohnson, 2018b)LabView Code

Plasmid construction

Request a detailed protocol

Plasmids Gag-mEGFP, Gag-mTagBFP, pLNCX2-mEGFP-VPS4A and pLNCX2-mCherry-CHMP4B, Gag-∆p6 were described in Bleck et al. (2014), and the plasmids pCR3.1/Syn-Gag and pCR3.1/Syn-Gag-pHluorin were described in Jouvenet et al. (2008). The Gag in this study was based on the sequence from HIV-1 clone HXB2 (Kotsopoulou et al., 2000).

pLNCX2-mCherry-CHMP2A-siRNAres and pLNCX2-mCherry-CHMP2B-siRNAres were generated as follows. CHMP2A and CHMP2B were PCR amplified (Platinum PCR SuperMix, Thermo Fisher) from a cDNA library created from HEK293T cells (made via Invitrogen SuperScript III CellDirect kit #46–6320). PCR primers for CHMP2A (NM_014453.3) were 5’-GCGCTCCGGACTCAGATCCCCGGAATTCATGGACCTATTGTTCGGGCG-3’ and 5’-GCGCCTCGAGTCAGTCCCTCCGCAGGTTCT-3’ and primers for CHMP2B (NM_014043.3) were 5’-GCGCTCCGGACTCAGATCCCCGGAATTCATGGCGTCCCTCTTCAAGAA-3’ and 5’-GCGCCTCGAGCTAATCTACTCCTAAAGCCT-3’. After PCR amplification, the fragments were digested with XhoI and BspEI (New England BioLabs, Ipswich, MA) and ligated into the plasmid pLNCX2-mCherry-CHMP4B (which was first digested with the same restriction enzymes to remove CHMP4B) using T4 DNA Ligase (New England BioLabs) yielding the plasmids pLNCX2-mCherry-CHMP2A and pLNCX2-mCherry-CHMP2B. Six silent coding mutations were then incorporated into these plasmids (QuickChange Lightning Site-Directed Mutagenesis Kit, Agilent, Santa Clara, CA) to make them insensitive to siRNA knockdown targeted at the cellular CHMP2A and CHMP2B RNA. The primers for the CHMP2A site-directed mutagenesis were 5'-ACCTGGGACACCACAGCATCGCTTTCTTCCTCGTCCTCCTCATCACCCATGGCATC-3’ and 5'-GATGCCATGGGTGATGAGGAGGACGAGGAAGAAAGCGATGCTGTGGTGTCCCAGGT-3’ and for CHMP2B were 5’-AACCGTGGATGATGTAATAAAGGAGCAAAACCGTGAATTACGAGGTACACAGAGGGCTAT-3’ and 5’-ATAGCCCTCTGTGTACCTCGTAATTCACGGTTTTGCTCCTTTATTACATCATCCACGGTT-3’. The siRNA sequence for CHMP2A knockdown was 5’-rArArGrArUrGrArArGrArGrGrArGrArGrUrGrAdTdT-3’ (begins at position 464 in NM_014453.2) and for CHMP2B was 5’-rGrGrArArCrArGrArArUrCrGrArGrArGrUrUrAdTdT-3’ (begins at position 45 in NM_014043.3) (Morita et al., 2011). The forward and reverse DsiRNA for CHMP2A knockdown was 5'-rArArGrArUrGrArArGrArGrGrArGrArGrUrGrArUrGrCrUdGdT-3' and 5'-rArCrArGrCrArUrCrArCrUrCrUrCrCrUrCrUrUrCrArUrCrUrUrCrC-3'. The forward and reverse DsiRNA for CHMP2B knockdown was 5'-rGrGrArArCrArGrArArUrCrGrArGrArGrUrUrArCrGrArGdGdT-3' and 5'-rArCrCrUrCrGrUrArArCrUrCrUrCrGrArUrUrCrUrGrUrUrCrCrUrU-3'. All ssDNA and ssRNA oligos were purchased from Integrated DNA Technologies (Coralville, IA) and manufacturers’ protocols were used for all preparations.

pLNCX2-mEGFP-CHMP2A and pLNCX2-mEGFP-CHMP2B were generated by replacing mCherry in pLNCX-mCherry-CHMP2A and pLNCX-mCherry-CHMP2B with monomeric variant (A206K) of mEGFP from pEGFP-N1 (Clontech/Takara Bio USA, Mountain View, CA). Restriction enzymes AgeI and BspEI (New England BioLabs) were used to digest the backbone and fragments, and these fragments were then ligated into the backbones with T4 DNA ligase. The clonal HeLa cell lines were generated from these plasmids using a previously described protocol (Bleck et al., 2014). pLNCX2-mCherry-VPS4A was generated by replacing mEGFP in pLNCX2-mCherry-VPS4A (Bleck et al., 2014) with mCherry. mCherry was PCR amplified from pmCherry-N1 (Clontech) using In-Fusion recombination primers 5'-CTCTAGCGCTACCGGTCGCCACCATGGTGAGCAAGGGC-3’ and 5'-CTCTAGCGCTACCGGTCGCCACCATGGTGAGCAAGGGC-3’. pLNCX2-mEGFP-VPS4A was digested with AgeI and BspEI and the fragment containing VPS4A was gel purified (Thermo Fisher PureLink Quick Gel Extraction Kit). The PCR product was then inserted into purified backbone using In-Fusion HD Cloning Kit (Clontech) according to manufacturer’s instructions.

Gag-∆p6-mEGFP was generated by deleting p6 and SP2 from Gag-mEGFP via site-directed mutagenesis (QuickChange Lightning Site-Directed Mutagenesis Kit). The following primers were used for the deletion 5'- TACTGAGAGACAGGCTAATTCGGATCCACCGGT-3'; 5'- ACCGGTGGATCCGAATTAGCCTGTCTCTCAGTA −3'. Gag-MA-sf3 and Gag-MA-sf11 were generated by inserting the circularly permuted superfolder GFPs (provided by Jeffrey Waldo lab) (Pédelacq et al., 2006) into a variant of pCR3.1/Syn-Gag that has an EcoRV restriction enzyme site near the carboxy terminal of MA (Asn-Gln-Val-Ser modified to Asn-Gln-Asp-Ile-Val-Ser). Circularly permuted version 3 was PCR amplified with recombination In-Fusion primers 5’-CACAGCAACCAGGATGGCAGCAGCCATCATCATC-3’ and 5’-GTTCTGGCTGACGATGGTACCTCCAGTAGTGCAAATAA-3’. The primers for circularly permuted version 11 were 5’-CACAGCAACCAGGATGGCAGCAGCCATCATCATC-3’ and 5’-GTTCTGGCTGACGATGGTACCATCTTCAATGTTGTGG-3’. After digesting pCR3.1/Syn-Gag-EcoRV with EcoRV (New England BioLabs) the In-Fusion HD kit was used to insert PCR fragments into the Syn-Gag backbone.

