1. Cell Biology
  2. Medicine
Download icon

Lymphangiogenic therapy prevents cardiac dysfunction by ameliorating inflammation and hypertension

  1. LouJin Song
  2. Xian Chen
  3. Terri A Swanson
  4. Brianna LaViolette
  5. Jincheng Pang
  6. Teresa Cunio
  7. Michael W Nagle
  8. Shoh Asano
  9. Katherine Hales
  10. Arun Shipstone
  11. Hanna Sobon
  12. Sabra D Al-Harthy
  13. Youngwook Ahn
  14. Steven Kreuser
  15. Andrew Robertson
  16. Casey Ritenour
  17. Frank Voigt
  18. Magalie Boucher
  19. Furong Sun
  20. William C Sessa
  21. Rachel J Roth Flach  Is a corresponding author
  1. Internal Medicine Research Unit, Pfizer Inc, United States
  2. Comparative Medicine, Pfizer Inc, United States
  3. Drug Safety Research & Development, Pfizer Inc, United States
  4. Early Clinical Development, Pfizer Inc, United States
  5. Acceleron Pharma, United States
  6. Eisai Inc, United States
  7. Inflammation and Immunology Research Unit, Pfizer Inc, United States
  8. Target Sciences, Emerging Science and Innovation, Pfizer Inc, United States
  9. Department of Pharmacology, Vascular Biology and Therapeutics Program, Yale University School of Medicine, United States
Research Article
  • Cited 0
  • Views 867
  • Annotations
Cite this article as: eLife 2020;9:e58376 doi: 10.7554/eLife.58376


The lymphatic vasculature is involved in the pathogenesis of acute cardiac injuries, but little is known about its role in chronic cardiac dysfunction. Here, we demonstrate that angiotensin II infusion induced cardiac inflammation and fibrosis at 1 week and caused cardiac dysfunction and impaired lymphatic transport at 6 weeks in mice, while co-administration of VEGFCc156s improved these parameters. To identify novel mechanisms underlying this protection, RNA sequencing analysis in distinct cell populations revealed that VEGFCc156s specifically modulated angiotensin II-induced inflammatory responses in cardiac and peripheral lymphatic endothelial cells. Furthermore, telemetry studies showed that while angiotensin II increased blood pressure acutely in all animals, VEGFCc156s-treated animals displayed a delayed systemic reduction in blood pressure independent of alterations in angiotensin II-mediated aortic stiffness. Overall, these results demonstrate that VEGFCc156s had a multifaceted therapeutic effect to prevent angiotensin II-induced cardiac dysfunction by improving cardiac lymphatic function, alleviating fibrosis and inflammation, and ameliorating hypertension.


The lymphatic vasculature plays an important role in mediating fluid balance and local inflammation in many tissues and organs throughout the body (Huang et al., 2017; Oliver et al., 2020). The heart also carries a complex lymphatic network and relies on cardiac lymphatics to drain interstitial fluids and immune cells for maintaining homeostasis (Brakenhielm and Alitalo, 2019). Disrupting cardiac lymphatics can cause myocardial edema and lead to impaired cardiac function (Cui et al., 2001; Mehlhorn et al., 1995), indicating a critical role of cardiac lymphatics in cardiovascular physiology. Recently, cardiac lymphatics have emerged as a new therapeutic target for acute cardiac injuries. Several studies have demonstrated using rodent models that therapeutic lymphangiogenesis reduced myocardial edema and fibrosis, resolved inflammation, and improved cardiac function after myocardial infarction (Henri et al., 2016; Houssari et al., 2020; Klotz et al., 2015; Tatin et al., 2017; Trincot et al., 2019; Vieira et al., 2018) or ischemia and reperfusion injury (Shimizu et al., 2018). These studies in aggregate concluded that the improvement in cardiac function was due to local proliferation of lymphatic vessels at the site of injury in response to lymphangiogenic therapies. Importantly, these animal models represent cardiac injuries, in which blood and lymphatic vessels are surgically manipulated. However, the role of the lymphatic vasculature in the pathogenesis of chronic cardiac dysfunction and the effects of lymphangiogenic therapies on cardiac dysfunction remain to be explored. Here, we explored the role of the lymphatic vasculature in cardiac dysfunction and investigated the effects of a lymphangiogenic therapy (VEGFCc156s) on the angiotensin II infusion-induced cardiac dysfunction model. We found that angiotensin II infusion-induced cardiac dysfunction is associated with impaired lymphatic vascular function as well as increased cardiac fibrosis and inflammation, whereas VEGFCc156s treatment ameliorated these pathologies. Interestingly, angiotensin II-infused mice treated with VEGFCc156s also demonstrated a delayed and dramatic response to reverse angiotensin II-induced hypertension. Thus, we propose that the beneficial effects of the lymphangiogenic therapy VEGFCc156s on angiotensin II infusion-induced cardiac dysfunction are multifaceted and mediated by its concomitant effects on cardiac lymphatic function, inflammatory and fibrotic gene expression, and systemic hypertension.


Lymphatic endothelial markers associate with cardiac comorbidities and are reduced in human failing hearts

To investigate the role of the lymphatic vasculature in human heart failure and cardiac dysfunction, we first analyzed human genome wide association studies (GWAS) for single-nucleotide polymorphisms (SNPs) that were near lymphatic marker gene loci and were associated with human cardiovascular or metabolic comorbidities. Interestingly, several SNPs near lymphatic endothelial markers VEGFC, LYVE1, FLT4 loci are associated with cardiovascular and metabolic phenotypes including cardiac hypertrophy in humans (Fung et al., 2019; Johansson et al., 2010; justice et al., 2019; Kettunen et al., 2016; Kichaev et al., 2019; Lotta et al., 2018; Lu et al., 2017; Nasa Sinnott-Armstrong et al., 2019; Saxena et al., 2010; van der Harst and Verweij, 2018; Wild et al., 2017; Xu et al., 2018; Table 1). In addition, human heart samples were obtained from healthy donors or patients with chronic heart failure, and the gene expression of lymphatic endothelial markers VEGFC, LYVE1, PDPN, and FLT4 was assessed. A significant (19.6% for VEGFC, 38.8% for LYVE1 and 21.7% for FLT4 on average) reduction was observed for lymphatic markers VEGFC, LYVE1, and FLT4, and a 31.6% reduction was observed in PDPN (p=0.07) in hearts from chronic heart failure patients compared with hearts from healthy donors (Figure 1A–D, Figure 1—source data 1), suggesting that the cardiac lymphatic vasculature is impaired in human chronic heart failure.

Table 1
SNPs mapping to lymphatic endothelial markers associate with cardiac comorbidities.

SNPs in human genetic loci, where lymphatic endothelial marker genes VEGFC, LYVE1, FLT4 are located, are associated with cardiovascular and metabolic phenotypes. MRVI1, murine retrovirus integration site one homolog. ADM, adrenomedullin. CTR9, RNA polymerase-associated protein CTR9 homolog. MGAT1, alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase. SCGB3A1, Secretoglobin Family 3A Member 1. OR2Y1, olfactory receptor family two subfamily Y member 1.

SNPNearest gene(s)Associated phenotypep ValueReference
rs2333496VEGFCWaist-to-hip ratio (WHR) adj BMI8.00E-11Lotta, et al.
rs7660760VEGFCLeft ventricle wall thickness4.00E-07Wild, et al.
rs309795VEGFC2 hr Glucose Adj. for BMI2.22E-06Saxena, et al.
rs114108584VEGFCIdiopathic dilated cardiomyopathy9.00E-06Xu, et al.
rs11042906LYVE1 and MRVI1Systolic BP2.00E-14Kichaev, et al.
rs2218793LYVE1 and ADMHigh density lipoprotein cholesterol (HDL-C)1.60E-11Sinnott-Armstrong, et al.
rs11042937LYVE1 and CTR9Coronary artery disease3.00E-10Van der harst, et al.
rs7940646LYVE1 and MRVI1Triglycerides 2017 Mostly European and East Asian2.93E-08Lu, et al.
rs10840457LYVE1 and MRVI1Arterial stiffness index3.00E-08Fung, et al.
rs11603178LYVE1 and MRVI1Diastolic BP9.85E-08Nealelab-uk-biobank
rs12807023LYVE1 and ADMPlasma + serum IDL-TAG levels8.21E-07Kettunen, et al.
rs12807023LYVE1 and ADMPlasma + serum XS-VLDL values (concentration, TAG)5.41E-06Kettunen, et al.
rs634501FLT4 and MGAT1High density lipoprotein cholesterol (HDL-C)9.35E-08Lu, et al.
rs142342609FLT4 and SCGB3A1WHR adjusted BMI7.00E-07Justice, et al.
rs12517906FLT4 and OR2Y1Body mass index (females)6.00E-06Johansson, et al.
Lymphatic endothelial markers are reduced in human failing heart.

(A–D) Expression of lymphatic endothelial marker genes VEGFC (A), LYVE1 (B), PDPN (C), FLT4 (D) in hearts from healthy human donors (HH) and hearts from patients with chronic heart failure (CHF). The data were normalized to the expression of the housekeeping gene HPRT1 and represented as fold change from the HH group (n = 16–18 for HH and n = 10–11 for CHF). Data are mean ± s.d. Student’s t-test was used for statistics. *p<0.05.

VEGFCc156s prevented angiotensin II-induced cardiac dysfunction

To examine the role of the lymphatic vasculature in cardiac dysfunction further, we used a model of angiotensin II infusion, which promotes cardiac dysfunction directly via its effects on cardiomyocytes (Mazzolai et al., 2000; Mehta and Griendling, 2007) and indirectly by its action on the renin-angiotensin system to induce hypertension (Mehta and Griendling, 2007). To induce lymphangiogenesis in this model, we used the lymphangiogenic growth factor mutant VEGFCc156s, which specifically activates vascular endothelial growth factor receptor 3 (VEGFR3) but not vascular endothelial growth factor receptor 2 (VEGFR2) in vitro (Joukov et al., 1998) and enhances lymphangiogenesis in vivo (Klotz et al., 2015). Pharmacokinetic analysis of single subcutaneous dosing of VEGFCc156s indicated that VEGFCc156s has a short half-life in plasma (Figure 2—figure supplement 1A). Thus, we hypothesized that continuous infusion to maintain a stable increase in plasma VEGFCc156s concentration would be the most effective mode of administration. Therefore, an osmotic pump was implanted subcutaneously to infuse angiotensin II and VEGFCc156s simultaneously (Figure 2A). The VEGFCc156s infusion was calculated to maintain a two-fold increase in plasma VEGFC concentration, and the analysis at endpoint confirmed a significant 1.9-fold average increase in plasma VEGFC concentration in the treated mice compared with control mice (Figure 2—figure supplement 1B).

Figure 2 with 1 supplement see all
VEGFCC156S treatment prevented angiotensin II-induced cardiac dysfunction.

(A) Experimental design for animal studies. Angiotensin II (angII) was infused to induce cardiac dysfunction, and VEGFCc156s (VEGFC) was infused as a lymphangiogenic therapy via the same subcutaneously-implanted osmotic pump. Bovine serum albumin (BSA) was loaded to the pumps for control (ctrl) and angII groups to balance for the loading of VEGFCc156s in the therapeutic arm. (B–E) Echocardiography was conducted 6 weeks after minipump implantation. Fractional Shortening (FS) (B), Ejection Fraction (EF) (C), Left Ventricular (LV) mass index (D) and Relative Wall Thickness (RWT) (E) are shown (n = 17–24/group). (F–G) Heart weight (F) and lung weight (G) (normalized to tibia length) of the animals at euthanasia (n = 7–18/group). (H) RNA was isolated from the mouse hearts, and quantitative RT-PCR was performed for Nppb and normalized to the expression of housekeeping gene Hprt. The data were normalized to ctrl group and represented as fold change (n = 8–9/group). (I) Mouse hearts were fixed, OCT embedded, sectioned, and stained for podoplanin, smooth muscle actin and DAPI (light blue). Representative images of podoplanin-positive lymphatic vessels (green) and smooth muscle actin-positive arteries (red) for each group were shown. Scale bar, 200 μm. (J) Quantification of podoplanin-positive lymphatic vessel density (J, normalized to total area and represented as fold change to ctrl group) and podoplanin-positive lymphatic vessel lumen area (K) in mouse hearts (n = 8–10 animal/group, n = 10–12 sections/animal). Data are mean ± s.d. One-way ANOVA with Bonferroni posthoc was used for all figures except 2J and 2K (a linear mixed model was used for statistics). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, n.s. not significant.

Echocardiography was conducted at endpoint to examine cardiac function, and the results indicated that angiotensin II infusion induced cardiac hypertrophy and impaired cardiac contractility. In contrast, VEGFCc156s treatment prevented angiotensin II-induced impairments in cardiac function (Figure 2B–E, Figure 2—figure supplement 1C–1G). Consistent with the echocardiography results, angiotensin II infusion also significantly increased heart weight and lung weight, which possibly reflects an increase in lung edema (King and Goldstein, 2020), whereas VEGFCc156s prevented the angiotensin II-induced increases in heart and lung weights (Figure 2F and G). Moreover, gene expression analysis revealed a significant increase in the expression of Nppb, encoding heart failure marker B-type natriuretic peptide (BNP), in angiotensin II-treated mouse hearts compared with control hearts, while VEGFCc156s significantly decreased Nppb expression in angiotensin II-infused hearts (Figure 2H).

Finally, cardiomyocyte cell size was examined using wheat germ agglutinin (WGA), which stains the cell membrane. Whereas angiotensin II infusion significantly increased cardiomyocyte size and heterogeneity, VEGFCc156s treatment prevented the change in cell size heterogeneity in angiotensin II-infused mouse hearts (Figure 2—figure supplement 1H–1J), confirming the beneficial effects of VEGFCc156s on angiotensin II-induced cardiac hypertrophy.

To understand how VEGFCc156s ameliorated cardiac dysfunction, the effect of VEGFCc156s on cardiac lymphatic vascular marker expression and VEGFR3-mediated signaling cascades was examined. Similar to what was observed in human hearts (Figure 1), a significant reduction in lymphatic endothelial marker podoplanin expression was observed in angiotensin II-infused hearts compared with control hearts, indicating a potential reduction in cardiac lymphatic vascular density. Interestingly, VEGFCc156s treatment restored podoplanin expression in angiotensin II-infused hearts back to control level, indicating that VEGFCc156s treatment may prevent the loss of cardiac lymphatic vessels during cardiac dysfunction (Figure 2—figure supplement 1K and L). Consistent with the protein expression analysis, immunohistochemistry revealed a significant reduction in podoplanin-positive lymphatic vessel density in angiotensin II-infused hearts, which was restored by VEGFCc156s treatment (Figure 2I and J). More interestingly, podoplanin-positive lymphatic vessel lumen area was significantly increased in the hearts of VEGFCc156s + angiotensin II-infused animals compared with animals that had been treated with angiotensin II alone, indicating that VEGFCc156s may improve lymphatic transport function in diseased animals (Figure 2K). Consistent with the ability of VEGFC to activate Akt and Erk pathways, we observed increased phospho-Akt levels and a trend towards an increase in phospho-Erk in VEGFCc156s-treated hearts compared with control or angiotensin II-infused hearts, indicating the activation of signaling pathways that promote survival and growth by VEGFCc156s treatment (Figure 2—figure supplement 1K, M and N). To further characterize the systemic lymphangiogenic effect of VEGFCc156s, we examined lymphatic vessel diameter and density in the ear skin by immunohistochemistry. Similar to its effects on cardiac lymphatic vessels, VEGFCc156s treatment also significantly increased lymphatic vessel diameter and lymphatic vascular density in the ear skin of treated animals, supporting a systemic lymphangiogenic response induced by VEGFCc156s treatment (Figure 2—figure supplement 1O–1R).

