Mutation of the N-terminal endo-lysosomal targeting motif in human TPC2 redirects it to the plasma membrane where TPC2 reportedly mediates robust Ca²⁺ entry upon activation with NAADP (Brailoiu et al., 2010). We took advantage of this property to screen a cell line stably expressing TPC2^L11A/L12A with a library of 80000 natural and synthetic small molecules using a FLIPR-based Ca²⁺ assay (Figure 1A and B). Two structurally independent hits were identified, termed TPC2-A1-N and TPC2-A1-P (Figure 1C and D), which reproducibly evoked Ca²⁺ signals. The signals evoked by the compounds showed different kinetics whereby the TPC2-A1-N response reached its plateau faster than TPC2-A1-P (Figure 1E and F). The structures and activities of these hits were confirmed by independent chemical syntheses and subsequent retesting. Full concentration-effect relationships for the plateau response indicated EC₅₀ values of 7.8 μM and 10.5 μM, for TPC2-A1-N and TPC2-A1-P, respectively (Figure 1G and H). We thus identified novel small molecules that activate TPC2 and confirm its Ca²⁺-permeability in intact cells.

Figure 1 with 7 supplements see all

Download asset Open asset

Figure 1—source data 1

Identification of TPC2 hit compounds.

https://cdn.elifesciences.org/articles/54712/elife-54712-fig1-data1-v4.xlsx

Download elife-54712-fig1-data1-v4.xlsx

To validate the hits further, we performed ratiometric Ca²⁺ imaging of single cells transiently transfected with TPC2^L11A/L12A or a ‘pore-dead’ version (TPC2^{L11A/L12A/L265P}). As shown in Figure 1I and J, TPC2-A1-N evoked Ca²⁺ signals in cells expressing TPC2^L11A/L12A but not TPC2^{L11A/L12A/L265P}. These data confirm that TPC2-A1-N evoked Ca²⁺ influx through the TPC2 pore. In accord, the responses to TPC2-A1-N were selectively blocked by the recently identified TPC2 blockers tetrandrine (Tet), raloxifene (Ral), and fluphenazine (Flu) (Penny et al., 2019; Sakurai et al., 2015; Figure 1—figure supplement 1) and by removal of extracellular Ca²⁺ (Figure 1—figure supplement 2). TPC2-A1-P also induced Ca²⁺ signals in cells expressing TPC2 in the presence (Figure 1K and L) but not absence (Figure 1—figure supplement 2) of extracellular Ca²⁺. However, the responses were smaller and delayed compared to TPC2-A1-N (Figure 1I and K), consistent with the results obtained in cells stably expressing TPC2^L11A/L12A (Figure 1E and F). TPC2-A1-P failed to induce Ca²⁺ signals in cells expressing ‘pore-dead’ TPC2^{L11A/L12A/L265P} (Figure 1K and L). Both TPC2-A1-N and TPC2-A1-P also failed to evoke Ca²⁺ signals in cells expressing human TRPML1 re-routed to the plasma membrane (TRPML1^ΔNC) (Grimm et al., 2010; Yamaguchi et al., 2011; Figure 1M–N and Figure 1—figure supplement 1A–B). Similar negative results were obtained with the agonists in cells expressing TRPML2 or TRPML3 (Figure 1—figure supplement 3C and D), indicating a selective, pore-dependent action of both agonists on TPC2.

The consensus logP (octanol/water; SwissADME) values for TPC2-A1-N (4.56) and TPC2-A1-P (5.35) predict that they are cell permeable. To determine whether TPC2-A1-N and TPC2-A1-P were able to release Ca²⁺ from lysosomes, we expressed TPC2 fused to the genetically encoded Ca²⁺ indicator, GCaMP6(s) both with (TPC2^GCaMP) and without (TPC2^GCaMP/L265P) an intact pore (Figure 1O–T) in order to measure global Ca²⁺ signals. TPC2-A1-N and TPC2-A1-P evoked Ca²⁺ signals in cells expressing intracellular TPC2^GCaMP but not TPC2^GCaMP/L265P. Again the responses to TPC2-A1-P were modest compared to TPC2-A1-N.

Systematic structure modifications were performed on both screening hits. Surprisingly, none of the modified versions of TPC-A1-N or TPC2-A1-P showed significantly increased efficacies (Figure 1—figure supplements 4 and 5). TPC2-A1-P analogues missing the trifluoromethoxy residue were completely inactive (Figure 1—figure supplement 6).

Collectively, our data show that TPC2-A1-N and TPC2-A1-P activate TPC2 with differential effects on Ca²⁺ mobilization.

To determine more directly whether TPC2-A1-N and TPC2-A1-P activate TPC2, endo-lysosomal patch-clamp experiments were performed (Figure 2). TPC2-A1-N elicited currents using Na⁺ as the major permeant ion, in vacuolin-enlarged endo-lysosomes isolated from TPC2-expressing cells (Figure 2A). The currents were inhibited by ATP as reported previously (Cang et al., 2013). In contrast, no activation was found in cells expressing TPC1 (Figure 1—figure supplement 7). Endo-lysosomes isolated from cells expressing a gain-of-function variant of TPC2 (TPC2^M484L) (Chao et al., 2017) showed larger currents compared to the wild-type isoform upon application of TPC2-A1-N (Figure 2B). TPC2-A1-P also evoked currents in endo-lysosomes isolated from cells expressing TPC2 and TPC2^M484L (Figure 2C and D). As with TPC2-A1-N, the currents were potentiated by the gain-of-function variant (Figure 2D). Surprisingly, the currents evoked by TPC2-A1-P were significantly larger than those evoked by TPC2-A1-N (Figure 2E–G) in both wild-type and gain-of-function variant. Full concentration-effect relationships for the plateau response in endo-lysosomal patch-clamp experiments indicated EC₅₀ values of 0.6 μM for both TPC2-A1-N and TPC2-A1-P (Figure 2—figure supplement 1A).

Figure 2 with 1 supplement see all

Download asset Open asset

Figure 2—source data 1

TPC2 agonists alter Ca/Na permeability of TPC2.

https://cdn.elifesciences.org/articles/54712/elife-54712-fig2-data1-v4.xlsx

Download elife-54712-fig2-data1-v4.xlsx

Increased Na⁺ currents in the face of reduced Ca²⁺ signals (Figure 1) upon TPC2-A1-P activation prompted us to examine the effects of Na⁺ removal on intracellular Ca²⁺ elevation. For these experiments, we used cells stably expressing TPC2^L11A/L12A and agonist concentrations that evoked similar responses. As shown in Figure 2H and J, the amplitude of Ca²⁺ signals evoked by TPC2-A1-N were unaffected by removal of Na⁺ from the extracellular solution, although the rate of rise was increased. In contrast, both the amplitude and rate of rise of the responses to TPC2-A1-P were markedly enhanced (Figure 2I and J). These data indicate that TPC2 is activated by TPC2-A1-N and TPC2-A1-P but that its permeability to Na⁺ differs upon activation.

The above analyses raised the intriguing possibility that the selectivity of TPC2 to Ca²⁺ and Na⁺ might not be fixed. To directly test this, we measured cation conductance evoked by the two compounds under bi-ionic conditions (luminal side: 105 mM Ca²⁺, pH 4.6, cytosolic side: 160 mM Na⁺, pH 7.2) (Figure 2K and L). For these experiments, we used cells stably expressing TPC2. Based on the reversal potential (E_rev), the P_Ca/P_Na permeability ratio of TPC2-A1-N-evoked currents (I_TPC2-A1-N) was 0.65 ± 0.13 (Figure 2O–Q). In marked contrast, E_rev values for TPC2-A1-P-evoked currents (I_TPC2-A1-P) were more negative such that the P_Ca/P_Na permeability ratio was 0.04 ± 0.01 (Figure 2O–Q) and thus Na⁺-selective. These ratios are highly reminiscent of those obtained for endogenous NAADP-mediated currents in planar patch-clamp analyses (Ruas et al., 2015) and for recombinant TPC2 activated by PI(3,5)P₂ measured using endo-lysosomal patch-clamp experiments where the channel appeared insensitive to NAADP (Wang et al., 2012). We thus examined the effects of NAADP and PI(3,5)P₂ in parallel. NAADP (50 nM) evoked robust currents with an E_rev similar to TPC2-A1-N (−8.5 mV for NAADP versus −12 mV for TPC2-A1-N). The P_Ca/P_Na for NAADP (0.73 ± 0.14) was thus similar to TPC2-A1-N (Figure 2M–Q). In contrast, the E_rev for PI(3,5)P₂ (−53 mV) was similar to TPC2-A1-P (−61 mV) and the previously reported E_rev for PI(3,5)P₂ (−68 mV) (Wang et al., 2012), corresponding to a P_Ca/P_Na ratio of 0.08 ± 0.01 (Figure 2M–Q). No significant outward Na⁺ or inward Ca²⁺ conductances were observed in endo-lysosomes isolated from HEK293 cells expressing ‘pore-dead’ TPC2^L265P in the presence of TPC2-A1-N or TPC2-A1-P (Figure 2R–S and Figure 2—figure supplement 1B–C). Moreover, the agonists induced similar shifts in selectivity using luminal solution containing 114 mM Na⁺ and 30 mM Ca²⁺ and a bath solution containing 160 mM Na⁺ (Figure 2—figure supplement 1D–F) confirming that the measured P_Ca/P_Na permeability ratio is independent of the luminal Ca²⁺ concentration. These data indicate that TPC2-A1-N and TPC2-A1-P not only differentially affect current amplitudes but also influence the P_Ca/P_Na permeability ratio (Figure 2Q). TPC2-A1-N-activated TPC2 shows a higher relative Ca²⁺ permeability, similar to NAADP-activated TPC2. In contrast, TPC2-A1-P-activated TPC2 shows a lower relative Ca²⁺ permeability, similar to PI(3,5)P₂-activated TPC2. Ion permeation through TPC2 is thus ligand-dependent providing an explanation for conflicting evidence that TPC2 is a NAADP-activated Ca²⁺ release channel (Brailoiu et al., 2010; Grimm et al., 2014; Pitt et al., 2010; Ruas et al., 2015; Schieder et al., 2010) or a PI(3,5)P₂ gated Na⁺ channel (Boccaccio et al., 2014; Guo et al., 2017; Wang et al., 2012).

The PI(3,5)P₂ binding site in TPC2 has recently been identified (She et al., 2019). To gain mechanistic insight into agonist action, we mutated K204 which is required for activation of TPC2 by PI(3,5)P2 (Kirsch et al., 2018; She et al., 2019) and examined its effect on responses to TPC2-A1-N and TPC2-A1-P. Intracellular Ca²⁺ elevation mediated by TPC2-A1-N was similar in cells expressing plasma membrane targeted TPC2 with and without the K204A mutation (Figure 3A and C). In contrast, the responses to TPC2-A1-P were reduced approximately two-fold (Figure 3B and C). Similar selective inhibition was observed in GCaMP assays (Figure 3G). Thus, whereas responses to TPC2-A1-N were comparable for the wild-type and mutant channel, the responses to TPC2-A1-P were reduced by the mutation. Furthermore, currents evoked by TPC2-A1-N were largely unaffected by the K204A mutation (Figure 3H and J). In contrast, those to TPC2-A1-P were reduced (Figure 3I and J). Collectively, these data suggest K204 is required for activation of TPC2 by TPC2-A1-P and PI(3,5)P₂ but not TPC2-A1-N. Molecular determinants for agonist action in TPC2 thus differ.

Figure 3

Download asset Open asset

Figure 3—source data 1

TPC2 agonists activate TPC2 through distinct sites.

https://cdn.elifesciences.org/articles/54712/elife-54712-fig3-data1-v4.xlsx

Download elife-54712-fig3-data1-v4.xlsx

Lysosomal function and integrity critically depend on the pH in the lysosomal lumen. Previously, it has been reported that NAADP induced pH changes in the lumen of acidic Ca²⁺ stores, leading to an alkalinization (Cosker et al., 2010; Morgan and Galione, 2007) but the role of TPC2 in regulating lysosomal pH is conflicting (Ambrosio et al., 2016; Cang et al., 2013; Grimm et al., 2014; Lin et al., 2015; Ruas et al., 2015). We therefore assessed the acute effects of TPC2-A1-N and TPC2-A1-P on lysosomal pH using a recently described novel lysosomal pH sensor, pH-Lemon-GPI (Burgstaller et al., 2019; Figure 4A–K and Video 1). Results from high-resolution array confocal laser scanning microscopy revealed that TPC2-A1-N, but not TPC2-A1-P, increased pH of single vesicles in cells expressing wild-type TPC2 (Figure 4A–B and Video 1). In contrast, no pH changes were observed in cells expressing TPC2^L265P. Time-lapse wide-field fluorescence microscopy showed that activation of endogenous TPC2 with TPC2-A1-N modestly increased the lysosomal pH in untransfected cells in a time-dependent manner (Figure 4C and I). The pH response was markedly potentiated in cells expressing wild-type TPC2 but not the pore-mutant (Figure 4D,E and I). The response in the former was approximately half that evoked by direct alkalization with NaN₃/NH₄Cl (Figure 4K). Again, vesicular pH was largely unaffected by TPC2-A1-P (Figure 4F–H and J). Time-lapse imaging additionally revealed that vesicle motility was strongly impaired by TPC2-A1-N but not TPC2-A1-P (Video 2). The effect of TPC2-A1-N was reversible and appeared to temporally correlate with the increase in vesicular pH (Video 1). In endo-lysosomal patch-clamp experiments, we probed the proton permeability of TPC2 and found that in contrast to TPC2-A1-P, TPC2-A1-N rendered the channel proton-permeable, thus providing a direct channel-dependent mechanism leading to alkalinization (Figure 4L–N). Proton permeability did not substantially change our estimates of relative Ca²⁺ and Na⁺ permeability as P_Ca/P_Na values were similar when proton currents were subtracted from currents obtained under bi-ionic conditions (0.44 for TPC2-A1-N and 0.06 for TPC2-A1-P). In sum, these findings demonstrate that TPC2 activation is coupled to lysosomal pH and motility in an agonist-dependent manner.

Figure 4

Download asset Open asset

Figure 4—source data 1

Effect of TPC2-A1-N on vesicular pH.

https://cdn.elifesciences.org/articles/54712/elife-54712-fig4-data1-v4.xlsx

Download elife-54712-fig4-data1-v4.xlsx

Video 1

Download asset

Video 2

Download asset

To further probe the physiological relevance of TPC2 activation by the agonists, we assessed the effect of TPC2-A1-N and TPC2-A1-P on lysosomal exocytosis (Figure 5). Lysosomal exocytosis is involved in a plethora of physiological and pathophysiological processes including release of lysosomal enzymes and inflammatory mediators, clearance of lysosomal storage material and pathogens, plasma membrane repair and cancer progression (Lopez-Castejon and Brough, 2011; Machado et al., 2015; Miao et al., 2015; Xu and Ren, 2015). The Ca²⁺-dependence of this process has been mostly ascribed to activation of TRPML1 (Xu and Ren, 2015). Here, we used murine macrophages which express high endogenous levels of TPC2 (Cang et al., 2013). To assess lysosomal exocytosis, we quantified translocation of LAMP1 to the cell surface. As shown in Figure 5A–E, TPC2-A1-N was without effect on lysosomal exocytosis. This was not due to lack of efficacy of TPC2-A1-N on the murine channel because Ca²⁺ measurements with mouse TPC2 fused to GCaMP6 (MmTPC2^GCaMP) confirmed that TPC2-A1-N evoked larger responses than TPC2-A1-P (Figure 5—figure supplement 1A) similar to the human channel (Figure 1). In contrast, TPC2-A1-P evoked robust lysosomal exocytosis in a time- and concentration-dependent manner (Figure 5A–E), providing a corollary to the effects of the agonists on lysosomal pH. To further corroborate that TPC2-A1-P triggers TPC2-dependent vesicle fusion in primary macrophages, electrophysiological measurements of membrane capacitance via the whole-cell patch-clamp technique were performed (Figure 5F–H). These data showed that TPC2-A1-P caused a modest increase in cell size. In the final set of experiments, we examined the effects of TPC2 knockout on agonist responses. As shown in Figure 5—figure supplement 1, both TPC2-A1-N and TPC2-A1-P evoked measurable endogenous TPC2-like currents in macrophages from wild-type animals. The amplitudes of the currents were larger for TPC2-A1-P than TPC2-A1-N, again recapitulating agonist effects on human TPC2 (Figure 2). Importantly, currents were reduced in macrophages derived from TPC2 KO cells (Figure 5—figure supplement 1) and the effects of TPC2-A1-P on lysosomal exocytosis and cell size were abolished (Figure 5A–E). TPC2 knockout however failed to affect lysosomal exocytosis in response to ionomycin attesting to specificity (Figure 5A–E). Collectively, these data further identify agonist-selective effects of TPC2 on lysosomal physiology in an endogenous setting.

Figure 5 with 1 supplement see all

Download asset Open asset

Figure 5—source data 1

TPC2 agonists differentially affect lysosomal exocytosis.

https://cdn.elifesciences.org/articles/54712/elife-54712-fig5-data1-v4.xlsx

Download elife-54712-fig5-data1-v4.xlsx

The high-throughput screen was performed using a custom-made fluorescence imaging plate reader built into a robotic liquid handling station (Freedom Evo 150, Tecan, Männedorf, Switzerland) as previously described (Urban et al., 2016). HEK293 cells were used that stably expressed RFP fusion proteins of human TPC2 (C-terminally tagged) or human CLN3 (N-terminally tagged) rerouted to the plasma membrane. Targeting was achieved by mutation of the endo-lysosomal targeting motifs (hTPC2^L11A/L12A, hCLN3^L253A/I254A). Mutants were generated by site-directed mutagenesis using the QuikChange II XL protocol (Agilent), according to the manufacturer’s instructions. Stable HEK293 cell lines were generated using 400 μg/mL geneticin (G418, Sigma). If G418-resistant foci were not identified after 3–4 days, the concentration of G418 was increased to 800 μg/mL. After 2–3 weeks cells were picked from G418-resistant foci and colonies were expanded in six well plates. RFP expression was assessed using confocal microscopy when cells were >50% confluent. Colonies with more than 95% RFP positive cells were selected, grown to >90% confluency, split and further expanded. For HTS experiments, cells were cultured at 37°C with 5% of CO₂ in Dulbecco’s modified Eagle medium (Thermo Fisher), supplemented with 10% fetal calf serum (Biochrom, Berlin, Germany), 2 mM L-glutamine, 100 U/mL penicillin, 0.1 mg/mL streptomycin, and 400–800 µg/mL G418. Cells were seeded on black-walled, clear-bottom 384-well plates (Greiner, Germany) and incubated with Fluo-4/AM (4 µM; Life Technologies, Eugene, OR) for 30 min at 37°C, washed and resuspended in a HEPES-buffered solution 1 (HBS1) comprising 132 mM NaCl, 6 mM KCl, 1 mM MgCl₂, 1 mM CaCl₂, 10 mM HEPES, and 5.5 mM D-glucose (pH was adjusted to 7.4 with NaOH). For primary screening, individual compounds from Roche libraries (Xplore libraries X30 and X50, Roche, Basel, CH) were diluted in HBS1 to a working concentration of 100 µM. After recording the baseline for 30 s, compounds were injected to a final concentration of 10 µM. Recording continued for 180 s per quadrant (total 750 s). If high intensities were measured in both cell lines, the compounds were deemed false positives and excluded. Concentration-effect relationships were plotted using GraphPad Prism five and fitted to the Hill equation. The identity of the cell lines used has been authenticated by STR profiling. No mycoplasma contamination has been reported.

Single cell Ca²⁺ imaging experiments were performed using Fura-2. HeLa cells and HEK293 cells were cultured at 37°C with 5% of CO₂ in Dulbecco’s modified Eagle medium (Gibco), supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 0.1 mg/mL streptomycin. Cells were plated onto poly-L-lysine (sigma)-coated glass coverslips, grown overnight and transiently transfected for 18–24 hr with plasmids using lipofectamine 2000 (Invitrogen) or TurboFect (Thermo Fisher) according to the manufacturer’s instructions. For Ca²⁺ influx experiments, cells were transfected with human TPC2 (C-terminally tagged with GFP or RFP) (Brailoiu et al., 2010) or TRPML1 (N-terminally-tagged with GFP (Yamaguchi et al., 2011) or C-terminally tagged with YFP). They were targeted to the plasma membrane by mutation/deletion of the endo-lysosomal targeting motifs. For Ca²⁺ imaging experiments with TRPML2 or TRPML3 (both C-terminally tagged with YFP Grimm et al., 2010), the latter two sufficiently locating to the plasma membrane when overexpressed. A pore-dead mutant of plasma membrane, GFP-tagged TPC2 (hTPC2^{L11A/L12A/L265P}) was generated by site-directed mutagenesis. Transfected cells were loaded for 1 hr at room temperature with Fura-2 AM (2.5 µM) and 0.005% (v/v) pluronic acid (both from Invitrogen) in HEPES-buffered solution 2 (HBS2) comprising 1.25 mM KH₂PO₄, 2 mM CaCl₂, 2 mM MgSO₄, 3 mM KCl, 156 mM NaCl, 10 mM D-glucose and 10 mM HEPES (adjusted to pH 7.4 with HCl). After loading, cells were washed three times in HBS2, and mounted in an imaging chamber. All recordings were performed in HBS2. Ca²⁺ imaging experiments were also performed in HEK293 cells stably expressing C-terminally RFP-tagged hTPC2^L11A/L12A (see above). These cells were plated, loaded with Fura-2 and recorded as with HeLa cells, except for that in indicated experiments, NaCl in HBS2 was replaced with NMDG. For lysosomal Ca²⁺ release experiments, HeLa cells were transfected with human TPC2, C-terminally tagged with GCaMP6(s) (hTPC2^GCaMP). The hTPC2 sequence was amplified by PCR from the pcDNA3.1 plasmid encoding YFP-tagged hTPC2 as described previously (Chao et al., 2017), using a forward primer carrying a NheI restriction site followed by a Kozak sequence, and a sequence binding the first 17 base-pairs of hTPC2: TATGCTAGCGCCACCATGGCGGAACCCCAGGC. The reverse primer also contained a NheI restriction site, preceded by a GSG-linker coding sequence, and the final 20 base-pairs of hTPC2, excluding the TPC2 stop codon: ATAGCTAGCACCAGAACCCCTGCACAGCCACAGGTG. The PCR product was cloned into the GCaMP6(s) (Addgene ID 40753) vector by insertion into a NheI site, yielding plasmids encoding 6xHis tag-HsTPC2-GSG-Xpress tag-GCaMP6 fusion proteins. The ligated plasmid was sequenced by Sanger sequencing using standard CMV forward and pEGFP reverse primers, to confirm the insertion took place as desired. A pore dead mutant (hTPC2^GCaMP/L265P) was generated by site-directed mutagenesis using the QuikChange II XL protocol (Agilent), according to the manufacturer’s instructions, using the forward primer sequence GAGTCTCTGACTTCCCCCCTGGTGCTGCTGAC (reverse primer reverse complement of the former). All recordings were performed in nominally Ca²⁺-free HBS2. Images were acquired every 3 s at 20X (Fura-2) or 40X magnification using a cooled coupled device camera (TILL photonics) attached to an Olympus IX71 inverted fluorescence microscope fitted with a monochromator light source. Fura-2 was excited at 340 nm/380 nm, and GCaMP6(s) was excited at 470 nm. Emitted fluorescence was captured using 440 nm or 515 nm long-pass filters, respectively.