Sample preparation

Request a detailed protocol

With the exception of 120 s pCO2 switching data, all imagings were conducted in HEK293T cells grown in DMEM (#11965, Thermo Fisher Scientific, Waltham, MA) with 10% FBS (#F4135, MilliporeSigma, St. Louis, MO). HEK293T cells were gift from P. Bieniasz Laboratory and were not further authenticated but tested negative for mycoplasma contamination. 120 s pCO2 switching experiments imaged in HeLa cells which were grown in the same growth medium. HeLa cells were from ATCC and were not authenticated or tested for mycoplasma contamination. For polarization excitation experiments, cells were grown on 35-mm glass bottom dishes (#P35G-1.0–20 C, MatTek, Ashland, MA) coated with fibronectin (#33010, Thermo Fisher) by incubating the dish with 10 µg/ml fibronectin in PBS for 1 hr. For pCO2 switching experiments, perfusion slides (#80186 µ-Slide, Ibidi, Martinsried, Germany) were incubated with 60 µg/ml fibronectin in PBS for 1 hr before plating cells. For all experiments, cells at ~ 75% confluency were transfected with expression plasmids ~3.5 hr prior to beginning to image. For transfection 8 µl of Lipofectamine2000 (#11668, Thermo Fisher) was incubated for 5 min in 250 µl of Opti-MEM I (#31985, Thermo Fisher) and 2000 µg of DNA was incubated for 5 min in 250 µl of Opti-MEM I. Both solutions were then mixed and incubated for 20 min before adding to adhered cells on MatTek dish in 2000 µl of DMEM. The same procedure was used for cells in the flow slide, but the transfection mixture was added to 2000 µl of DMEM and then 1000 µl was perfused through the chamber. At least four cells were used for each experimental condition in order to account for potential variability between cells. Both CHMP2A and CHMP2B were knocked down with siRNA for mCherry-CHMP2A and mCherry-CHMP2B experiments. siRNA transfections were conducted 48 hr prior to DNA plasmid transfection using Lipofectamine RNAiMAX (following manufacturer’s instructions; #13778, Thermo Fisher). A second round of siRNA transfection was performed at the time of DNA transfection.

The open-reading frame was verified via sequencing for all plasmids and the following DNA ratios were used for transfections: Gag:Gag-mEGFP (4:1), Gag:Gag-MA-sf3 (4:1), Gag:Gag-MA-sf3 (4:1), Gag-∆p6:Gag-∆p6-mEGFP (4:1), Gag:Gag-pHluorin:mCherry-VPS4A (12:3:5), Gag:Gag-pHluorin:mCherry-CHMP4B (12:3:5), Gag:Gag-pHluorin:mCherry-CHMP2A-siRNAres (4:1:5), Gag:Gag-pHluorin:mCherry-CHMP2B-siRNAres (4:1:5), Gag:Gag-TagBFP:mEGFP-VPS4A:mCherry-CHMP4B (24:6:5:5). Note: The Gag to tagged Gag ratio was 4:1 in all experiments.

CO2 modulation system

Request a detailed protocol

Gas from compressed cylinders was bubbled into two imaging media reservoirs (140 ml open piston Monoject syringe, Medtronic, Minneapolis, MN) partially filled with cell imaging media (10 mM HEPES, 9.7 g/L of Hanks BBS (MilliporeSigma), and NaOH to adjust the pH to 7.4) with 1% FBS. One reservoir was equilibrated with compressed air (labeled 0% in these experiments but actually contained 0.04% CO2), and the other reservoir was equilibrated with 10% CO2 (balanced with air) (Figure 1—figure supplement 1). The reservoirs were mounted to a flow perfusion system (ValveBank II, AutoMate Scientific, Berkeley, CA), which enabled automated selection of desired media via solenoid valves under the reservoirs. Tygon tubes (R-3603) from each valve carried the media to a fluid combiner just prior to the perfusion slide chamber containing adhered cells. After the flow chamber, a single tube carried the discharge media to a collection container. This container was placed below the height of equilibration reservoirs so that fluid flow was driven by gravity. The flow rate (~3 ml/min) was controlled with a clamp regulator attached to the discharge tube. At this flow rate, the response time of the fluorophores to a pCO2 change, characterized in terms of an exponential decay constant, was ~7 s. A peristaltic pump (MS-Reglo, Ismatec/Cole-Parmer, Wertheim, Germany) then passed the media from the collection reservoir back to the equilibration reservoirs so that the media could be recycled. The microscope and entire imaging media flow system were enclosed in a temperature control box held at 37°C. Valve regulation, camera trigger and laser excitation were all controlled via custom software (https://github.com/SimonLab-RU/Microscope-Control; copy archived at https://github.com/elifesciences-publications/Microscope-Control) written in LabView (National Instruments, Austin, TX).

Imaging with pCO2 switching

Request a detailed protocol

For experiments with pCO2 switching every 10 s the media was continuously flowed through the imaging chamber, with the reservoir supplying the media being switched every 10 s. Two images were collected every 2.5 s (4.0 s for CHMP4B experiments) with 488 nm excitation for pHluorin (100 ms exposure with power between 1 and 5 mW), followed by 594 nm excitation for mCherry (100 ms exposure with laser power between 5 and 20 mW; 100 mW DPSS laser, Cobolt, Solna, Sweden). A multipass emission filter (zet405/488/594 m, Chroma Technology, Bellows Falls, VT) enabled rapid sequential wavelength imaging. For experiments with pCO2 switching every 120 s the desired media was only applied to the chamber for 10 s, followed by no flow for 110 s. During this time sequential 488 nm (100 ms, 1 mW) and 594 nm (100 ms, 1 mW) excitation images were captured every 10 s. All experiments were conducted with 100 Hz azimuthal scanning TIRF microscopy illumination.