VEGFCc156s improved cardiac lymphatic vascular function

To investigate whether the changes in podoplanin-positive lymphatic vessel density and lumen area in heart were translated into functional changes, we conducted lymphangiography to directly evaluate cardiac lymphatic transport function. FITC-dextran and cadaverine were injected intravenously to label the cardiac blood vasculature and reveal any vascular leak, respectively. Next, fluorescent qdots were injected into the apex of the heart. Qdots are macromolecules that diffuse into interstitial fluid and may be cleared by the lymphatic vasculature and transported back to the blood circulation (Henri et al., 2016; Shimizu et al., 2018). Angiotensin II treatment induced vascular leakage, leading to interstitial accumulation of cadaverine in angiotensin II-infused hearts. In contrast, VEGFCc156s-treated, angiotensin II-infused animals showed significantly reduced cadaverine accumulation in heart, indicating reduced leakage and improved fluid clearance (Figure 3A and B, Figure 3—figure supplement 1). We observed that in all animals, the qdots were transported back to the blood circulation within 5 mins after injection. However, quantification of the plasma qdot concentration, which is an indirect parameter to evaluate cardiac lymphatic transport efficiency, demonstrated a significant decrease in angiotensin II-infused mice compared with control mice, indicating impaired cardiac lymphatic transport. Conversely, VEGFCc156s treatment in the angiotensin II-infused mice significantly increased the plasma qdot concentration compared with the angiotensin II-infused mice, indicating improved cardiac lymphatic transport (Figure 3C). Concomitantly, a trend toward an increased heart wet-to-dry weight ratio was observed in angiotensin II-infused hearts, which was significantly reduced with VEGFCc156s treatment, indicating improved regulation of cardiac fluid balance in VEGFCc156s-treated mice (Figure 3D). These results demonstrated that VEGFCc156s treatment improved cardiac lymphatic vascular function in angiotensin II-infused animals, which may facilitate fluid balance regulation and contribute to the improved cardiac function observed after VEGFCc156s treatment.

Figure 3 with 1 supplement see all
VEGFCC156S treatment improved cardiac lymphatic vascular function.

(A) Representative lymphangiography images of adult mouse hearts. FITC-dextran (green) indicates blood vessels, cadaverine (orange) indicates vascular leak and qdot (red) indicates injection site and cardiac lymphatics. Objective, 1x. Scale bar, 2000 μm. (B) Analysis of cadaverine-positive area (normalized to total area) in heart 5 mins after injection. The data were normalized to ctrl group and represented as fold change (n = 10–19/group). (C) Analysis of qdot plasma concentration 5 mins after injection (n = 10–16/group). (D) Wet-to-dry weight ratio of hearts (n = 9–22/group). Ctrl, control. AngII, angiotensin II. VEGFC, VEGFCc156s. Data are mean ± s.d. One-way ANOVA with Bonferroni posthoc was used for statistics. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, n.s. not significant.

VEGFCc156s ameliorated angiotensin II-induced inflammatory responses

To further characterize the effects of VEGFCc156s on angiotensin II infusion-induced cardiac dysfunction, we conducted RNA sequencing (RNA-seq) analysis to profile the transcriptional changes in different cell populations from the heart. Transcriptional changes in diaphragm lymphatic endothelial cells (LECs) were also profiled to evaluate the effect of VEGFCc156s on peripheral lymphatics, as the treatment is systemic. To efficiently distinguish LECs from blood endothelial cells (BECs), we generated a Prox1-eGFP knock-in mouse model in which eGFP expression is driven by the endogenous promoter of the lymphatic endothelial marker Prox1 gene using CRISPR/Cas9 technology and confirmed the eGFP signals from lymphatic vessels in the heart and the diaphragm (Figure 4—figure supplement 1A–1C). The Prox1-eGFP mice were next used for in vivo studies following the study design shown in Figure 2A. From the animals, LECs, BECs and cardiomyocytes were isolated from the heart, and LECs were additionally isolated from the diaphragm following an optimized protocol (Figure 4—figure supplement 1D) and used for RNA-seq. A principal component analysis of the normalized expression counts across cell types indicated that the samples clustered based on cell population and showed a distinct expression profile (Figure 4—figure supplement 1E). Differential expression and signaling pathway analysis revealed that angiotensin II significantly altered gene expression in all four cell populations. VEGFCc156s treatment reversed many of these changes in heart and diaphragm LECs but not in cardiomyocytes or cardiac BECs, confirming the specificity of VEGFCc156s effects on the lymphatic vasculature (Figure 4A–C, Figure 4—figure supplement 1F–1H). A causal reasoning analysis was performed to predict potential upstream regulators for the modulated genes. This analysis predicted that angiotensin II is a causal factor for the gene expression changes in cardiomyocytes from both the angiotensin II-infused and the VEGFCc156s-treated, angiotensin II-infused group, confirming similar effects of angiotensin II on cardiomyocytes at endpoint (Figure 4—figure supplement 1I). One common causal factor and related pathway that was activated by VEGFCc156s treatment in LECs from both heart and diaphragm is MYCN, suggesting the activation of lymphatic endothelial cell growth and proliferation by VEGFCc156s (Figure 4—figure supplement 1J). Notably, angiotensin II infusion upregulated the expression of multiple genes involved in inflammation, chemotaxis and related pathways in LECs from both heart and diaphragm. Conversely, VEGFCc156s treatment downregulated the expression of these inflammatory and chemotactic genes (Figure 4A–C). Causal reasoning analysis also suggested that toll-like receptor 4 (TLR4) and toll-like receptor 3 (TLR3) signaling pathways were activated in LECs from angiotensin II-infused hearts but were reduced in LECs from VEGFCc156s-treated, angiotensin II-infused hearts, supporting a beneficial effect of VEGFCc156s treatment on angiotensin II infusion-induced inflammatory pathways in LECs (Figure 4—figure supplement 1J).

Figure 4 with 1 supplement see all
VEGFCC156S treatment ameliorated angiotensin II-induced inflammatory responses.

(A–B) Heat map visualization of all FDR-significant differential expression changes in genes comparing angII and ctrl groups (angII vs ctrl), angII+VEGFC and angII groups (angII+VEGFC vs angII), and angII+VEGFC and ctrl groups (angII+VEGFC vs ctrl) in heart lymphatic endothelial cells (LECs) and diaphragm LECs. The differential expression test-statistics are indicated by the shading in the heatmap and several genes that are significantly regulated by VEGFC treatment are shown. (C) Top 15 affected signaling pathways in angII+VEGFC vs angII comparison for heart LECs and diaphragm LECs from gene ontology (GO) pathway analysis. (D) KC/GRO levels in mouse plasma (n = 16–21/group). (E–F) IP-10 and MDC levels in native mouse skin lysates. The values of IP-10 levels were log-transformed, and the values were normalized to the ctrl group and represented as fold change (n = 7–9/group). (G) Mouse hearts were fixed, OCT embedded, sectioned, and stained for CD68 (green), smooth muscle actin (red) and DAPI (light blue). Representative images for each group are shown and CD68/DAPI double-positive macrophages are indicated with arrowheads. Scale bar, 100 μm. (H–I) CD68/DAPI double-positive macrophage density and macrophage density near smooth muscle actin-positive arteries (normalized to total area and represented as fold change to ctrl group) in mouse hearts (n = 8–9/group). Ctrl, control. AngII, angiotensin II. VEGFC, VEGFCc156s. Data are mean ± s.d. One-way ANOVA with Bonferroni posthoc was used for all figures except 4E (One-way ANOVA with Tukey’s posthoc was used for log-transformed data). *p<0.05, **p<0.01, n.s. not significant.

To validate the findings from the RNA-seq analysis, we examined circulating chemokine levels as well as chemokine levels in skin, which is highly vascularized with lymphatic capillaries. Consistent with the RNA-seq analysis, a significant 43% increase in plasma KC/GRO levels was noted in angiotensin II-infused mice compared with control mice, and VEGFCc156s treatment trended to reduce plasma KC/GRO levels in angiotensin II-infused mice (Figure 4D). Furthermore, we observed significantly increased levels of several chemokines (37.2% for chemokine interferon γ-induced protein 10 (IP-10), 68% for macrophage-derived chemokine (MDC) and 30% for KC/GRO on average) in skin of angiotensin II-infused mice compared with control mice, while VEGFCc156s treatment significantly reduced the levels or induced a trend toward a reduction in these chemokines (Figure 4E and F, Figure 4—figure supplement 1K). In addition, angiotensin II infusion significantly increased general macrophage density in heart as well as macrophage density near arteries as assessed by CD68 immunostaining, indicating increased local macrophage content, whereas VEGFCc156s treatment significantly reduced these parameters (Figure 4G–I). Altogether, the results suggest that VEGFCc156s treatment ameliorated angiotensin II infusion-induced inflammatory and chemotactic responses potentially by affecting the LEC transcriptome, which may contribute to the efficacy observed in the disease model.

VEGFCc156s ameliorated angiotensin II-induced hypertension

Immune cells and inflammatory processes can play a role in the pathogenesis of hypertension (Caillon et al., 2019), and angiotensin II-induced hypertension promotes cardiac dysfunction. Therefore, the effect of VEGFCc156s treatment on angiotensin II-induced hypertension was examined by conducting a telemetry study as detailed in Figure 5A. Telemetry recordings started 3 days before minipump implantation and lasted for 5 weeks after surgery. The time-course analysis of mean blood pressure demonstrated a significant increase in blood pressure and the development of hypertension in angiotensin II-infused mice compared with control mice. Interestingly, VEGFCc156s-treated, angiotensin II-infused mice showed a similar significant increase in both systolic and diastolic blood pressure as those that were treated with angiotensin II alone in the first week. However, starting at week 2, the VEGFCc156s-treated angiotensin II group demonstrated a gradual return in systolic and diastolic blood pressure that was comparable to control mice by week 4 (Figure 5B–E, Figure 5—figure supplement 1). To examine whether VEGFCc156s alleviated angiotensin II infusion-mediated aortic remodeling to reduce blood pressure, pulse wave velocity was assessed to examine aortic stiffness, and both angiotensin II-infused mice and VEGFCc156s-treated, angiotensin II-infused mice showed a significant increase in pulse wave velocity compared with control mice, indicating that VEGFCc156s treatment did not alter angiotensin II infusion-mediated aortic stiffness and remodeling (Figure 5F). In addition, the expression of renal Ace2 mRNA, which encodes the degradation enzyme for angiotensin II, was induced in both angiotensin II-infused mice and VEGFCc156s-treated, angiotensin II-infused mice to a similar extent compared with the kidneys from control mice, indicating a similar compensatory response in kidney to cope with continuous angiotensin II infusion (Figure 5G). These results suggest that VEGFCc156s treatment ameliorated angiotensin II-induced hypertension without altering angiotensin II infusion-mediated aortic stiffness and the subsequent renal compensatory response, elucidating another mechanism underlying the beneficial effects of VEGFCc156s on angiotensin II-induced cardiac dysfunction.

Figure 5 with 1 supplement see all
VEGFCC156S treatment ameliorated angiotensin II-induced hypertension.

(A) Experimental design for telemetry study. (B) Mean blood pressure of control, angII and angII+VEGFCc156s mice after minipump implantation (a linear mixed model was used for statistics). (C–E) Analysis of mean blood pressure at baseline (C), week 1 (D) and week 4 (E) (n = 5–6/group). (F) Pulse wave velocity assessment (aortic stiffness) 4.5 weeks after minipump implantation (n = 9–19/group). (G) RNA was extracted from mouse kidneys and qPCR was performed for Ace2 and normalized to Hprt. The data were normalized to the ctrl group and represented as fold change (n = 16–21/group). Ctrl, control. AngII, angiotensin II. VEGFC, VEGFCc156s. Data are mean ± s.d. One-way ANOVA with Bonferroni posthoc was used for statistics. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, n.s. not significant.

VEGFCc156s improved angiotensin II-induced kidney dysfunction

To validate the effect of VEGFCc156s treatment on angiotensin II infusion-induced hypertension, angiotensin II-induced pathological changes in kidney were investigated. Based on the evaluation of hematoxylin and eosin (H and E) stained sections by a veterinary pathologist, angiotensin II infusion induced vascular hypertrophy in the kidney of both angiotensin II-infused and VEGFCc156s-treated angiotensin II-infused animals, which is consistent with the putative action of angiotensin II as a vasoactive molecule (Mehta and Griendling, 2007). However, angiotensin II-infused VEGFCc156s-treated animals showed a reduced incidence of angiotensin II-induced secondary disturbances such as interstitial mononuclear cell infiltrates and tubular basophilia in the kidney compared with angiotensin II-infused animals, indicating that VEGFCc156s treatment partially alleviated angiotensin II infusion-induced kidney injury (Figure 6—figure supplement 1A and B). In addition, picrosirius red (PSR) staining demonstrated increased fibrosis with angiotensin II infusion, and VEGFCc156s treatment significantly reduced the total and perivascular PSR-positive area in kidneys of angiotensin II-infused mice, indicating that VEGFCc156s treatment alleviated angiotensin II-induced kidney fibrosis and injury (Figure 6—figure supplement 1A, C and D). Moreover, a significant increase in urine volume was observed in angiotensin II-infused mice compared with control mice over 24 hr, while the angiotensin II-infused, VEGFCc156s-treated mice displayed a significant reduction in urine volume (Figure 6A). Urine composition was also evaluated, and consistent with the pathological evaluation, angiotensin II infusion caused kidney damage and significantly increased the amount of non-esterified fatty acids (NEFA), total urinary protein, and the albumin-to-creatinine ratio (ACR) (Figure 6B–D). In contrast, VEGFCc156s treatment significantly reduced these parameters compared with animals that had been treated with angiotensin II alone, suggesting that VEGFCc156s treatment alleviated angiotensin II-induced kidney damage. Taken together, these results demonstrate that VEGFCc156s treatment improved angiotensin II-induced kidney dysfunction.

Figure 6 with 1 supplement see all
VEGFCC156S treatment improved angiotensin II-induced kidney dysfunction.