Manual whole-endo-lysosomal patch-clamp recordings were performed as described previously (Chen et al., 2017). HEK293 cells were plated onto poly-L-lysine (Sigma)-coated glass coverslips, grown over night and transiently transfected for 17–25 hr with plasmids using TurboFect (Thermo Fisher) according to the manufacturer’s instructions. Cells expressing wild-type (hTPC2) and a gain-of-function variant (hTPC2^M484L) of human TPC2 tagged at their C-termini with YFP were used (Chao et al., 2017). Cells were treated with either vacuolin or YM201636 (1 μM and 800 nM overnight, respectively) to enlarge endo-lysosomes. Currents were recorded using an EPC-10 patch-clamp amplifier (HEKA, Lambrecht, Germany) and PatchMaster acquisition software (HEKA). Data were digitized at 40 kHz and filtered at 2.8 kHz. Fast and slow capacitive transients were cancelled by the compensation circuit of the EPC-10 amplifier. Glass pipettes for recording were polished and had a resistance of 4–8 MΩ. For all experiments, salt-agar bridges were used to connect the reference Ag-AgCl wire to the bath solution to minimize voltage offsets. Liquid junction potential was corrected as described (Chen et al., 2017). For the application of agonists, cytoplasmic solution was completely exchanged. Unless otherwise stated, the cytoplasmic solution comprised 140 mM K-MSA, 5 mM KOH, 4 mM NaCl, 0.39 mM CaCl₂, 1 mM EGTA and 10 mM HEPES (pH was adjusted with KOH to 7.2). Luminal solution comprised 140 mM Na-MSA, 5 mM K-MSA, 2 mM Ca-MSA, 1 mM CaCl₂, 10 mM HEPES and 10 mM MES (pH was adjusted to 4.6 with MSA). 500 ms voltage ramps from −100 to +100 mV were applied every 5 s, holding potential at 0 mV. The current amplitudes at −100 mV were extracted from individual ramp current recordings. For MmTPC1 measurements a one step protocol was applied (+140 mV over 2 s, holding potential of −70 mV) and the cytoplasmic solution contained 140 mM Na-gluconate, 5 mM NaOH, 4 mM KCl, 2 mM MgCl2, 0.39 mM CaCl2, 1 mM EGTA and mM 10 HEPES (pH 7.2). The luminal solution contained 140 mM Na-MSA, 5 mM K-MSA, 2 mM Ca-MSA, 1 mM CaCl₂, 10 mM HEPES and 10 mM MES (pH was adjusted to 4.6 with MSA). All statistical analyses were done using Origin8 software.

For analyses under bi-ionic conditions, HEK293 cells stably expressing hTPC2 tagged at its C-terminus with YFP were used. The cytoplasmic solution comprised 160 mM NaCl and 5 mM HEPES (pH was adjusted with NaOH to 7.2) and the luminal solution comprised 105 mM CaCl₂, 5 mM HEPES and 5 mM MES (pH was adjusted to 4.6 with MSA). The permeability ratio (P_Ca/P_Na) was calculated according to Fatt and Ginsborg (1958):

for bi-ionic test (Figure 2Q and Figure 2—figure supplement 1F), and equation according to Eq. 13.47 from Jackson (2006),

for internal and external solutions containing the same monovalent and divalent cations (Figure 2—figure supplement 1D–F). P_Ca = Ca²⁺ permeability; P_Na = Na⁺ permeability; γ_Ca = Ca²⁺ activity coefficient (0.52); γ_Na = Na⁺ activity coefficient (0.75); [Ca]_o = concentration of Ca²⁺ in the lumen; [Na]_i = concentration of Na⁺ in the cytosol; [Na]_o = concentration of Na⁺ in the lumen; E_rev = reversal potential; F, R = standard thermodynamic constants; T = temperature.

For preparation of primary alveolar macrophages, mice were deeply anesthetized and euthanized by exsanguination. The trachea was exposed and cannulated by inserting a 20-gauge catheter (B. Braun). Cells were harvested by eight consecutive lung lavages with 1 mL of DPBS (Dulbeccos’s Phosphate-Buffered Saline) and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% antibiotics. For experimentation, alveolar macrophages were directly seeded onto 12 mm glass cover slips and used within 5 days after preparation.

Alveolar macrophages (3 × 10⁴), isolated from wild-type and TPC2 KO mice (described in Grimm et al., 2014) were seeded on 8-well plates (Ibidi) and cultured overnight. Cells were washed once with Minimum Essential Media (MEM) supplemented with 10 mM HEPES and then treated with TPC2-A1-N or TPC2-A1-P as indicated. Ionomycin (4 µM for 10 min) was used as positive control. Following treatment, cells were incubated with an anti-LAMP1 antibody (1:200, SantaCruz) in MEM supplemented with 10 mM HEPES and 1% BSA for 20 min on ice. Cells were then fixed with 2.6% PFA (Thermo Fisher) for 20 min and incubated with Alexa Fluor 488 conjugated secondary antibody (Thermo Fisher) for 1 hr in PBS containing 1% BSA. Nuclei were stained with DAPI. Confocal images were acquired using an LSM 880 microscope (Zeiss) with 40X magnification.

Vesicle fusion of wild-type and TPC2-deficient primary alveolar macrophages was analyzed by measuring cell membrane capacitance using the patch-clamp technique as previously described (Zierler et al., 2016). In brief, vesicle fusion was recorded using the automated capacitance cancellation function of the EPC-10 (HEKA, Lambrecht, Germany). Measurements were performed in a tight seal whole-cell configuration at room temperature. Membrane capacitance values directly captured after breaking the seal between the membrane and the glass pipette were used as a reference for the initial cell size. Further recorded capacitance values were normalized to this initial determined capacitance. Extracellular solution contained: 140 mM NaCl, 1 mM CaCl₂, 2.8 mM KCl, 2 mM MgCl₂, 10 mM HEPES-NaOH, 11 mM glucose (pH 7.2, 300 mosmol/L). Internal solution contained: 120 mM potassium glutamate, 8 mM NaCl, 1 mM MgCl₂, 10 mM HEPES-NaOH, 0.1 mM GTP (pH 7.2, 280 mosmol/L). At 180 s TPC2-A1-P (30 µM, diluted in external solution) was applied via an application pipette.

Cell culture and transfection: DMEM (Sigma Aldrich) containing 10% fetal bovine serum, 100 U/mL penicillin, 100 µg/mL streptomycin, and 2.5 µg/mL Fungizone (Thermo Fisher) was used to grow HeLa cells (all obtained from ATCC, Guernsey, UK). Transfection of cells in six-well (Greiner-Bio-One, Kremsmünster, Austria) was performed using PolyJet transfection reagent (SignaGen Laboratories, Rockville). HeLa cells stably expressing pH-Lemon-GPI (NGFI, Graz, Austria) were generated by selection with 800 µg/mL of G418 (Sigma Aldrich, St. Louis, USA) and FACS sorting for CFP (excitation at 405 nm). Wide-field fluorescence microscopy experiments were performed using an OLYMPUS IX73 inverted microscope (OLYMPUS, Vienna, Austria) using a 40X objective (UApo N 340, 40X/1.35 Oil, ∞/0.17/FN22, OLYMPUS). Illumination was performed using an OMICRON LedHUB High-Power LED Light Engine, equipped with a 455 nm and 505 nm LED light source (OMICRON electronics, Vienna, Austria), and 430 nm and 500 nm excitation filters (AHF Analysentechnik, Tübingen, Germany), respectively. Images were captured at a binning of 2 using a Retiga R1 CCD camera (TELEDYNE QIMAGING, Surrey, Canada) and emissions were separated using an optical beam splitter (DV2, Photometrics, Arizona). Array Confocal microscopy was performed using an array confocal laser scanning microscope (ACLSM) built on a fully automatic inverse microscope (Axio Observer.Z1, Zeiss, Göttingen, Germany) using a 100x objective (Plan-Apochromat 100x, 1.4 Oil M27). Excitation was performed using laser light of diode lasers (Visitron Systems): CFP of pH-lemon was excited at 445 nm and 505 nm respectively. Emitted light was acquired with emission filters ET480/40 m for CFP and ET525/50 m for EYFP (Chroma Technologies, VT). A Photometrics CCD camera (CoolSnap HQ2) was used to capture all images at a binning of 1. Device control and image acquisition was performed using VisiView image acquisition and control software (Visitron Systems, Puchheim, Germany) for both devices. Images were processed using MetaMorph analysis software (Molecular Devices, San Jose). Data and statistical analyses were done using GraphPad Prism Software.

All chemicals used were of analytical grade and were obtained from abcr (Karlsruhe, Germany), Fischer Scientific (Schwerte, Germany), Sigma-Aldrich (now Merck, Darmstadt, Germany), TCI (Eschborn, Germany) or Th. Geyer (Renningen, Germany). HPLC grade and dry solvents were purchased from VWR (Darmstadt, Germany) or Sigma-Aldrich, all other solvents were purified by distillation. Hydrophobic phase separation filters (MN 617 WA, 125 mm) were purchased from Macherey Nagel (Düren, Germany). All reactions were monitored by thin-layer chromatography (TLC) using pre-coated plastic sheets POLYGRAM SIL G/UV254 from Macherey-Nagel and detected by irradiation with UV light (254 nm or 366 nm). Flash column chromatography (FCC) was performed on Merck silica gel Si 60 (0.015–0.040 mm).

NMR spectra (¹H, ¹³C, DEPT, COSY, HSQC/HMQC, HMBC) were recorded at 23°C on an Avance III 400 MHz Bruker BioSpin or Avance III 500 MHz Bruker BioSpin instrument, unless otherwise specified. Chemical shifts δ are stated in parts per million (ppm) and are calibrated using residual protic solvents as an internal reference for proton (CDCl₃: δ = 7.26 ppm, (CD₃)₂SO: δ = 2.50 ppm) and for carbon the central carbon resonance of the solvent (CDCl₃: δ = 77.16 ppm, (CD₃)₂SO: δ = 39.52 ppm). Multiplicity is defined as s = singlet, d = doublet, t = triplet, q = quartet, sext = sextet, m = multiplet. NMR spectra were analyzed with NMR software MestReNova, version 12.0.1–20560 (Mestrelab Research S.L.). High-resolution mass spectra were performed by the LMU Mass Spectrometry Service applying a Thermo Finnigan MAT 95 or Joel MStation Sektorfeld instrument at a core temperature of 250°C and 70 eV for EI or a Thermo Finnigan LTQ FT Ultra Fourier Transform Ion Cyclotron Resonance device at 250°C for ESI. IR spectra were recorded on a Perkin Elmer FT-IR Paragon 1000 instrument as neat materials. Absorption bands were reported in wave number (cm⁻¹) with ATR PRO450-S. Melting points were determined by the open tube capillary method on a Büchi melting point B-540 apparatus and are uncorrected. Microwave-assisted reactions were carried out in a Discover (S-Class Plus) SP microwave reactor (CEM GmbH, Kamp-Lintfort, Germany). HPLC purities were determined using an HP Agilent 1100 HPLC with a diode array detector and an Agilent Poroshell column (120 EC-C18; 3.0 × 100 mm; 2.7 micron) with acetonitrile/water as eluent (60:40 acetonitrile/water + 0.1% formic acid).

According to Sjogren et al. (1991) the appropriate amides received from general procedure A (1.0 eq.) were dissolved in dry THF, the solution was cooled to 0°C and NaH (dispersion in paraffin, 60%, 2.3 eq.) was added. After stirring for 15 min, the appropriate benzoyl chloride (1.1 eq.) was added. The mixture was stirred at 0°C for 1 hr and then cautiously treated with 1 M HCl. The precipitate was collected by filtration, washed with ice water and cold EtOH and recrystallized from toluene to give the desired cyanoacetamides.

If the appropriate benzoyl chloride was not commercially available, it was prepared by refluxing the appropriate benzoic acid (1.1 eq.) in SOCl₂ (55 eq.) for 1 hr and concentrating in vacuo. The resulting acid chloride was immediately transferred to the reaction.

LiOH (10 eq.) was added to a solution of the appropriate ester (1.0 eq.) in dioxane/H₂O (5:1) and the reaction mixture was stirred in a closed vessel under microwave irradiation (p_max = 8 bar, P_max = 200 W, T_max = 180°C) for 1–18 hr. The suspension was diluted with water to thrice original volume and aq. 2 M HCl was added dropwise under vigorous stirring until the mixture was strongly acidic. The formed precipitate was collected by filtration, washed with water and dried. If necessary the acids were recrystallized from EtOH to yield the pure products.

Chemical structure 1

Download asset Open asset

According to general procedure A, 4-(trifluoromethyl)aniline (812 µL, 6.47 mmol, 1.1 eq.), 2-cyanoacetic acid (500 mg, 5.88 mmol, 1.0 eq.) and DCC (1.27 g, 6.17 mmol, 1.1 eq.) in DMF (7.0 mL) were used to yield amide SGA-34 as colorless crystals (983 mg, 4.31 mmol, 73%). Analytical data are in accordance with literature (Davies et al., 2009; Sjogren et al., 1991). R_f = 0.14 (4:1 hexanes/acetone). m.p.: 195°C [(Sjogren et al., 1991): 191–193°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.65 (s, 1H, NH), 7.75 (d, J = 8.8 Hz, 2H, 3’-H, 5’-H), 7.70 (d, J = 8.8 Hz, 2H, 2’-H, 6’-H), 3.95 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 161.9 (C-1), 141.9 (C-1’), 126.3 (q, J_CF = 3.7 Hz, C-3’, C-5’), 124.4 (q, J_CF = 271.4 Hz, CF₃), 124.0 (q, J_CF = 32.0 Hz, C-4’), 119.2 (C-2’, C-6’), 115.7 (CN), 27.0 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3287, 3221, 3147, 1681, 1612, 1557, 1319, 1110, 1065, 849, 835. HRMS (ESI): calcd. for C₁₀H₆F₃N₂O (M-H)^- 227.04377; found 227.04371. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 2

Download asset Open asset

According to general procedure A, p-toluidine (712 µL, 6.47 mmol, 1.1 eq.), 2-cyanoacetic acid (500 mg, 5.88 mmol, 1.0 eq.) and DCC (1.27 g, 6.17 mmol, 1.1 eq.) in DMF (7.0 mL) were used to yield amide one as colorless crystals (728 mg, 4.18 mmol, 71%). Analytical data are in accordance with literature (Yuan et al., 2019). R_f = 0.14 (4:1 hexanes/acetone). m.p.: 184°C [(Yuan et al., 2019): 186°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.19 (s, 1H, NH), 7.47–7.36 (m, 2H, 2’-H, 6’-H), 7.13 (d, J = 8.2 Hz, 2H, 3’-H, 5’-H), 3.86 (s, 2H, 2 hr), 2.25 (s, 3H, CH₃). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 160.7 (CO), 135.9 (C-1’), 132.9 (C-4’), 129.3 (C-3’, C-5’), 119.2 (C-2’, C-6’), 116.0 (CN), 26.6 (C-2), 20.4 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3267, 3207, 3137, 1660, 1613, 1552, 1510, 819. HRMS (ESI): calcd. for C₁₀H₉N₂O (M-H)^- 173.07204; found 173.07194. Purity (HPLC): >96% (λ = 210 nm), >96% (λ = 254 nm).

Chemical structure 3

Download asset Open asset

According to general procedure A, aniline (1.96 mL, 21.5 mmol, 1.0 eq.), 2-cyanoacetic acid (2.01 g, 23.6 mmol, 1.1 eq.) and DCC (4.87 g, 23.6 mmol, 1.1 eq.) in DMF (20 mL) were used to yield amide two as colorless crystals (2.60 g, 16.2 mmol, 76%). Analytical data are in accordance with literature (Yuan et al., 2019). R_f = 0.12 (4:1 hexanes/acetone). m.p.: 202°C [(Yuan et al., 2019): 172°C]. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.28 (s, 1H, NH), 7.54 (dt, J = 8.7, 1.6 Hz, 2H, 2’-H, 6’-H), 7.39–7.29 (m, 2H, 3’-H, 5’-H), 7.15–7.04 (m, 1H, 4’-H), 3.89 (s, 2H, 2 hr). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 161.0 (CO), 138.4 (C-1’), 128.9 (C-3’, C-5’), 123.9 (C-4’), 119.2 (C-2’, C-6’), 115.9 (CN), 26.7 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3265, 3207, 3143, 3099, 3052, 1653, 1620, 1557, 1299, 943, 761, 696. HRMS (ESI): calcd. for C₉H₇N₂O (M-H)^- 159.05639; found 159.05628. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 4

Download asset Open asset

According to general procedure A, p-anisidine (2.36 mL, 20.3 mmol, 1.0 eq.), 2-cyanoacetic acid (19.0 g, 22.3 mmol, 1.1 eq.) and DCC (4.61 g, 22.3 mmol, 1.1 eq.) in DMF (20 mL) were used to yield amide three as pale blue crystals (1.58 g, 8.31 mmol, 41%). Analytical data are in accordance with literature (Yuan et al., 2019). R_f = 0.10 (4:1 hexanes/acetone). m.p.: 137°C [(Yuan et al., 2019): 176°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.14 (s, 1H, NH), 7.53–7.38 (m, 2H, 2’-H, 6’-H), 7.00–6.83 (m, 2H, 3’-H, 5’-H), 3.84 (s, 2H, 2 hr), 3.72 (s, 3H, OCH₃). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 160.4 (CO), 155.6 (C-4’), 131.4 (C-1’), 120.8 (C-2’, C-6’), 116.0 (CN), 114.0 (C-3’, C-5’), 55.2 (OCH₃), 26.5 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3299.3150, 1655, 1608, 1557, 1511, 1251, 1032, 828. HRMS (ESI): calcd. for C₁₀H₉N₂O₂ (M-H)^- 189.06695; found 189.06688. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 5

Download asset Open asset

According to general procedure A, 4-chloroaniline (682 µL, 23.0 mmol, 1.0 eq.), 2-cyanoacetic acid (2.16 g, 25.4 mmol, 1.1 eq.) and DCC (5.23 g, 25.4 mmol, 1.1 eq.) in DMF (20 mL) were used to yield amide four as colorless crystals (3.46 g, 17.8 mmol, 77%). Analytical data are in accordance with literature (Yuan et al., 2019). R_f = 0.14 (3:2 hexanes/acetone). m.p.: 207°C [(Yuan et al., 2019): 179°C]. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.42 (s, 1H, NH), 7.62–7.51 (m, 2H, 2’-H, 6’-H), 7.50–7.27 (m, 2H, 3’-H, 5’-H), 3.91 (s, 2H, 2 hr). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 161.2 (CO), 137.3 (C-1’), 128.8 (C-3’, C-5’), 127.5 (C-4’), 120.8 (C-2’, C-6’), 115.8 (CN), 26.8 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3264, 3200, 3132, 3083, 1664, 1610, 1548, 1491, 832. HRMS (ESI): calcd. for C₉H₆³⁵ClN₂O (M-H)^- 193.01741; found 193.01750. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 6

Download asset Open asset

According to general procedure A, 4-bromoaniline (2.00 mL, 17.1 mmol, 1.0 eq.), 2-cyanoacetic acid (1.60 g, 18.8 mmol, 1.1 eq.) and DCC (3.88 g, 18.8 mmol, 1.1 eq.) in DMF (20 mL) were used to yield amide five as colorless crystals (1.62 g, 6.76 mmol, 40%). Analytical data are in accordance with literature (Yuan et al., 2019). R_f = 0.14 (4:1 hexanes/acetone). m.p.: 186°C [(Yuan et al., 2019): 185°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.42 (s, 1H, NH), 7.52 (s, 4H, 2’-H, 3’-H, 5’-H, 6’-H), 3.90 (s, 2H, 2 hr).¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 161.2 (CO), 137.7 (C-1‘), 131.7 (C-2‘, C-6’ or C-3’, C-5’), 121.2 (C-2‘, C-6’ or C-3’, C-5’), 115.8 (C-4’), 115.5 (CN), 26.8 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3322, 2927, 2849, 1608, 1547, 1245, 828. HRMS (ESI): calcd. for C₉H₆⁷⁹BrN₂O (M-H)^- 236.96690; found 236.96692. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 7