Temporal determination of scission

Request a detailed protocol

The cytosolic pH was oscillated by switching the pCO2 from 0% to 10% (for an average of 5%) every 10 s or every 120 s. The cytosolic carbonic anhydrase ensures that the pH in the cytosol closely tracks the pCO2 (Simon et al., 1994). At scission, the luminal pH of the VLP or virion is no longer continuous with the cytosol and no longer tracks the cytosolic pH. Individual VLPs were identified from the Gag-pHluorin images using Metamorph (version 7.8.10, Molecular Devices, Sunnyvale, CA) and the peak pixel amplitude in a 15 pixel (975 nm) diameter regions of interests centered on individual VLPs was found for all frames (Figure 1, Figure 1—figure supplement 2).

For switching every 10 s, we used a custom LabView software lock-in amplifier to find changes in VLP sensitivity to pCO2 modulation (https://github.com/SimonLab-RU/CO2-switch-analysis; copy archived at https://github.com/elifesciences-publications/CO2-switch-analysis). The data were high-pass filtered (2-pole Butterworth with 0.01 Hz cutoff) to bias the pCO2-dependent pHluorin intensity fluctuations (with a period of 20 s) around 0. This signal was then multiplied by an in-phase sine wave with the same period and a moving average was calculated over a period of 60 s. A significant change in signal indicated a change in sensitivity to pCO2 modulation. At many of the identified VLPs, a clear transition from a high plateau to a low plateau in the lock-in signal was observed (Figure 1—figure supplement 2). The moment of scission was classified as the halfway amplitude between the two plateaus, with half of the moving window containing pre-scission data and the other half containing post-scission data (Figure 1—figure supplement 2A). In the same regions of interest, the average mCherry signal (tagged to VPS4A, CHMP4B, CHMP2A, or CHMP2B) was analyzed and peaks were identified in which there was a clear increase followed by decrease in fluorescence intensity (Figure 1A,C,E,G and Figure 1—figure supplement 2). The appearance time was identified when a signal was first observed above cellular background, and the disappearance time when the signal dropped to cellular background. Appearance and disappearance relative to scission were then found by comparing these times to the scission time (Figure 1B,D,F,H). Based on the observed distribution of appearance and disappearance times relative to scission, with an average of roughly a minute, we excluded data in which scission and ESCRT-III/VPS4A recruitment were more than 4 min apart. Excluded data was attribute to a failed or uncorrelated scission event. ~25 traces under each condition were collected to gain understanding of the distribution of events.

The average signal-to-noise was approximately 7:1 (peak signal:S.D.) across all ESCRT-III/VPS4A measurements, and ESCRT-III/VPS4A recruitment was estimated to be detectable when the sustained signal deviated from the mean by ~ 1–2 standard deviations. Based on this deviation, it is estimated that ESCRT-III/VPS4A recruitment below ~20% of peak recruitment would be undetected. We estimate that there are between 10 and 100 ESCRTs in a complex at peak signal, with the possibility of < 10 ESCRTS undetectable in the background noise. Assuming a peak signal (100 ESCRTs) decreases exponentially into the noise after 10 s (10 ESCRTS), we estimate only ~1 ESCRTs would remain after another 10 s. This time is comparable to the ~20 s measured between peak disappearance and scission. If the disappearance is faster than exponential, for example linear, the ESCRTs will be gone even sooner. This interpolation of ESCRT-IIIs or VPS4A disappearance profiles into the noise indicates the ESCRTs predominantly leave the budding site prior to scission (Figure 1—figure supplement 2). For a significant number (>1) of either ESCRT-IIIs or VPS4A to be around following scission there would need to be a second, smaller population that follows much slower disappearance kinetics.

For pCO2 switching every 120 s for each tracing we determined the first transition of pCO2 for which the fluorescence had decreased sensitivity, indicating protons were no long freely flowing between cytosol and lumen of the VLP. We assumed that scission must have occurred during the previous plateau of pCO2 (Figure 2A–E). For example, if scission occurred during the 10% pCO2 cycle (low fluorescence) then after the next transition to 0% pCO2, and all subsequent transitions, the fluorescence would be closer to that of the 10% (low fluorescence state) than the 0% pCO2 (high fluorescence) state. Conversely, if scission occurred during the 0% (high fluorescence), future 10% pCO2 plateaus would be closer to the high fluorescence state. Occasionally traces appeared to be trapped in an intermediate pH state, which we attribute to scission occurring during the transition between pCO2 states. Individual VLP traces were categorized into being trapped in a high, middle, or low pH state by comparing the Gag-pHLuorin signal before and after the VLP became insensitive to pCO2 switching (Figure 2F).

Simultaneous VPS4A and CHMP4B imaging

Request a detailed protocol

Gag-mTagBFP, mEGFP-VPS4A and mCherry-CHMP4B were imaged with TIRF with sequential illumination of 594 nm (100 ms, 10–20 mW), 488 nm (100 ms, 4–10 mW) and 405 nm (100 ms, 2–4 mW; 120 mW LuxX diode laser, Omicron). mEGFP-VPS4A and mCherry-CHMP4B images were acquired every 5 s and Gag-TagBFP images were acquired every 60 s. VPS4A and CHMP4B relative appearance time were conducted using the same method as described previously (Figure 1—figure supplement 4) (Bleck et al., 2014). 

mEGFP-CHMP2A/B knockdown imaging

Request a detailed protocol

HeLa cell lines stably expressing either mEGFP-CHMP2A or mEGFP-CHMP2B and transfected with the respective siRNA (48 hr in advance) were imaged on an inverted microscope (IX-70, Olympus, Shinjuku, Japan) with epi-illumination via a Xenon lamp and transmitted bright-field illumination (Figure 1—figure supplement 3).