(A–D) Urine was collected 4.5 weeks after minipump implantation. Urine volume (A), Urine non-esterified fatty acid (NEFA) levels (B), total urinary protein (C) and albumin to creatinine ratio (ACR) (D) are shown (n = 7–10/group). (E–F) RNA was extracted from whole kidney, and quantitative RT-PCR was performed for Lyve1 (E) and Pdpn (F) and normalized to the expression of housekeeping gene Hprt. The data were normalized to the control group and represented as fold change (n = 16–21/group). Ctrl, control. AngII, angiotensin II. VEGFC, VEGFCc156s. Data are mean ± s.d. One-way ANOVA with Bonferroni posthoc was used for statistics. *p<0.05, **p<0.01, ****p<0.0001, n.s. not significant.

Recent reports indicated a role of renal lymphatics in the pathogenesis of hypertension and demonstrated that renal lymphatics respond to systemic hypertension by expansion (Balasubbramanian et al., 2020; Lopez Gelston et al., 2018). Therefore, we examined lymphatic endothelial marker expression and lymphatic vascular density in kidney. Angiotensin II infusion significantly increased the mRNA expression levels of lymphatic endothelial markers Lyve1, Pdpn, Vegfc, and Flt4 in kidney, which is consistent with previous reports (Balasubbramanian et al., 2020; Lopez Gelston et al., 2018) and represents an endogenous expansion in response to systemic hypertension. Surprisingly, VEGFCc156s treatment significantly reduced, rather than increased, lymphatic endothelial marker expression in angiotensin II-infused mouse kidneys to levels that were comparable to control mice (Figure 6E and F, Figure 6—figure supplement 1E and F). Consistent with the gene expression analysis, immunohistochemistry also showed a trend toward increased Lyve1-positive lymphatic vessel density in angiotensin II-infused kidneys, and VEGFCc156s treatment ameliorated this response (Figure 6—figure supplement 1G and H). In summary, these results suggest that VEGFCc156s treatment improved angiotensin II-induced kidney dysfunction and ameliorated the response of renal lymphatics to systemic hypertension, supporting the observation that VEGFCc156s ameliorated angiotensin II infusion-induced hypertension.

VEGFCc156s alleviated angiotensin II-induced cardiac fibrosis and inflammation at 1 week after treatment

To characterize the time-course of VEGFCc156s-mediated protection from angiotensin II-induced cardiac dysfunction and dissect the potential direct effects of VEGFCc156s on the heart from its systemic effect to reduce blood pressure, we examined the effect of VEGFCc156s on angiotensin II-infused animals after 1 week of infusion, when blood pressure was similar between angiotensin II-infused and VEGFCc156s-treated, angiotensin II-infused mice (Figure 5). To further characterize the lymphangiogenic response of VEGFCc156s in healthy animals, we added an additional group in which animals were treated with VEGFCc156s alone (Figure 7A). As expected, VEGFCc156s infusion increased plasma VEGFC concentration in animals treated with VEGFCc156s alone as well as in animals treated with angiotensin II and VEGFCc156s similarly as was observed in the longer study (Figure 7—figure supplement 1A). As a surrogate for blood pressure measurements, we measured hemoglobin levels and calculated hematocrit percentage, which positively correlates with blood pressure (Atsma et al., 2012). Significant and comparable increases in hemoglobin levels and hematocrit percentage were observed in the angiotensin II-infused animals compared with the control groups, consistent with an increase in blood pressure in angiotensin II-infused groups (Figure 7—figure supplement 1B and C). As an additional control, we examined renal Ace2 mRNA expression and confirmed its similar induction in both angiotensin II-infused groups compared with the control groups, indicating induction of a compensatory response in the kidney and further validating the action of angiotensin II on both treatment groups at endpoint (Figure 7—figure supplement 1D).

Figure 7 with 2 supplements see all
VEGFCC156S treatment reduced the gene expression of cardiac dysfunction, fibrosis and inflammatory markers, and alleviated cardiac fibrosis and inflammation at 1 week after treatment.

(A) Experimental design for the animal study. Angiotensin II (angII) was infused to induce cardiac dysfunction, and VEGFCc156s (VEGFC) was infused as a lymphangiogenic therapy via a subcutaneously-implanted osmotic pump. Bovine serum albumin (BSA) was loaded to the pumps for control (ctrl) and angII groups to balance for the loading of VEGFCc156s. (B–E) Echocardiography was conducted at day 6 after minipump implantation. Fractional Shortening (FS) (B), Ejection Fraction (EF) (C), Left Ventricular (LV) mass index (D) and Relative Wall Thickness (RWT) (E) are shown (n = 13–17/group). (F–G) Heart weight (F) and lung weight (G) (normalized to tibia length) of the animals at euthanasia (n = 6–8/group). (H–J) RNA was isolated from the mouse hearts, and quantitative RT-PCR was performed for Nppb(H), Col1a1(I), Col3a1(J), and normalized to the expression of housekeeping gene Hprt. The data were normalized to ctrl group and represented as fold change (n = 6–8/group). (K) Hearts from the mice described in (A) were fixed, sectioned, and stained. Representative Picrosirius red (PSR) stains of mouse heart sections are shown. Scale bar, 100 μm. (L) Quantification of PSR-positive area (normalized to total area) on PSR-stained heart sections (n = 7–10/group). (M) Quantitative RT-PCR was performed for Cd68 and normalized to the expression of housekeeping gene Hprt. The data were normalized to ctrl group and represented as fold change (n = 6–8/group). (N) CD68/DAPI double-positive macrophage density (normalized to total area and represented as fold change to ctrl group) in mouse hearts (n = 7–10/group). Data are mean ± s.d. One-way ANOVA with Bonferroni posthoc was used for statistics. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, n.s. not significant.

Kidney function was examined in these animals by measuring urinary ACR, and no significant change was observed among the groups (Figure 7—figure supplement 1E), indicating that the animals had not developed significant kidney dysfunction with a 7-day angiotensin II infusion. We further evaluated kidney expression of lymphatic endothelial marker Lyve1 as well as lyve1-positive lymphatic vessel density and found no significant change in both parameters among the groups (Figure 7—figure supplement 1F–1H), indicating renal lymphangiogenesis was not yet observed with a 7-day infusion of angiotensin II or VEGFCc156s.

To characterize systemic lymphangiogenic responses induced by VEGFCc156s after 7 days of infusion, lymphatic vessel density in skin and heart was examined. We found no significant changes in lyve1-positive lymphatic vessel density in skin at this time point (Figure 7—figure supplement 1I and J). However, animals treated with VEGFCc156s alone or in combination with angiotensin II showed a significant increase in podoplanin-positive lymphatic vessel density in heart compared with other groups (Figure 7—figure supplement 1K and L).

To investigate whether the lymphangiogenesis response observed in heart in the VEGFCc156s-treated animals altered cardiac function, echocardiography was conducted. While echocardiography demonstrated no significant change in cardiac contractility among the animals, a significant increase in left ventricular mass and ventricular wall thickness in angiotensin II-infused mice was observed, indicating the development of cardiac hypertrophy at 1 week after angiotensin II infusion (Figure 7B–E, Figure 7—figure supplement 1M–1O). Interestingly, VEGFCc156s treatment did not significantly alleviate angiotensin II-induced cardiac hypertrophy at 1 week after treatment by echocardiography. Similarly, a significant increase in heart weight and a trend towards increased lung weight were observed in angiotensin II-infused animals compared with the control groups, and VEGFCc156s treatment did not alter heart and lung weights in angiotensin II-infused animals at this time point (Figure 7F and G).

Despite the lack of alterations in cardiac function with 7 days of VEGFCc156s infusion, a significant increase in nppb mRNA expression was observed in angiotensin II-infused hearts, and VEGFCc156s treatment restored nppb expression in angiotensin II-infused hearts back to a level that was comparable with the control hearts (Figure 7H). Furthermore, a significant increase in the mRNA expression of profibrotic markers (Col1a1, Col1a2, Col3a1 and Fn1) was observed in angiotensin II-infused hearts compared with control hearts, while animals that had also been treated with VEGFCc156s demonstrated a significant reduction in the expression of these markers (Figure 7I and J, Figure 7—figure supplement 1P and Q), indicating a potential beneficial effect of VEGFCc156s to reduce angiotensin II infusion-induced cardiac fibrosis. To support this observation, PSR staining was performed in mouse heart sections. Consistent with the gene expression analyses, angiotensin II-infused hearts showed a significant increase in PSR-positive area, indicating the development of cardiac fibrosis, while VEGFCc156s induced a trend toward a reduced PSR-positive area percentage in angiotensin II-infused hearts (Figure 7K and L), suggesting that VEGFCc156s ameliorated angiotensin II infusion-induced cardiac fibrosis.

Gene expression analyses of proinflammatory markers revealed that angiotensin II infusion for 7 days significantly increased the mRNA expression of multiple inflammatory markers, cytokines, and chemokines (Figure 7M, Figure 7—figure supplement 2A–2I). Conversely, VEGFC156s treatment significantly decreased the expression of these proinflammatory markers in angiotensin II-infused hearts, suggesting that VEGFCc156s alleviated angiotensin II-induced cardiac inflammation. Immunohistochemistry was performed to visualize CD68-positive macrophages in heart. A significant increase in CD68-positive macrophage density was observed in angiotensin II-infused hearts compared with control hearts, and VEGFCc156s treatment significantly reduced CD68-positive macrophage density in angiotensin II-infused hearts (Figure 7N, Figure 7—figure supplement 2J). In summary, VEGFCc156s treatment ameliorated angiotensin II-induced pathological gene expression and angiotensin II-induced cardiac fibrosis and inflammation at 1 week after treatment, a time point at which no divergence in blood pressure is observed.


Recent studies indicated that the lymphatic vasculature, a traditionally-neglected target for therapeutic interventions, plays an important role in the pathogenesis of cardiovascular diseases, and enhancing lymphangiogenesis could be beneficial for acute cardiac injuries (Henri et al., 2016; Houssari et al., 2020; Huang et al., 2017; Klotz et al., 2015; Liu and Oliver, 2019; Shimizu et al., 2018; Tatin et al., 2017; Trincot et al., 2019; Vieira et al., 2018; Vivien et al., 2019). However, the role of the lymphatic vasculature in chronic cardiac dysfunction remains to be elucidated. In this study, we aimed to investigate the role of the lymphatic vasculature in the pathogenesis of chronic heart failure and cardiac dysfunction. We found several SNPs near lymphatic marker gene loci that were associated with human cardiovascular or metabolic comorbidities in human GWAS studies, although some of the associations did not meet the genome-wide threshold and some of the loci are close to another gene in addition to the lymphatic endothelial marker (Table 1). To validate the findings from the GWAS analysis, we conducted expression profiling using human heart samples and found reduced expression of lymphatic endothelial markers in human chronic heart failure hearts (Figure 1), suggesting that the lymphatic vasculature may play a role in the pathogenesis of human chronic heart failure and cardiac dysfunction. Our observations are in line with previously published RNA sequencing analyses of human hearts (Sweet et al., 2018; van Heesch et al., 2019) and a recent clinical report indicating that serum VEGFC levels are significantly and inversely associated with all-cause and cardiovascular death (Wada et al., 2018), supporting a role of lymphatic vasculature in the pathogenesis of cardiovascular diseases. However, previous reports found minimal changes in lymphatic vascular density in left ventricular endomyocardial biopsies from terminal heart failure hearts and healthy donor hearts using immunohistochemistry (Dashkevich et al., 2009; Dashkevich et al., 2010). Thus, further investigations are required to characterize the changes in lymphatic vasculature in human chronic heart failure pathogenesis.

Using a murine model of cardiac dysfunction, we demonstrate that a chronic cardiac insult such as angiotensin II infusion induced lymphatic vascular dysfunction by reducing lymphatic vascular density (Figure 2) and impairing lymphatic vascular transport function in the heart (Figure 3). Podoplanin is widely used as a marker for LECs and is preferentially expressed in pre-collectors and collectors of the cardiac lymphatic vasculature (Henri et al., 2016). A previous study demonstrated that enhancing lymphangiogenesis by over-expressing VEGFC with adenoviruses in a mouse model of lymphedema induced robust growth of lymphatic capillaries in axillary tissues after 2 weeks but failed to improve lymphatic vascular leakage, while with prolonged VEGFC stimulation (2–6 months), the lymphatic capillaries underwent an intrinsic remodeling and maturation and became functional collecting vessels, leading to reduced tissue edema and restored lymphatic drainage (Norrmén et al., 2011; Tammela et al., 2007). Moreover, VEGFCc156s can reportedly directly enhance lymphatic pump activity and lymphatic output in rat mesentery collecting lymphatics (Breslin et al., 2007), indicating a potential direct beneficial effect of VEGFCc156s on lymphatic vascular function in addition to its role in enhancing lymphangiogenesis and maturation. Here, consistent with these previous reports, we observed that 6 week continuous infusion of VEGFCc156s concomitant with angiotensin II restored collecting vessel function and improved cardiac lymphatic drainage, leading to improved cardiac fluid balance regulation. Myocardial edema is a key clinical feature of cardiac dysfunction and chronic heart failure, and heart function could be significantly compromised with a subtle increase in interstitial fluid volume (Dongaonkar et al., 2010). Therefore, the improved cardiac lymphatic vascular function and tissue fluid homeostasis in the VEGFCc156s-treated, angiotensin II-infused animals might contribute to the improved cardiac function and reduced cardiac hypertrophy observed. One area for future investigation is a further characterization of the changes in cardiac lymphatic valves, which play an important role in regulating the lymph flow in collecting vessels. In addition, podoplanin, a marker of lymphatic collecting vessels, is also reportedly expressed in inflammatory cells. Previous reports indicated that a high frequency of podoplanin-expressing cells appeared in the infarcted heart and facilitated local inflammation, and podoplanin neutralization improved cardiac function after myocardial infarction (Cimini et al., 2017; Cimini et al., 2019; Quintanilla et al., 2019). In our study, we assessed podoplanin-expressing lymphatic vessels but not other podoplanin-expressing cells; further analysis of other podoplanin-expressing cells in our disease model would be an area for future investigation.

Previous studies have demonstrated impairments in the lymphatic vasculature in a myocardial infarction model, where the left anterior descending artery is surgically ligated (Henri et al., 2016; Klotz et al., 2015). Importantly, the lymphatic vessel parallel to this major blood vessel is likely also mechanically impaired by this surgical manipulation, thus testing the hypothesis that mechanical disruption of the lymphatic vasculature can impair heart function, and regrowth using lymphangiogenic therapy is beneficial. Our observations are in line with these previous studies; however, the studies presented herein importantly assess lymphatic dysfunction in the absence of direct injury or surgical manipulation. Likely the impairments in lymphatic vascular function observed in angiotensin II-infused mice could come directly from angiotensin II actions on the endothelium, as angiotensin II can induce endothelial dysfunction (Gomolak and Didion, 2014; Watanabe et al., 2005) or perhaps indirectly from angiotensin II infusion-induced hypertension, which reportedly alters lymphatic vascular function (Dongaonkar et al., 2015).