Download asset Open asset

According to general procedure A, 4-fluoroaniline (2.16 mL, 22.5 mmol, 1.0 eq.), 2-cyanoacetic acid (1.91 g, 22.5 mmol, 1.0 eq.) and DCC (4.64 g, 22.5 mmol, 1.0 eq.) in DMF (20 mL) were used to yield amide six as colorless crystals (3.00 g, 16.9 mmol, 75%). Analytical data are in accordance with literature (Ammar et al., 2006). R_f = 0.11 (4:1 hexanes/acetone). m.p.: 179°C [(Ammar et al., 2006): 158–160°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.34 (s, 1H, NH), 7.66–7.46 (m, 2H, 2’-H, 6’-H), 7.27–7.09 (m, 2H, 3’-H, 5’-H), 3.89 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 161.0 (CO), 158.3 (d, J_CF = 240.5 Hz, C-4’), 134.7 (d, J_CF = 2.7 Hz, C-1’), 121.1 (d, J_CF = 7.9 Hz, C-2’, C-6’), 115.9 (CN), 115.5 (d, J_CF = 22.3 Hz, C-3’, C-5’), 26.6 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3274, 3166, 3107, 1662, 1623, 1566, 1505, 834. HRMS (ESI): calcd. for C₉H₆FN₂O (M-H)^- 177.04696; found 177.04687. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 8

Download asset Open asset

According to general procedure A, 4-iodoaniline (4.50 g, 20.5 mmol, 1.0 eq.), 2-cyanoacetic acid (17.5 g, 20.5 mmol, 1.0 eq.) and DCC (4.24 g, 20.5 mmol, 1.0 eq.) in DMF (20 mL) were used to yield amide seven as pale blue crystals (4.50 g, 15.7 mmol, 77%). The compound is literature known, but no analytical data are available (Sjogren et al., 1991). R_f = 0.11 (4:1 hexanes/acetone). m.p.: 218°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.38 (s, 1H, NH), 7.78–7.60 (m, 2H, 3’-H, 5’-H), 7.49–7.29 (m, 2H, 2’-H, 6’-H), 3.90 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 161.2 (CO), 138.2 (C-1’), 137.6 (C-3’, C-5’), 121.4 (C-2’, C-6’), 115.8 (CN), 87.6 (C-4’), 26.8 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3265, 3188, 3113, 3078, 1666, 1543, 1391, 1299, 823. HRMS (ESI): calcd. for C₉H₆IN₂O (M-H)^- 284.95303; found 284.95302. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 9

Download asset Open asset

According to general procedure A, 4-nitroaniline (696 µL, 7.24 mmol, 1.0 eq.), 2-cyanoacetic acid (616 mg, 7.24 mmol, 1.0 eq.) and DCC (1.49 g, 7.24 mmol, 1.0 eq.) in DMF (20 mL) were used to yield amide eight as yellow solid (918 mg, 4.47 mmol, 62%). Analytical data are in accordance with literature (Sohn et al., 2017). R_f = 0.11 (4:1 hexanes/acetone). m.p.: 218°C [(Sohn et al., 2017): 220°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.88 (s, 1H, NH), 8.35–8.15 (m, 2H, 3’-H, 5’-H), 7.93–7.71 (m, 2H, 2’-H, 6’-H), 4.00 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 162.2 (CO), 144.4 (C-1’), 142.7 (C-4’), 125.1 (C-3’, C-5’), 119.0 (C-2’, C-6’), 115.5 (CN), 27.2 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3287, 1673, 1562, 1503, 1336, 1259, 860, 748. HRMS (ESI): calcd. for C₉H₆N₃O₃ (M-H)^- 204.04146; found 204.04146. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 10

Download asset Open asset

According to general procedure A, 4-aminobenzonitrile (1.00 g, 8.46 mmol, 1.0 eq.), 2-cyanoacetic acid (7.20 g, 8.46 mmol, 1.0 eq.) and DCC (1.75 g, 8.46 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide nine as yellow solid (1.22 g, 6.57 mmol, 78%). The compound is literature known, but no analytical data are available (Sjogren et al., 1991). R_f = 0.08 (4:1 hexanes/acetone). m.p.: 201°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.72 (s, 1H, NH), 7.82–7.78 (m, 2H, 3’-H, 5’-H), 7.74–7.70 (m, 2H, 2’-H, 6’-H), 3.97 (s, 2H, 2 hr). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 162.0 (CO), 142.5 (C-1’), 133.5 (C-3’, C-5’), 119.3 (C-2’, C-6’), 118.9 (C-4’), 115.6 (CH₂CN), 105.7 (CN), 27.1 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3268, 3194, 3118, 2229, 1599, 1538, 1504, 845. HRMS (ESI): calcd. for C₁₀H₆N₃O (M-H)^- 184.05164; found 184.05161. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 11

Download asset Open asset

According to general procedure A, 4-aminoacetophenone (1.30 mL, 7.40 mmol, 1.0 eq.), 2-cyanoacetic acid (629 mg, 7.40 mmol, 1.0 eq.) and DCC (1.53 g, 7.40 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 10 as yellow crystals (802 mg, 3.97 mmol, 54%). Analytical data are in accordance with literature (Metwally et al., 2017). R_f = 0.37 (3:2 hexanes/acetone). m.p.: 194°C [(Metwally et al., 2017): 225°C]. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.63 (s, 1H, NH), 7.99–7.91 (m, 2H, 3’-H, 5’-H), 7.74–7.62 (m, 2H, 2’-H, 6’-H), 3.96 (s, 2H, 2 hr), 2.53 (s, 3H, CH₃). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 196.5 (COCH₃), 161.7 (HNCO), 142.6 (C-1‘), 132.2 (C-4‘), 129.6 (C-3‘, C-5‘), 118.5 (C-2‘, C-6‘), 115.7 (CN), 27.0 (C-2), 26.5 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3286, 2250, 1695, 1651, 1599, 1536, 1279, 1249, 833, 720. HRMS (ESI): calcd. for C₁₁H₉N₂O₂ (M-H)^- 201.06695; found 201.06694. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 12

Download asset Open asset

According to general procedure A, 4-propoxyaniline (679 µL, 4.49 mmol, 1.0 eq.), 2-cyanoacetic acid (382 mg, 4.49 mmol, 1.0 eq.) and DCC (927 mg, 4.49 mmol, 1.0 eq.) in DMF (2.0 mL) were used to yield amide 11 as colorless crystals (604 mg, 2.77 mmol, 62%). R_f = 0.24 (95:5 CH₂Cl₂/EtOH). m.p.: 183°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.13 (s, 1H, NH), 7.51–7.38 (m, 2H, 2’-H, 6’-H), 6.98–6.83 (m, 2H, 3’-H, 5’-H), 3.88 (t, J = 7.1 Hz, 2H, CH₂CH₂CH₃), 3.84 (s, 2H, 2 hr), 1.70 (sext, J = 7.1 Hz, 2H, CH₂CH₂CH₃), 0.96 (t, J = 7.1 Hz, 3H, CH₂CH₂CH₃). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 160.4 (CO), 155.1 (C-4’), 131.4 (C-1’), 120.8 (C-2’, C-6’), 116.0 (CN), 114.5 (C-3’, C-5’), 69.0 (CH₂CH₂CH₃), 26.5 (C-2), 22.0 (CH₂CH₂CH₃), 10.4 (CH₂CH₂CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3283, 3096, 1607, 1559, 1508, 1239, 828, 570. HRMS (ESI): calcd. for C₁₂H₁₃N₂O₂ (M-H)^- 217.09825; found 217.09832. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 13

Download asset Open asset

According to general procedure A, 4-(trifluoromethoxy)aniline (939 µL, 7.00 mmol, 1.0 eq.), 2-cyanoacetic acid (595 mg, 7.00 mmol, 1.0 eq.) and DCC (1.44 g, 7.00 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 12 as colorless solid (1.23 g, 5.03 mmol, 72%). The compound is literature known, but no analytical data are available (Sjogren et al., 1991). R_f = 0.39 (95:5 CH₂Cl₂/EtOH). m.p.: 154°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.49 (s, 1H, NH), 7.74–7.55 (m, 2H, 2’-H, 6’-H), 7.47–7.26 (m, 2H (3’-H, 5’-H), 3.92 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 161.3 (CO), 144.0 (C-4‘), 137.5 (C-1‘), 121.8 (C-3’, C-5’), 120.7 (C-2’, C-6’), 120.1 (q, J_CF = 255.7 Hz, OCF₃), 115.8 (CN), 26.8 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3278, 2975, 1667, 1616, 1557, 1508, 1277, 1205, 1171. HRMS (ESI): calcd. for C₁₀H₆F₃N₂O₂ (M-H)^- 243.03869; found 243.03869. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 14

Download asset Open asset

According to general procedure A, methyl 4-aminobenzoate (3.00 g, 19.5 mmol, 1.0 eq.), 2-cyanoacetic acid (1.66 g, 19.5 mmol, 1.0 eq.) and DCC (4.01 g, 19.5 mmol, 1.0 eq.) in DMF (15 mL) were used to yield amide 13 as colorless solid (2.76 g, 12.6 mmol, 65%). The compound is literature known, but no analytical data are available (Sjogren et al., 1991). R_f = 0.44 (3:2 hexanes/acetone). m.p.: 162°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.63 (s, 1H, NH), 8.01–7.87 (m, 2H, 2 hr, 6 hr), 7.76–7.61 (m, 2H, 3 hr, 5 hr), 3.96 (s, 2H, 2 hr), 3.82 (s, 3H, CH₃). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 165.7 (COOCH₃), 161.7 (HNCO), 142.7 (C-4), 130.4 (C-2, C-6), 124.6 (C-1), 118.6 (C-3, C-5), 115.7 (CN), 52.0 (CH₃), 27.0 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2809, 1722, 1608, 1558, 1507, 1431, 1274, 1110, 757. HRMS (ESI): calcd. for C₁₁H₉N₂O₃ (M-H)^- 217.06187; found 217.06187. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 15

Download asset Open asset

According to general procedure A, 2-bromo-4-chloroaniline (1.00 g, 4.84 mmol, 1.0 eq.), 2-cyanoacetic acid (412 mg, 4.84 mmol, 1.0 eq.) and DCC (999 mg, 4.84 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 14 as colorless crystals (919 mg, 3.36 mmol, 69%). R_f = 0.22 (3:2 hexanes/acetone). m.p.: 157°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 9.97 (s, 1H, NH), 7.83 (d, J = 2.4 Hz, 1H, 3’-H), 7.63 (d, J = 8.7 Hz, 1H, 6’-H), 7.49 (dd, J = 8.7, 2.4 Hz, 1H, 5’-H), 3.98 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 161.8 (CO), 134.7 (C-1’), 132.0 (C-3’), 130.7 (C-4’), 128.2 (C-5’), 128.0 (C-6’), 118.5 (C-2’), 115.7 (CN), 26.1 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3281, 2258, 1666, 1577, 1530, 1470, 1284, 822. HRMS (ESI): calcd. for C₉H₅⁷⁹Br³⁵ClN₂O (M-H)^- 270.92793; found 270.92809. Purity (HPLC): >93% (λ = 210 nm), >93% (λ = 254 nm).

Chemical structure 16

Download asset Open asset

According to general procedure A, 2-iodoaniline (1.00 g, 4.57 mmol, 1.0 eq.), 2-cyanoacetic acid (388 mg, 4.57 mmol, 1.0 eq.) and DCC (942 mg, 4.57 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 15 as brown crystals (913 g, 3.19 mmol, 70%). R_f = 0.16 (4:1 hexanes/acetone). m.p.: 161°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 9.88 (s, 1H, NH), 7.90 (d, J = 7.6 Hz, 1H, 3’-H), 7.46–7.38 (m, 2H, 5’-H, 6’-H), 7.03 (ddd, J = 8.6, 5.4, 3.6 Hz, 1H, 4’-H), 3.93 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 161.4 (CO), 139.1 (C-3’), 138.7 (C-1’), 128.8 (C-5’), 128.3 (C-4’), 127.4 (C-6’), 115.8 (CN), 96.4 (C-2’), 26.0 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3252, 2263, 1658, 1577, 1542, 1433, 1015, 758, 768. HRMS (ESI): calcd. for C₉H₆IN₂O (M-H)^- 284.95303; found 284.95295. Purity (HPLC): >96% (λ = 210 nm), >96% (λ = 254 nm).

Chemical structure 17

Download asset Open asset

According to general procedure A, 3-chloro-2,4-difluoroaniline (1.06 g, 6.48 mmol, 1.0 eq.), 2-cyanoacetic acid (551 mg, 6.48 mmol, 1.0 eq.) and DCC (1.34 g, 6.48 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 16 as colorless crystals (1.01 g, 4.39 mmol, 68%). R_f = 0.16 (4:1 hexanes/acetone). m.p.: 144°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.32 (s, 1H, NH), 7.79 (td, J = 9.0, 5.8 Hz, 1H, 6’-H), 7.33 (td, J = 9.0, 2.1 Hz, 1H, 5’-H), 3.99 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 162.0 (CO), 154.8 (dd, J_CF = 246.5, 2.0 Hz, C-2’ or C-4’), 150.4 (dd, J_CF = 250.4, 3.3 Hz, C-2’ or C-4’), 123.4 (dd, J_CF = 8.8, 2.4 Hz, C-6’), 123.0 (dd, J_CF = 11.8, 3.5 Hz, C-1’), 115.7 (CN), 111.9 (dd, J_CF = 21.4, 3.8 Hz, C-5’), 108.7 (dd, J_CF = 21.9, 19.7 Hz, C-3’), 26.3 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3274.2935, 2264, 1681, 1551, 1488, 1443, 1012, 831, 628. HRMS (ESI): calcd. for C₉H₄³⁵ClF₂N₂O (M-H)^- 228.99857; found 228.99850. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 18

Download asset Open asset

According to general procedure A, 3,4-dimethoxyaniline (1.00 g, 6.53 mmol, 1.0 eq.), 2-cyanoacetic acid (555 mg, 6.53 mmol, 1.0 eq.) and DCC (1.35 g, 6.53 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 17 as violet crystals (1.10 g, 4.99 mmol, 76%). The compound is literature known, but no analytical data are available (Edraki et al., 2016). R_f = 0.05 (4:1 hexanes/acetone). m.p.: 174°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.15 (s, 1H, NH), 7.21 (d, J = 2.4 Hz, 1H, 2’-H), 7.04 (dd, J = 8.7, 2.4 Hz, 1H, 6’-H), 6.90 (d, J = 8.7 Hz, 1H, 5’-H), 3.84 (s, 2H, 2 hr), 3.79–3.66 (m, 6H, 2x OCH₃). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 160.5 (CO), 148.6 (C-3’), 145.3 (C-4’), 131.9 (C-1’), 116.0 (CN), 112.0 (C-5’), 111.2 (C-6’), 104.3 (C-2’), 55.7 (OCH₃), 55.4 (OCH₃), 26.6 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3273, 2914, 2256, 1660, 1513, 1239, 1132, 1020, 837. HRMS (ESI): calcd. for C₁₁H₁₁N₂O₃ (M-H)^- 219.07752; found 219.07751. Purity (HPLC): >96% (λ = 210 nm), >96% (λ = 254 nm).

Chemical structure 19

Download asset Open asset

According to general procedure A, 2,3-dichloroaniline (745 µL, 6.30 mmol, 1.0 eq.), 2-cyanoacetic acid (536 mg, 6.30 mmol, 1.0 eq.) and DCC (1.30 g, 6.30 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 18 as colorless crystals (414 mg, 1.81 mmol, 29%). R_f = 0.21 (4:1 hexanes/acetone). m.p.: 176°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.11 (s, 1H, NH), 7.69 (dd, J = 8.1, 1.3 Hz, 1H, 4’-H or 6’-H), 7.51 (dd, J = 8.1, 1.3 Hz, 1H, 4’-H or 6’-H), 7.38 (t, J = 8.1 Hz, 1H, 5’-H), 4.02 (s, 2H, 2 hr). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 161.9 (CO), 136.1 (C-1’ or C-3’), 132.0 (C-1’ or C-3’), 128.2 (C-5’), 127.3 (C-4’ or C-6’), 125.3 (C-2’), 124.8 (C-4’ or C-6’), 115.7 (CN), 26.3 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3287, 2253, 1666, 1580, 1527, 1415, 1338, 1182, 953, 788. HRMS (ESI): calcd. for C₉H₅³⁵Cl₂N₂O (M-H)^- 226.97844; found 226.97859. Purity (HPLC): >96% (λ = 210 nm), >96% (λ = 254 nm).

Chemical structure 20

Download asset Open asset

According to general procedure A, 2,6-dibromoaniline (1.00 g, 4.00 mmol, 1.0 eq.), 2-cyanoacetic acid (340 mg, 4.00 mmol, 1.0 eq.) and DCC (825 mg, 4.00 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 19 as colorless crystals (514 mg, 1.62 mmol, 40%). R_f = 0.48 (3:2 hexanes/acetone). m.p.: 187°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.37 (s, 1H, NH), 7.74 (d, J = 8.1 Hz, 2H, 3’-H, 5’-H), 7.22 (t, J = 8.1 Hz, 1H, 4’-H), 3.93 (s, 2H, 2 hr). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 161.1 (CO), 134.7 (C-1‘), 132.4 (C-3‘, C-5‘), 130.7 (C-4‘), 123.9 (C-2‘, C-6‘), 115.6 (CN), 25.4 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3326, 2926, 2851, 1626, 1568, 1539, 1242, 642. HRMS (ESI): calcd. for C₉H₅⁷⁹Br₂N₂O (M-H)^- 314.87741; found 314.87761. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 21

Download asset Open asset

According to general procedure A, 3,5-bis(trifluoromethyl)aniline (1.09 mL, 7.00 mmol, 1.0 eq.), 2-cyanoacetic acid (595 mg, 7.00 mmol, 1.0 eq.) and DCC (1.44 g, 7.00 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 20 as colorless crystals (1.68 g, 5.67 mmol, 81%). The compound is literature known, but no analytical data are available (Shah et al., 2018). R_f = 0.43 (95:5 CH₂Cl₂/EtOH). m.p.: 141°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 10.96 (s, 1H, NH), 8.28–8.12 (m, 2H, 2’-H, 6’-H), 7.90–7.77 (m, 1H, 4’-H), 4.00 (s, 2H, 2 hr). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 162.4 (CO), 140.2 (C-1’), 130.9 (q, J_CF = 32.9 Hz, C-3’, C-5’), 123.1 (q, J_CF = 272.7 Hz, CF₃), 119.2–118.7 (m, C-2’, C-6’), 116.9–116.5 (m, C-4’), 115.4 (CN), 27.1 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3313, 1695, 1572, 1471, 1381, 1272, 1132, 889, 703, 681. HRMS (ESI): calcd. for C₁₁H₅F₆N₂O (M-H)^- 295.03116; found 295.03127. Purity (HPLC): >96% (λ = 210 nm), >96% (λ = 254 nm).

Chemical structure 22

Download asset Open asset

According to general procedure A, N-methyl-4-(trifluoromethyl)aniline (403 µL, 2.85 mmol, 1.0 eq.), 2-cyanoacetic acid (243 mg, 2.85 mmol, 1.0 eq.) and DCC (589 mg, 2.85 mmol, 1.0 eq.) in DMF (10 mL) were used to yield amide 21 as colorless solid (513 mg, 2.12 mmol, 74%). Analytical data are in accordance with literature (Kobayashi and Harayama, 2009). R_f = 0.58 (95:5 CH₂Cl₂/EtOH). m.p.: 70°C [(Kobayashi and Harayama, 2009): 66–68°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 7.77 (d, J = 8.6 Hz, 2H, 3’-H, 5’-H), 7.40 (d, J = 8.2 Hz, 2H, 2’-H, 6’-H), 3.34 (s, 3H, CH₃), 3.23 (s, 2H, 2 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 161.4 (CO), 145.6 (C-1’), 131.7 (C-4’), 127.9 (C-2’, C-6’ or C-3’, C-5’), 127.8 (C-2’, C-6’ or C-3’, C-5’), 123.5 (q, J = 271.4 Hz, CF₃), 113.7 (CN), 38.1 (CH₃), 25.6 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3152, 2355, 1657, 1611, 1322, 1122, 1103, 1065, 848. HRMS (ESI): calcd. for C₁₁H₈F₃N₂O (M-H)^- 241.05942; found 241.05939. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 23

Download asset Open asset

According to general procedure A, 4-(trifluoromethyl)benzylamine (2.50 mL, 17.5 mmol, 1.0 eq.), 2-cyanoacetic acid (1.49 g, 17.5 mmol, 1.0 eq.) and DCC (3.62 g, 17.5 mmol, 1.0 eq.) in DMF (15 mL) were used to yield amide 22 as colorless solid (299 mg, 1.23 mmol, 7%). Analytical data are in accordance with literature (Guo et al., 2011). R_f = 0.46 (3:2 hexanes/acetone). m.p.: 113°C [(Guo et al., 2011): 128°C]. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 8.83 (t, J = 5.7 Hz, 1H, NH), 7.74–7.66 (m, 2H, 3’-H, 5’-H), 7.54–7.44 (m, 2H, 2’-H, 6’-H), 4.38 (d, J = 5.7 Hz, 2H, CH₂), 3.73 (s, 2H, 2 hr). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 162.5 (CO), 143.6 (C-1’), 128.0 (C-2’, C-6’), 127.7 (q, J_CF = 31.7 Hz, C-4’), 125.2 (q, J_CF = 3.7 Hz, C-3’, C-5’). 124.3 (q, J_CF = 272.1 Hz, CF₃), 116.1 (CN), 42.2 (CH₂), 25.3 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3316, 2937, 2364, 1734, 1664, 1547, 1325, 1152, 1107, 1066. HRMS (ESI): calcd. for C₁₁H₈F₃N₂O (M-H)^- 241.05942; found 241.05949. Purity (HPLC): >96% (λ = 210 nm), >96% (λ = 254 nm).