Polarized excitation imaging

Request a detailed protocol

Images were collected on an inverted microscope (IX-81, Olympus) with a custom built through-the-objective (100X UAPON 1.49 NA, Olympus) polarized TIRF microscopy illuminator (Johnson et al., 2014). Throughout imaging the excitation TIR light was azimuthally scanned at 200 Hz with mirror galvanometers (Nutfield Technology, Hudson, NH) in order to reduce spatial illumination nonuniformities. A multiband polychroic (zt405/488/594/647rpc 2 mm substrate, Chroma) was positioned between the galvanometers and objective in order to isolate the excitation light from the emitted light. Light from a 488 nm laser (100 mW LuxX diode laser, Omicron, Rodgau-Dudenhofen, Germany) was modulated between being polarized perpendicular (p^) or parallel (s^) to the glass surface by passing the light through an electro-optic modulator (EOM) (Conoptics, Danbury, CT) and quarter-wave plate prior to the galvanometer scan-head. The polarization generated by the EOM was modulated in sync with the galvanometers such that during scanning a p^ or s^ state was maintained at all azimuthal positions. The scanning polar angle was selected such that the excitation light was just beyond the TIR critical angle, minimizing s^ polarized light contaminating p^ excitation (Johnson et al., 2014).

A combined p^/s^ ratio image was collected every 30 s. To generate this ratio image a sequential series of 10 p^ and s^ images were collected, divided (after subtracting camera offset), and then averaged. Each p^ or s^ image had an exposure of 5 ms (laser power between 25 and 50 mW), with a new image collected every 15 ms. Thus, in 30 ms, a single p^/s^ image was generated, and then 10 of these images (over a 300 ms duration) were averaged (ImageJ) (Schneider et al., 2012) to create the combined ratio image. The short period was utilized in order to minimize artifacts in the p^/s^ ratio image from VLP or cell movement. The galvonometers, EOM, camera shutter, and laser shutters were all driven/triggered by a multifunction data acquisition board (PCIe-6323, National Instruments) and controlled from custom written software in LabView (https://github.com/SimonLab-RU/Microscope-Control; copy archived at https://github.com/elifesciences-publications/Microscope-Control). Images were streamed from a CMOS camera (Flash-4.0, Hamamatsu, Hamamatsu City, Japan) to a workstation (T7500, Dell, Round Rock, TX) running image acquisition software (Metamorph). A single band emission filter (ET525/50 m, Chroma) was used to isolate fluorophore emission. In order to characterize the amount of Gag in an assembling VLP, an average p^+2s^ image was also generated at each time point.

Polarization analysis

Request a detailed protocol

Puncta were found in the p^+2s^ images which increased and then plateaued in amplitude. These puncta were then selected for orientation analysis with p^/s^. A 2D Gaussian was fit to these assembling puncta to find a frame by frame subpixel peak location (https://github.com/SimonLab-RU/Puncta-Fit; copy archived at https://github.com/elifesciences-publications/Puncta-Fit). Using bilinear interpolation, the p^/s^ and p^+2s^ images were resampled 10X in the horizontal and vertical directions (65 to 6.5 nm wide pixels). On these resampled images P/S and P+2S values were found by averaging the resampled pixel intensities that are within 100 nm of the peak fit locations (https://github.com/SimonLab-RU/Average-puncta-center; copy archived at https://github.com/elifesciences-publications/Average-puncta-center) (Figure 4A, Figure 4—figure supplement 1). For frames prior to the appearance of a puncta P/S and P+2S values were determined using the fit location of the first frame in which there was a puncta fit. For each tagged version of Gag, the average P/S value for background and assembled VLPs was calculated by finding an average P/S for each trace before assembly and after a plateau was reached, and then averaging across all traces (Figure 4B). A relative time to half growth for each VLP was determined by finding the halfway to assembly point (i.e. the point where the intensity is halfway between the intensity at assembly beginning and plateau) and then finding the normalized time at this point relative to the time assembly began and appeared to reach a plateau. This normalized time was between 0 and 1. A normalized time to halfway drop in P/S was also found (normalized to the same time scale) and these values were subtracted to find: t1/2 of P+2St1/2 of P/S (normalized). All fluorophore combinations were included in the P/S histogram (Figure 4C) since all combinations had similar P/S characteristics.

Data availability

Data generated or analyzed during this study are included in the manuscript and supporting files.


Decision letter

  1. Stephen P Goff
    Reviewing Editor; Howard Hughes Medical Institute, Columbia University, United States
  2. Wendy S Garrett
    Senior Editor; Harvard School of Public Health, United States

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Timing of ESCRT-III protein recruitment and membrane scission during HIV-1 assembly" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen Wendy Garrett as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Stuart Neil (Reviewer #2); Andrew Lever (Reviewer #3).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Our reviewers had several suggestions for improvement. We include here their reviews and some ranking of the importance of responses to their comments.

Editorial comments on the reviews below:

Re: Review #1:

No edits requested.

Reviewer #1

The mode of action of the ESCRT proteins in narrowing and pinching off a membranous neck has been a puzzle for many years. Using TIRF imaging of budding virus, this paper provides much new information about the process, mainly concerning the timing of the ESCRT presence at the buds. The data show the arrival of various components late in the game, and then (significantly) their departure right before closure. There is nice quantification of the ESCRTs. The strength of the paper is the detailed measurement of the timing. The findings explain such issues as the absence of the ESCRTs in the final virions and limit the models for the structures used for the narrowing. Various manipulations of the system reveal some parameters of the reaction. Basically, this is cutting-edge imaging that is pushed to give great kinetic and stoichiometric information about ESCRT functions. The paper represents a significant advance in the field.

Re: Comments on Review #2:

This review is strongly positive.

Adding some discussion of the number of waves of recruitment that are typically seen would be very helpful. Highly encouraged. The reviewer is surprised by the inefficiency of this system, so some comments on that might be warranted. Whether the need for multiple tries would be true of wild-type virus might be raised.

Looking at L-domain-negative mutants could be interesting, but the extent of L-domain-negative budding might be too low to measure, or too aberrant to evaluate. This is probably of lower priority. Could be addressed by discussion.

Including movies would be attractive indeed. We could imagine it may be difficult to provide ones that convey the data in a format that is helpful to readers, but eLife is good at this. Try to add these.