The lymphatic vasculature also plays an important role in mediating local inflammation (Brakenhielm and Alitalo, 2019), and in acute cardiac injury models, resolution of inflammation following lymphangiogenic therapy has been proposed to be an underlying therapeutic mechanism (Tatin et al., 2017; Vieira et al., 2018). Our RNA-seq analysis indicated that LECs expressed proinflammatory chemokines after angiotensin II stimulation (Figure 4), which is consistent with previous reports indicating a role of angiotensin II in initiating inflammatory and chemotactic responses in tissues and vasculature (Benigni et al., 2010; Suzuki et al., 2003). Interestingly, VEGFCc156s treatment alleviated the inflammatory responses induced by angiotensin II infusion in LECs by reducing the expression of proinflammatory chemokines, which may contribute to the beneficial effects of VEGFCc156s on angiotensin II-induced cardiac dysfunction. Our results are in line with a previous report indicating that VEGFCc156s treatment downregulated the expression of genes involved in immune regulation and inflammation in dermal LECs without stress or stimulation (Dieterich et al., 2017), while here we report that VEGFCc156s treatment ameliorated inflammatory responses in LECs under stress (angiotensin II infusion). Moreover, the transcriptional changes in LECs detected by RNA-seq analysis translated to tissue and systemic levels, and we observed elevations in chemokine levels in skin and plasma in angiotensin II-infused mice, which were alleviated by VEGFCc156s treatment. These results in aggregate suggest that lymphatic vessels may play a more active role in mediating local and systemic inflammation than simply providing a route for immune cell clearance, and VEGFCc156s may directly alleviate systemic inflammation through transcriptional effects on LECs.

More interestingly, upon VEGFCc156s treatment, a significant reduction of angiotensin II-induced increases in blood pressure and kidney damage was observed (Figure 5 and Figure 6). Our observations are in line with a previous report indicating that the treatment of VEGFC, a ligand for both VEGFR2 and VEGFR3, also induced a delayed systemic hemodynamic response to reduce blood pressure and attenuated related renal damage in a high-salt induced hypertension model (Beaini et al., 2019). Our study used VEGFCc156s, a ligand with specificity for VEGFR3, suggesting that VEGFC-mediated effects are indeed mediated by VEGFR3 activation. Furthermore, these effects are not limited to salt-induced pathology, as VEGFCc156s also ameliorated angiotensin II-induced hypertension and renal damage, suggesting that VEGFC may play a broad role to modulate hypertension. Moreover, in line with the observations using the murine models, a recent clinical study also showed that patients with hypertension have significantly lower serum VEGFC levels compared with healthy individuals (Chachaj et al., 2018), supporting a potential role of lymphatic vasculature in the pathogenesis of human hypertension. Hypertension is a major risk factor for heart failure and other cardiovascular diseases (Dorans et al., 2018; Tackling and Borhade, 2019), and anti-hypertensive therapies significantly reduce cardiovascular events and mortality in patients in clinical studies (Ettehad et al., 2016). Therefore, the effect of VEGFCc156s on blood pressure might also contribute significantly to its beneficial effects on angiotensin II-induced cardiac dysfunction.

Consistent with previous reports regarding the role of renal lymphatics in the pathogenesis of hypertension (Balasubbramanian et al., 2020; Lopez Gelston et al., 2018), we also observed an endogenous expansion of renal lymphatics in response to angiotensin II-induced hypertension (Figure 6). The previous reports also demonstrated that enhancing renal lymphatic expansion by over-expressing VEGFD prevented the development of hypertension. Therefore, we initially hypothesized that VEGFCc156s might enhance the endogenous renal lymphangiogenesis response and thus ameliorate angiotensin II infusion-induced hypertension. Surprisingly, no lymphangiogenic response was observed in the kidney of VEGFCc156s-treated angiotensin II-infused animals at both the 1-week and 6-week time points assessed here (Figure 6E and F, Figure 6—figure supplement 1E–1H and Figure 7—figure supplement 1F–1H). Thus, it is possible that the lymphangiogenesis response we observed in the kidney of angiotensin II-infused mice could be an adaptation to hypertension and was therefore ameliorated in VEGFCc156s-treated, angiotensin II-infused mice at the 6-week timepoint due to reduced blood pressure. In the previous reports, the authors used a transgenic line to over-express VEGFD by 800-fold over baseline specifically in kidney and observed significant expansion of renal lymphatics, while our study used VEGFCc156s at a low dose that only increased plasma VEGFC levels by 1.6-fold to 1.9-fold on average. In addition, as a low-molecular weight protein, VEGFCc156s will be quickly filtered through glomeruli followed by adsorptive endocytosis and lysosomal degradation (Franssen et al., 1994), resulting in poor local retention and exposure of VEGFCc156s in kidney. Therefore, the discrepancy between our study and previous studies could possibly be explained by differences in local exposure of the lymphangiogenic factors with transgenic overexpression and chronic systemic administration.

Although VEGFCc156s significantly ameliorated angiotensin II-induced hypertension, the underlying molecular mechanisms remain to be explored. We first carefully examined the possibility that VEGFCc156s interfered with angiotensin II-mediated effects, and several lines of evidence in our studies indicate that there were no alterations in angiotensin II-mediated vascular effects after VEGFCc156s treatment, as angiotensin II caused aortic remodeling (Figure 5F), induced vascular leakage (Figure 3B) and vascular hypertrophy (Figure 6—figure supplement 1A) and increased renal Ace2 expression (Figure 5G and Figure 7—figure supplement 1D) similarly in both the angiotensin II-infused and the VEGFCc156s-treated, angiotensin II-infused group, indicating that angiotensin II acted as a vasoactive molecule in both groups. In addition, causal reasoning analysis of RNA-seq data also pointed at angiotensin II as a causal factor for the changes observed in cardiomyocytes from both the angiotensin II-infused and the VEGFCc156s-treated, angiotensin II-infused group. Finally, the similar blood pressure elevations detected in the first week in both angiotensin II-infused and VEGFCc156s-treated, angiotensin II-infused groups indicated successful release of angiotensin II from the pumps in both groups (Figure 5). Therefore, we suggest that VEGFCc156s did not interfere with angiotensin II effects to alleviate the phenotypes in this disease model. Another possibility is that VEGFCc156s might affect the skin lymphatic vasculature to regulate blood pressure, as skin lymphatics have been implicated as a potential disease-modifying factor in the pathogenesis of salt-sensitive hypertension (Karlsen et al., 2018). After 6 weeks of treatment, VEGFCc156s significantly increased skin lymphatic vessel density and diameter in angiotensin II-infused mice (Figure 2—figure supplement 1O–1R); these changes may contribute to the reductions observed in blood pressure in these animals. Further investigations are needed to fully characterize the molecular mechanisms underlying the beneficial effect of VEGFCc156s on angiotensin II-induced hypertension.

To dissect the potential direct effect of VEGFCc156s on the heart from its effect on blood pressure, we examined the effects of VEGFCc156s in angiotensin II-infused mice at 1 week after treatment, at which timepoint the blood pressure was similarly high in animals treated with angiotensin II alone or a combination of angiotensin II and VEGFCc156s (Figure 5). Although VEGFCc156s treatment enhanced podoplanin-positive lymphatic vessel growth in the heart at this timepoint, it did not alleviate cardiac hypertrophy in angiotensin II-infused mice. More interestingly, VEGFCc156s treatment restored angiotensin II-induced pro-fibrotic and pro-inflammatory markers in angiotensin II-infused hearts in gene expression analyses and immunohistochemistry staining, indicating a beneficial effect of VEGFCc156s in a blood pressure-independent manner (Figure 7 and Figure 7—figure supplements 1 and 2). The lymphatic vasculature has been proposed to play an important role in regulating myocardial fibrosis (Brakenhielm et al., 2020) and a previous report indicated that lymphangiogenic factor treatment in a rat model of myocardial infarction improved cardiac function by reducing cardiac fibrosis (Henri et al., 2016). Our results are in line with this previous report, as VEGFCc156s also reduced cardiac fibrosis in angiotensin II-infused mice as early as 1 week post-treatment, which may contribute to the efficacy we observed at the 6-week timepoint.

In summary, our study demonstrates that lymphatic vessels are impaired in cardiac dysfunction, and the lymphangiogenic therapy VEGFCc156s prevented cardiac dysfunction by improving lymphatic vascular function, alleviating cardiac fibrosis and inflammation, and ameliorating hypertension. These results provide new insights into the potential effects of a lymphangiogenic therapy on chronic cardiac diseases and underlying mechanisms and indicate that the lymphatic vasculature could be a therapeutic target for hypertension and hypertensive heart disease.

Materials and methods

Animals and treatments

Request a detailed protocol

10 to14 weeks old C57/BL6N (#027 purchased from Charles River laboratories) male mice were used for most of the studies, and Prox1-eGFP knock-in male mice were generated using the CRISPR/Cas9 technology and used for in vivo studies at 9–15 weeks old. Bovine serum albumin (A7030, Sigma-Aldrich), human angiotensin II (A9525, Sigma-Aldrich) and recombinant human VEGF-C (Cys156Ser) protein (752-VC, R and D systems) were used as treatments. The sample size was predicted prior to study start with a power analysis. All animal experimental procedures were carried out in accordance with regulations and established guidelines and were reviewed and approved by the Pfizer Institutional Animal Care and Use Committee (AUP # KSQ-2013–00895).

Minipump implantation

Request a detailed protocol

Animals were randomized based on body weight and implanted with a minipump (Alzet 1002 or Alzet 2006 pump) subcutaneously for continuous infusion for 7 days or 42 days. Isoflurane was used as anesthetic in the minipump implantation surgery, and Carprofen in the form of MediGel CPF (Clear H20) (or Meloxicam SR) and Buprenorphine were used as pain medications for pre-op and post-op care.

Generation of Prox1-eGFP knock-in mouse model using the CRISPR/Cas9 technology

Request a detailed protocol

The Prox1-eGFP knock-in model was generated by inserting an IRES-eGFP cassette into the 3′UTR of the endogenous Prox1 locus (at 470 bp downstream of the stop codon). For gene editing in one-cell embryos collected from super-ovulated C57BL/6J donors, Cas9 (Streptococcus pyogenes) protein (IDT) or mRNA (TriLink), a pair of single guide RNAs (sgRNA) and a donor plasmid were delivered via pronuclear injection. Seed sequences for the sgRNAs were 5′tacccagctgccgagggcat, 5′gtgagctacccagctgccga, and 5′aaccaatgccctcggcagct. The seed sequences were carefully chosen to minimize potential risk of off-target effect. Specifically, these guides lack any potential off-target with off-target score over 1.5 (http://www.benchling.com) across the whole mouse genome. The donor plasmid consists of IRES-eGFP flanked by 1.0 kb and 0.8 kb homology arms on the 5′ and 3′ sides, respectively. Founders were identified by genomic PCR with the forward and reverse primers, 5TCCAGGCAACA′GTTCTACAG and 5′TGCACATCAGATTGTCTAAGG, both external to the homology arms. Germline transmission of the targeted allele was achieved by crossing the founders with wild-type C57BL/6J mice.

Pharmacokinetic study and VEGFC ELISA

Request a detailed protocol

Animals were bled via tail snip immediately prior to subcutaneous injection of 0.1 μg/g or 0.3 μg/g human VEGF-C (Cys156Ser) protein dissolved in phosphate buffered saline containing 0.1% BSA. Blood was sampled in EDTA from the animals at 1, 2, 4, 6, and 24 hr after injection via tail snip bleeding. Plasma VEGFC concentration was measured using the human VEGFC Quantikine ELISA kit (DVEC00, R and D systems) or V-PLEX Human VEGFC kit (K151LTD-1, MSD).

Telemetry study

Request a detailed protocol

Telemeters (PA-C10 or HD-X10 from Data Sciences International) were implanted in the animals by cannulating the carotid artery. A small skin incision was made midline over the ventral surface of the neck. The carotid artery was exposed and isolated using blunt dissection. Three lengths of non-absorbable suture were passed underneath the isolated vessel section (proximal occlusion, artery ligature, and distal occlusion). Tension was applied to the proximal and distal sutures to occlude blood flow and elevate the vessel. A small incision was made in the vessel wall with a 25-gauge needle bevel; the catheter was inserted, and tension was released on the proximal occlusion suture. The catheter was advanced beyond the middle and proximal suture approximately 8.0 mm. The middle and proximal sutures were tied around the vessel and catheter. The skin was closed in an interrupted pattern using 6–0 absorbable monofilament suture. Carprofen in the form of MediGel CPF (Clear H20) was provided to the animals 2 days prior to surgery and 2 days following surgery, and Buprenorphine was administered post-operatively, and then as needed. The animals recovered for 2 weeks following surgery and telemetry signals were evaluated for acceptable signals. Animals with functional telemeters and stable telemetry signals were used for the following minipump implantation and continuous telemetry recordings. Mean blood pressure, systolic blood pressure, diastolic blood pressure, and heart rate were recorded from the animals at 1 min intervals for 5 weeks. The data for individual day reflect the averaged value over a 24-hr reading period and the weekly data reflect the averaged values over a 3-day reading period. Except necessary post-op care and husbandry needs, any other potential disturbances were minimized. Time-course telemetry recordings were analyzed using a linear mixed model, in which animals are treated as random effects, while time point (i.e. week) and group are treated as fixed effects. Tukey’s multiple comparison adjustment was performed for pairwise comparisons in the linear mixed model when the group had a statistically significant impact on the endpoint.


Request a detailed protocol

Echocardiography was performed in mice under 0.5–1% isoflurane anesthesia using the Vevo 2100 or Vevo 3100 Imaging System (VisualSonics Inc, Toronto, Canada). B-mode images from long axis and M-mode images from short axis were obtained by one trained individual (T.S. or X.C.), and data were analyzed blindly by another trained individual (L.S.) using Vevo Lab. Pulse wave velocity doppler was conducted using a doppler flow velocity system (Indus Instruments). Simultaneous doppler velocity spectrograms were obtained from the aortic arch and the abdominal aorta using two probes, and the recordings were analyzed blindly by L.S. following manufacturer’s technical notes. Pulse wave velocity was calculated by dividing the distance between the probes over the time measurement.

Tissue sampling

Request a detailed protocol

Animals were subjected to isoflurane anesthesia, and tissues (heart, lung, chest skin, and kidney) and blood were collected from the animals. Hearts and lungs were weighed, and hearts, chest skins, and kidneys were snap-frozen in liquid nitrogen and stored in −80°C. The tibia was isolated from the animals, and its length was measured with a caliper. Hemoglobin level and hematocrit percentage were measured using an AimStrip Hb Hemoglobin test system (Germaine Laboratories) using whole blood in EDTA. The blood was next centrifuged, and plasma was isolated and stored at −80°C until being used for plasma VEGFC concentration measurements. For histology, animals were perfused transcardially with PBS containing heparin (20 U/ml), vasodilators (adenosine 1 g/L and papaverine 4 mg/L) and 25 mM potassium chloride (to arrest the heart in diastole) followed by 10% neutral-buffered formalin perfusion. The heart, ear, diaphragm, and kidney were next collected and immersed in 10% neutral-buffered formalin at 4°C for 24–48 hr.