Chemical structure 24

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to yield TPC2-A1-N as colorless crystals (276 mg, 0.688 mmol, 69%). R_f = 0.62 (4:1 hexanes/acetone). m.p.: 202°C [(Sjogren et al., 1991): 208–210°C]. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.36 (s, 1H, NH), 7.79–7.76 (m, 2H, 2’-H, 6’-H), 7.65 (t, J = 1.9 Hz, 1H, 4’’-H), 7.62–7.60 (m, 2H, 3’-H, 5’-H), 7.59 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 182.7 (C-3), 166.5 (C-1), 144.9 (C-1’’), 143.6 (C-1’), 133.5 (C-3’’, C-5’’), 128.6 (C-4’’), 126.2–125.9 (m, C-3’, C-5’ and C-2’’, C-6’’), 124.6 (q, J_CF = 286.1 Hz, CF₃), 123.3 (C-2), 121.8 (q, J_CF = 31.8 Hz, C-4’), 118.7 (C-2’, C-6’), 77.7 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3293, 2213, 1538, 1409, 1320, 1268, 1244, 1167, 1106, 1070, 837, 810, 660, 591. HRMS (ESI): calcd. for C₁₇H₈³⁵Cl₂F₃N₂O₂ (M-H)^- 398.99204; found 398.99202. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 25

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and benzoyl chloride (128 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-10 as colorless crystals (185 mg, 0.557 mmol, 56%). Analytical data are in accordance with literature (Davies et al., 2009). R_f = 0.28 (3:2 hexanes/acetone). m.p.: 242°C [(Davies et al., 2009): 245–247°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.12 (s, 1H, NH), 7.84–7.74 (m, 2H, 2’-H, 6’-H), 7.70–7.58 (m, 4H, 3’-H, 5’-H, Ph), 7.48–7.39 (m, 3H, Ph). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 185.7 (C-3), 167.3 (C-1), 143.1 (C-1‘), 139.7 (qPh), 135.0 (C-2), 130.0 (Ph), 127.8 (Ph), 127.6 (Ph), 126.0 (q, J_CF = 3.8 Hz, C-3’, C-5’), 125.0 (d, J_CF = 270.6 Hz, CF₃), 122.3 (d, J_CF = 35.2 Hz, C-4’), 119.4 (C-2’, C-6’), 77.8 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3283, 2216, 1592, 1550, 1309, 1109, 1067, 840, 694. HRMS (ESI): calcd. for C₁₇H₁₀F₃N₂O₂ (M-H)^- 331.06999; found 331.06985. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 26

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dinitrobenzoyl chloride (254 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-11 as red crystals (124 mg, 0.294 mmol, 29%). R_f = 0.21 (3:2 hexanes/acetone). m.p.: 240°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.32 (s, 1H, NH), 10.00 (s, 1H, OH), 8.89–8.80 (m, 3H, 2’’-H, 4’’-H, 6’’-H), 7.84–7.75 (m, 2H, 2’-H, 6’-H), 7.67–7.58 (m, 2H, 3’-H, 5’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 180.5 (C-3), 166.1 (C-1), 147.6 (C-3‘‘, C-5‘‘), 144.4 (C-1’’), 143.5 (C-1‘), 127.6 (C-2‘‘, C-6‘‘),126.1 (q, J_CF = 3.5 Hz, C-3‘, C-5‘),124.2 (q, J_CF = 271.0 Hz, CF₃), 123.3 (C-2), 121.8 (q, J_CF = 31.7 Hz, C-4’), 119.0 (C-4’’), 118.6 (C-2’, C-6’), 77.7 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3262, 3093, 2223, 1539, 1342, 1317, 1115, 1067, 841, 730, 703, 687. HRMS (ESI): calcd. for C₁₇H₈F₃N₄O₆ (M-H)^- 421.04014; found 421.04021. Purity (HPLC):>96% (λ = 210 nm), >96% (λ = 254 nm).

Chemical structure 27

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 4-nitrobenzoyl chloride (204 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-15 as yellow crystals (276 mg, 0.688 mmol, 69%). R_f = 0.19 (3:2 hexanes/acetone). m.p.: 217°C [(Sjogren et al., 1991): 211–214°C]. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.39 (s, 1H, NH), 8.28–8.19 (m, 2H, 3’’-H, 5’’-H), 7.84–7.80 (m, 2H, 2’’-H, 6’’-H), 7.78 (d, J = 8.6 Hz, 2H, 2’-H, 6’-H), 7.60 (d, J = 8.6 Hz, 2H, 3’’-H, 5’’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 184.3 (C-3), 166.4 (C-1), 148.1 (C-1’’), 147.5 (C-4’’), 143.7 (C-1’), 128.6 (C-2’’, C-6’’), 126.1 (q, J_CF = 3.6 Hz, C-3’, C-5’), 124.6 (q, J_CF = 270.9 Hz, CF₃), 123.2 (C-2), 123.1 (C-3’’, C-5’’), 121.6 (q, J_CF = 32.0 Hz, C-4’), 118.6 (C-2’, C-6’), 77.9 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3307, 2219, 1551, 1320, 1111, 1069, 844, 750, 700. HRMS (ESI): calcd. for C₁₇H₉F₃N₃O₄ (M-H)^- 376.05506; found 376.05509. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 28

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 4-chlorobenzoyl chloride (141 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-16 as colorless crystals (222 mg, 0.605 mmol, 61%). R_f = 0.32 (3:2 hexanes/acetone). m.p.: 220°C [(Sjogren et al., 1991): 218–220°C]. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.31 (s, 1H, NH), 7.81–7.75 (m, 2H, 2’-H, 6’-H), 7.68–7.63 (m, 2H, 2’’-H, 6’’-H), 7.63–7.58 (m, 2H, 3’-H, 5’-H), 7.49–7.44 (m, 2H, 3’’-H, 5’’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 184.8 (C-3), 167.0 (C-1), 143.5 (C-1’), 139.6 (C-1’’), 134.1 (C-4’’), 129.4 (C-2’’, C-6’’), 127.8 (C-3’’, C-5’’), 126.0 (q, J_CF = 3.6 Hz, C-3’, C-5’), 124.6 (q, J_CF = 271.0 Hz, CF₃), 123.0 (C-2), 121.8 (q, J_CF = 31.0 Hz, C-4’), 118.9 (C-2’, C-6’), 77.5 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3282.2215, 1587, 1240, 1302, 1129, 1113, 1097, 839. HRMS (ESI): calcd. for C₁₇H₉³⁵ClF₃N₂O₂ (M-H)^- 365.03101; found 365.03108. Purity (HPLC): >96% (λ = 210 nm), >96% (λ = 254 nm).

Chemical structure 29

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 2,3,4,5,6-pentafluorobenzoyl chloride (158 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-40 as colorless crystals (236 mg, 0.560 mmol, 56%). R_f = 0.28 (3:2 hexanes/acetone). m.p.: 161°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 11.70 (s, 1H, NH), 7.81–7.72 (m, 2H, 2’-H, 6’-H), 7.67–7.56 (m, 2H, 3’-H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 172.6 (C-3), 164.9 (C-1), 143.9–140.9 (m, C-2’’, C-6’’ or C-3’’, C-5’’), 143.3 (C-1’), 141.9–138.9 (m, C-4’’), 138.5–135.1 (m, C-2’’, C-6’’ or C-3’’, C-5’’), 126.1 (q, J_CF = 3.6 Hz, C-3’, C-5’), 124.6 (q, J_CF = 271.0 Hz, CF₃), 122.0 (q, J_CF = 31.9 Hz, C-4’), 117.5–117.0 (m, C-1’’), 121.7 (C-2’, C-6’), 118.7 (C-2), 81.8 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2230, 1590, 1543, 1524, 1497, 1323, 1116, 1000, 839. HRMS (ESI): calcd. for C₁₇H₅F₈N₂O₂ (M-H)^- 421.02288; found 421.02337. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 30

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dibromobenzoic acid (308 mg, 1.10 mmol, 1.1 eq.; converted into the corresponding aryl chloride) were used to give SGA-70 as light yellow crystals (206 mg, 0.420 mmol, 42%). R_f = 0.32 (3:2 hexanes/acetone). m.p.: 211°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.32 (s, 1H, NH), 8.96 (s, 1H, OH), 7.91–7.81 (m, 1H, 4’’-H), 7.78–7.72 (m, 4H, 2’-H, 6’-H, 2’’-H, 6’’-H), 7.65–7.55 (m, 2H, 3’-H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.5 (C-3), 166.4 (C-1), 145.5 (C-1’’), 143.6 (C-1’), 133.7 (C-4’’), 129.2 (C-2’’, C-6’’), 126.0 (q, J_CF = 3.5 Hz, C-3’, C-5’), 123.9 (q, J_CF = 271.2 Hz, CF₃), 123.3 (C-2), 121.8 (C-3’’, C-5’’), 121.6 (q, J_CF = 31.9 Hz, C-4’), 118.5 (C-2’, C-6’), 77.4 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2218, 1594, 1538, 1315, 1166, 1109, 1068, 838, 750. HRMS (ESI): calcd. for C₁₇H₈⁷⁹Br₂F₃N₂O₂ (M-H)^- 486.89101; found 486.89128. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 31

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 2,4,6-trichlorobenzoyl chloride (172 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-71 as colorless crystals (158 mg, 0.363 mmol, 36%). R_f = 0.14 (3:2 hexanes/acetone). m.p.: 220°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 11.92 (s, 1H, NH), 7.79–7.74 (m, 2H, 2’-H, 6’-H), 7.66 (s, 2H, 3’’-H, 5’’-H), 7.63–7.58 (m, 2H, 3’-H, 5’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 180.7 (C-3), 165.7 (C-1), 143.6 (C-1’), 139.5 (C-1’’), 133.1 (C-4’’), 132.0 (C-2’’, C-6’’), 127.8 (C-3’’, C-5’’), 126.1 (q, J_CF = 3.6 Hz, C-3’, C-5’), 124.6 (q, J_CF = 271.1 Hz, CF₃), 121.9 (C-2), 121.6 (q, J_CF = 31.9 Hz, C-4’), 118.4 (C-2’, C-6’), 79.5 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2230, 1598, 1541, 1318, 1116, 841. HRMS (ESI): calcd. for C₁₇H₇³⁵Cl₃F₃N₂O₂ (M-H)^- 432.95307; found 432.95394. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 32

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and acetyl chloride (78.5 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-94 as colorless crystals (206 mg, 0.761 mmol, 76%). Analytical data are in accordance with literature (Métro et al., 2012). R_f = 0.65 (3:2 hexanes/acetone). m.p.: 224°C [(Métro et al., 2012): 230–232°C]. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.28 (s, 1H, OH), 10.91 (s, 1H, NH), 7.81–7.72 (m, 2H, 2’-H, 6’-H), 7.70–7.61 (m, 2H, 3’-H, 5’-H), 2.25 (s, 3H, 4 hr). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 187.1 (C-3), 166.4 (C-1), 141.9 (C-1’), 125.9 (q, J_CF = 3.7 Hz, C-3’, C-5’), 124.4 (q, J_CF = 271.3 Hz, CF₃), 123.5 (q, J_CF = 32.1 Hz, C-4’), 120.7 (C-2’, C-6’), 118.9 (C-2), 80.5 (CN), 23.5 (C-4). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2335, 2214, 1551, 1319, 1154, 1113, 840, 679. HRMS (ESI): calcd. for C₁₂H₈F₃N₂O₂ (M-H)^- 269.05434; found 269.05423. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 33

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-bis(trifluoromethyl)benzoyl chloride (199 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-111 as colorless crystals (357 mg, 0.762 mmol, 76%). R_f = 0.43 (3:2 hexanes/acetone). m.p.: 230°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.36 (s, 1H, NH), (m, 3H, 2’’-H, 6’’-H, 4’’-H), 7.87–7.71 (m, 2H, 2’-H, 6’-H), 7.69–7.51 (m, 2H, 3’-H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.4 (C-3), 166.3 (C-1), 144.0 (C-1’’), 143.6 (C-1’), 129.8 (q, J_CF = 32.8 Hz, C-3’’, C-5’’), 128.1 (q, J_CF = 4.7 Hz, C-2’’, C-6’’), 126.1 (q, J_CF = 3.6 Hz, C-3’, C-5’), 126.0 (q, J_CF = 257.2 Hz, m-CF₃), 123.4 (C-2), 123.3 (q, J_CF = 271.6 Hz, p-CF₃), 122.7 (q, J_CF = 4.0 Hz, C-4’’), 121.7 (q, J_CF = 31.9 Hz, C-4’), 118.5 (C-2’, C-6’), 77.7 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3289, 2218, 1349, 1323, 1284, 1186, 1139, 1114, 836. HRMS (ESI): calcd. for C₁₉H₈F₉N₂O₂ (M-H)^- 467.04475; found 467.04496. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 34

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dimethylbenzoyl chloride (163 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-112 as colorless crystals (175 mg, 0.486 mmol, 49%). R_f = 0.48 (3:2 hexanes/acetone). m.p.: 187°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.08 (s, 1H, NH), 7.85–7.74 (m, 2H, 2’-H, 6’-H), 7.66–7.58 (m, 2H, 3’-H, 5’-H), 7.25 (s, 2H, 2’’-H, 6’’-H), 7.09 (s, 1H,4’’-H), 2.30 (s, 6H, CH₃). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 186.5 (C-3), 167.8 (C-1), 143.6 (C-1’), 140.1 (C-1’’), 137.2 (C-3’’, C-5’’), 131.8 (C-4’’), 126.4 (q, J_CF = 3.8 Hz, C-3’, C-5’), 125.8 (C-2’’, C-6’’), 125.3 (q, J_CF = 270.8 Hz, CF₃), 122.6 (q, J_CF = 31.9 Hz, C-4’), 121.8 (C-2), 119.9 (C-2’, C-6’), 78.2 (CN), 21.4 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3270, 2218, 1526.1319, 1247, 1157, 1110, 1066, 839. HRMS (ESI): calcd. for C₁₉H₁₄F₃N₂O₂ (M-H)^- 359.10129; found 359.10142. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 35

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dimethoxybenzoyl chloride (221 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-113 as colorless crystals (309 mg, 0.789 mmol, 79%). R_f = 0.54 (3:2 hexanes/acetone). m.p.: 203°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.99 (s, 1H, NH), 7.73–7.63 (m, 4H, 2’-H, 6’-H, 3’-H, 5’-H), 7.12 (d, J = 2.3 Hz, 2H, 2’’-H, 6’’-H), 6.69 (t, J = 2.3 Hz, 1H, 4’’-H), 3.85 (s, 6H, OCH₃). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 184.1 (C-3), 168.7 (C-1), 161.0 (C-3’’, C-5’’), 139.1 (C-1’), 133.9 (C-1’’), 127.8 (q, J_CF = 33.2 Hz, C-4’), 126.7 (q, J_CF = 3.8 Hz, C-3’, C-5’), 123.9 (q, J_CF = 270.1 Hz, CF₃), 121.0 (C-2’, C-6’), 117.5 (C-2), 106.4 (C-2’’, C-6’’), 106.0 (C-4’’), 78.5 (CN), 55.8 (OCH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3297, 2215, 1550, 1324, 1208, 1156, 1095, 1067, 834. HRMS (ESI): calcd. for C₁₉H₁₄F₃N₂O₄ (M-H)^- 391.09112; found 391.09140. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 36

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 4-(trifluoromethoxy)benzoyl chloride (173 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-114 as colorless crystals (200 mg, 0.481 mmol, 48%). R_f = 0.58 (3:2 hexanes/acetone). m.p.: 198°C [(Sjogren et al., 1991): 188–190°C]. ¹H NMR (500 MHz, CDCl₃) δ/ppm = 8.12–8.05 (m, 2H, 2’’-H, 6’’-H), 7.96 (s, 1H, NH), 7.78–7.62 (m, 4H, 2’-H, 6’-H, 3’-H, 5’-H), 7.42–7.32 (m, 2H, 3’’-H, 5’’-H). ¹³C NMR (126 MHz, CDCl₃) δ/ppm = 182.6 (C-3), 168.5 (C-1), 152.8 (C-4’’), 139.0 (C-1’), 130.7 (C-2’’, C-6’’), 130.5 (C-1’’), 128.0 (q, J_CF = 33.0 Hz, C-4’), 126.7 (q, J_CF = 3.7 Hz, C-3’, C-5’), 123.9 (q, J_CF = 271.7 Hz, CF₃), 121.0 (C-2’, C-6’), 120.8 (C-3’’, C-5’’), 120.6 (q, J_CF = 259.4 Hz, OCF₃), 117.3 (C-2), 78.6 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3285, 2215, 1597, 1551, 1505, 1268, 1168, 1128, 839. HRMS (ESI): calcd. for C₁₈H₉F₆N₂O₃ (M-H)^- 415.05228; found 415.05225. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 37

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and nicotinoyl chloride hydrochloride (196 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-127 as orange solid (169 mg, 0.506 mmol, 51%). R_f = 0.00 (3:2 hexanes/EtOAc). m.p.: 235°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.22 (s, 1H, NH), 9.12 (s, 1H, 2’’-H), 8.88 (d, J = 5.6 Hz, 1H, 6’’-H), 8.70 (d, J = 8.0 Hz, 1H, 4’’-H), 8.04 (dd, J = 8.0, 5.6 Hz, 1H, 5’’-H), 7.83–7.72 (m, 2H, 2’-H, 6’-H), 7.67–7.56 (m, 2H, 3’-H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 180.0 (C-3), 165.9 (C-1), 143.5 (C-1’), 143.3 (C-6’’), 143.0 (C-4’’), 141.9 (C-2’’), 139.9 (C-3’’), 126.2 (C-5’’), 126.1 (q, J_CF = 3.6 Hz, C-3’, C-5’), 124.2 (q, J_CF = 270.7 Hz, CF₃), 123.3 (C-2), 121.8 (q, J_CF = 32.0 Hz, C-4’), 118.5 (C-2’, C-6’), 78.5 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2356, 2191, 1533, 1317, 1105, 1060, 849, 698. HRMS (ESI): calcd. for C₁₆H₉F₃N₃O₂ (M-H)^- 332.06523; found 332.06517. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 38

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3-bromo-5-iodobenzoic acid (360 mg, 1.10 mmol, 1.1 eq.; converted into the corresponding aryl chloride) were used to give SGA-132 as colorless crystals (332 mg, 0.618 mmol, 62%). R_f = 0.38 (3:2 hexanes/EtOAc). m.p.: 207°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.31 (s, 1H, NH), 7.97 (s, 1H, 4’’-H), 7.89 (s, 1H, 2’’-H or 6’’-H), 7.78–7.72 (m, 3H, 2’-H, 6’-H and 2’’-H or 6’’-H), 7.63–7.55 (m, 2H, 3’-H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.6 (C-3), 166.4 (C-1), 145.4 (C-1’’), 143.6 (C-1’), 139.1 (C-4’’), 135.0 (C-2’’ or C-6’’), 129.5 (C-2’’ or C-6’’), 126.0 (q, J_CF = 3.8 Hz, C-3’, C-5’), 123.9 (q, J_CF = 263.8 Hz, CF₃), 123.3 (C-2), 121.7 (q, J_CF = 31.6 Hz, C-4’), 121.6 (C-3’’ or C-5’’), 118.6 (C-2’, C-6’), 95.0 (C-3’’ or C-5’’), 77.4 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3276, 2213, 1532, 1318, 1163, 1112, 731. HRMS (ESI): calcd. for C₁₇H₈⁷⁹BrIF₃N₂O₂ (M-H)^- 534.87714; found 534.87813. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 39

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 5-chloronicotinic acid (173 mg, 1.10 mmol, 1.1 eq.; converted into the corresponding aryl chloride) were used to give SGA-136 as light pink crystals (225 mg, 0.611 mmol, 61%). R_f = 0.15 (3:2 hexanes/acetone). m.p.: 221°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.33 (s, 1H, NH), 8.74 (s, 1H, 2’’-H or 4’’-H), 8.69–8.64 (m, 1H, 6’’-H), 8.11–8.05 (m, 1H, 2’’-H or 4’’-H), 7.81–7.73 (m, 2H, 2’-H, 6’-H), 7.64–7.55 (m, 2H, 3’-H, 5’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 181.7 (C-3), 166.2 (C-1), 147.9 (C-6’’), 146.1 (C-2’’ or C-4’’), 143.6 (C-1’), 138.8 (C-3’’ or C-5’’), 134.9 (C-2’’ or C-4’’), 130.5 (C-3’’ or C-5’’), 126.1 (q, J_CF = 3.7 Hz, C-3’, C-5’), 124.6 (q, J_CF = 271.0 Hz, CF₃), 123.5 (C-2), 121.6 (q, J_CF = 31.5 Hz, C-4’), 118.5 (C-2’, C-6’), 78.2 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3285, 2225, 1539, 1308, 1113, 951, 838. HRMS (ESI): calcd. for C₁₆H₈³⁵ClF₃N₃O₂ (M-H)^- 366.02626; found 366.02652. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 40

Download asset Open asset

According to general procedure B, amide SGA-34 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 1-methylpyrrole-2-carbonyl chloride (158 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-32 as colorless crystals (221 mg, 0.660 mmol, 66%). R_f = 0.57 (3:2 hexanes/acetone). m.p.: 203°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.86 (s, 1H, NH), 7.69–7.61 (m, 4H, 2’-H, 6’-H, 3’-H, 5’-H), 7.57 (dd, J = 4.3, 1.6 Hz, 1H, 3’’-H), 6.93–6.90 (m, 1H, 4’’-H), 6.27 (dd, J = 4.3, 2.5 Hz, 1H, 5’’-H), 3.93 (s, 3H, CH₃). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 175.6 (C-3), 170.2 (C-1), 139.5 (C-1’), 132.6 (C-5’’), 127.4 (q, J_CF = 31.8 Hz, C-4’), 126.6 (q, J = 3.8 Hz, C-3’, C-5’), 124.1 (C-2’’), 124.0 (q, J_CF = 271.4 Hz, CF₃), 121.3 (C-3’’), 120.7 (C-2’, C-6’), 119.0 (C-2), 110.0 (C-4’’), 72.6 (CN), 38.7 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3273, 2210, 1518, 1379, 1228, 1111, 996, 837, 745. HRMS (ESI): calcd. for C₁₆H₁₁F₃N₃O₂ (M-H)^- 334.08088; found 334.08090. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 41