The carbonic anhydrase measurements would be helpful if data are in hand.

Reviewer #2:

Having previously established TIRF microscopy techniques to analyse the budding of HIV-1 virions in real time, and the coordination of the recruitment of ESCRT proteins, the Simon lab now further develop these studies to the recruitment and disappearance of individual ESCRT-III components and VPS4 in the context of the actual membrane scission event itself. To visualize the moment of scission by live imaging, the authors have adapted their CO2-mediated manipulation of cytoplasmic pH and pHluorinGFP-fused Gag by imaging assembly and Gag recruitment under conditions where CO2 concentrations oscillate every 10s. Since the pHluorin in released virions becomes much less sensitive to these perturbations, this allows the authors to precisely define the moment of membrane scission in live cells – a really inventive solution to a key problem. By doing this, the authors show that ESCRT-III components and VPS4 are removed from the virion several seconds before the scission event, favouring a model whereby ESCRT-III constricts the neck of the virion to a point favourable to scission but must be removed by VPS4 to allow the reaction to take place rather than directly participating in it. If scission fails after their removal, subsequent rounds of ESCRT-III recruitment appear to occur to allow viral release. By varying the time of pH oscillation, the authors find that low cytoplasmic pH promotes scission. From this they suggest that protonation of phospholipid heads in the constricted neck may explain this, raising the possibility that it is proximity of the lipid heads that drive local destabilization resulting scission. Finally, using GFP variants embedded in Gag that only fluoresce under polarized excitation and therefore are restricted in an assembling particle, the authors model the membrane curvature of the budding virion, providing realtime evidence that Gag alone is the driving force of budding, and ESCRT-III recruitment occurs only when the spherical structure is formed.

Overall, this is a very interesting manuscript whose key strength is imaging of ESCRT function in relation to precise timing of scission in live cells using inventive and complex methodology. Despite this, the take home message is simple and important. I have some comments and queries below that the authors should consider addressing:

1) It is not clear from the manuscript how many waves of ESCRT-III recruitment happen for the average budding event. Do most scission events require only one? How many fail to progress to scission over the time frame despite multiple waves of ESCRT-III recruitment?

2) It is well established in artificial systems that Gag can induce membrane curvature, but the key novelty here is measuring it in real time in live cells. However, to definitively demonstrate ESCRT-independence, it would seem important to me to examine the membrane curvature of assembly of a Gag lacking the late domain in comparison – one should expect the same profile but subtle differences in timing might be interesting.

3) The authors should include representative videos of the events described.

4) Can the authors measure the relative concentration to carbonic anhydrase in purified virions vs the cytoplasm?

Re: Comments on Review #3:

This reviewer is also positive, with some suggested experiments. Some comments on his suggestions:

The issue of whether the readouts are revealing closure of the sphere, or pinching off of the membrane, is a real one, but it is not clear whether or not this can be fully determined experimentally (perhaps some aspects of this are known already?). At a minimum the issue should be directly discussed.

Looking at budding mutants (L-domain mutants again?) might be informative but might be hard to interpret, as noted above. It seems likely the authors have already looked at these, and if so, the issue can be addressed by discussion.

If there is a discrepancy with earlier work with respect to to CHMP4 recruitment, it should be addressed.

Comparing the effects on budding seen here, with effects on other host-mediated fusion effects (e.g. MVB fusion) would be helpful but might require setting up entire new assays. This would not seem absolutely required for acceptance.

The potential roles of Gag-Pol and viral RNA in the processes examined here are very interesting issues. I would include PR-mediated processing. But repeating all the work with and without these factors is a major effort, and it would probably be adequate to discuss the potential roles.

ESCRT-II is very likely involved and should be mentioned.

Reviewer #3:

The authors have used a number of interesting biophysical techniques to analyse the later stages of HIV budding and the temporal dynamics of recruitment of ESCRT-III components and membrane scission. Oscillating fluorescence of a pH dependent fluorophore was used to determine the point of membrane scission. I am curious to know whether they are actually measuring completion of the Gag sphere or actual membrane pinching off. In the original work of Gottlinger many of the particles that remained adherent to the cell appeared to have completed Gag sphere formation. Would it be useful to test out their oscillating pH system using such a budding mutant to determine whether they see slowing of oscillation caused by Capsid shell completion without particle release?

They previously showed ESCRT-III recruitment kinetics using a fluorophore based super resolution microscopy approach so some of the data here is more confirmatory rather than novel. The timing of CHMP4 recruitment and departure appears to be shorter than in their previously published work.

Acidification of the cytosol accelerates scission. My understanding is that the inner surface of the plasma membrane carries a generalized negative charge, so I am not sure how important the PIP2 components are in affecting scission. PIP2 acts as an important bridge binding the Matrix region of Gag to the inner plasma membrane but this occurs with all the Gag polyproteins from the first stages of assembly even before membrane bending and is not specific to those interactions involved at the budding neck. It would be of interest to see whether formation of vesicles triggered by ESCRT, such as in MVB formation, is similarly affected by pH changes to define how specific this is (or isn't) for virion budding and whether PIP2 is of specific importance.

The demonstration of repeated recruitment and loss of VPS4A and CHMP4B is interesting and novel. It begs the question as to what is the critical trigger for scission as it would appear that although they are important for the process they themselves are necessary but not sufficient. A significant caveat is that the experiments as far as I can tell are performed with Gag alone and there is evidence that the Gag/Pol polyprotein may influence budding significantly with a suggestion that cargo size affects ESCRT function (Bendjennat et al., 2016). Similarly, there is no genomic RNA, and this may affect virion assembly. Either of these may be involved in effecting the scission pathway and might be part of the definitive trigger, which would render repeated VPS4A/CHMP4B recruitment unnecessary.

I note that nowhere is the role of ESCRT-II mentioned. There is now clear biochemical and EM evidence that it is involved in HIV budding (Meng et al., 2015).

The membrane bending experiments are elegant although I am not mathematical enough to give an opinion on the calculations although the results are highly plausible.