Request a detailed protocol

Wet heart weights were measured immediately after euthanasia, and hearts were dried in a 37°C incubator for 5 days. Dry weights were measured after desiccation. The wet-to-dry weight ratio was calculated by dividing the wet weight over the dry weight for each animal.

Gene and protein expression analysis

Request a detailed protocol

Snap-frozen tissues were smashed, mixed and distributed into small portions for RNA and protein isolation. RNA was isolated from the tissues using Trizol reagent (Thermofisher) and RNeasy mini kits (Qiagen). The RNA was either directly used for qPCR with TaqMan RNA to Ct 1-step kit (ThermoFisher) or cDNA was synthesized from the RNA using high capacity cDNA reverse transcription kit (ThermoFisher) and used for qPCR. qPCR was conducted using TaqMan probes (Nppb, Mm01255770_g1; Pdpn, Mm01348912_g1; Lyve1, Mm00475056_m1; Flt4, Mm01292604_m1; Vegfc, Mm00437310_m1; Col1a1, Mm00801666; Col1a2, Mm00483888; Col3a1, Mm00802300_m1; Fn1, Mm01256744; Cd68, Mm03047343_m1; Cxcl10, Mm00445235_m1; Ptprc, Mm01293577_m1; Itgax, Mm00498701_m1; Itgam, Mm00434455_m1; Il1b, Mm00434228_m1; Il6, Mm00446190_m1; Ccl6, Mm01302419_m1; Ccl4, Mm00443111_m1; Ccl3, Mm00441259_g1; Ace2, Mm01159006_m1; Hprt, Mm03024075_m1), TaqMan gene expression master mix (ThermoFisher) and QuantStudio 7 Flex Real-Time PCR System. The expression of every gene was normalized to the expression of housekeeping gene Hprt and then normalized to control group to be presented as fold change in the corresponding figures.

Podoplanin antibody (AF3244, R and D systems, 1:500), Akt antibody (#9272, cell signaling, 1:1000), p-Akt (Ser473) antibody (#9271, cell signaling, 1:1000), p44/42 MAPK (Erk 1/2) antibody (#9102, cell signaling, 1:2000), phsopho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) antibody (#4370, cell signaling, 1:2000), and GAPDH antibody (#5174, cell signaling, 1:5000) were used for western blots. For western blots, tissues were lysed using cell lysis buffer (cell signaling) containing Halt protease and phosphatase inhibitor cocktail and EDTA. Protein concentrations were measured using Pierce BCA protein assay kit and samples were denatured using NuPAGE LDS sample buffer and reducing agent at 95°C for 5 min. A total of 20–40 μg of proteins were loaded to each well of NuPAGE 4–12% Bis-Tris Midi gels and ran in MOPS buffer with Xcell4 Surelock midi gel electrophoresis system. The gels were transferred to PVDF membranes using an iblot2 gel transfer device and blocked with 5% milk (cell signaling) for 1 hr under room temperature followed by primary antibody incubation at 4°C overnight. The next day, membranes were washed and incubated with corresponding HRP-conjugated secondary antibody for 1 hr under room temperature. Then the membranes were washed, developed using SuperSignal west Femto maximal sensitivity substrate and imaged with Amersham Imager 600 (GE Healthcare). All reagents were from ThermoFisher unless otherwise stated. Densitometric quantification was conducted using Image J.

Histology and immunohistochemistry

Request a detailed protocol

Formalin fixed hearts, ears, and kidneys were dehydrated and used for either OCT embedding or paraffin embedding. One paraffin—embedded cross-section (5 μm thickness) through the hilus of the kidney from each animal was stained with H and E using an automatic slide stainer (Leica) and microscopic evaluation was performed by a veterinary pathologist. Cryo-sections (10 μm thickness) through the hilus of the kidney were generated for immunohistochemistry. Cryo-section (10 μm thickness) of OCT embedded hearts at different depths spanning the whole ventricle were generated for immunohistochemistry. Cryo-section (10 μm thickness) of OCT embedded ears at different depths spanning the whole ear were generated for immunohistochemistry. Picrosirius red (PSR) stain were conducted using mouse heart or kidney frozen sections following an optimized protocol using Bouin’s solution (FXBOULT, American Mastertech), 1% phosphomolybdic acid (26693–08, EMS), 0.1% picrosirius red solution (F-357–2, Rowley Biochemical) and 1% acetic acid (100–1, Ricca). Lyve1 (abcam, ab14917, 1:500), podoplanin (abcam, ab11936, 1:250), CD68 (ThermoFisher, MA5-16674, 1:300), smooth muscle actin (abcam, ab7817,1:100) and GFP (abcam, ab13970, 1:100) immunostaining was performed in 3% goat serum (ThermoFisher) and 2% BSA in 0.3% Triton-X (ThermoFisher) at 4°C overnight, followed by fluorescent secondary antibodies (Invitrogen). Autofluorescence were quenched using trueview autofluorescence quenching kit and sections were mounted in VECTASHIELD Vibrance Antifade Mounting Medium with DAPI (vector laboratories). For the whole mount stain of diaphragm, the whole diaphragm of Prox1-eGFP mice was used for staining following the immunostaining protocol for cryo-sections without the autofluorescence quenching step. For the whole mount stain of ear skins, the ear skins were isolated and cleaned, and stained for Lyve1 following the immunostaining protocol for cryo-sections without the autofluorescence quenching step. The whole-mount-stained samples were imaged using a confocal microscope (ZEISS) with 20x objective. WGA stain was conducted using Alexa 594-conjugated WGA (W11262, ThermoFisher) following manufacturer’s protocol with one modification that sections were incubated with WGA overnight at 4°C instead of 10 mins under room temperature. The WGA-stained sections were washed after WGA incubation and mounted with Prolong Gold mounting medium with DAPI (P36935, Thermofisher). Stained slides were scanned using a ZEISS Axio Scan Slide Scanner with 20x objective and whole section images were analyzed using Visiopharm and custom-designed apps. For the quantification of CD68-positive macrophages, three to six sections spanning the ventricle were used, and macrophages were defined as CD68 and DAPI double-positive cells. Macrophage density was calculated by dividing the count of macrophages to the total area for each section. The density of macrophages near arteries was defined as the total count of macrophages within 20 μm distance from any smooth muscle actin-positive artery normalized to the total area for each section. The data for macrophage density was normalized to the average value of ctrl group and represented as fold change. For the quantification of podoplanin-positive lymphatic vessel density and area, 6 to 12 sections spanning the ventricle were used. A size filter of 500 μm2 was used to define the vessels and reduce the noise from podoplanin-positive cells. The count of podoplanin-positive lymphatic vessels was normalized to the total area for each section and defined as the density of podoplanin-positive lymphatic vessels. The average lumen area was calculated by dividing the lumen area of the podoplanin-positive lymphatic vessels by the density of podoplanin-positive lymphatic vessels in each section. A linear mixed model with animals treated as random effects and group and sections treated as fixed effects was used for the statistical analysis for the quantification of podoplanin-positive lymphatic vessel density and lumen area. Tukey’s multiple comparison adjustment was used for pairwise comparisons in the linear mixed model. The data for podoplanin-positive lymphatic vessel density was normalized to the average value of ctrl group and represented as fold change. The analysis for the quantification of cardiomyocyte size and variance coefficient was conducted following previously published methods and SOPs for muscle fiber size and size variability quantification (Briguet et al., 2004; Pertl et al., 2013). The variance coefficient is defined as the ratio of the standard deviation of cardiomyocyte size to the mean value of cardiomyocyte size and represents the variability of cell size among the quantified population. A linear mixed model with defined regions of interest (ROIs) treated as random effects and group treated as fixed effects was used for the statistical analysis for variance coefficient and Tukey’s multiple comparison adjustment was used for pairwise comparisons in the model. For the quantification of lyve1-positive lymphatic vessel density in kidney and ear skin, the lyve1-positive lymphatic vessel count was normalized to the total area for each section. A linear mixed model with defined regions of interest (ROI) treated as random effects and group treated as fixed effects was used for the statistical analysis of lyve1-positive lymphatic vessel density. Tukey’s multiple comparison adjustment was used for pairwise comparisons in the linear mixed model. For the quantification of PSR stains, three sections spanning the ventricle were used for staining and the images were analyzed using visiopharm. The total PSR-positive area and perivascular PSR-positive area were normalized to total area of the section. For the quantification of lyve1-positive lymphatic vessel diameter in ear skin, the analysis was conducted blindly by L.S. using Image J. Visiopharm-based image analyses were conducted blindly by J.P. All the representative images were taken using a confocal microscope (ZEISS) with 20x or 40x objective.


Request a detailed protocol

Lymphangiography was performed in anesthetized mice 5–6 weeks after minipump implantation following a previously reported method with modifications (Henri et al., 2016). The animal first received a dose of FITC-Dextran (30 mg/ml, FD500S, MW: 500 kDa, Sigma-Aldrich) mixed with alexa Fluor 555 Cadaverine (6 μg/g, A30677, ThermoFisher) and heparin (20 U/ml) via retro-orbital (R.O.) injection under isoflurane. Next, the mouse was further anesthetized and placed under a surgical plane of anesthesia using isoflurane with intubation through tracheotomy. Ten μl fluorescent quantum dots (Q21021MP, ThermoFisher) were injected intramyocardially into the apex of the heart using a Hamilton neuros micro-injection syringe (Hamilton 6546006). Five min after injection, blood was sampled from the animal in EDTA, and the heart was extracted from the animal, arrested in diastole with saturated potassium chloride and fixed with formalin for imaging. The plasma qdot signal (emission at 655) in 50 μl plasma was measured using a fluorescent plate reader. Whole heart was imaged using a LSM 880 Confocal microscope (ZEISS) with a 1x objective, and HDR imaging was used to enhance image contrast. The same intensity and imaging settings were used for acquiring the cadaverine images for all the animals. The results in Figure 3 were acquired from two rounds of independent in vivo studies. The cadaverine-positive areas were quantified from at least four images taken from four different sides of each heart and normalized to the total area of the heart using image J. The values were normalized to the average value of the control group for presentation in Figure 3B. The qdot plasma concentrations of each group were normalized to the average qdot plasma concentration of the control group for each round of studies and then combined for illustration in Figure 3C.

Cell isolation using Prox1-eGFP mice and low input RNA-seq

Request a detailed protocol

Prox1-eGFP mice were used for cell isolation at 5–6 weeks after minipump implantation for preparing RNA-seq samples and wildtype non-carrier mice were used at similar age for preparing single stain controls. The animals were euthanized using carbon dioxide, and heart and diaphragm were isolated from the animals and transferred into a storage solution containing 2.5% BSA (A7030, Sigma-Aldrich) in HBSS (14025092, Thermo Fisher). The tissues were then cut into tiny pieces and digested with a digestion enzyme mixture with Collegenase A (11088793001, Roche), Collegenase from Clostridium histolyticum (C7657, Sigma-Aldrich), Dnase I (DN25, Sigma-Aldrich), Hydraluronidase (HX0514-1, Sigma-Aldrich) and 2.5% BSA in HBSS for 45 min in 37°C waterbath with shaking. The tissue pieces were next broken up further with pipetting and the enzymes were neutralized with DMEM/F12 medium (10565042, Thermo Fisher) containing 10% FBS (26140087, Thermo Fisher). The solutions with digested tissues were centrifuged at 400 g for 3 min, and cardiomyocytes were pelleted from digested heart tissues. The cardiomyocytes were next washed with PBS once and lysed for RNA with RLT cell lysis buffer. The supernatant of each solution was isolated and filtered through 40-µm cell strainer. The solutions were then centrifuged at 1500 g for 5 min to pellet the cells and the cells were resuspended in red blood cell lysis buffer (11814389001, Roche) to lyse red blood cells. Next, the cells were pelleted and washed with FACS buffer (1% BSA in PBS) twice and cell density was counted. 0.2 million cells were aliquoted either from wild-type animal tissues or Prox1-eGFP tissues for single stain controls. Mouse Fc block (553142, BD) were added to each tube to inhibit non-specific binding and the samples were stained for CD45.2 (560696, BD, 1:100), or/and CD31 (561814, BD, 1:100) for 30 min on ice in the dark. The cells were then washed with FACS buffer twice and resuspended in sort buffer (10 mM HEPES (15630080, Thermo Fisher), 2 mM EDTA (AM9912, Thermo Fisher) and 0.5% BSA in PBS) at 20 million/ml for live cell sorting. DAPI (D1306, Thermo Fisher, 1:5000) was added to the cells before sorting to stain the dead cells and the cells were sorted using SONY SH800 cell sorter with 100 µm chip. Blood endothelial cells were defined as DAPI negative, CD45.2 negative, CD31 positive, and eGFP negative cells and lymphatic endothelial cells were defined as DAPI negative, CD45.2 negative, CD31 positive, and eGFP positive cells. The cells were sorted into RLT lysis buffer at 4°C, and total RNA was extracted from each isolated cell population using the RNeasy MinElute cleanup kit (74204, Qiagen) following manufacturer’s protocol. Extracted total RNA was stored at −80°C freezer until the library preparation step. For low-input RNA-seq, total RNA concentration for each sample was measured using high sensitivity plates on a Lunatic nanodrop instrument (Unchained Labs) before proceeding to library prep. Of total RNA, 2 ng were aliquoted from each sample from which mRNA was isolated and converted into cDNA using the Smart-Seq ultra low input RNA kit (634890, Takara) following manufacturer’s protocol. The libraries were next prepared from converted cDNA using Nextera DNA XT Library Prep Kit (FC-131–1096, Illumina) following manufacturer’s protocol. Library concentrations were quantified using Qubit 1X dsDNA HS Assay kit (Q33231, Thermo Fisher) and the quality of the libraries was examined using Agilent High Sensitivity D1000 Screentape System (5067–5584 and 5067–5585, Agilent) on an Agilent 4200 Tapestation. The libraries from cardiomyocytes were pooled together and sequenced using NextSeq 500/550 High Output Kit (20024907, Illumina). The libraries from endothelial cells were randomized, divided into two sets and pooled together for two rounds of sequencing using NextSeq 500/550 High Output Kits (20024907, Illumina).

RNA-seq analysis

Request a detailed protocol

Sequencing reads were de-multiplexed using the picard tool bcl2fastq, and quality control was performed on the fastq files using FastQC. The reads were then aligned to the mouse reference genome (GRCm38) using the STAR aligner (v.2.5.3a) with quantMode specified for Transcriptome SAM, out SAM type specified as BAM, out Filter Mismatch Nover Lmax as 0.05, align SJDBoverhang Min as 1, out Filter Score Min Over Lread as 0.9, out Filter Match Nmin Over Lread as 0.9, and align Intron Max as 1000000. Gene counts for each sample were generated from the BAM alignment files using Salmon (v.0.12.0) in alignment-aware mode, based on gene/isoform features annotated by Ensembl release 95. Using the log2 normalized gene counts, we performed principal components analysis across samples within each of the four different cell types to identify outlier samples and removed samples that were greater than three standard deviations from the mean value of the first two principal components. For differential expression analysis, all downstream differential expression analysis and functional enrichment analyses were performed in R (v.3.5.3). We performed differential expression analysis within each of the four different cell types among treatment groups using DESeq2, adjusting for age of the animals, and sequencing run batch for the endothelial cell experiments, as well as surrogate technical variables detected using sva analysis. We additionally performed differential expression analysis across all three endothelial cell groups to identify potential interactions with treatment using the limma-voom framework. To identify pathways and sets of genes enriched in our significantly differentially expressed results, we performed functional enrichment analysis using the topGO enrichment analysis with the weight01 method. Finally, in order to identify potential upstream regulators of the observed expression changes from our results, we performed causal reasoning analysis based on a previously reported approach (Chindelevitch et al., 2012). In order to generate the network to identify the upstream regulators, we used proprietary network data compiled from several different sources, but including information on proteins, mRNAs, compounds, and biological processes.