Download asset Open asset

According to general procedure B, amide 2 (228 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 1-methylpyrrole-2-carbonyl chloride (158 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-31 as colorless crystals (200 mg, 0.747 mmol, 75%). R_f = 0.65 (3:2 hexanes/acetone). m.p.: 171°C [(Walker, 1981): 174–175°C]. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.74 (s, 1H, NH), 7.54 (dd, J = 4.3, 1.6 Hz, 1H, 3’’-H), 7.50 (d, J = 8.0 Hz, 2H, 2’-H, 6’-H), 7.44–7.34 (m, 2H, 3’-H, 5’-H), 7.20 (t, J = 7.4 Hz, 1H, 4’-H), 6.89 (t, J = 1.9 Hz, 1H, 5’’-H), 6.25 (dd, J = 4.3, 2.5 Hz, 1H, 4’’-H), 3.92 (s, 3H, CH₃). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 175.6 (C-3), 170.0 (C-1), 136.2 (C-1’), 132.0 (C-5’’), 129.3 (C-3’, C-5’), 125.7 (C-4’), 124.4 (C-2’’), 121.3 (C-2’, C-6’), 120.7 (C-3’’), 119.1 (C-2), 109.7 (C-4’’), 72.6 (CN), 38.5 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3293, 2210, 1526, 1382, 1231, 751, 736, 687. HRMS (ESI): calcd. for C₁₅H₁₂N₃O₂ (M-H)^- 266.09350; found 266.09370. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 42

Download asset Open asset

According to general procedure B, amide 2 (160 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-1 as yellow solid (227 mg, 0.681 mmol, 68%). R_f = 0.67 (3:2 hexanes/acetone). m.p.: 200°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 11.95 (s, 1H, NH), 7.61 (t, J = 1.9 Hz, 1H, 4’’-H), 7.56 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.53 (dd, J = 8.5, 1.0 Hz, 2H, 2’-H, 6’-H), 7.27–7.22 (m, 2H, 3’-H, 5’-H), 6.96–6.90 (m, 1H, 4’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 182.2 (C-3), 166.1 (C-1), 145.3 (C-1’’), 140.1 (C-1’), 133.4 (C-3’’, C-5’’), 128.7 (C-3’, C-5’), 128.3 (C-4’’), 126.1 (C-2’’, C-6’’), 123.6 (C-2), 121.7 (C-4’), 118.8 (C-2’, C-6’), 77.4 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3294, 2212, 1579, 1445, 810, 748, 683. HRMS (ESI): calcd. for C₁₆H₉³⁵Cl₂N₂O₂ (M-H)^- 331.00466; found 331.00465. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 43

Download asset Open asset

According to general procedure B, amide 1 (174 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-4 as yellow crystals (185 mg, 0.534 mmol, 53%). R_f = 0.28 (3:2 hexanes/acetone). m.p.: 214°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 11.82 (s, 1H, NH), 7.63 (t, J = 1.9 Hz, 1H, 4’’-H), 7.56 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.46–7.39 (m, 2H, 2’-H, 6’-H), 7.09–7.02 (m, 2H, 3’-H, 5’-H), 2.24 (s, 3H, CH₃). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.0 (C-3), 166.0 (C-1), 145.1 (C-1’’), 137.4 (C-1’), 133.4 (C-3’’, C-5’’), 130.6 (C-4’), 129.1 (C-3’, C-5’), 128.3 (C-4’’), 126.1 (C-2’’, C-6’’), 123.5 (C-2), 119.0 (C-2’, C-6’), 77.5 (CN), 20.4 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3299, 2212, 1543, 1518.866, 806, 654. HRMS (ESI): calcd. for C₁₇H₁₁³⁵Cl₂N₂O₂ (M-H)^- 345.02031; found 345.02052. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 44

Download asset Open asset

According to general procedure B, amide 1 (174 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-bis(trifluoromethyl)benzoyl chloride (199 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-108 as light yellow crystals (208 mg, 0.502 mmol, 50%). R_f = 0.28 (3:2 hexanes/acetone). m.p.: 183°C. ¹H NMR (500 MHz, CDCl₃) δ/ppm = 8.45 (s, 2H, 2’’-H, 6’’-H), 8.10 (s, 1H, 4’’-H), 7.86 (s, 1H, NH), 7.43–7.37 (m, 2H, 2’-H, 6’-H), 7.25–7.20 (m, 2H, 3’-H, 5’-H), 2.37 (s, 3H, CH₃). ¹³C NMR (126 MHz, CDCl₃) δ/ppm = 180.4 (C-3), 167.9 (C-1), 136.7 (C-4’), 134.7 (C-1’’), 132.7 (C-1’), 132.6 (q, J_CF = 34.2 Hz, C-3’’, C-5’’), 130.1 (C-3’, C-5’), 128.6 (q, J_CF = 3.1 Hz, C-2’’, C-6’’), 126.3 (q, J_CF = 3.7 Hz, C-4’’), 122.8 (q, J_CF = 272.9 Hz, CF₃), 121.8 (C-2’, C-6’), 116.5 (C-2), 79.7 (CN), 21.2 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3276, 2213, 1538, 1278, 1129, 811, 681. HRMS (ESI): calcd. for C₁₉H₁₁F₆N₂O₂ (M-H)^- 413.07302; found 413.07301. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 45

Download asset Open asset

According to general procedure B, amide 4 (195 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-2 as yellow solid (256 mg, 0.695 mmol, 70%). R_f = 0.71 (3:2 hexanes/acetone). m.p.: 230°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.12 (s, 2H, NH), 7.62 (t, J = 1.9 Hz, 1H, 4’’-H), 7.60–7.57 (m, 2H, 2’-H, 6’-H), 7.55 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.30–7.26 (m, 2H, 3’-H, 5’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 182.5 (C-3), 166.1 (C-1), 145.4 (C-1’’), 139.1 (C-1’), 133.4 (C-3’’, C-5’’), 128.6 (C-3’, C-5’), 128.3 (C-4’’), 126.0 (C-2’’, C-6’’), 125.0 (C-4’), 123.6 (C-2), 120.2 (C-2’, C-6’), 77.2 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3305, 2212, 1545, 1495, 1506, 1316, 1098, 809. HRMS (ESI): calcd. for C₁₆H₈³⁵Cl₃N₂O₂ (M-H)^- 364.96568; found 364.96593. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 46

Download asset Open asset

According to general procedure B, amide 5 (239 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-3 as yellow crystals (289 mg, 0.702 mmol, 70%). R_f = 0.73 (3:2 hexanes/acetone). m.p.: 237°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.09 (s, 1H, NH), 7.62 (t, J = 1.9 Hz, 1H, 4’’-H), 7.58–7.51 (m, 4H, 2’-H, 6’-H, 2’’-H, 6’’-H), 7.44–7.38 (m, 2H, 3’-H, 5’-H).¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.4 (C-3), 166.1 (C-1), 145.2 (C-1’’), 139.4 (C-1’), 133.4 (C-3’’, C-5’’), 131.4 (C-3’, C-5’), 128.3 (C-4’’), 126.0 (C-2’’, C-6’’), 122.6 (C-2), 120.7 (C-2’, C-6’), 112.9 (C-4’), 77.4 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3309, 2211, 1540, 1493, 1403, 1316, 1290, 1012, 809. HRMS (ESI): calcd. for C₁₆H₈⁷⁹Br³⁵Cl₂N₂O₂ (M-H)^- 408.91517; found 408.91581. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 47

Download asset Open asset

According to general procedure B, amide 5 (239 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dibromobenzoic acid (308 mg, 1.10 mmol, 1.1 eq.; converted into the corresponding aryl chloride) were used to give SGA-75 as colorless crystals (222 mg, 0.443 mmol, 44%). R_f = 0.20 (3:2 hexanes/acetone). m.p.: 233°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.05 (s, 1H, NH), 7.86 (t, J = 1.8 Hz, 1H, 4’-H), 7.73 (d, J = 1.8 Hz, 2H, 2’’-H, 6’’-H), 7.57–7.50 (m, 2H, 2’-H, 6’-H), 7.46–7.37 (m, 2H, 3’-H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.2 (C-3), 166.1 (C-1), 145.5 (C-1’’), 139.4 (C-1’), 133.7 (C-4’’), 131.5 (C-3’, C-5’), 129.2 (C-2’’, C-6’’), 122.7 (C-2), 121.8 (C-3’’, C-5’’), 120.8 (C-2’, C-6’), 113.0 (C-4’), 77.4 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3314, 2214, 1596, 1543, 865, 817, 748, 658. HRMS (ESI): calcd. for C₁₆H₈⁷⁹Br₃N₂O₂ (M-H)^- 496.81414; found 496.81449. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 48

Download asset Open asset

According to general procedure B, amide 5 (239 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 2,4,6-trichlorobenzoyl chloride (172 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-72 as colorless solid (227 mg, 0.507 mmol, 51%). R_f = 0.14 (3:2 hexanes/acetone). m.p.: 191°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 11.69 (s, 1H, NH), 7.65 (s, 2H, 3’’-H, 5’’-H), 7.58–7.52 (m, 2H, 2’-H, 6’-H), 7.44–7.38 (m, 2H, 3’-H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 180.3 (C-3), 165.4 (C-1), 139.6 (C-1’ or C-1’’), 139.4 (C-1’ or C-1’’), 133.0 (C-4’’), 132.0 (C-2’’, C-6’’), 131.5 (C-3’, C-5’), 127.8 (C-3’’, C-5’’), 122.1 (C-2), 120.5 (C-2’, C-6’), 112.9 (C-4’), 79.5 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2238, 1588, 1539, 1488, 1307, 856, 818. HRMS (ESI): calcd. for C₁₆H₇⁷⁹Br³⁵Cl₃N₂O₂ (M-H)^- 442.87620; found 442.87747. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 49

Download asset Open asset

According to general procedure B, amide 6 (178 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-8 as white crystals (220 mg, 0.626 mmol, 63%). R_f = 0.69 (3:2 hexanes/acetone). m.p.: 225°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 11.92 (s, 1H, NH), 7.63 (t, J = 1.9 Hz, 1H, 4’’-H), 7.60–7.53 (m, 4H, 2’-H, 6’-H, 2’’-H, 6’’-H), 7.12–7.03 (m, 2H, 3’-H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.2 (C-3), 166.1 (C-1), 157.3 (d, J_CF = 236.9 Hz, C-4’), 144.9 (C-1’’), 136.3 (d, J_CF = 2.4 Hz, C-1’), 133.4 (C-3’’, C-5’’), 128.4 (C-4’’), 126.1 (C-2’’, C-6’’), 123.3 (C-2), 120.5 (d, J_CF = 7.6 Hz, C-2’, C-6’), 115.2 (d, J_CF = 22.0 Hz, C-3’, C-5’), 77.4 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3296, 2212, 1739, 1549, 1506, 1210, 823, 809, 645. HRMS (ESI): calcd. for C₁₆H₈³⁵Cl₂FN₂O₂ (M-H)^- 348.99523; found 348.99526. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 50

Download asset Open asset

According to general procedure B, amide 7 (286 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-9 as yellow crystals (279 mg, 0.608 mmol, 61%). R_f = 0.71 (3:2 hexanes/acetone). m.p.: 238°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.04 (s, 1H, NH), 7.63 (t, J = 1.9 Hz, 1H, 4’’-H), 7.59–7.53 (m, 4H, 3’-H, 5’-H, 2’’-H, 6’’-H), 7.44–7.38 (m, 2H, 2’-H, 6’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.4 (C-3), 166.2 (C-1), 145.1 (C-1’’), 139.8 (C-1’), 137.3 (C-3’, C-5’ or C-2’’, C-6’’), 133.4 (C-3’’, C-5’’), 128.4 (C-4’’), 126.1 (C-3’, C-5’ or C-2’’, C-6’’), 123.3 (C-2), 121.1 (C-2’, C-6’), 84.5 (C-4’), 77.5 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3303, 2217, 1592, 1523, 1485, 1314, 817, 806, 658. HRMS (ESI): calcd. for C₁₆H₈³⁵Cl₂IN₂O₂ (M-H)^- 456.90130; found 456.90014. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 51

Download asset Open asset

According to general procedure B, amide 8 (205 mg, 1.00 mmol, 1.0 eq.) in dry THF (16 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-13 as yellow solid (208 mg, 0.550 mmol, 55%). R_f = 0.82 (3:2 hexanes/acetone). m.p.: 246°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.64 (s, 1H, NH), 8.19–8.13 (m, 2H, 3’-H, 5’-H), 7.82–7.77 (m, 2H, 2’-H, 6’-H), 7.64 (t, J = 1.9 Hz, 1H, 4’’-H), 7.57 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 181.6 (C-3), 166.9 (C-1), 149.4 (C-1’’), 147.0 (C-1’), 141.3 (C-4’), 133.9 (C-3’’, C-5’’), 129.0 (C-4’’), 126.5 (C-2’’, C-6’’), 125.7 (C-3’, C-5’), 121.8 (C-2), 118.6 (C-2’, C-6’), 77.0 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3314, 2209, 1568, 1546, 1514, 1498, 1340, 1309, 847, 813, 656. HRMS (ESI): calcd. for C₁₆H₈³⁵Cl₂N₃O₄ (M-H)^- 375.98973; found 375.98970. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 52

Download asset Open asset

According to general procedure B, amide 3 (190 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-12 as yellow solid (220 mg, 0.606 mmol, 61%). R_f = 0.76 (3:2 hexanes/acetone). m.p.: 207°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 11.36 (s, 1H, NH), 9.87 (s, 1H, OH), 7.71 (t, J = 1.8 Hz, 1H, 4’-H), 7.65 (d, J = 1.8 Hz, 2H, 2’’-H, 6’’-H), 7.49–7.41 (m, 2H, 2’-H, 6’-H), 6.90–6.85 (m, 2H, 3’-H, 5’-H), 3.72 (s, 3H, OCH₃). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 181.6 (C-3), 166.4 (C-1), 155.2 (C-4’), 142.6 (C-1’’), 133.7 (C-3’’, C-5’’), 131.9 (C-1’), 129.3 (C-4’’), 126.3 (C-2’’, C-6’’), 121.7 (C-2’, C-6’), 121.4 (C-2), 113.9 (C-3’, C-5’), 78.1 (CN), 55.2 (OCH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3296, 2211, 1601, 1467, 1441, 1297, 1251, 1032, 764. HRMS (ESI): calcd. for C₁₇H₁₁³⁵Cl₂N₂O₃ (M-H)^- 361.01522; found 361.01516. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 53

Download asset Open asset

According to general procedure B, amide 9 (185 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-38 as yellow solid (137 mg, 0.382 mmol, 38%). R_f = 0.12 (3:2 hexanes/acetone). m.p.: 236°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.42 (s, 1H, NH), 7.75–7.72 (m, 2H, 3’-H, 5’-H), 7.71–7.67 (m, 2H, 2’-H, 6’-H), 7.64 (t, J = 1.9 Hz, 1H, 4’’-H), 7.57 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 183.0 (C-3), 166.4 (C-1), 145.1 (C-1’’), 144.3 (C-1’), 133.5 (C-3’’, C-5’’), 133.3 (C-3’, C-5’), 128.5 (C-4’’), 126.0 (C-2’’, C-6’’), 123.2 (C-4’), 119.4 (C-2), 118.8 (C-2’, C-6’), 103.1 (4’-CN), 77.4 (2-CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3321, 2360, 2340, 1533, 839, 655. HRMS (ESI): calcd. for C₁₇H₈³⁵Cl₂N₃O₂ (M-H)^- 355.99991; found 356.00057. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 54

Download asset Open asset

According to general procedure B, amide 10 (202 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-76 as off white solid (296 mg, 0.789 mmol, 79%). R_f = 0.08 (3:2 hexanes/acetone). m.p.: 209°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.32 (s, 1H, NH), 7.91–7.86 (m, 2H, 3’-H, 5’-H), 7.71–7.66 (m, 2H, 2’-H, 6’-H), 7.64 (t, J = 1.9 Hz, 1H, 4’’-H), 7.58 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 2.51 (s, 3H, CH₃, collapses with DMSO). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 196.3 (CO), 182.8 (C-3), 166.3 (C-1), 145.1 (C-1’’), 144.5 (C-1’), 133.5 (C-3’’, C-5’’), 130.4 (C-4’), 129.7 (C-3’, C-5’), 128.5 (C-4’’), 126.1 (C-2’’, C-6’’), 123.3 (C-2), 117.9 (C-2’, C-6’), 77.6 (CN), 26.3 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3304, 2207, 1682, 1596, 1544, 1355, 1272, 809. HRMS (ESI): calcd. for C₁₈H₁₁³⁵Cl₂N₂O₃ (M-H)^- 373.01522; found 373.01580. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 55

Download asset Open asset

According to general procedure B, amide 11 (218 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-84 as yellow solid (245 mg, 0.626 mmol, 63%). R_f = 0.15 (3:2 hexanes/acetone + 2% TEA). m.p.: 184°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 11.36 (s, 1H, NH), 9.30 (s, 1H, OH), 7.71 (t, J = 1.7 Hz, 1H, 4’’-H), 7.67–7.62 (m, 2H, 2’’-H, 6’’-H), 7.49–7.40 (m, 2H, 3’-H, 5’-H), 6.90–6.82 (m, 2H, 2’-H, 6’-H), 3.88 (t, J = 6.5 Hz, 2H, CH₂CH₂CH₃), 1.71 (sext, J = 7.2 Hz, 2H, CH₂CH₂CH₃), 0.97 (t, J = 7.4 Hz, 3H, CH₂CH₂CH₃). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 181.6 (C-3), 166.4 (C-1), 154.6 (C-4’), 142.7 (C-1’’), 133.7 (C-3’’, C-5’’), 131.9 (C-1’), 129.3 (C-4’’), 126.3 (C-2’’, C-6’’), 121.6 (C-3’, C-5’), 121.5 (C-2), 114.5 (C-2’, C-6’), 78.0 (CN), 69.1 (CH₂CH₂CH₃), 22.1 (CH₂CH₂CH₃), 10.4 (CH₂CH₂CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3304, 2208, 1601, 1550, 1511, 1249, 1235, 822, 811. HRMS (ESI): calcd. for C₁₉H₁₅³⁵Cl₂N₂O₃ (M-H)^- 389.04652; found 389.04631. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 56

Download asset Open asset

According to general procedure B, amide 12 (244 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-86 as colorless solid (344 mg, 0.825 mmol, 83%). R_f = 0.53 (3:2 hexanes/acetone). m.p.: 195°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.02 (s, 1H, NH), 9.41 (s, 1H, OH), 7.69–7.64 (m, 3H, 2’-H, 6’-H, 4’’-H), 7.59 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.28–7.23 (m, 2H, 3’-H, 5’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 182.3 (C-3), 166.3 (C-1), 144.6 (C-1’’), 142.7 (C-4’), 139.1 (C-1’), 133.5 (C-3’’, C-5’’), 128.6 (C-4’’), 126.1 (C-2’’, C-6’’), 123.0 (C-2), 121.6 (C-3’, C-5’), 120.3 (q, J_CF = 255.2 Hz, OCF₃), 120.2 (C-2’, C-6’), 77.6 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3304, 2218, 1614, 1536, 1506, 1262, 1208, 1164, 661. HRMS (ESI): calcd. for C₁₇H₈³⁵Cl₂F₃N₂O₃ (M-H)^- 414.98696; found 414.98676. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 57

Download asset Open asset

According to general procedure B, amide 13 (218 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used. The resulting solid was washed with hexanes, EtOH and water to give SGA-133 as colorless solid (331 mg, 0.846 mmol, 85%). R_f = 0.15 (3:2 hexanes/acetone). m.p.: 234°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.33 (s, 1H, NH), 11.41 (s, 1H, OH), 7.90–7.83 (m, 2H, 2 hr, 6 hr), 7.71–7.66 (m, 2H, 3 hr, 5 hr), 7.64 (t, J = 1.9 Hz, 1H, 4’’-H), 7.57 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 3.81 (s, 3H, CH₃). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.8 (C-3’), 166.3 (C-1’), 166.0 (CO), 145.1 (C-1’’), 144.6 (C-4), 133.4 (C-3’’, C-5’’), 130.4 (C-2, C-6), 128.5 (C-4’’), 126.1 (C-2’’, C-6’’), 123.3 (C-2’), 122.3 (C-1), 118.1 (C-3, C-5), 77.6 (CN), 51.7 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3304, 3093, 2215, 1727, 1591, 1534, 1415, 1283, 1262, 1112, 810, 766. HRMS (ESI): calcd. for C₁₈H₁₁³⁵Cl₂N₂O₄ (M-H)^- 389.01014; found 389.01077. Purity (NMR):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 58

Download asset Open asset

Ester SGA-133 (95.0 mg, 0.243 mmol, 1.0 eq.) was dissolved in dioxane/H₂O (3:1; 4.0 mL) and LiOH (61.2 mg, 2.43 mmol, 10 eq.) was added. The mixture was stirred at rt for 3 hr, before 1 M aq. HCl (5.0 mL) was added. The precipitate was filtered off, washed with cold water and dried to give SGA-137 as colorless solid (59.6 mg, 0.158 mmol, 65%). R_f = 0.00 (3:2 hexanes/acetone). m.p.: 244°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.30 (s, 1H, NH), 7.87–7.81 (m, 2H, 2 hr, 6 hr), 7.68–7.64 (m, 2H, 3 hr, 5 hr), 7.63 (t, J = 1.9 Hz, 1H, 4’’-H), 7.57 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 182.7 (C-3’), 167.1 (CO), 166.3 (C-1’), 145.2 (C-1’’), 144.2 (C-4), 133.4 (C-3’’, C-5’’), 130.5 (C-2, C-6), 128.4 (C-4’’), 126.1 (C-2’’, C-6’’), 123.5 (C-1), 123.4 (C-2’), 118.0 (C-3, C-5), 77.5 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3311, 2215, 1696, 1595, 1550, 1415, 1294, 855, 770. HRMS (ESI): calcd. for C₁₇H₉³⁵Cl₂N₂O₄ (M-H)^- 374.99449; found 374.99480. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 59