Author response

Reviewer #2:

[…] Overall, this is a very interesting manuscript whose key strength is imaging of ESCRT function in relation to precise timing of scission in live cells using inventive and complex methodology. Despite this the take home message is simple and important. I have some comments and queries below that the authors should consider addressing:

1) It is not clear from the manuscript how many waves of ESCRT-III recruitment happen for the average budding event. Do most scission events require only one? How many fail to progress to scission over the time frame despite multiple waves of ESCRT-III recruitment?

A majority of our scission events occurred following the first recruitment of ESCRTs, but multiple rounds of ESCRT recruitment were also observed. In this work approximately 20% of our scission events consisted of more than one round of ESCRT recruitment. This is in rough agreement with our previous work in which we quantified the number of rounds of waves of recruitment (Jouvenet et al., 2011). In the previous work we did not simultaneously study scission, but in the current manuscript we demonstrate that scission only occurs following the last ESCRT recruitment. We have added a statement to the main text to clarify how often we observed multiple recruitment events. We rarely observed the recruitment of ESCRT-III without subsequent scission (~5%). However, we imaged cells for only a finite time and for those few events where we did not observe scission, we believe it occurred after we stopped imaging.

2) It is well established in artificial systems that Gag can induce membrane curvature, but the key novelty here is measuring it in real time in live cells. However, to definitively demonstrate ESCRT-independence, it would seem important to me to examine the membrane curvature of assembly of a Gag lacking the late domain in comparison – one should expect the same profile but subtle differences in timing might be interesting.

To address this question, we have repeated the Gag assembly experiments with either the intact Gag or with a deletion of the late domain (p6) of Gag, which contains sites for ESCRT recruitment. These were imaged and quantified using the same polarization-based excitation technique to monitor the orientation of the fluorophore (new Figure 4A). By measuring relative emission of GFP when excited with an electric field parallel (S-polarized) or perpendicular (P-polarized) to the glass we observed a similar change in the emission ratio (P-polarized/S-polarized) in the native Gag and Gag deleted of p6. Like wild type Gag assembly, the Gag missing p6 also had an initial P/S ratio of ~2 which then dropped to ~1.4 during the early parts of VLP formation (example trace added to Figure 4A; and additional examples shown in a new figure, Figure 4—figure supplement 2). We attribute this change to the VLP assembling into a spherical shell throughout assembly.

These results demonstrate that eliminating the late domain and the recruitment of early acting ESCRTs (like TSG101 or ALIX), have no effect that can be detected on the timing or extent of membrane bending. Thus, they are not required for VLPs to form the spherical shell structure, consistent with previous electron microscopy results in which Gag missing the late domain still formed spherical shells (Martin-Serrano and Bieniasz, 2003).

3) The authors should include representative videos of the events described.

We have now included representative movies for the following scenarios:

Video 1: Gag-pHluorin assembly (left) in whole cells with CO2 switching every 10s along with simultaneous recruitment of mCherry-CHMP4B (right).

Video 2: Example of individual puncta of Gag-pHluorin assembly with CO2 switching (left, every 10s) with simultaneous recruitment of mCherry-CHMP4B (right). CHMP4B was visible starting at 13:29 min.

Video 3: Gag-pHluorin assembly (top) in whole cells with CO2 switching every 10s along with simultaneous imaging of mCherry-VPS4A recruitment (right).

Video 4: Example of individual puncta of Gag-pHluorin assembly with CO2 switching (left, every 10s) with simultaneous recruitment of mCherry-VPS4A (right). VPS4A was visible starting at 20:49 min.

Video 5: Gag-pHluorin assembly (left) in whole cells with CO2 switching every 120s along with simultaneous imaging of mCherry-VPS4A recruitment (right).

Video 6: Example of individual puncta of Gag-pHluorin assembly with CO2 switching (left, every 120s) with simultaneous recruitment of mCherry-VPS4A (right). VPS4A was visible starting at 14:33 min.

Video 7: Gag-mEGFP assembly in whole cells with ratio image of perpendicular and parallel excitation (P/S) and total emission (P+2S).

Video 8: Example of individual puncta of Gag-mEGFP with P/S and P+2S images

We have added references and legends for these videos to the text.

4) Can the authors measure the relative concentration to carbonic anhydrase in purified virions vs the cytoplasm?

This is a good question, which has previously been addressed. Mass spectrometry studies of purified virions of HIV-1 that have probed for cellular proteins could not detect the presence of carbonic anhydrase (Ott, 2008). This is consistent with our observation that in isolated VLPs, modulating the pCO2 does not affect the pH in the VLPs. If there was significant carbonic anhydrase in isolated VLPs then CO2 modulation would result in pH (and thus fluorescence) changes – which we don’t observe (this work and Jouvenet, 2008).

Thus, the change in pH reported by the Gag-pHluorin in the forming bud is not the consequence of carbonic anhydrase in the bud. It is the result of a diffusive pathway in the neck that is sufficient size to allow the transit of protons. After scission, the connecting pathway is lost and protons in the cell cannot enter the nascent VLP. We have expanded the text to clarify our hypothesis on carbonic anhydrase in the VLPs.

Reviewer #3:

The authors have used a number of interesting biophysical techniques to analyse the later stages of HIV budding and the temporal dynamics of recruitment of ESCRT-III components and membrane scission. Oscillating fluorescence of a pH dependent fluorophore was used to determine the point of membrane scission. I am curious to know whether they are actually measuring completion of the Gag sphere or actual membrane pinching off. In the original work of Gottlinger many of the particles that remained adherent to the cell appeared to have completed Gag sphere formation. Would it be useful to test out their oscillating pH system using such a budding mutant to determine whether they see slowing of oscillation caused by Capsid shell completion without particle release?

As described above, we believe that we are measuring scission of the membrane as opposed to completion of the Gag shell. Electron microscopy studies (Briggs et al., 2009; Carlson et al., 2008; Woodward et al., 2015; Wright et al., 2007) show that the immature Gag lattice is generally incomplete with openings in the Gag lattice at the junction with the mother cell, thus continued movement of protons back and forth. The rapid transition to a state where protons cannot move between the mother and bud indicates a loss of continuity thus scission. Based on our results carbonic anhydrase is not in the nascent VLP. Additionally, mass spectrometry of nascent virions looking at cellular proteins did not detect carbonic anhydrase in the virions (Ott, 2008). Thus, any CO2 that passes the membrane of the VLP can only be very slowly converted to bicarbonate and protons. We have previously demonstrated that with a late domain mutant, the Gag inside the nascent virion remains sensitive to the cytosolic pH (Jouvenet, 2008, Figure 3F).