Plasma and skin chemokine measurement

Request a detailed protocol

Chemokine levels in plasma and native skin lysates were examined using MSD U-plex chemokine combo 1 (Ms) kit (K15321K-1, MSD) following manufacturer’s protocol. 20 μg of native skin lysate was loaded to each well. The data was analyzed using MSD discovery workbench software (v4.0).

Urine collection and biochemistry

Request a detailed protocol

Animals were transferred into metabolic cages for urine collection for 24 hr and returned to regular cages after collection. Non-esterified fatty acid and creatinine in urine were measured by Siemens clinical analyzer (ADVIA Chemistry XPT system). Albumin was measured using BCP albumin assay kit (Sigma-Aldrich). Total protein amount was measured using Pierce BCA protein assay kit (ThermoFisher).

Gene expression analysis of human hearts

Request a detailed protocol

Human heart tissues were commercially purchased and three commercially available healthy human heart RNA samples (from Ambion, Takara and Origene) were also purchased and used for the analysis. RNA was extracted from human tissues using Qiazol reagent and RNeasy plus universal kit (Qiagen), and cDNA was synthesized using high-capacity cDNA reverse transcription kit (ThermoFisher). qPCR was conducted using TaqMan probes (LYVE1, Hs00272659_m1; PDPN, Hs00366766_m1; FLT4, Hs01047677_m1; VEGFC, Hs01099203_m1; HPRT1, Hs02800695_m1), TaqMan gene expression master mix (ThermoFisher) and QuantStudio 7 Flex Real-Time PCR System. The expression of every gene was normalized to the expression of housekeeping gene HPRT1 and then normalized to the healthy heart group to be presented as fold change in the corresponding figures.

GWAS result evaluation

Request a detailed protocol

GWAS summary statistics were aggregated from publicly available resources, including the GWAS catalog (https://www.ebi.ac.uk/gwas/). Locus-wide variant lookups for associations to cardiometabolic-related traits were performed for genes involved in lymphatic-related pathways, including VEGFC, LYVE1 and FLT4. Methods for each GWAS analyses can be found at each reference.


The statistical analysis used for every figure has been illustrated in the corresponding figure legends. Independent two-tailed Student’s t-tests and one-way ANOVA with Bonferroni-adjusted posthoc test for multiple pairwise comparisons were performed using Graphpad Prism 7/8 software. F tests were conducted for comparing variances for the Student’s t-tests, and Welch’s correction was used for the Student’s t-test when the F test result was significant. Statistical analysis using a linear mixed model and the statistical analysis for log-transformed data were conducted using R statistical software (version 3.6.1). All the fitted models meet the model assumptions. All the samples used in the study were biological repeats, not technical repeats. No samples were excluded from the analysis unless it was determined to be a significant outlier by the Grubbs’ test.

Appendix 1

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Mice, maleC67/BL6NCharles River laboratoriesCatalog: #027
Mice, maleProx1-eGFP KIThis papereGFP gene was inserted at the end of endogenous Prox1 gene to generate this indicator line. The sperms of the animals are cryopreserved in Charles River Laboratories.
Peptide, recombinant proteinBovine serum albuminSigma-AldrichA7030
Peptide, recombinant proteinhuman angiotensin IISigma-AldrichA9525
Peptide, recombinant proteinrecombinant human VEGF-C (Cys156Ser) protein VEGFCR and D systems752-VC
OtherminipumpAlzetAlzet 1002 or Alzet 2006
Sequence-based reagentProx1-eGFP genotyping forward primerThis paperPCR primerThe primer sequence is 5’TCCAGGCAACAGTTCTACAG. It can be ordered from Integrated DNA Technologies using the sequence.
Sequenced-based reagentProx1-eGFP genotyping reverse primerThis paperPCR primerThe primer sequence is 5’TGCACATCAGATTGTCTAAGG. It can be ordered from Integrated DNA Technologies using the sequence.
Commercial assay or kithuman VEGFC Quantikine ELISA kitR and D systemsDVEC00
Commercial assay or kitV-PLEX Human VEGFC kitMSDK151LTD-1
OtherTelemetersData Sciences InternationalPA-C10 or HD-X10
OtherVevo2100 or Vevo3100VisualSonics Inc
Otherdoppler flow velocity systemIndus Instruments
OtherAimStrip Hb Hemoglobin test systemGermaine Laboratories
OtherTrizol reagentThermoFisher15596026
Commercial assay or kitRNeasy mini kitsQiagen74104
Commercial assay or kitTaqMan RNA to Ct 1-step kitThermofisher4392938
Commercial assay or kithigh capacity cDNA reverse transcription kitThermofisher4368814
OtherTaqMan gene expression master mixThermofisher4369016
OtherTapman probes for mouseThermofisherNppb, Mm01255770_g1; Pdpn, Mm01348912_g1; Lyve1, Mm00475056_m1; Flt4, Mm01292604_m1; Vegfc, Mm00437310_m1; Col1a1, Mm00801666; Col1a2, Mm00483888; Col3a1, Mm00802300_m1; Fn1, Mm01256744; Cd68, Mm03047343_m1; Cxcl10, Mm00445235_m1; Ptprc, Mm01293577_m1; Itgax, Mm00498701_m1; Itgam, Mm00434455_m1; Il1b, Mm00434228_m1; Il6, Mm00446190_m1; Ccl6, Mm01302419_m1; Ccl4, Mm00443111_m1; Ccl3, Mm00441259_g1; Ace2, Mm01159006_m1; Hprt, Mm03024075_m1
OtherQuantStudio 7 Flex Real-Time PCR SystemThermoFisher
AntibodyAnti-mouse Podoplanin antibody
(Goat polyclonal)
R and D systemsAF32441:500 dilution for Western blot
Antibodyanti-Akt antibody
(Rabbit polyclonal)
Cell signaling#92721:1000 dilution for Western blot
Antibodyanti- p-Akt (Ser473) antibody
(Rabbit polyclonal)
Cell signaling#92711:1000 dilution for Western blot
Antibodyp44/42 MAPK (Erk 1/2) antibody
(Rabbit polyclonal)
Cell signaling#91021:2000 dilution for Western blot
Antibodyphsopho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) antibody (Rabbit monoclonal)Cell signaling#43701:2000 dilution for Western blot
AntibodyGAPDH antibody (Rabbit monoclonal)Cell signaling#51741:5000 dilution for Western blot
AntibodyLyve1 antibody (Rabbit polyclonal)Abcamab149171:500 dilution for IF
Antibodypodoplanin antibody (Hamster monoclonal)Abcamab119361:250 dilution for IF
AntibodyCD68 antibody (Rat monoclonal)ThermoFisherMA5-166741:300 dilution for IF
Antibodysmooth muscle actin antibody (Mouse monoclonal)Abcamab78171:100 dilution for IF
AntibodyGFP antibody (Chicken polyclonal)Abcamab139701:100 dilution for IF
Commercial assay or kittrueview autofluorescence quenching kitVector laboratoriesSP-8400–15
OtherAlexa 594-conjugated WGAThermoFisherW112621:200 dilution for IF
Software, algorithmPathology image analysis software VisiopharmVisiopharm
Otheralexa Fluor 555 CadaverineThermoFisherA30677
OtherQdot 655ThermoFisherQ21021MP
OtherHamilton neuros micro-injection syringeHamilton6546006
AntibodyPE-Cy7 Mouse Anti-Mouse CD45.2 antibody
(Mouse monoclonal)
BD Pharmingen5606961:100 dilution for FACS
AntibodyAPC Rat Anti-Mouse CD31
Clone MEC 13.3 (RUO) antibody
(Rat monoclonal)
BD Pharmingen5618141:100 dilution for FACS
OtherDAPIThermo FisherD13061:5000 dilution for FACS
Commercial assay or kitRNeasy MinElute cleanup kitQiagen74204
Commercial assay or kitSmart-Seq ultra low input RNA kitTakara634890
Commercial assay or kitNextera DNA XT Library Prep KitIlluminaFC-131–1096
Commercial assay or kitNextSeq 500/550 High Output KitIllumina20024907
Software, algorithmRR-projectv.3.5.3 and v.3.6.1
Commercial assay or kitU-plex chemokine combo 1 (Ms) kitMSDK15321K-1
OtherSiemens clinical analyzerADVIA Chemistry XPT system
Commercial assay or kitBCP albumin assay kitSigma-AldrichMAK125-1KT
OtherTaqman probes for humanThermo FisherLYVE1, Hs00272659_m1; PDPN, Hs00366766_m1; FLT4, Hs01047677_m1; VEGFC, Hs01099203_m1; HPRT1, Hs02800695_m1
Software, algorithmGraphpad PrismGraphpad