Download asset Open asset

According to general procedure B, amide 14 (274 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-27 as colorless solid (330 mg, 0.738 mmol, 74%). R_f = 0.25 (3:2 hexanes/acetone). m.p.: 203°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 12.29 (s, 1H, NH), 8.56 (d, J = 9.0 Hz, 1H, 6’-H), 7.68 (d, J = 2.5 Hz, 1H, 3’-H), 7.63 (t, J = 1.9 Hz, 1H, 4’’-H), 7.58 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.36 (dd, J = 9.0, 2.5 Hz, 1H, 5’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 182.7 (C-3), 166.4 (C-1), 145.2 (C-1’’), 137.8 (C-1’), 133.4 (C-3’’, C-5’’), 131.4 (C-6’), 128.4 (C-4’’), 127.8 (C-5’), 126.1 (C-2’’, C-6’’), 125.4 (C-4’), 123.5 (C-2), 122.1 (C-3’), 112.1 (C-2’), 77.3 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3366, 3087, 2208, 1556, 1521, 1469, 1360, 1292, 863, 815. HRMS (ESI): calcd. for C₁₆H₇⁷⁹Br³⁵Cl₃N₂O₂ (M-H)^- 442.87620; found 442.87736. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 60

Download asset Open asset

According to general procedure B, amide 17 (220 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-28 as yellow solid (200 mg, 0.508 mmol, 51%). R_f = 0.17 (3:2 hexanes/acetone). m.p.: 195°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 11.52 (s, 1H, NH), 7.68 (t, J = 1.8 Hz, 1H, 4’’-H), 7.62 (d, J = 1.8 Hz, 2H, 2’’-H, 6’’-H), 7.30 (d, J = 2.2 Hz, 1H, 2’-H), 7.01 (dd, J = 8.7, 2.2 Hz, 1H, 6’-H), 6.86 (d, J = 8.7 Hz, 1H, 5’-H), 3.73 (s, 3H, OCH₃), 3.71 (s, 3H, OCH₃). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 181.7 (C-3), 166.2 (C-1), 148.6 (C-3’), 144.4 (C-4’), 143.6 (C-1’’), 133.6 (C-3’’, C-5’’), 133.0 (C-1’), 128.9 (C-4’’), 126.2 (C-2’’, C-6’’), 122.2 (C-2), 112.3 (C-5’), 111.5 (C-6’), 104.9 (C-2’), 77.9 (CN), 55.8 (OCH₃), 55.4 (OCH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3284, 2217, 1608, 1549, 1516, 1238, 1028, 810. HRMS (ESI): calcd. for C₁₈H₁₃³⁵Cl₂N₂O₄ (M-H)^- 391.02579; found 391.02608. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 61

Download asset Open asset

According to general procedure B, amide 15 (286 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-39 as yellow solid (237 mg, 0.515 mmol, 52%). R_f = 0.20 (3:2 hexanes/acetone). m.p.: 171°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 11.87 (s, 1H, NH), 8.27 (dd, J = 8.3, 1.5 Hz, 1H, 6’-H), 7.80 (dd, J = 7.9, 1.5 Hz, 1H, 3’-H), 7.63 (t, J = 1.9 Hz, 1H, 4’’-H), 7.59 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.29 (ddd, J = 8.4, 7.3, 1.5 Hz, 1H, 5’-H), 6.80–6.67 (m, 1H, 4’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 182.2 (C-3), 166.4 (C-1), 145.1 (C-1’’), 141.5 (C-1’), 139.0 (C-3’), 133.4 (C-3’’, C-5’’), 128.4 (C-4’’), 128.3 (C-5’), 126.1 (C-2’’, C-6’’), 124.0 (C-4’), 123.6 (C-2), 122.1 (C-6’), 89.2 (C-2’), 77.2 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3337, 2213, 1579, 1537, 1294, 742. HRMS (ESI): calcd. for C₁₆H₈³⁵Cl₂IN₂O₂ (M-H)^- 456.90130; found 456.90095. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 62

Download asset Open asset

According to general procedure B, amide 16 (231 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-33 as colorless crystals (290 mg, 0.719 mmol, 72%). R_f = 0.15 (3:2 hexanes/acetone). m.p.: 193°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.34 (s, 1H, NH), 8.43 (td, J = 9.0, 6.0 Hz, 1H, 6’-H), 7.63 (t, J = 1.9 Hz, 1H, 4’’-H), 7.58 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.23 (td, J = 9.2, 2.1 Hz, 1H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.9 (C-3), 166.3 (C-1), 152.1 (d, J_CF = 242.4 Hz, C-4’), 147.7 (d, J_CF = 245.4 Hz, C-2’), 145.0 (C-1’’), 133.4 (C-3’’, C-5’’), 128.5 (C-4’’), 126.3 (dd, J_CF = 10.3, 2.6 Hz, C-1’), 126.1 (C-2’’, C-6’’), 123.2 (C-2), 119.1 (dd, J_CF = 7.8, 3.0 Hz, C-6’), 111.5 (dd, J_CF = 20.7, 3.6 Hz, C-5’), 107.8 (dd, J_CF = 22.2, 2.9 Hz, C-3’), 77.3 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3293, 2206, 1539, 1497, 1370, 1289, 1023, 803. HRMS (ESI): calcd. for C₁₆H₆³⁵Cl₃F₂N₂O₂ (M-H)^- 400.94684; found 400.94724. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 63

Download asset Open asset

According to general procedure B, amide 16 (231 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 2,4,6-trichlorobenzoyl chloride (172 µL, 1.10 mmol, 1.1 eq.) were used to give SGA-73 as colorless solid (217 mg, 0.496 mmol, 50%). R_f = 0.16 (1:1 hexanes/acetone). m.p.: 199°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 11.93 (s, 1H, NH), 8.45 (td, J = 9.1, 5.9 Hz, 1H, 6’-H), 7.66 (s, 2H, 3’’-H, 5’’-H), 7.23 (td, J = 9.2, 2.0 Hz, 1H, 5’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 180.8 (C-3), 165.6 (C-1), 152.1 (d, J_CF = 242.6 Hz, C-4’), 147.5 (d, J_CF = 245.6 Hz, C-2’), 139.4 (C-1’’ or C-4’’), 133.1 (C-1’’ or C-4’’), 132.0 (C-2’’, C-6’’), 127.8 (C-3’’, C-5’’), 126.3 (dd, J_CF = 10.2, 3.2 Hz, C-1’), 121.8 (C-2), 118.8 (dd, J_CF = 7.9, 2.9 Hz, C-6’), 111.5 (dd, J_CF = 20.7, 3.5 Hz, C-5’), 107.9 (dd, J_CF = 22.0, 19.2 Hz, C-3’), 79.4 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3279, 2222, 1626, 1590, 1519, 1484, 1445, 1359, 1275, 1017, 816, 631. HRMS (ESI): calcd. for C₁₆H₅³⁵Cl₄F₂N₂O₂ (M-H)^- 434.90787; found 434.90791. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 64

Download asset Open asset

According to general procedure B, amide 16 (231 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dibromobenzoic acid (308 mg, 1.10 mmol, 1.1 eq.; converted into the corresponding aryl chloride) were used to give SGA-90 as light yellow solid (374 mg, 0.759 mmol, 76%). R_f = 0.16 (1:1 hexanes/acetone). m.p.: 192°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.33 (s, 1H, NH), 8.43 (td, J = 8.9, 6.0 Hz, 1H, 6’-H), 7.86 (t, J = 1.7 Hz, 1H, 4’’-H), 7.74 (d, J = 1.7 Hz, 2H, 2’’-H, 6’’-H), 7.23 (td, J = 9.3, 2.0 Hz, 1H, 5’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 182.7 (C-3), 166.3 (C-1), 152.1 (d, J_CF = 242.4 Hz, C-2’), 147.7 (d, J_CF = 242.4 Hz, C-4’), 145.4 (C-1’’), 133.7 (C-4’’), 129.2 (C-2’’, C-6’’), 126.3 (dd, J_CF = 10.3, 3.2 Hz, C-1’), 123.2 (C-2), 121.8 (C-3’’, C-5’’), 119.1 (dd, J_CF = 7.5, 2.9 Hz, C-6’), 111.5 (dd, J_CF = 20.7, 3.6 Hz, C-5’), 108.3–107.7 (m, C-3’), 77.3 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3297, 2205, 1586, 1531, 1496, 1022, 803, 750. HRMS (ESI): calcd. for C₁₆H₆⁷⁹Br₂ClF₂N₂O₂ (M-H)^- 488.84581; found 488.84607. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 65

Download asset Open asset

According to general procedure B, amide 18 (229 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-78 as colorless crystals (344 mg, 0.856 mmol, 86%). R_f = 0.17 (3:2 hexanes/acetone). m.p.: 211°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.49 (s, 1H, NH), 8.58 (dd, J = 8.3, 1.5 Hz, 1H, 6’-H), 7.63 (t, J = 1.9 Hz, 1H, 4’’-H), 7.59 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.27 (t, J = 8.2 Hz, 1H, 5’-H), 7.20 (dd, J = 8.0, 1.5 Hz, 1H, 4’-H). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 182.8 (C-3), 166.4 (C-1), 145.1 (C-1’’), 139.3 (C-1’), 133.4 (C-3’’, C-5’’), 131.4 (C-3’), 128.5 (C-4’’), 128.0 (C-5’), 126.1 (C-2’’, C-6’’), 123.4 (C-2), 122.6 (C-4’), 119.3 (C-2’), 119.1 (C-6’), 77.5 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3355, 2203, 1649, 1584, 1539, 1453, 1415, 872, 812, 777. HRMS (ESI): calcd. for C₁₆H₇³⁵Cl₄N₂O₂ (M-H)^- 398.92671; found 398.92789. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 66

Download asset Open asset

According to general procedure B, amide 19 (318 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-77 as colorless crystals (66.0 mg, 0.134 mmol, 13%). R_f = 0.78 (3:2 hexanes/acetone). m.p.: 226°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 10.64 (s, 1H, NH), 8.09–7.90 (m, 3H, 2’’-H, 6’’-H, 4’’-H), 7.79 (d, J = 8.0 Hz, 2H, 3’-H, 5’-H), 7.26 (t, J = 8.0 Hz, 1H, 4’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 162.4 (C-1, C-3), 136.6 (C-1’’), 135.2 (C-1’), 134.6 (C-3’’, C-5’’), 132.3 (C-3’, C-5’), 131.5 (C-4’’), 130.7 (C-4’), 126.4 (C-2’’, C-6’’), 124.4 (C-2’, C-6’), 76.4 (CN), C-2 is missing. IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3206, 2215, 1650.1567, 1516, 1283, 779, 750, 723. HRMS (ESI): calcd. for C₁₆H₇⁷⁹Br₂³⁵Cl₂N₂O₂ (M-H)^- 486.82568; found 486.82870. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 67

Download asset Open asset

According to general procedure B, amide 20 (296 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-85 as colorless solid (320 mg, 0.682 mmol, 68%). R_f = 0.15 (3:2 hexanes/acetone). m.p.: 210°C. ¹H NMR (400 MHz, (CD₃)₂SO) δ/ppm = 12.58 (s, 1H, NH), 8.93 (s, 1H, OH), 8.25 (s, 2H, 2’-H, 6’-H), 7.65 (t, J = 1.9 Hz, 1H, 4’’-H), 7.62–7.56 (m, 3H, 4’-H, 2’’-H, 6’’-H). ¹³C NMR (101 MHz, (CD₃)₂SO) δ/ppm = 183.5 (C-3), 167.3 (C-1), 145.4 (C-1’’), 142.3 (C-1’), 134.0 (C-3’’, C-5’’), 131.2 (q, J_CF = 32.6 Hz, C-3’, C-5’), 129.1 (C-4’’), 126.5 (C-2’’, C-6’’), 123.7 (q, J_CF = 270.8 Hz, CF₃), 123.4 (C-2), 119.1–118.8 (m, C-2’, C-6’), 114.8–114.5 (m, C-4’), 77.6 (CN). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2230, 1637, 1571, 1547, 1375, 1275, 1175, 1128, 810. HRMS (ESI): calcd. for C₁₈H₇³⁵Cl₂F₆N₂O₂ (M-H)^- 466.97943; found 466.97933. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 68

Download asset Open asset

According to general procedure B, amide 21 (242 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-115 as colorless solid (198 mg, 0.476 mmol, 48%). R_f = 0.67 (3:2 hexanes/acetone). m.p.: 147°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.80–7.73 (m, 2H, 3’-H, 5’-H), 7.64 (d, J = 1.9 Hz, 2H, 2’’-H, 6’’-H), 7.49 (t, J = 1.9 Hz, 1H, 4’’-H), 7.47–7.41 (m, 2H, 2’-H, 6’-H), 3.48 (s, 3H, CH₃). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 184.2 (C-3), 170.4 (C-1), 145.2 (C-1’), 135.8 (C-1’’), 135.5 (C-3’’, C-5’’), 132.5 (C-4’’), 131.4 (q, J_CF = 32.9 Hz, C-4’), 127.8 (C-2’, C-6’), 127.5 (q, J = 3.6 Hz, C-3’, C-5’), 127.2 (C-2’’, C-6’’), 123.7 (q, J_CF = 272.6 Hz, CF₃), 115.3 (C-2), 78.6 (CN), 39.9 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3074, 2214, 1578, 1540, 1396, 1331, 1165, 1118, 807. HRMS (ESI): calcd. for C₁₈H₁₀³⁵Cl₂F₃N₂O₂ (M-H)^- 413.00769; found 413.00806. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 69

Download asset Open asset

According to general procedure B, amide 22 (242 mg, 1.00 mmol, 1.0 eq.) in dry THF (10 mL), NaH (92.0 mg, 2.30 mmol, 2.3 eq.) and 3,5-dichlorobenzoyl chloride (230 mg, 1.10 mmol, 1.1 eq.) were used to give SGA-138 as colorless solid (228 mg, 0.549 mmol, 55%). R_f = 0.70 (3:2 hexanes/acetone). m.p.: 173°C. ¹H NMR (500 MHz, (CD₃)₂SO) δ/ppm = 9.57 (s, 1H, NH), 7.84 (t, J = 1.8 Hz, 1H, 4’’-H), 7.77 (d, J = 1.8 Hz, 2H, 2’’-H, 6’’-H), 7.74–7.69 (m, 2H, 3’-H, 5’-H), 7.57–7.50 (m, 2H, 2’-H, 6’-H), 4.52 (s, 2H, CH₂). ¹³C NMR (126 MHz, (CD₃)₂SO) δ/ppm = 181.1 (C-3), 169.2 (C-1), 143.5 (C-1’), 138.5 (C-1’’), 134.2 (C-3’’, C-5’’), 130.8 (C-4’’), 128.1 (C-2’, C-6’), 127.7 (q, J_CF = 31.7 Hz, C-4’), 126.6 (C-2’’, C-6’’), 125.3 (q, J_CF = 3.8 Hz, C-3’, C-5’), 124.3 (q, J_CF = 271.9 Hz, CF₃), 118.1 (C-2), 78.0 (CN), 42.4 (CH₂). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3326, 2206, 1538, 1324, 1108, 1067, 805. HRMS (ESI): calcd. for C₁₈H₁₀³⁵Cl₂F₃N₂O₂ (M-H)^- 413.00769; found 413.00780. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 70

Download asset Open asset

4-Bromo-2-iodo-1-(trifluoromethoxy)benzene (610 mg, 1.66 mmol, 1.0 eq.) was dissolved in dry THF (8.0 mL) and cooled to −78°C, then n-BuLi (0.670 mL, 1.66 mmol, 1.0 eq.) was added dropwise. The mixture was stirred for 20 min at −78°C and a solution of 2-chloro-N-methoxy-N-methylacetamide (700 mg, 4.99 mmol, 3.0 eq.) in dry THF (8.0 mL) was added slowly. The mixture was stirred for 1 hr at −78°C and then poured on sat. aq. NH₄Cl solution. The mixture was extracted with pentane, the organic layer was washed with sat. aq. NaCl solution, dried using hydrophobic phase separation filter papers and filtered through a short silica column (eluent: pentane). The product was carefully concentrated under ambient pressure to yield a colorless oil (23, 221 mg, 0.696 mmol, 42%). R_f = 0.65 (9:1 hexanes/EtOAc). ¹H NMR (500 MHz, CDCl₃) δ/ppm = 7.93 (d, J = 2.5 Hz, 1H, 6’-H), 7.71 (dd, J = 8.8, 2.5 Hz, 1H, 4’-H), 7.25–7.22 (m, 1H, 3’-H), 4.61 (s, 2H, 2 hr). ¹³C NMR (126 MHz, CDCl₃) δ/ppm = 190.5 (C-1), 146.2 (C-2’), 137.1 (C-4’), 134.1 (C-6’), 130.8 (C-5’), 122.2 (C-3’), 120.8 (C-1’), 120.3 (q, J_CF = 261 Hz, OCF₃), 49.0 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=1703, 1592, 1480, 1398, 1308, 1252, 1174, 1129, 1088, 822, 664. HRMS (EI): calcd. for C₉H₅⁷⁹Br³⁵ClF₃O₂ (M)˙⁺ 315.9108; found 315.9106. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 71

Download asset Open asset

2'-(Trifluoromethoxy)acetophenone (779 µL, 4.90 mmol, 1.0 eq.) was dissolved in CH₂Cl₂ (10 mL), then p-toluenesulfonic acid (86.1 mg, 0.490 mmol, 0.10 eq.) and N-bromosuccinimide (872 mg, 4.90 mmol, 1.0 eq.) were added. The mixture was stirred for 24 hr at rt, then sat. aq. NaCl (10 mL) was added. The aqueous phase was extracted with CH₂Cl₂ (3 × 10 mL), dried using a hydrophobic filter paper and concentrated in vacuo. Purification by FCC (pentane/EtOAc 9:1) yielded bromoketone 24 (672 mg, 2.87 mmol, 49%) as light brown liquid. Analytical data are in accordance with literature (Saruta et al., 2015). R_f = 0.58 (9:1 hexanes/EtOAc). ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.81 (dd, J = 7.8, 1.8 Hz, 1H, 6’-H), 7.60 (ddd, J = 8.3, 7.6, 1.8 Hz, 1H, 4’-H), 7.41 (td, J = 7.6, 1.0 Hz, 1H, 5’-H), 7.37–7.32 (m, 1H, 3’-H), 4.47 (s, 2H, 2 hr). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 191.5 (C-1), 147.1 (q, J = 1.7 Hz, C-2’), 134.3 (C-4’), 131.6 (C-6’), 129.3 (C-1’), 127.3 (C-5’), 120.6 (C-3’), 120.5 (q, J = 260.1 Hz, OCF₃), 35.1 (C-2). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=1698, 1603, 1450, 1295, 1248, 1200, 1160. HRMS (EI): calcd. for C₉H₆⁷⁹BrF₃O₂ (M)˙⁺ 281.9498; found 281.9494. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 72

Download asset Open asset

Following general procedure C, ethyl acetoacetate (88.0 µL, 0.693 mmol, 1.1 eq.) in dry THF (3.0 mL), NaH (37.8 mg, 0.945 mmol, 1.5 eq.) and a solution of ketone 23 (200 mg, 0.630 mmol, 1.0 eq.) and KI (209 mg, 1.26 mmol, 2.0 eq.) in dry THF (3.0 mL) were used. Then the residue was dissolved in acetic acid (6.0 mL) and cyclohexanemethanamine (0.160 mL, 1.26 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 99:1) yielded SGA-140 as colorless oil (140 mg, 0.287 mmol, 46%). R_f = 0.30 (9:1 hexanes/EtOAc). ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.54–7.50 (m, 2H, 4’-H, 6’-H), 7.20 (ddt, J = 7.6, 3.0, 1.5 Hz, 1H, 3’-H), 6.55 (s, 1H, 4 hr), 4.27 (q, J = 7.1 Hz, 2H, CH₂CH₃), 3.59 (d, J = 7.1 Hz, 2H, CH₂-cy), 2.59 (s, 3H, CH₃), 1.60–1.54 (m, 3H, cy), 1.38–1.32 (m, 6H, CH₂CH₃, cy), 1.07–0.99 (m, 3H, cy), 0.68–0.59 (m, 2H, cy). ¹³C NMR (121 MHz, CDCl₃) δ/ppm = 165.6 (COOEt), 146.3 (C-2’), 137.6 (C-3), 135.7 (C-6’), 132.4 (C-4’), 129.0 (C-5’), 126.5 (C-5), 122.1 (C-3’), 120.3 (q, J_CF = 260.2 Hz, OCF₃), 119.9 (C-1’), 112.6 (C-2), 112.2 (C-4), 59.6 (CH₂CH₃), 50.8 (CH₂-cy), 39.0 (cy), 30.6 (cy), 26.2 (cy), 25.7 (cy), 14.7 (CH₂CH₃), 12.1 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2976, 2925, 2854, 1699, 1254, 1240, 1206, 1190, 1169, 1080, 1064, 774. HRMS (ESI): calcd. for C₂₂H₂₆⁷⁹BrF₃NO₃ (M+H)⁺ 488.10427; found 488.10459. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 73