They previously showed ESCRT-III recruitment kinetics using a fluorophore based super resolution microscopy approach so some of the data here is more confirmatory rather than novel. The timing of CHMP4 recruitment and departure appears to be shorter than in their previously published work.

First, one of the key novelties in this work is imaging the recruitment kinetics of ESCRT-III simultaneously with membrane bending or simultaneously with scission. This has not been done before by us, or anyone else.

Second, there is a difference in relative timing between recruitment of CHMP4B and VPS4A, but it is a difference not between previous work and this work, but a subtle difference that varies with the cell type. In both this work, which mainly examined HEK293T cells, and in our previous work on HeLa cells (Bleck et al., 2014), we monitored the time course of recruitment of CHMP4B simultaneously with recruitment of VPS4A. In both cell types, after ESCRT-III appeared (see red tracing in Figure 3 of the current manuscript), we detected VPS4A (see the green tracing). The ESCRT-III fluorescence increased, with the VPS4A following. The CHMP4B reached a maximum shortly before VPS4A, and then they both decreased.

In the HEK293T cells we observed that the lag to VPS4A reached its ½ max 5.1 seconds after CHMP4B and in the HeLa cells the lag was 9 seconds (Author response image 1 and Figure 1E from our previous paper, Bleck et al., 2014). From re-examining the histograms we are uncertain what, if any, the significance is of that delay. For this work we performed the majority of measurements in HEK293T cells because scission was observed to occur much more frequently, allowing us to study many more events. The difference in the lag between the HeLa and HEK293T is consistent between our previous work and this work (here we examined both). However, we did not examine the difference in the lag closely and therefore we are reticent to make any statements about its biochemical significance. For this publication we focused on the relative timing of the ESCRTs and VPS4 to the scission – where there is a much greater and consistent difference.

Author response image 1
Measurement of the lag in the rise to ½ max between CHMPB and VPS4A in HEK293T cells.

Acidification of the cytosol accelerates scission. My understanding is that the inner surface of the plasma membrane carries a generalized negative charge, so I am not sure how important the PIP2 components are in affecting scission. PIP2 acts as an important bridge binding the Matrix region of Gag to the inner plasma membrane but this occurs with all the Gag polyproteins from the first stages of assembly even before membrane bending and is not specific to those interactions involved at the budding neck. It would be of interest to see whether formation of vesicles triggered by ESCRT, such as in MVB formation, is similarly affected by pH changes to define how specific this is (or isn't) for virion budding and whether PIP2 is of specific importance.

Thank you for the emphasizing the presence of PIP2 throughout the Gag bud, and pointing out that PIP2 might not be a critical lipid for the scission. Based on the pHluorin fluorescence change we observed when switching between 0% and 10% CO2 we believe the cytosolic pH is modulated between ~7.5 and ~6.5. Phosphatidic acid (PA), phosphatidylethanolamine (PE), phosphatidylcholine (PC), phosphatidylglycerol (PG), and phosphatidylserine (PS) all have pKa values that are away from this range. The two phosphates on the inositol of PIP2 have a pKa of 6.5 and 7.7, which are in the range of sensitivity of our measurements and therefore we highlighted the possibility of this lipid being sensitive to charge change in the pH range for our experiments. However, we acknowledge that this is just one possible component that is sensitive to charge modulation in this pH range, and we have modified the discussion to more clearly state this possibility.

MVB formation would be an excellent system to also study membrane scission and although outside the scope of this work, we hope our research will provide inspiration for a similar study. In particular, due to differences in lipid composition in MVBs, it would be interesting to determine how scission in MVBs are sensitive to pH.

The demonstration of repeated recruitment and loss of VPS4A and CHMP4B is interesting and novel. It begs the question as to what is the critical trigger for scission as it would appear that although they are important for the process they themselves are necessary but not sufficient. A significant caveat is that the experiments as far as I can tell are performed with Gag alone and there is evidence that the Gag/Pol polyprotein may influence budding significantly with a suggestion that cargo size affects ESCRT function (Bendjennat et al., 2016). Similarly, there is no genomic RNA and this may affect virion assembly. Either of these may be involved in effecting the scission pathway and might be part of the definitive trigger, which would render repeated VPS4A/CHMP4B recruitment unnecessary.

We have previously observed the repeated recruitment and loss of VPS4A and ESCRT components (Jouvenet et al., 2011). We had struggled with the meaning of this until this current work. The results now demonstrate that the durations of ESCRT recruitment and loss are fairly stereotypic in duration. At the end of each round, there is either scission, or not. If there is scission, there are no further rounds of ESCRT recruitment. If there is not scission, then there is another round. We think that the ESCRTs are pulling the neck just an extra bit closer to facilitate scission, but then have to move out of the way. This is repeated until scission occurs. This suggests that it may be possible for scission to occur even in the absence of ESCRTs, albeit at a reduced rate. Thus, we don’t believe there is a definitive trigger for ESCRT-III recruitment. Instead, we hypothesize that the presence of the late domains helps to initiate recruitment of ESCRT-IIIs in a probabilistic fashion and may also be governed by the current neck structure. This is supported by Bendjennat and Saffarian (2016) which showed that the absence of the late domain (deletion of PTAP) delayed particle release by 10 hours but did not prevent viral particle release. Thus, without the late domains, scission events might still be observed, though would be rarer. We have updated the text to include information that scission may occur in the absence of late domain. However, when we previously monitored for scission in the presence of a late domain mutant (Jouvenet et al., 2008), we did not see scission during the 30-60 minute imaging periods we used.