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
    Immunohistochemical study of remodeling of myocardial lymphatic and blood microvascular structures in terminal heart failure: differences between ischemic and dilated cardiomyopathy
    1. A Dashkevich
    2. W Bloch
    3. A Antonyan
    4. H Goebel
    5. JU Fries
    6. C Schlensak
    7. F Beyersdorf
    8. HJ Geissler
    Lymphology 43:110–117.
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
    Protein-coding variants implicate novel genes related to lipid homeostasis contributing to body-fat distribution
    1. AE justice
    2. T Karaderi
    3. HM Highland
    4. KL Young
    5. M Graff
    6. Y Lu
    7. V Turcot
    8. PL Auer
    9. RS Fine
    10. X Guo
    11. C Schurmann
    12. A Lempradl
    13. E Marouli
    14. A Mahajan
    15. TW Winkler
    16. AE Locke
    17. C Medina-Gomez
    18. T Esko
    19. S Vedantam
    20. A Giri
    21. KS Lo
    22. T Alfred
    23. P Mudgal
    24. MCY Ng
    25. NL Heard-Costa
    26. MF Feitosa
    27. AK Manning
    28. SM Willems
    29. S Sivapalaratnam
    30. G Abecasis
    31. DS Alam
    32. M Allison
    33. P Amouyel
    34. Z Arzumanyan
    35. B Balkau
    36. L Bastarache
    37. S Bergmann
    38. LF Bielak
    39. M Blüher
    40. M Boehnke
    41. H Boeing
    42. E Boerwinkle
    43. CA Böger
    44. J Bork-Jensen
    45. EP Bottinger
    46. DW Bowden
    47. I Brandslund
    48. L Broer
    49. AA Burt
    50. AS Butterworth
    51. MJ Caulfield
    52. G Cesana
    53. JC Chambers
    54. DI Chasman
    55. YI Chen
    56. R Chowdhury
    57. C Christensen
    58. AY Chu
    59. FS Collins
    60. JP Cook
    61. AJ Cox
    62. DS Crosslin
    63. J Danesh
    64. PIW de Bakker
    65. S Denus
    66. R Mutsert
    67. G Dedoussis
    68. EW Demerath
    69. JG Dennis
    70. JC Denny
    71. E Di Angelantonio
    72. M Dörr
    73. F Drenos
    74. MP Dubé
    75. AM Dunning
    76. DF Easton
    77. P Elliott
    78. E Evangelou
    79. AE Farmaki
    80. S Feng
    81. E Ferrannini
    82. J Ferrieres
    83. JC Florez
    84. M Fornage
    85. CS Fox
    86. PW Franks
    87. N Friedrich
    88. W Gan
    89. I Gandin
    90. P Gasparini
    91. V Giedraitis
    92. G Girotto
    93. M Gorski
    94. H Grallert
    95. N Grarup
    96. ML Grove
    97. S Gustafsson
    98. J Haessler
    99. T Hansen
    100. AT Hattersley
    101. C Hayward
    102. IM Heid
    103. OL Holmen
    104. GK Hovingh
    105. JMM Howson
    106. Y Hu
    107. YJ Hung
    108. K Hveem
    109. MA Ikram
    110. E Ingelsson
    111. AU Jackson
    112. GP Jarvik
    113. Y Jia
    114. T Jørgensen
    115. P Jousilahti
    116. JM Justesen
    117. B Kahali
    118. M Karaleftheri
    119. SLR Kardia
    120. F Karpe
    121. F Kee
    122. H Kitajima
    123. P Komulainen
    124. JS Kooner
    125. P Kovacs
    126. BK Krämer
    127. K Kuulasmaa
    128. J Kuusisto
    129. M Laakso
    130. TA Lakka
    131. D Lamparter
    132. LA Lange
    133. C Langenberg
    134. EB Larson
    135. NR Lee
    136. WJ Lee
    137. T Lehtimäki
    138. CE Lewis
    139. H Li
    140. J Li
    141. R Li-Gao
    142. LA Lin
    143. X Lin
    144. L Lind
    145. J Lindström
    146. A Linneberg
    147. CT Liu
    148. DJ Liu
    149. J Luan
    150. LP Lyytikäinen
    151. S MacGregor
    152. R Mägi
    153. S Männistö
    154. G Marenne
    155. J Marten
    156. NGD Masca
    157. MI McCarthy
    158. K Meidtner
    159. E Mihailov
    160. L Moilanen
    161. M Moitry
    162. DO Mook-Kanamori
    163. A Morgan
    164. AP Morris
    165. M Müller-Nurasyid
    166. PB Munroe
    167. N Narisu
    168. CP Nelson
    169. M Neville
    170. I Ntalla
    171. JR O'Connell
    172. KR Owen
    173. O Pedersen
    174. GM Peloso
    175. CE Pennell
    176. M Perola
    177. JA Perry
    178. JRB Perry
    179. TH Pers
    180. A Ewing
    181. O Polasek
    182. OT Raitakari
    183. A Rasheed
    184. CK Raulerson
    185. R Rauramaa
    186. DF Reilly
    187. AP Reiner
    188. PM Ridker
    189. MA Rivas
    190. NR Robertson
    191. A Robino
    192. I Rudan
    193. KS Ruth
    194. D Saleheen
    195. V Salomaa
    196. NJ Samani
    197. PJ Schreiner
    198. MB Schulze
    199. RA Scott
    200. M Segura-Lepe
    201. X Sim
    202. AJ Slater
    203. KS Small
    204. BH Smith
    205. JA Smith
    206. L Southam
    207. TD Spector
    208. EK Speliotes
    209. K Stefansson
    210. V Steinthorsdottir
    211. KE Stirrups
    212. K Strauch
    213. HM Stringham
    214. M Stumvoll
    215. L Sun
    216. P Surendran
    217. KMA Swart
    218. JC Tardif
    219. KD Taylor
    220. A Teumer
    221. DJ Thompson
    222. G Thorleifsson
    223. U Thorsteinsdottir
    224. BH Thuesen
    225. A Tönjes
    226. M Torres
    227. E Tsafantakis
    228. J Tuomilehto
    229. AG Uitterlinden
    230. M Uusitupa
    231. CM van Duijn
    232. M Vanhala
    233. R Varma
    234. SH Vermeulen
    235. H Vestergaard
    236. V Vitart
    237. TF Vogt
    238. D Vuckovic
    239. LE Wagenknecht
    240. M Walker
    241. L Wallentin
    242. F Wang
    243. CA Wang
    244. S Wang
    245. NJ Wareham
    246. HR Warren
    247. DM Waterworth
    248. J Wessel
    249. HD White
    250. CJ Willer
    251. JG Wilson
    252. AR Wood
    253. Y Wu
    254. H Yaghootkar
    255. J Yao
    256. LM Yerges-Armstrong
    257. R Young
    258. E Zeggini
    259. X Zhan
    260. W Zhang
    261. JH Zhao
    262. W Zhao
    263. H Zheng
    264. W Zhou
    265. MC Zillikens
    266. F Rivadeneira
    267. IB Borecki
    268. JA Pospisilik
    269. P Deloukas
    270. TM Frayling
    271. G Lettre
    272. KL Mohlke
    273. JI Rotter
    274. Z Kutalik
    275. JN Hirschhorn
    276. LA Cupples
    277. RJF Loos
    278. KE North
    279. CM Lindgren
    280. CHD Exome+ Consortium
    281. Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) Consortium
    282. EPIC-CVD Consortium
    283. ExomeBP Consortium
    284. Global Lipids Genetic Consortium
    285. GoT2D Genes Consortium
    286. InterAct
    287. ReproGen Consortium
    288. T2D-Genes Consortium
    289. MAGIC Investigators
    Nature Genetics 51:452–469.
  31. 31
  32. 32
  33. 33
  34. 34
    Congestive Heart Failure and Pulmonary Edema
    1. KC King
    2. S Goldstein
    Treasure Island: StatPearls Publishing.
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
    Genetic variation in GIPR influences the glucose and insulin responses to an oral glucose challenge
    1. R Saxena
    2. MF Hivert
    3. C Langenberg
    4. T Tanaka
    5. JS Pankow
    6. P Vollenweider
    7. V Lyssenko
    8. N Bouatia-Naji
    9. J Dupuis
    10. AU Jackson
    11. WH Kao
    12. M Li
    13. NL Glazer
    14. AK Manning
    15. J Luan
    16. HM Stringham
    17. I Prokopenko
    18. T Johnson
    19. N Grarup
    20. TW Boesgaard
    21. C Lecoeur
    22. P Shrader
    23. J O'Connell
    24. E Ingelsson
    25. DJ Couper
    26. K Rice
    27. K Song
    28. CH Andreasen
    29. C Dina
    30. A Köttgen
    31. O Le Bacquer
    32. F Pattou
    33. J Taneera
    34. V Steinthorsdottir
    35. D Rybin
    36. K Ardlie
    37. M Sampson
    38. L Qi
    39. M van Hoek
    40. MN Weedon
    41. YS Aulchenko
    42. BF Voight
    43. H Grallert
    44. B Balkau
    45. RN Bergman
    46. SJ Bielinski
    47. A Bonnefond
    48. LL Bonnycastle
    49. K Borch-Johnsen
    50. Y Böttcher
    51. E Brunner
    52. TA Buchanan
    53. SJ Bumpstead
    54. C Cavalcanti-Proença
    55. G Charpentier
    56. YD Chen
    57. PS Chines
    58. FS Collins
    59. M Cornelis
    60. G J Crawford
    61. J Delplanque
    62. A Doney
    63. JM Egan
    64. MR Erdos
    65. M Firmann
    66. NG Forouhi
    67. CS Fox
    68. MO Goodarzi
    69. J Graessler
    70. A Hingorani
    71. B Isomaa
    72. T Jørgensen
    73. M Kivimaki
    74. P Kovacs
    75. K Krohn
    76. M Kumari
    77. T Lauritzen
    78. C Lévy-Marchal
    79. V Mayor
    80. JB McAteer
    81. D Meyre
    82. BD Mitchell
    83. KL Mohlke
    84. MA Morken
    85. N Narisu
    86. CN Palmer
    87. R Pakyz
    88. L Pascoe
    89. F Payne
    90. D Pearson
    91. W Rathmann
    92. A Sandbaek
    93. AA Sayer
    94. LJ Scott
    95. SJ Sharp
    96. E Sijbrands
    97. A Singleton
    98. DS Siscovick
    99. NL Smith
    100. T Sparsø
    101. AJ Swift
    102. H Syddall
    103. G Thorleifsson
    104. A Tönjes
    105. T Tuomi
    106. J Tuomilehto
    107. TT Valle
    108. G Waeber
    109. A Walley
    110. DM Waterworth
    111. E Zeggini
    112. JH Zhao
    113. T Illig
    114. HE Wichmann
    115. JF Wilson
    116. C van Duijn
    117. FB Hu
    118. AD Morris
    119. TM Frayling
    120. AT Hattersley
    121. U Thorsteinsdottir
    122. K Stefansson
    123. P Nilsson
    124. AC Syvänen
    125. AR Shuldiner
    126. M Walker
    127. SR Bornstein
    128. P Schwarz
    129. GH Williams
    130. DM Nathan
    131. J Kuusisto
    132. M Laakso
    133. C Cooper
    134. M Marmot
    135. L Ferrucci
    136. V Mooser
    137. M Stumvoll
    138. RJ Loos
    139. D Altshuler
    140. BM Psaty
    141. JI Rotter
    142. E Boerwinkle
    143. T Hansen
    144. O Pedersen
    145. JC Florez
    146. MI McCarthy
    147. M Boehnke
    148. I Barroso
    149. R Sladek
    150. P Froguel
    151. JB Meigs
    152. L Groop
    153. NJ Wareham
    154. RM Watanabe
    155. GIANT consortium
    156. MAGIC investigators
    Nature Genetics 42:142–148.
  49. 49
  50. 50
  51. 51
  52. 52
    Hypertensive Heart Disease
    1. G Tackling
    2. MB Borhade
    Treasure Island: StatPearls.
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
    Large-scale genome-wide analysis identifies genetic variants associated with cardiac structure and function
    1. PS Wild
    2. JF Felix
    3. A Schillert
    4. A Teumer
    5. MH Chen
    6. MJG Leening
    7. U Völker
    8. V Großmann
    9. JA Brody
    10. MR Irvin
    11. SJ Shah
    12. S Pramana
    13. W Lieb
    14. R Schmidt
    15. AV Stanton
    16. D Malzahn
    17. AV Smith
    18. J Sundström
    19. C Minelli
    20. D Ruggiero
    21. LP Lyytikäinen
    22. D Tiller
    23. JG Smith
    24. C Monnereau
    25. MR Di Tullio
    26. SK Musani
    27. AC Morrison
    28. TH Pers
    29. M Morley
    30. ME Kleber
    31. J Aragam
    32. EJ Benjamin
    33. JC Bis
    34. E Bisping
    35. U Broeckel
    36. S Cheng
    37. JW Deckers
    38. F Del Greco M
    39. F Edelmann
    40. M Fornage
    41. L Franke
    42. N Friedrich
    43. TB Harris
    44. E Hofer
    45. A Hofman
    46. J Huang
    47. AD Hughes
    48. M Kähönen
    49. K Investigators
    50. J Kruppa
    51. KJ Lackner
    52. L Lannfelt
    53. R Laskowski
    54. LJ Launer
    55. M Leosdottir
    56. H Lin
    57. CM Lindgren
    58. C Loley
    59. CA MacRae
    60. D Mascalzoni
    61. J Mayet
    62. D Medenwald
    63. AP Morris
    64. C Müller
    65. M Müller-Nurasyid
    66. S Nappo
    67. PM Nilsson
    68. S Nuding
    69. T Nutile
    70. A Peters
    71. A Pfeufer
    72. D Pietzner
    73. PP Pramstaller
    74. OT Raitakari
    75. KM Rice
    76. F Rivadeneira
    77. JI Rotter
    78. ST Ruohonen
    79. RL Sacco
    80. TE Samdarshi
    81. H Schmidt
    82. ASP Sharp
    83. DC Shields
    84. R Sorice
    85. N Sotoodehnia
    86. BH Stricker
    87. P Surendran
    88. S Thom
    89. AM Töglhofer
    90. AG Uitterlinden
    91. R Wachter
    92. H Völzke
    93. A Ziegler
    94. T Münzel
    95. W März
    96. TP Cappola
    97. JN Hirschhorn
    98. GF Mitchell
    99. NL Smith
    100. ER Fox
    101. ND Dueker
    102. VWV Jaddoe
    103. O Melander
    104. M Russ
    105. T Lehtimäki
    106. M Ciullo
    107. AA Hicks
    108. L Lind
    109. V Gudnason
    110. B Pieske
    111. AJ Barron
    112. R Zweiker
    113. H Schunkert
    114. E Ingelsson
    115. K Liu
    116. DK Arnett
    117. BM Psaty
    118. S Blankenberg
    119. MG Larson
    120. SB Felix
    121. OH Franco
    122. T Zeller
    123. RS Vasan
    124. M Dörr
    Journal of Clinical Investigation 127:1798–1812.
  63. 63

Decision letter

  1. Matthias Barton
    Senior Editor; University of Zurich, Switzerland
  2. Gou Young Koh
    Reviewing Editor; Institute of Basic Science and Korea Advanced Institute of Science and Technology (KAIST), Republic of Korea
  3. Gou Young Koh
    Reviewer; Institute of Basic Science and Korea Advanced Institute of Science and Technology (KAIST), Republic of Korea

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

The manuscript shows the importance of lymphatic vasculature in chronic cardiac dysfunction with mechanical insights. Moreover, the authors elegantly show that lymphangiogenic therapy using VEGFCc156s can alleviate pathological changes and ameliorate heart function by improving cardiac lymphatic function and mitigating inflammation and hypertension. Finally, this study provide a potential therapeutic avenue for chronic cardiac dysfunction induced by hypertension.

Decision letter after peer review:

Thank you for submitting your article "Lymphangiogenic therapy prevents cardiac dysfunction by ameliorating inflammation and hypertension" for consideration by eLife. Your article has been reviewed by two peer reviewers, including Gou Young Koh as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Matthias Barton as the Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. In the light of the comments made by the reviewers, we decided to offer a "major revision" prior to publishing your manuscript in eLife.

The comments of all two reviewers are in good agreement. While the reviewers found this work to be of importance as a translational research, they raised concerns about the lack of mechanistic insights on the preclinical VEGFC1563 therapy for chronic cardiac dysfunction. The authors are required to carefully address the comments point-by-point in a data-driven manner or with further analyses or discussions. Specifically, the authors are encouraged to pay attention to the major comment 1 of reviewer 1 and comments 1-3 of reviewer 2. If necessary, please provide the reasons for not implementing the suggested changes. We believe the authors could revise the manuscript successfully given their expertise.

We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data.

Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in eLife, either of which would be linked to the original paper.

Reviewer #1:

The manuscript by Song et al., shows the importance and mechanistic insights of lymphatic vasculature in chronic cardiac dysfunction. The authors demonstrated pathological and functional association of cardiac lymphatics in an angiotensin infusion-induced cardiac dysfunction model. Moreover, they showed that lymphangiogenic therapy using VEGFCc156s can alleviate pathological changes and ameliorate heart function by improving cardiac lymphatic function and mitigating inflammation and hypertension. The intriguing findings of this study suggest a potential therapeutic strategy for chronic cardiac dysfunction induced by hypertension. Therefore, I consider this work suitable for publication in eLife after addressing following points.

(1) VEGFC – VEGFR3 signaling pathway is the most well-known signaling axis regulating development and growth of lymphatic vasculature. The authors showed that VEGFCc156s infusion reduced the loss of cardiac lymphatic vasculature as demonstrated by increased podoplanin+ lymphatic vessel density and area in Figure 2J and Figure 2—figure supplement 1M. However, an interesting observation was made in kidney lymphatic vasculature, where the VEGFCc156s administration reduced lymphatic endothelial cell marker genes and lymphatic vessel density in Figure 6E, F and Figure 6—figure supplement 1B, C, D. What is the authors' explanation for such an opposite effect of VEGFCc156s, and what is the effect of VEGFCc156s on other organ lymphatics? For example, "skin" which is related to pathogenesis of hypertension.

2) How are cardiac lymphatic valves affected in AngII and AngII+VEGFC groups?

3) In Figure 2I and Figure 4G, what is the image showing? Is it ctrl, angll or angll+VEGFC group? The authors should provide a representative image for each group.

4) In Figure 4—figure supplement 1B, eGFP signal shown is quite not clear. Co-staining with LEC marker genes are required.

5) In Figure 2—figure supplement 1G and H – representative images for each group is required. In Figure 2—figure supplement 1L and Figure 6—figure supplement 1D, P-value for the quantification is omitted.

6) Results – LYVE1 is highly expressed in a subset of macrophages. How could the authors exclude the involvement of LYVE1 sequence from LYVE1+ macrophages when analyzing the SNP of the genome from whole human heart tissue?

7) Results – What is the source of VEGF-C?

8) Results – PDPN expression can be upregulated in inflamed heart, but the authors stated that the PDPN expression was reduced in chronic heart failure patients. What could be the reason for this discrepancy?

9) More defined analyses are required to visualize interstitial mononuclear cell infiltrate and tubular basophilia in the kidney.

10) Figure 1A can be arranged by Table 1.

11) Figure 2 – What is an implication of the lung weight change? Does it imply a reduction in lung edema?

12) In Figure 3 – The injection site and cardiac lymphatics are unclear.

13) Overall, the data presentation should be improved. It is hard to follow them.

Reviewer #2:

Song et al. report that continuous infusion of Vegfr-3 ligand VEGF-C156S prevents development of chronic cardiac dysfunction using angiotensin II (AngII) infusion-induced model. Continuous delivery of VEGFC156s increased heart lymphatic vascular density and lymphatic drainage, reduced AngII-induced cardiac and lung hypertrophy and improved cardiac contractibility together with a decreased Nppb expression The authors also analysed the transcriptional changes in LECs, BECs and cardiomyocytes isolated from the heart and diaphragm LECs. They report that AngII produces global changes at the transcriptomes of LECs, BECs and cardiomyocytes and many of the changes are resolved upon VEGFC156s, specifically in LECs of heart and diaphragm. AngII induced genes involved in inflammation and immune cell chemotaxis, changes that were reversed upon VEGFC156s treatment. They also suggest that TLR, Hif1a and Gli1 pathways drive LEC transcriptional changes in cardiac dysfunction, which are then ameliorated upon VEGF-C treatment. Since hypertension is one of the characteristics of chronic cardiac disease, the authors analysed the effect of VEGFC156s and demonstrate by that it reduces blood pressure. Finally, the authors report kidney dysfunction (by Urine volume and ACR ratio) recovery after VEGFC156s treatment.