Download asset Open asset

According to general procedure D, LiOH (51.6 mg, 2.05 mmol, 10 eq.) and a solution of SGA-140 (100 mg, 0.205 mmol, 1.0 eq.) in dioxane/H₂O (3.0 mL) were used. After 2 hr the reaction was completed and recrystallization from EtOH gave TPC2-A1-P as a colorless solid (51.2 mg, 0.111 mmol, 54%). R_f = 0.14 (9:1 hexanes/EtOAc). m.p.: 202°C. ¹H NMR (500 MHz, CDCl₃) δ/ppm = 11.34 (s, 1H, COOH), 7.56–7.51 (m, 2H, 3’-H, 4’-H), 7.23–7.19 (m, 1H, 6’-H), 6.61 (s, 1H, 4 hr), 3.60 (d, J = 7.1 Hz, 2H, CH₂-cy), 2.60 (s, 3H, CH₃), 1.62–1.56 (m, 3H, cy), 1.40–1.33 (m, 3H, cy), 1.09–1.01 (m, 3H, cy), 0.68–0.61 (m, 2H, cy). ¹³C NMR (126 MHz, CDCl₃) δ/ppm = 170.0 (COOH), 146.4 (C-2’), 138.8 (C-2), 135.7 (C-6’), 132.6 (C-4’), 128.8 (C-5’), 126.8 (C-5), 122.2 (C-3’), 120.3 (q, J_CF = 259.3 Hz, OCF₃), 119.9 (C-1’), 112.9 (C-4), 111.6 (C-3), 50.9 (CH₂-cy), 39.0 (cy), 30.6 (cy), 26.2 (cy), 25.7 (cy), 12.3 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2961, 2924, 2875, 2853, 2359, 2342, 1667, 1266, 1243, 1212, 1198, 1171, 925, 779, 658. HRMS (ESI): calcd. for C₂₀H₂₀⁷⁹BrF₃NO₃ (M-H)^- 458.05841; found 458.05889. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 74

Download asset Open asset

Following general procedure C, ethyl acetoacetate (42.0 µL, 3.30 mmol, 1.1 eq.) in dry THF (12 mL), NaH (180 mg, 4.50 mmol, 1.5 eq.) and a solution of 2-bromo-1-phenylethan-1-one (405 µL, 3.00 mmol, 1.0 eq.) and KI (996 mg, 6.00 mmol, 2.0 eq.) in dry THF (10 mL) were used. Then the residue was dissolved in acetic acid (10 mL) and cyclohexanemethanamine (781 µL, 6.00 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 9:1) yielded SGA-43 as colorless solid (516 mg, 1.58 mmol, 53%). The compound is literature known, but no analytical data are available (Kang et al., 2010). R_f = 0.49 (9:1 hexanes/EtOAc). m.p.: 91°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.42–7.36 (m, 2H, Ph), 7.35–7.29 (m, 3H, Ph), 6.53 (s, 1H, 4 hr), 4.27 (q, J = 7.1 Hz, 2H, CH₂CH₃), 3.78 (d, J = 7.1 Hz, 2H, CH₂-cy), 2.60 (s, 3H, CH₃), 1.58–1.49 (m, 3H, cy), 1.41–1.31 (m, 6H, cy, CH₂CH₃), 1.06–0.95 (m, 3H, cy), 0.69–0.57 (m, 2H, cy). ¹³C NMR (121 MHz, CDCl₃) δ/ppm = 165.9 (COOEt), 137.0 (C-2), 134.1 (qPh), 133.7 (C-5), 129.6 (Ph), 128.5 (Ph), 127.4 (Ph), 112.0 (C-3), 110.0 (C-4), 59.4 (CH₂CH₃), 50.2 (CH₂-cy), 39.0 (cy), 30.6 (cy), 26.2 (cy), 25.8 (cy), 14.7 (CH₂CH₃), 12.1 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2975, 2926, 2850, 1738, 1698, 1420, 1242, 1224, 1191, 1062, 772, 702. HRMS (ESI): calcd. for C₂₁H₂₈NO₂ (M+H)⁺ 326.21146; found 326.21121. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 75

Download asset Open asset

According to general procedure D, LiOH (38.7 mg, 1.54 mmol, 10 eq.) and a solution of SGA-43 (50.0 mg, 0.154 mmol, 1.0 eq.) in dioxane/H₂O (1.3 mL) were used. After 1 hr the reaction was completed and gave SGA-53 as a colorless solid (40.4 mg, 0.136 mmol, 88%). The compound is literature known, but no analytical data are available (Kang et al., 2010). R_f = 0.18 (6:1 hexanes/EtOAc). m.p.: 196°C. ¹H NMR (500 MHz, CDCl₃) δ/ppm = 7.42–7.38 (m, 2H, Ph), 7.36–7.32 (m, 3H, Ph), 6.59 (s, 1H, 4 hr), 3.80 (d, J = 7.2 Hz, 2H, CH₂), 2.62 (s, 3H, CH₃), 1.59–1.52 (m, 3H, cy), 1.42–1.33 (m, 3H, cy), 1.06–0.97 (m, 3H, cy), 0.68–0.59 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 170.8 (COOH), 138.3 (C-2), 134.5 (C-5), 133.5 (qPh), 129.7 (Ph), 128.5 (Ph), 127.5 (Ph), 111.2 (C-3), 110.7 (C-4), 50.3 (CH₂), 39.0 (cy), 30.6 (cy), 26.2 (cy), 25.8 (cy), 12.3 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3030, 2971, 2921, 2848, 1738, 1660, 1533, 1435, 1364, 1267, 1227, 1205, 778, 768, 712, 703. HRMS (ESI): calcd. for C₁₉H₂₂NO₂ (M-H)^- 296.16572; found 296.16560. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 76

Download asset Open asset

Following general procedure C, ethyl acetoacetate (143 µL, 1.10 mmol, 1.1 eq.) in dry THF (5.0 mL), NaH (60.0 mg, 1.50 mmol, 1.5 eq.) and a solution of 2-bromo-1-(5-bromo-2-methoxyphenyl)ethan-1-one (308 mg, 1.00 mmol, 1.0 eq.) in dry THF (1.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and cyclohexanemethanamine (0.260 mL, 2.00 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 9:1) yielded SGA-54 as colorless solid (411 mg, 0.947 mmol, 95%). R_f = 0.37 (6:1 hexanes/EtOAc). m.p.: 83°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.45 (dd, J = 8.7, 2.5 Hz, 1H, 4’-H), 7.37 (d, J = 2.5 Hz, 1H, 6’-H), 6.81 (d, J = 8.7 Hz, 1H, 3’-H), 6.48 (s, 1H, 4 hr), 4.25 (q, J = 7.1 Hz, 2H, CH₂CH₃), 3.76 (s, 3H, OCH₃), 3.56 (d, J = 7.2 Hz, 2H, CH₂-cy), 2.58 (s, 3H, CH₃), 1.60–1.54 (m, 3H, cy), 1.41–1.29 (m, 6H, cy, CH₂CH₃), 1.08–0.97 (m, 3H, cy), 0.68–0.57 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 165.7 (COOEt), 156.6 (C-2’), 136.9 (C-2), 135.2 (C-6’), 132.3 (C-4’), 128.9 (C-5), 124.8 (C-1’), 112.8 (C-5’), 112.6 (C-3’), 112.1 (C-3), 110.6 (C-4), 59.3 (CH₂CH₃), 55.9 (OCH₃), 50.9 (CH₂-cy), 39.0 (cy), 30.7 (cy), 26.3 (cy), 25.8 (cy), 14.7 (CH₂CH₃), 12.1 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2979, 2928, 2849, 1695, 1676, 1473, 1461, 1434, 1253, 1234, 1187, 1176, 1060, 1048, 1027, 774, 619. HRMS (ESI): calculated for C₂₂H₂₉⁷⁹BrNO₃ (M+H)⁺ 434.13253; found 434.13229. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 77

Download asset Open asset

According to general procedure D, LiOH (88.4 mg, 3.51 mmol, 10 eq.) and a solution of SGA-54 (152 mg, 0.351 mmol, 1.0 eq.) in dioxane/H₂O (1.3 mL) were used. After 1 hr the reaction was completed and gave SGA-55 as a colorless solid (90.0 mg, 0.222 mmol, 63%). R_f = 0.72 (1:1 hexanes/EtOAc). m.p.: 224°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.46 (dd, J = 8.8, 2.5 Hz, 1H, 4’-H), 7.38 (d, J = 2.5 Hz, 1H, 6’-H), 6.82 (d, J = 8.8 Hz, 1H, 3’-H), 6.54 (s, 1H, 4 hr), 3.77 (s, 3H, OCH₃), 3.57 (d, J = 7.2 Hz, 2H, CH₂-cy), 2.59 (s, 3H, CH₃), 1.62–1.52 (m, 3H, cy), 1.43–1.33 (m, 3H, cy), 1.10–0.98 (m, 3H, cy), 0.69–0.58 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 170.4 (COOH), 156.6 (C-2’), 138.2 (C-2), 135.2 (C-6’), 132.4 (C-4’), 129.3 (C-5), 124.6 (C-1’), 112.8 (C-5’), 112.6 (C-3’), 111.4 (C-4), 111.3 (C-3), 55.9 (OCH₃), 51.0 (CH₂-cy), 39.0 (cy), 30.7 (cy), 26.3 (cy), 25.8 (cy), 12.3 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3027, 2969, 2926, 2850, 1739, 1658, 1476, 1462, 1442, 1362, 1274, 1244, 1205, 1018, 808, 782, 619. HRMS (ESI): calculated for C₂₀H₂₃⁷⁹BrNO₃ (M-H)^- 404.08668; found 404.08697. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 78

Download asset Open asset

Following general procedure C, ethyl acetoacetate (208 µL, 1.65 mmol, 1.1 eq.) in dry THF (5.0 mL), NaH (90.0 mg, 2.25 mmol, 1.5 eq.) and a solution of 2-bromo-1-(2,5-dichlorophenyl)ethan-1-one (402 mg, 1.50 mmol, 1.0 eq.) in dry THF (1.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and cyclohexanemethanamine (390 µL, 3.00 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 9:1), followed by recrystallization from EtOH yielded SGA-48 as colorless solid (271 mg, 0.686 mmol, 46%). R_f = 0.48 (9:1 hexanes/EtOAc). m.p.: 98°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.48 (d, J = 2.0 Hz, 1H, 6’-H), 7.29 (dd, J = 8.2, 2.0 Hz, 1H, 4’-H), 7.25 (d, J = 9.1 Hz, 1H, 3’-H, collapses with chloroform), 6.51 (s, 1H, 4 hr), 4.27 (q, J = 7.0 Hz, 2H, CH₂CH₃), 3.55 (d, J = 7.0 Hz, 2H, CH₂-cy), 2.59 (s, 3H, CH₃), 1.61–1.56 (m, 3H, cy), 1.40–1.31 (m, 6H, cy, CH₂CH₃), 1.08–0.99 (m, 3H, cy), 0.68–0.58 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 165.6 (COOEt), 137.0 (C-2), 135.9 (C-1’ or C-5’), 134.8 (C-1’ or C-5’), 134.0 (C-3’), 131.2 (C-2’), 129.6 (C-6’), 129.2 (C-5), 127.2 (C-4’), 112.2 (C-3), 111.1 (C-4), 59.5 (CH₂CH₃), 50.8 (CH₂-cy), 39.1 (cy), 30.6 (cy), 26.2 (cy), 25.8 (cy), 14.7 (CH₂CH₃), 12.1 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2981, 2923, 2845, 1739, 1723, 1695, 1565, 1454, 1262, 1238, 1201, 1159, 1076, 1066, 800, 771. HRMS (ESI): calculated for C₂₁H₂₆³⁵Cl₂NO₂ (M+H)⁺ 394.13351; found 394.13343. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 79

Download asset Open asset

According to general procedure D, LiOH (63.9 mg, 2.54 mmol, 10 eq.) and a solution of SGA-48 (100 mg, 0.254 mmol, 1.0 eq.) in dioxane/H₂O (1.3 mL) were used. After 1 hr the reaction was completed and gave SGA-52 as a colorless solid (75.7 mg, 0.207 mmol, 81%). R_f = 0.18 (6:1 hexanes/EtOAc). m.p.: 180°C. ¹H NMR (500 MHz, CDCl₃) δ/ppm = 7.48 (d, J = 2.0 Hz, 1H, 6’-H), 7.30 (dd, J = 8.2, 2.0 Hz, 1H, 4’-H), 7.26 (d, J = 8.2 Hz, 1H, 3’-H, collapses with chloroform), 6.57 (s, 1H, 4 hr), 3.57 (d, J = 6.4 Hz, 2H, CH₂-cy), 2.60 (s, 3H, CH₃), 1.63–1.57 (m, 3H, cy), 1.42–1.36 (m, 3H, cy), 1.08–1.00 (m, 3H, cy), 0.68–0.59 (m, 2H, cy). ¹³C NMR (126 MHz, CDCl₃) δ/ppm = 170.7 (COOH), 138.3 (C-2), 136.0 (C-1’ or C-5’), 135.0 (C-1’ or C-5’), 134.0 (C-3’), 131.0 (C-2’), 129.7 (C-6’), 129.6 (C-5), 127.2 (C-4’), 111.8 (C-4), 111.4 (C-3), 50.9 (CH₂-cy), 39.0 (cy), 30.7 (cy), 26.2 (cy), 25.8 (cy), 12.3 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3014, 2970, 2926, 2851, 1739, 1659, 1449, 1365, 1270, 1228, 1217, 1204, 814, 776. HRMS (ESI): calculated for C₁₉H₂₀³⁵Cl₂NO₂ (M-H)^- 364.08766; found 364.08783. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 80

Download asset Open asset

Following general procedure C, ethyl acetoacetate (208 µL, 1.65 mmol, 1.1 eq.) in dry THF (5.0 mL), NaH (90.0 mg, 2.25 mmol, 1.5 eq.) and a solution of 2-chloro-1-(4-fluorophenyl)ethan-1-one (259 mg, 1.50 mmol, 1.0 eq.) and KI (249 mg, 1.50 mmol, 1.0 eq.) in dry THF (3.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and cyclohexanemethanamine (0.390 mL, 3.00 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 9:1) yielded SGA-59 as yellow oil (499 mg, 1.45 mmol, 97%). R_f = 0.43 (9:1 hexanes/EtOAc). ¹H NMR (500 MHz, CDCl₃) δ/ppm = 7.28–7.23 (m, 2H, 2’-H, 6’-H), 7.10–7.01 (m, 2H, 3’-H, 5’-H), 6.48 (s, 1H, 4 hr), 4.25 (q, J = 7.1 Hz, 2H, CH₂CH₃), 3.71 (d, J = 7.2 Hz, 2H, CH₂-cy), 2.57 (s, 3H, CH₃), 1.58–1.48 (m, 3H, cy), 1.38–1.28 (m, 6H, cy, CH₂CH₃), 1.06–0.89 (m, 3H, cy), 0.68–0.53 (m, 2H, cy). ¹³C NMR (121 MHz, CDCl₃) δ/ppm = 165.7 (COOH), 162.2 (d, J_CF = 247.0 Hz, C-4’), 136.9 (C-2), 132.8 (C-5), 131.3 (d, J_CF = 8.0 Hz, C-2’, C-6’), 129.7 (d, J_CF = 3.3 Hz, C-1’), 115.4 (d, J_CF = 21.3 Hz, C-3’, C-5’), 111.9 (C-3), 110.0 (C-4), 59.3 (CH₂CH₃), 50.1 (CH₂-cy), 39.0 (cy), 30.5 (cy), 26.1 (cy), 25.7 (cy), 14.6 (CH₂CH₃), 12.0 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2977, 2925, 2853, 1693, 1242, 1227, 1218, 1195, 1152, 1062, 844, 811, 774. HRMS (ESI): calculated for C₂₁H₂₇FNO₂ (M+H)⁺ 344.20203; found 344.20193. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 81

Download asset Open asset

According to general procedure D, LiOH (169 mg, 6.71 mmol, 10 eq.) and a solution of SGA-59 (230 mg, 0.671 mmol, 1.0 eq.) in dioxane/H₂O (3.0 mL) were used. After 2 hr the reaction was completed and gave SGA-66 as a colorless solid (186 mg, 0.590 mmol, 88%). R_f = 0.24 (6:1 hexanes/EtOAc). m.p.: 171°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.35–7.27 (m, 2H, 2’-H, 6’-H), 7.14–7.04 (m, 2H, 3’-H, 5’-H), 6.57 (s, 1H, 4 hr), 3.75 (d, J = 7.1 Hz, 2H, CH₂-cy), 2.61 (s, 3H, CH₃), 1.63–1.51 (m, 3H, cy), 1.41–1.32 (m, 3H, cy), 1.08–0.97 (m, 3H, cy), 0.70–0.57 (m, 2H, cy). ¹³C NMR (121 MHz, CDCl₃) δ/ppm = 171.2 (COOH), 162.37 (d, J_CF = 247.1 Hz, C-4’), 138.3 (C-2), 133.3 (C-5), 131.42 (d, J_CF = 8.1 Hz, C-2’, C-6’), 129.6 (d, J_CF = 3.4 Hz, C-1’), 115.57 (d, J_CF = 21.5 Hz, C-3’, C-5’), 111.2 (C-3), 110.8 (C-4), 50.3 (CH₂-cy), 39.0 (cy), 30.6 (cy), 26.2 (cy), 25.8 (cy), 12.3 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2927, 2854, 1739, 1652, 1568, 1494, 1449, 1265, 1223, 1203, 1158, 840, 776, 582. HRMS (ESI): calculated for C₁₉H₂₁FNO₂ (M-H)^- 314.15618; found 314.15635. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 82

Download asset Open asset

Following general procedure C, ethyl acetoacetate (208 µL, 1.65 mmol, 1.1 eq.) in dry THF (5.0 mL), NaH (90.0 mg, 2.25 mmol, 1.5 eq.) and a solution of 2-bromo-1-(4-methoxyphenyl)ethan-1-one (344 mg, 1.50 mmol, 1.0 eq.) and KI (249 mg, 1.50 mmol, 1.0 eq.) in dry THF (3.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and cyclohexanemethanamine (390 µL, 3.00 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 9:1), followed by recrystallization from EtOH yielded SGA-61 as colorless solid (274 mg, 0.770 mmol, 51%). R_f = 0.37 (9:1 hexanes/EtOAc). m.p.: 88°C. ¹H NMR (500 MHz, CDCl₃) δ/ppm = 7.25–7.21 (m, 2H, 2’-H, 6’-H), 6.95–6.89 (m, 2H, 3’-H, 5’-H), 6.47 (s, 1H, 4 hr), 4.27 (q, J = 7.1 Hz, 2H, CH₂CH₃), 3.84 (s, 3H, OCH₃), 3.73 (d, J = 7.3 Hz, 2H, CH₂-cy), 2.58 (s, 3H, CH₃), 1.60–1.51 (m, 3H, cy), 1.42–1.31 (m, 6H, cy, CH₂CH₃), 1.07–0.96 (m, 3H, cy), 0.70–0.59 (m, 2H, cy). ¹³C NMR (126 MHz, CDCl₃) δ/ppm = 165.9 (COOH), 159.0 (C-4’), 136.6 (C-2), 133.8 (C-5), 130.9 (C-2’, C-6’), 126.1 (C-1’), 113.9 (C-3’, C-5’), 111.7 (C-3), 109.5 (C-4), 59.3 (CH₂CH₃), 55.4 (OCH₃), 50.1 (CH₂-cy), 39.0 (cy), 30.6 (cy), 26.2 (cy), 25.8 (cy), 14.7 (CH₂CH₃), 12.1 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3016, 2970, 2928, 2847, 1739, 1693, 1568, 1532, 1496, 1443, 1424, 1373, 1243, 1226, 1195, 1175, 1064, 1031, 835, 817, 795, 774. HRMS (ESI): calculated for C₂₂H₃₀NO₃ (M+H)⁺ 356.22202; found 356.22192. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 83

Download asset Open asset

According to general procedure D, LiOH (78.7 mg, 3.12 mmol, 10 eq.) and a solution of SGA-61 (111 mg, 0.312 mmol, 1.0 eq.) in dioxane/H₂O (1.3 mL) were used. After 2 hr the reaction was completed and gave SGA-67 as a colorless solid (95.3 mg, 0.291 mmol, 90%). R_f = 0.20 (6:1 hexanes/EtOAc). m.p.: 198°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.27–7.23 (m, 2H, 2’-H, 6’-H), 6.95–6.91 (m, 2H, 3’-H, 5’-H), 6.54 (s, 1H, 4 hr), 3.85 (s, 3H, OCH₃), 3.75 (d, J = 7.2 Hz, 2H, CH₂-cy), 2.60 (s, 3H, CH₃), 1.62–1.53 (m, 3H, cy), 1.43–1.33 (m, 3H, cy), 1.09–0.98 (m, 3H, cy), 0.70–0.59 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 171.3 (COOH), 159.0 (C-4’), 137.8 (C-2), 134.1 (C-5), 131.0 (C-2’, C-6’), 125.9 (C-1’), 113.9 (C-3’, C-5’), 111.0 (C-3), 110.2 (C-4), 55.3 (OCH₃), 50.2 (CH₂-cy), 38.9 (cy), 30.5 (cy), 26.2 (cy), 25.8 (cy), 12.3 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=3027, 3002, 2970, 2925, 2849, 1738, 1652, 1569, 1535, 1494, 1435, 1364, 1266, 1247, 1228, 1203, 840, 778. HRMS (ESI): calculated for C₂₀H₂₄NO₃ (M-H)^- 326.17617; found 326.17633. Purity (HPLC): 93% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 84