We have previously examined if this assembly is affected by whether Gag or Gag and Gag-Pol was recruited, and at the level of the single virion, the assembly kinetics were the same for Gag alone and for the provirus Gag/Gag-Pol (Jouvenet et al., 2008). We also could not distinguish any differences in assembly rate in the presence of the HIV-1 genome (Jouvenet et al., 2009). The referee points out that in ensemble measurements larger cargo sizes appear to slow down rate of viral particle release (Bendjennat and Saffarian, 2016). We think that this may be an indirect effect seen at the macroscopic level not seen at the level of single virions. Larger cargos take longer to synthesize and slow the overall rate of synthesis in the cell. We have previously demonstrated that rate of viral assembly is very sensitive to concentration of Gag. Gag-Pol takes longer to synthesize than just Gag and thus, it would take longer to get to a critical concentration to initiate assembly and longer to assemble.

I note that nowhere is the role of ESCRT-II mentioned. There is now clear biochemical and EM evidence that it is involved in HIV budding (Meng et al., 2015).

Just as viral particle release rate may depend on presence of ESCRT-I/TSG101 and particle size (Bendjennat and Saffarian, 2016), the presence of ESCRT-II, which works in concert with ESCRT-I, is also expected to affect the rate of viral particle release (Meng et al., 2015) which we have now added to the manuscript.


Article and author information

Author details

  1. Daniel S Johnson

    1. Laboratory of Cellular Biophysics, The Rockefeller University, New York, United States
    2. Department of Physics and Astronomy, Hofstra University, Hempstead, United States
    Conceptualization, Data curation, Software, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing, Designed experiments, Prepared samples, Collected and analyzed data
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8906-0509
  2. Marina Bleck

    Laboratory of Cellular Biophysics, The Rockefeller University, New York, United States
    Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Writing—original draft, Writing—review and editing, Designed experiments, Prepared samples
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-4175-8363
  3. Sanford M Simon

    Laboratory of Cellular Biophysics, The Rockefeller University, New York, United States
    Conceptualization, Formal analysis, Supervision, Funding acquisition, Investigation, Methodology, Writing—original draft, Project administration, Writing—review and editing, Designed experiments
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8615-4224


National Institutes of Health (5R01GM119585)

  • Daniel S Johnson
  • Marina Bleck
  • Sanford M Simon

National Institutes of Health (2U54GM103297)

  • Daniel S Johnson
  • Marina Bleck
  • Sanford M Simon

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank M Will and M A Lockard for assisting with plasmid preparations. We also thank M S Itano, M D Tomasini, K Bredbenner and P Bieniasz for discussion during manuscript preparation. This work was supported by NIH grants 1P50GM103297 and R01 GM11958 to SMS.

Senior Editor

  1. Wendy S Garrett, Harvard School of Public Health, United States

Reviewing Editor

  1. Stephen P Goff, Howard Hughes Medical Institute, Columbia University, United States

Publication history

  1. Received: February 26, 2018
  2. Accepted: July 2, 2018
  3. Accepted Manuscript published: July 4, 2018 (version 1)
  4. Version of Record published: August 7, 2018 (version 2)


© 2018, Johnson et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 2,419
    Page views
  • 427
  • 38

Article citation count generated by polling the highest count across the following sources: Crossref, Scopus, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Daniel S Johnson
  2. Marina Bleck
  3. Sanford M Simon
Timing of ESCRT-III protein recruitment and membrane scission during HIV-1 assembly
eLife 7:e36221.

Further reading

    1. Cell Biology
    2. Genetics and Genomics
    Peter S Johnstone, Maite Ogueta ... Deniz Top
    Tools and Resources

    Circadian clocks are highly conserved transcriptional regulators that control ~24-hour oscillations in gene expression, physiological function, and behavior. Circadian clocks exist in almost every tissue and are thought to control tissue-specific gene expression and function, synchronized by the brain clock. Many disease states are associated with loss of circadian regulation. How and when circadian clocks fail during pathogenesis remains largely unknown because it is currently difficult to monitor tissue-specific clock function in intact organisms. Here, we developed a method to directly measure the transcriptional oscillation of distinct neuronal and peripheral clocks in live, intact Drosophila, which we term Locally Activatable BioLuminescence, or LABL. Using this method, we observed that specific neuronal and peripheral clocks exhibit distinct transcriptional properties. Loss of the receptor for PDF, a circadian neurotransmitter critical for the function of the brain clock, disrupts circadian locomotor activity but not all tissue-specific circadian clocks. We found that, while peripheral clocks in non-neuronal tissues were less stable after the loss of PDF signaling, they continued to oscillate. We also demonstrate that distinct clocks exhibit differences in their loss of oscillatory amplitude or their change in period, depending on their anatomical location, mutation, or fly age. Our results demonstrate that LABL is an effective tool that allows rapid, affordable, and direct real-time monitoring of individual clocks in vivo.

    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Dirk H Siepe, Lukas T Henneberg ... K Christopher Garcia
    Tools and Resources

    Secreted proteins, which include cytokines, hormones and growth factors, are extracellular ligands that control key signaling pathways mediating cell-cell communication within and between tissues and organs. Many drugs target secreted ligands and their cell-surface receptors. Still, there are hundreds of secreted human proteins that either have no identified receptors ('orphans') and are likely to act through cell surface receptors that have not yet been characterized. Discovery of secreted ligand-receptor interactions by high-throughput screening has been problematic, because the most commonly used high-throughput methods for protein-protein interaction (PPI) screening do not work well for extracellular interactions. Cell-based screening is a promising technology for definition of new ligand-receptor interactions, because multimerized ligands can enrich for cells expressing low affinity cell-surface receptors, and such methods do not require purification of receptor extracellular domains. Here, we present a proteo-genomic cell-based CRISPR activation (CRISPRa) enrichment screening platform employing customized pooled cell surface receptor sgRNA libraries in combination with a magnetic bead selection-based enrichment workflow for rapid, parallel ligand-receptor deorphanization. We curated 80 potentially high value orphan secreted proteins and ultimately screened 20 secreted ligands against two cell sgRNA libraries with targeted expression of all single-pass (TM1) or multi-pass (TM2+) receptors by CRISPRa. We identified previously unknown interactions in 12 of these screens, and validated several of them using surface plasmon resonance and/or cell binding. The newly deorphanized ligands include three receptor tyrosine phosphatase (RPTP) ligands and a chemokine like protein that binds to killer cell inhibitory receptors (KIR's). These new interactions provide a resource for future investigations of interactions between the human secreted and membrane proteomes.