Download asset Open asset

Following general procedure C, ethyl acetoacetate (208 µL, 1.65 mmol, 1.1 eq.) in dry THF (5.0 mL), NaH (90.0 mg, 2.25 mmol, 1.5 eq.) and a solution of 2-chloro-1-(2,4-difluorophenyl)ethan-1-one (286 mg, 1.50 mmol, 1.0 eq.) and KI (249 mg, 1.50 mmol, 1.0 eq.) in dry THF (3.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and cyclohexanemethanamine (390 µL, 3.00 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 9:1) yielded SGA-62 as yellow solid (424 mg, 1.17 mmol, 78%). R_f = 0.43 (9:1 hexanes/EtOAc). m.p.: 94°C. ¹H NMR (500 MHz, CDCl₃) δ/ppm = 7.27 (td, J = 8.4, 6.5 Hz, 1H, 6’-H), 6.96–6.85 (m, 2H, 3’-H, 5’-H), 6.53 (s, 1H, 4 hr), 4.26 (q, J = 7.1 Hz, 2H, CH₂CH₃), 3.60 (d, J = 7.1 Hz, 2H, CH₂-cy), 2.58 (s, 3H, CH₃), 1.59–1.53 (m, 3H, cy), 1.38–1.30 (m, 6H, cy, CH₂CH₃), 1.06–0.98 (m, 3H, cy), 0.68–0.58 (m, 2H, cy). ¹³C NMR (121 MHz, CDCl₃) δ/ppm = 165.5 (COOEt), 162.9 (dd, J_CF = 250.1, 11.6 Hz, C-4’), 160.2 (dd, J_CF = 248.9, 12.0 Hz, C-2’), 137.2 (C-2), 133.5 (dd, J_CF = 9.4, 4.1 Hz, C-6’), 126.2 (C-5), 117.6 (dd, J_CF = 15.7, 3.9 Hz, C-1’), 112.3 (C-3), 111.6 (dd, J_CF = 21.1, 3.7 Hz, C-5’), 111.3 (C-4), 104.20 (t, J_CF = 25.8 Hz, C-3’), 59.4 (CH₂CH₃), 50.6 (d, J_CF = 3.0 Hz, CH₂-cy), 39.0 (cy), 30.5 (cy), 26.1 (cy), 25.7 (cy), 14.6 (CH₂CH₃), 12.0 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2971, 2929, 2848, 1739, 1698, 1571, 1426, 1371, 1235, 1199, 1067, 851, 834. HRMS (ESI): calculated for C₂₁H₂₆F₂NO₂ (M+H)⁺ 362.19261; found 362.19247. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 85

Download asset Open asset

According to general procedure D, LiOH (167 mg, 6.61 mmol, 10 eq.) and a solution of SGA-62 (239 mg, 0.661 mmol, 1.0 eq.) in dioxane/H₂O (1.3 mL) were used. After 1 hr the reaction was completed and gave SGA-68 as a colorless solid (170 mg, 0.511 mmol, 77%). R_f = 0.29 (6:1 hexanes/EtOAc). m.p.: 168°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.33–7.25 (m, 1H, 6’-H, collapses with chloroform), 6.98–6.86 (m, 2H, 3’-H, 5’-H), 6.60 (s, 1H, 4 hr), 3.62 (d, J = 7.1 Hz, 2H, CH₂-cy), 2.61 (s, 3H, CH₃), 1.65–1.51 (m, 3H, cy), 1.49–1.32 (m, 3H, cy), 1.14–0.94 (m, 3H, cy), 0.72–0.56 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 171.0 (COOH), 163.0 (dd, J_CF = 250.3, 11.6 Hz, C-4’), 160.3 (dd, J_CF = 249.0, 12.0 Hz, C-2’), 138.5 (C-2), 133.6 (dd, J_CF = 9.5, 4.0 Hz, C-6’), 126.7 (C-5), 117.5 (dd, J_CF = 15.8, 3.8 Hz, C-1’), 112.0 (C-3), 111.7 (dd, J_CF = 21.3, 3.8 Hz, C-5’), 111.6 (C-4), 104.3 (t, J_CF = 25.9 Hz, C-3’), 50.72 (d, J_CF = 3.0 Hz, CH₂-cy), 39.0 (cy), 30.6 (cy), 26.2 (cy), 25.7 (cy), 12.2 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2970, 2926, 2854, 1739, 1666, 1573, 1450, 1433, 1364, 1265, 1239, 1200, 1140, 778. HRMS (ESI): calculated for C₁₉H₂₀F₂NO₂ (M-H)^- 332.14676; found 332.14697. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 86

Download asset Open asset

Following general procedure C, ethyl acetoacetate (123 µL, 0.972 mmol, 1.1 eq.) in dry THF (4.0 mL), NaH (53.0 mg, 1.32 mmol, 1.5 eq.) and a solution of ketone 24 (250 mg, 0.883 mmol, 1.0 eq.) and KI (147 mg, 0.883 mmol, 1.0 eq.) in dry THF (2.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and cyclohexanemethanamine (230 µL, 1.77 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 9:1) yielded ester 25 as colorless solid (345 mg, 0.845 mmol, 95%). R_f = 0.46 (9:1 hexanes/EtOAc). m.p.: 66°C. ¹H NMR (100 MHz, CDCl₃) δ/ppm = 7.44–7.29 (m, 4H, 3’-H, 4’-H, 5’-H, 6’-H), 6.53 (s, 1H, 4 hr), 4.27 (q, J = 7.1 Hz, 2H, CH₂CH₃), 3.59 (d, J = 7.1 Hz, 2H, CH₂-cy), 2.59 (s, 3H, CH₃), 1.59–1.52 (m, 3H, cy), 1.40–1.32 (m, 6H, cy, CH₂CH₃), 1.06–0.94 (m, 3H, cy), 0.67–0.54 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 165.8 (COOEt), 147.4 (C-2’), 137.1 (C-2), 133.4 (C-4’, C-5’ or C-6’), 129.6 (C-4’, C-5’ or C-6’), 127.9 (C-5), 126.9 (C-1’), 126.7 (C-4’, C-5’ or C-6’), 120.5 (q, J_CF = 257.4 Hz, OCF₃), 120.4 (C-3’), 112.2 (C-3), 111.4 (C-4), 59.5 (CH₂CH₃), 50.7 (CH₂-cy), 39.0 (cy), 30.6 (cy), 26.2 (cy), 25.8 (cy), 14.7 (CH₂CH₃), 12.1 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=1934, 1692, 1447, 1422, 1242, 1192, 1155, 1059, 769. HRMS (ESI): calculated for C₂₂H₂₇F₃NO₃ (M+H)⁺ 410.19375; found 410.19336. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 87

Download asset Open asset

According to general procedure D, LiOH (142 mg, 5.62 mmol, 10 eq.) and a solution of ester 25 (230 mg, 0.562 mmol, 1.0 eq.) in dioxane/H₂O (3.0 mL) were used. After 2 hr the reaction was completed and gave SGA-162 as a colorless solid (199 mg, 0.523 mmol, 93%). R_f = 0.11 (9:1 hexanes/EtOAc). m.p.: 170°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 11.13 (s, 1H, COOH), 7.46–7.30 (m, 4H, 3’-H, 4’-H, 5’-H, 6’-H), 6.59 (s, 1H, 4 hr), 3.60 (d, J = 7.1 Hz, 2H, CH₂-cy), 2.61 (s, 3H, CH₃), 1.61–1.52 (m, 3H, cy), 1.41–1.31 (m, 3H, cy), 1.09–0.96 (m, 3H, cy), 0.67–0.55 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 169.9 (COOH), 147.4 (C-2’), 138.3 (C-2), 133.4 (C-4’, C-5’ or C-6’), 129.8 (C-4’, C-5’ or C-6’), 128.3 (C-5), 126.8 (C-4’, C-5’ or C-6’), 126.7 (C-1’), 120.5 (q, J_CF = 260.2 Hz, OCF₃), 120.4 (C-4’), 112.1 (C-4), 111.2 (C-3), 50.8 (CH₂-cy), 38.9 (cy), 30.6 (cy), 26.2 (cy), 25.7 (cy), 12.3 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2927, 1642, 1473, 1444, 1249, 1199, 1156, 776, 759. HRMS (ESI): calculated for C₂₀H₂₁F₃NO₃ (M-H)^- 380.14790; found 380.14805. Purity (HPLC):>96% (λ = 210 nm).

Chemical structure 88

Download asset Open asset

Following general procedure C, ethyl acetoacetate (104 µL, 0.821 mmol, 1.1 eq.) in dry THF (4.0 mL), NaH (44.8 mg, 1.12 mmol, 1.5 eq.) and a solution of ketone 23 (237 mg, 0.746 mmol, 1.0 eq.) and KI (124 mg, 0.746 mmol, 1.0 eq.) in dry THF (2.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and benzylamine (204 µL, 1.87 mmol, 2.5 eq.) was added. FCC (hexanes/EtOAc 97:3) yielded ethyl 5-(5-bromo-2-(trifluoromethoxy)phenyl)−1-isopropyl-2-methyl-1H-pyrrole-3-carboxylate (26) as colorless oil (107 mg, 0.222 mmol). This product was used without further purification or characterization for the next step. R_f = 0.44 (9:1 hexanes/EtOAc). According to general procedure D, LiOH (55.9 mg, 2.22 mmol, 10 eq.) and a solution of ester 26 (107 mg, 0.222 mmol, 1.0 eq.) in dioxane/H₂O (3.0 mL) were used. After 16 hr the reaction was completed and gave SGA-150 as a colorless solid (34.4 mg, 0.0757 mmol, 10% over two steps). R_f = 0.27 (9:1 hexanes/EtOAc). m.p.: 185°C. ¹H NMR (400 MHz, CD₂Cl₂) δ/ppm = 11.12 (s, 1H, COOH), 7.51 (dd, J = 8.8, 2.5 Hz, 1H, 4’-H), 7.39 (d, J = 2.5 Hz, 1H, 6’-H), 7.30–7.18 (m, 4H, 3’-H, Ph), 6.83–6.77 (m, 2H, Ph), 6.70 (s, 1H, 4 hr), 5.00 (s, 2H, CH₂), 2.49 (s, 3H, CH₃). ¹³C NMR (121 MHz, CD₂Cl₂) δ/ppm = 169.9 (COOH), 147.0 (C-2’), 139.6 (C-2), 137.4 (C-1’), 136.3 (C-6’), 133.4 (C-4’), 129.3 (Ph), 128.5 (qPh), 128.0 (Ph), 127.3 (C-5), 126.2 (Ph), 122.8 (C-3’), 120.8 (q, J_CF = 258.7 Hz, OCF₃), 120.3 (C-5’), 113.1 (C-4), 112.3 (C-3), 48.7 (CH₂), 12.2 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2925, 2360, 1670, 1249, 1223, 1198, 1171, 733. HRMS (ESI): calculated for C₂₀H₁₄⁷⁹BrF₃NO₃ (M-H)^- 452.01146; found 452.01168. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 89

Download asset Open asset

Following general procedure C, ethyl acetoacetate (87.6 µL, 0.693 mmol, 1.1 eq.) in dry THF (4.0 mL), NaH (37.8 mg, 0.945 mmol, 1.5 eq.) and a solution of ketone 23 (200 mg, 0.630 mmol, 1.0 eq.) and KI (105 mg, 0.630 mmol, 1.0 eq.) in dry THF (2.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and isopropylamine (108 µL, 1.26 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 99:1) yielded ethyl 5-(5-bromo-2-(trifluoromethoxy)phenyl)−1-isopropyl-2-methyl-1H-pyrrole-3-carboxylate (27) as colorless oil (65.9 mg, 0.152 mmol). This product was used without further purification or characterization for the next step. R_f = 0.55 (9:1 hexanes/EtOAc). According to general procedure D, LiOH (38.3 mg, 1.52 mmol, 10 eq.) and a solution of ester 27 (65.9 mg, 0.152 mmol, 1.0 eq.) in dioxane/H₂O (3.0 mL) were used. After 18 hr the reaction was completed and gave SGA-153 as a colorless solid (32.4 mg, 0.0798 mmol, 12% over two steps). R_f = 0.11 (9:1 hexanes/EtOAc). m.p.: 192°C. ¹H NMR (400 MHz, C₃D₆O) δ/ppm = 7.75 (dd, J = 8.8, 2.6 Hz, 1H, 4’-H), 7.65 (d, J = 2.6 Hz, 1H, 6’-H), 7.44 (dq, J = 8.8, 1.5 Hz, 1H, 3’-H), 6.47 (s, 1H, 4 hr), 4.27 (p, J = 7.0 Hz, 1H, CH), 2.72 (s, 3H, CH₃), 1.45 (d, J = 7.0 Hz, 6H, CH(CH₃)₂). ¹³C NMR (101 MHz, C₃D₆O) δ/ppm = 166.4 (COOH), 147.7 (C-2’), 137.5 (C-2), 137.0 (C-6’), 134.0 (C-4’), 130.5 (C-1’), 126.4 (C-5), 123.7 (q, J = 257.6 Hz, OCF₃), 123.5 (C-3’), 120.6 (C-5’), 113.9 (C-3), 113.0 (C-4), 50.2 (CH), 22.0 (CH(CH₃)₂), 13.0 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2936, 2358, 1672, 1248, 1214, 1200, 1166. HRMS (ESI): calculated for C₁₆H₁₄⁷⁹BrF₃NO₃ (M-H)^- 404.01146; found 404.01164. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 90

Download asset Open asset

Following general procedure C, ethyl acetoacetate (87.6 µL, 0.693 mmol, 1.1 eq.) in dry THF (4.0 mL), NaH (37.8 mg, 0.945 mmol, 1.5 eq.) and a solution of ketone 23 (200 mg, 0.630 mmol, 1.0 eq.) and KI (105 mg, 0.630 mmol, 1.0 eq.) in dry THF (2.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and n-pentylamine (146 µL, 1.26 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 99:1) yielded ethyl 5-(5-bromo-2-(trifluoromethoxy)phenyl)−2-methyl-1-pentyl-1H-pyrrole-3-carboxylate (28) as colorless oil (81.5 mg, 0.176 mmol). The product was used without further purification or characterization for the next step. R_f = 0.51 (9:1 hexanes/EtOAc). According to general procedure D, LiOH (44.4 mg, 1.76 mmol, 10 eq.) and a solution of ester 28 (81.5 mg, 0.176 mmol, 1.0 eq.) in dioxane/H₂O (3.0 mL) were used. After 18 hr the reaction was completed and gave SGA-149 as a colorless solid (40.5 mg, 0.0933 mmol, 15% over two steps). R_f = 0.06 (9:1 hexanes/EtOAc). m.p.: 121°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.57–7.51 (m, 2H, 4’’-H, 6’’-H), 7.24–7.20 (m, 1H, 3’’-H), 6.61 (s, 1H, 4 hr), 3.74–3.68 (m, 2H, 1’-H), 2.61 (s, 3H, CH₃), 1.49–1.43 (m, 2H, 2’-H), 1.19–1.06 (m, 4H, 3’-H, 4’-H), 0.80 (t, J = 7.2 Hz, 3H, 5’-H). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 169.4 (COOH), 146.6 (C-2’’), 138.3 (C-2), 135.9 (C-6’’), 132.8 (C-4’’), 128.7 (C-5’’), 126.1 (C-5), 122.5 (q, J = 279.8 Hz, OCF₃), 122.4 (C-3’’), 120.0 (C-1’’), 112.7 (C-4), 111.4 (C-3), 44.7 (C-1’), 30.2 (C-2’), 28.8 (C-3’), 22.1 (C-4’), 13.9 (C-5’), 11.9 (CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2929, 1663, 1471, 1436, 1247, 1212, 1194, 1160, 781. HRMS (ESI): calculated for C₁₈H₂₀⁷⁹BrF₃NO₃ (M+H)⁺ 434.05732; found 434.05765. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 91

Download asset Open asset

Following general procedure C, ethyl propionylacetate (99.9 µL, 0.693 mmol, 1.1 eq.) in dry THF (4.0 mL), NaH (37.8 mg, 0.945 mmol, 1.5 eq.) and a solution of ketone 23 (200 mg, 0.630 mmol, 1.0 eq.) and KI (105 mg, 0.630 mmol, 1.0 eq.) in dry THF (2.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and cyclohexanemethanamine (164 µL, 1.26 mmol, 2.0 eq.) was added. FCC (hexanes/EtOAc 99:1) yielded ethyl 5-(5-bromo-2-(trifluoromethoxy)phenyl)−1-(cyclohexylmethyl)−2-ethyl-1H-pyrrole-3-carboxylate (29) as colorless oil (98.0 mg, 0.195 mmol). This product was used without further purification or characterization for the next step. R_f = 0.58 (9:1 hexanes/EtOAc). According to general procedure D, LiOH (49.2 mg, 1.95 mmol, 10 eq.) and a solution of ester 29 (98.0 mg, 0.195 mmol, 1.0 eq.) in dioxane/H₂O (3.0 mL) were used. After 18 hr the reaction was completed and gave SGA-152 as yellow solid (30.8 mg, 0.0649 mmol, 9% over two steps). R_f = 0.24 (9:1 hexanes/EtOAc). m.p.: 152°C. ¹H NMR (500 MHz, CDCl₃) δ/ppm = 11.35 (s, 1H, COOH), 7.57–7.50 (m, 2H, 4’-H, 6’-H), 7.20 (dd, J = 8.6, 1.4 Hz, 1H, 3’-H), 6.61 (s, 1H, 4 hr), 3.61 (d, J = 7.2 Hz, 2H, CH₂-cy), 3.04 (q, J = 7.4 Hz, 2H, CH₂CH₃), 1.64–1.54 (m, 3H, cy), 1.39–1.31 (m, 3H, cy), 1.23 (t, J = 7.4 Hz, 3H, CH₂CH₃), 1.08–0.99 (m, 3H, cy), 0.70–0.60 (m, 2H, cy). ¹³C NMR (121 MHz, CDCl₃) δ/ppm = 169.8 (COOH), 146.3 (C-2’), 145.1 (C-2), 135.5 (C-4’ or C-6’), 132.5 (C-4’ or C-6’), 129.1 (C-1’), 126.7 (C-5), 122.3 (C-3’), 120.3 (q, J_CF = 259.2 Hz, OCF₃), 120.0 (C-5’), 113.2 (C-4), 110.8 (C-3), 50.9 (CH₂-cy), 39.6 (cy), 30.7 (cy), 26.2 (cy), 25.8 (cy), 19.2 (CH₂CH₃), 14.5 (CH₂CH₃). IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2927, 2359, 1659, 1469, 1441, 1250, 1212, 1192, 1172. HRMS (ESI): calculated for C₂₁H₂₂⁷⁹BrF₃NO₃ (M-H)^- 472.07406; found 472.07418. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

Chemical structure 92

Download asset Open asset

Following general procedure C, ethyl benzoylacetate (134 µL, 0.693 mmol, 1.1 eq.) in dry THF (4.0 mL), NaH (37.8 mg, 0.945 mmol, 1.5 eq.) and a solution of ketone 23 (200 mg, 0.630 mmol, 1.0 eq.) and KI (105 mg, 0.630 mmol, 1.0 eq.) in dry THF (2.0 mL) were used. Then the residue was dissolved in acetic acid (5.0 mL) and cyclohexanemethanamine (328 µL, 2.52 mmol, 4.0 eq.) was added. FCC (hexanes/EtOAc 99:1) yielded ethyl 5-(5-bromo-2-(trifluoromethoxy)phenyl)−1-(cyclohexylmethyl)−2-phenyl-1H-pyrrole-3-carboxylate (30) as yellow solid (151 mg, 0.274 mmol). This product was used without further purification or characterization for the next step. R_f = 0.50 (9:1 hexanes/EtOAc). According to general procedure D, LiOH (69.2 mg, 2.74 mmol, 10 eq.) and a solution of ester 30 (151 mg, 0.274 mmol, 1.0 eq.) in dioxane/H₂O (3.0 mL) were used. After 18 hr the reaction was completed and gave SGA-154 as yellow solid (91.5 mg, 0.175 mmol, 28% over two steps). R_f = 0.12 (9:1 hexanes/EtOAc). m.p.: 170°C. ¹H NMR (400 MHz, CDCl₃) δ/ppm = 7.61 (d, J = 2.5 Hz, 1H, 6’-H), 7.55 (dd, J = 8.7, 2.5 Hz, 1H, 4’-H), 7.47–7.41 (m, 3H, Ph), 7.39–7.35 (m, 2H, Ph), 7.23 (dq, J = 8.7, 1.3 Hz, 1H, 3’-H), 6.74 (s, 1H, 4 hr), 3.56 (d, J = 7.4 Hz, 2H, CH₂-cy), 1.48–1.42 (m, 3H, cy), 1.11–1.05 (m, 2H, cy), 1.03–0.95 (m, 1H, cy), 0.90–0.82 (m, 3H, cy), 0.43–0.32 (m, 2H, cy). ¹³C NMR (101 MHz, CDCl₃) δ/ppm = 167.7 (COOH), 146.1 (C-2’), 141.7 (C-2), 135.2 (C-6’), 132.7 (C-4’), 131.7 (C-5, C-1’, C-5’ or qPh), 131.0 (Ph), 128.8 (C-5, C-1’, C-5’ or qPh), 128.7 (Ph), 128.3 (Ph), 122.4 (C-3’), 120.4 (q, J_CF = 266.3 Hz, OCF₃), 120.2 (C-5, C-1’, C-5’ or qPh), 113.8 (C-4), 112.7 (C-3), 52.0 (CH₂-cy), 38.7 (cy), 30.3 (cy), 26.1 (cy), 25.6 (cy). One quaternary carbon is missing. IR (ATR) ${\displaystyle \tilde{V}}$_max/cm⁻¹=2915, 2335, 1667, 1487, 1248, 1208, 1169, 1127, 796, 697. HRMS (ESI): calculated for C₂₅H₂₂⁷⁹BrF₃NO₃ (M-H)^- 520.07406; found 520.07418. Purity (HPLC):>96% (λ = 210 nm),>96% (λ = 254 nm).

All error bars are depicted as SEM. Statistical significance was determined via Student’s t-test, one-way ANOVA, or two-way ANOVA followed by either Tukey’s or Bonferroni’s post hoc test. Significance is denoted on figures with asterisks as outlined in the legends. All data presented are representative of three or more independent experiments.