Finding that lymphangiogenic therapy improves resolution of myocardial edema and inflammation, and prevents cardiac dysfunction and fibrosis is not new, as reported in several previous studies (e.g. Henri et al. and Houssari et al. ). However, here the authors convincingly show that co-administration of VEGF-C improves multiple pathological parameters in chronic cardiac dysfunction model. It is therefore a clinically relevant result, especially because the authors deliver the protein systemically and show that relatively modest two-fold increase in circulating levels of VEGF-C156S produces substantial therapeutic benefits. Unfortunately, the study is rather descriptive and the authors did not pursue further molecular analysis of cardiac and diaphragm lymphatic endothelial cells to better characterize the molecular changes imposed by failing heart and treatment with VEGF-C.

1) An important distinguishing feature of the current manuscript is systemic delivery of VEGFR-3 ligand, as opposed to cardiac delivery in previous publications. Therefore the authors should provide better characterization of the effects of systemic VEGF-C administration on lymphatic vasculature both in heart and other organs, such as skin. Notably, they should establish whether their infusion method leads to the expansion of initial capillary network or, perhaps enlargement of pre-collecting or collecting vessels. At least one publication demonstrated that recombinant VEGF-C156S promoted lymphatic contractility (Breslin et al., 2007), hence improved lymphatic draining function upon VEGF-C156S administration can be potentially uncoupled from its lymphangiogenic activity. Indeed, in the lymphoangiography images of Figure 3 the angII effects on the heart and the vessel leakiness are clear, however the Qdot images do not show much expansion of lymphatic vascular network. Furthermore, increased skin lymphangiogenesis has been shown to improve outcomes in salt-induced hypertension model (Machnik et al., 2009), therefore lymphatic vessel expansion in organs other than heart is potentially directly relevant.

2) The beneficial effects of VEGFC156S infusion in AngII-infusion model are encouraging. However, AngII and VEGF-C156S were infused simultaneously. To know if lymphangiogenic treatment can be used as therapy, ideally it would be important to know whether VEGFC-156S administration helps after establishment of cardiac dysfunction. In the very least, the timeline of cardiac and other organ lymphangiogenesis should be documented in more detail.

3) Do the authors check the effect of VEGFC156s alone? It would have been great added value to include it as control in all in vivo experimentation.

4) The authors made a number of broad conclusions based on bulk RNAseq data of cardiac and diaphragm LECs. However, I am not convinced that they monitor cell-autonomous effects in their analyses. For example, several genes that they report to be modulate in LECs in their models are to the best of my knowledge, expressed in immune cells and not in LECs, such as PF4, ITGAM, CD276 etc. One potential explanation, and we observed this effect also in our models, is that bulk sorted LECs can be contaminated with small number of immune cells (and of course other cell types, depending on the organ). Please provide evidence of the purity of isolated populations by analysing the expression of established markers, such as CD31 and CDH5 (endothelial identity), Prox1, Flt1 and Nrp1 (lymphatic and blood endothelial cell markers), Ptprc (immune cells), collagen 6 subunits (fibroblasts) and confirm that at least some of the functionally relevant transcripts, identified as differentially expressed in LECs by bioinformatics analyses, are indeed expressed in lymphatic endothelial cells by immunostaining. Similarly, the suggestions that N-Myc drives VEGF-C effects and that AngII induces and Vegf-C repress activation of TLR, Hif1A and Gli1 pathways in LECs, are intriguing, but they are not substantiated by any other means, and therefore remains speculative.

5) Since patients with hypertension harbour lower VEGFC serum levels, did the authors analysed what were the serum levels of endogenous VEGF-C in their hypertension model for angII and angII+ VEGFC156s conditions?

6) The authors show that in concordance with reduction of hypertension, VEGFC156s improved kidney dysfunction. But what is the effect of VEGFC156s in renal lymphatics? Only expression levels of lymphatic markers and density analysis was performed. The authors confirm previous studies showing that in response to hypertension there is expansion of lymphatic vessels in kidneys and observe a decrease LEC markers expression upon VEGFC156s. This part is controversial, how do the authors explain the decrease on lymphatic markers expression upon VEGF156s? The authors suggest this is a result of the low dose used, however this dose was enough to recover lymphatic function, inflammation and hypertension and poor retention in the kidney would justify no differences, however there is a decrease of lymphatic endothelial cell markers when comparing angII and angII+ VEGFC. Indeed, in the kidney the effect of angII and angII +VEGFC156s on lymphatic markers is opposite to what is observed in the heart. How do the authors explain this point?

7) AngII infusion is known to induce extensive interstitial fibrosis. What was the effect of VEGF-C156S administration on this important pathophysiological parameter?


Author response

Reviewer #1:

[…] (1) VEGFC – VEGFR3 signaling pathway is the most well-known signaling axis regulating development and growth of lymphatic vasculature. The authors showed that VEGFCc156s infusion reduced the loss of cardiac lymphatic vasculature as demonstrated by increased podoplanin+ lymphatic vessel density and area in Figure 2J and Figure 2—figure supplement 1M. However, an interesting observation was made in kidney lymphatic vasculature, where the VEGFCc156s administration reduced lymphatic endothelial cell marker genes and lymphatic vessel density in Figure 6E, F and Figure 6—figure supplement 1B, C, D. What is the authors' explanation for such an opposite effect of VEGFCc156s, and what is the effect of VEGFCc156s on other organ lymphatics? For example, "skin" which is related to pathogenesis of hypertension.

We agree with the reviewer that systemic administration of VEGFCc156s could have a multitude of effects outside of the heart. To address this concern, we examined the effect of VEGFCc156s on ear skin lymphatic vessels 6 weeks post-angiotensin II infusion, and observed that similar to the effects of VEGFCc156s on the lymphatic vessels in heart at this timepoint, VEGFCc156s treatment significantly increased ear skin lymphatic vessel diameter and lymphatic vascular density, supporting a systemic lymphangiogenic response induced by VEGFCc156s treatment (new data in Figure 2—figure supplement 1O-R). We agree that the changes in skin lymphatics could contribute to the effect of the treatment on hypertension and we have added text to the Discussion accordingly.

We agree with the reviewer that the lymphatic marker qPCR and lyve1 staining data in the kidney at the 6-week timepoint are intriguing. As new data with this revision, we conducted in vivo studies to profile the time-course of the protective effects of VEGFCc156s on angiotensin II-induced cardiac dysfunction and characterized the changes induced by the treatment at 1 week after treatment. In this new study, VEGFCc156s treatment in healthy and angiotensin II-infused animals induced a trend towards increased lymphatic vessel density in skin and a significant increase in podoplanin-positive lymphatic vessel density in heart, indicating that VEGFCc156s can indeed induce lymphangiogenesis (Figure 7—figure supplement 1I-L). However, at this time point, Lyve1 expression and Lyve1-positive lymphatic vessel density was not altered in the kidney of animals treated with VEGFCc156s alone (Figure 7—figure supplement 1F-H), confirming that the VEGFCc156s treatment did not induce lymphangiogenesis in kidney at the dose we use for our studies. These new data along with the data on kidney lymphatics at 6 weeks after angiotensin II infusion (Figure 6E, F, Figure 6—figure supplement 1E-H) suggest that the increase in renal lyve1 gene expression and lymphatic vessel density in this model could be secondary to the hypertension status of the animals. At 1 week, the hypertension is not sufficient to drive this change, and by 6 weeks, hypertension has caused an adaptation in angiotensin II-infused animals to induce lymphangiogenesis that is ameliorated by the reduced hypertension in VEGFCc156s-infused, angiotensin II-treated animals. In addition, it is possible that the systemic infusion of VEGFCc156s did not significantly affect kidney lymphatics due to the low dose and poor local kidney retention, whereas transgenic overexpression of VEGFD specifically in kidney as in previous reports would sustain high local expression and therefore produce a greater local effect. We have discussed these hypotheses in the Discussion section.

2) How are cardiac lymphatic valves affected in AngII and AngII+VEGFC groups?

Unfortunately, we made cross-sections of the heart for immunofluorescence staining and we did not have additional heart tissue to perform whole mount imaging of the lymphatic valves. Therefore, we were unable to evaluate this parameter. This is discussed as a limitation in the manuscript Discussion and will be an area of interest for us to investigate in the future.

3) In Figure 2I and Figure 4G, what is the image showing? Is it ctrl, angll or angll+VEGFC group? The authors should provide a representative image for each group.

We have now added representative images for podoplanin and smooth muscle actin staining for each treatment group in Figure 2I as well as representative images of CD68, Smooth muscle actin and DAPI staining for each treatment group in Figure 4G.

4) In Figure 4—figure supplement 1B, eGFP signal shown is quite not clear. Co-staining with LEC marker genes are required.

We are pleased to provide new immunofluorescence staining data using mouse heart cross sections and whole mount staining using diaphragm tissue from Prox1-eGFP mice with GFP and Lyve1 co-staining (Figure 4—figure supplement 1C). The GFP stain overlapped with the Lyve1 stain, indicating that the eGFP signal came from the lymphatic vessels in the Prox1-eGFP mice.

5) In Figure 2—figure supplement 1G and H – representative images for each group is required. In Figure 2—figure supplement 1L and Figure 6—figure supplement 1D, P-value for the quantification is omitted.

We have added representative WGA stain images from heart cross-sections in Figure 2—figure supplement 1H. We have also added the p-value for the quantifications previously shown in Figure 2—figure supplement 1L and Figure 6—figure supplement 1D (in the current version, the figures are Figure 2—figure supplement 1N and Figure 6—figure supplement 1H).

6) Results – LYVE1 is highly expressed in a subset of macrophages. How could the authors exclude the involvement of LYVE1 sequence from LYVE1+ macrophages when analyzing the SNP of the genome from whole human heart tissue?

We appreciate this helpful comment from the reviewer. The associations we observed in GWAS analysis are the associations between a specific loci with a disease phenotype where Lyve1 and another gene are located or close to, and the results do not indicate the exact gene that mediates the effect or the exact cell type that mediates the effect. We agree with the reviewer that it is possible that several types of cells including both Lyve1+ macrophages and Lyve1+ lymphatic vessels may mediate the effect, and unfortunately the GWAS analysis will not provide us with the information concerning cell types due to the nature of the analysis. We have revised our description on the GWAS data to make it more accurate (Discussion).

7) Results – What is the source of VEGF-C?

The VEGFCc156s we used for our in vivo studies is the recombinant human VEGF-C (Cys156Ser) protein purchased from R&D systems. It has been used previously to induce lymphangiogenesis in vivo in mice (Klotz et al., 2015), and the sequence of this human VEGFC short-form is identical to the mouse VEGFC short-form.

8) Results – PDPN expression can be upregulated in inflamed heart, but the authors stated that the PDPN expression was reduced in chronic heart failure patients. What could be the reason for this discrepancy?

We are aware of previous publications (Cimini, et al., 2017; Miguel Quintanilla, et al., MDPI, 2019; Cimini, et al., 2019) indicating that podoplanin expression could be upregulated in inflamed hearts due to an increase in podoplanin-expressing cells that are not lymphatic endothelial cells. This upregulation would be most significant in the highly inflamed/fibrotic infarcted area due to the local accumulation of podoplanin-expressing cells that facilitate local inflammation. To that end, we used chronic heart failure human hearts and a chronic cardiac dysfunction model, which have a very different pathogenesis compared with a myocardial infarction model, which represents acute injury. In addition, compared with the previous reports that looked specifically at the infarcted/fibrotic site in heart, we sampled from the whole heart and also utilized immunohistochemistry staining for podoplanin-positive lymphatic vessels, in which we excluded podoplanin-positive cells that were not part of a vessel from the vessel quantification using a size filter in our visiopharm-based image analysis (subsection “Histology and immunohistochemistry”). Thus, we suggest that the changes in podoplanin expression we observed in our disease model largely come from the lymphatic vasculature but not podoplanin-expressing cells, and the discrepancy between our findings and previous reports is due to the differences in disease models and disease pathogenesis. We have added the references into our revised manuscript and added a Discussion point concerning this.

9) More defined analyses are required to visualize interstitial mononuclear cell infiltrate and tubular basophilia in the kidney.

We appreciate the comment from the reviewer. The pathologist that evaluated the H&E staining in the kidney used this nomenclature to describe the pathological findings. To improve visualization of these endpoints, we first enlarged the H&E image in Figure 6—figure supplement 1A to improve the image resolution. To further evaluate kidney pathology, we conducted a PSR stain using the same kidney sections to add an additional evaluation of kidney fibrosis. The results indicated that angiotensin II infusion induced renal fibrosis, which was significantly reduced by VEGFCc156s treatment (Figure 6—figure supplement 1A, C, D). We feel that the new PSR staining results will strengthen the kidney datasets reported at 6-week post-angiotensin II infusion and our overall conclusions.

10) Figure 1A can be arranged by Table 1.

We were informed by the editor that the format of table supplements is not preferred by the journal and therefore we have rearranged Figure 1 and converted the original Figure 1A (GWAS analysis) into Figure 1—figure supplement 1.

11) Figure 2 – What is an implication of the lung weight change? Does it imply a reduction in lung edema?

An increase in lung weight is commonly observed in severe cardiac dysfunction or heart failure and it does reflect a change in lung edema (King and Goldstein, 2020). We regularly use both heart weight and lung weight to evaluate cardiac function of the animals at euthanasia, and it’s possible that the reduction in the lung weight of VEGFCc156s-treated, angiotensin II-infused animals compared with animals treated with angiotensin II alone implied a reduction in lung edema. However, definitive measurement of lung edema requires measurement of the wet/dry ratio using fresh lungs and unfortunately, we no longer have fresh lungs to perform this measurement. We have added text to denote this possibility to the Results section.

12) In Figure 3 – The injection site and cardiac lymphatics are unclear.

We have revised Figure 3—figure supplement 1 and added a red arrowhead to the injection site (apex) and have used white arrow heads to delineate the cardiac lymphatics.

13) Overall, the data presentation should be improved. It is hard to follow them.

We appreciate that the complex data package has made the data somewhat difficult to follow. With this revision, we have added new data and refined the data presentation. We have additionally carefully edited the manuscript for additional clarity. We feel that these revisions have improved the data flow, and we thank the reviewer for calling this to our attention.

Reviewer #2:

[…] Finding that lymphangiogenic therapy improves resolution of myocardial edema and inflammation, and prevents cardiac dysfunction and fibrosis is not new, as reported in several previous studies (e.g. Henri et al. and Houssari et al. ). However, here the authors convincingly show that co-administration of VEGF-C improves multiple pathological parameters in chronic cardiac dysfunction model. It is therefore a clinically relevant result, especially because the authors deliver the protein systemically and show that relatively modest two-fold increase in circulating levels of VEGF-C156S produces substantial therapeutic benefits. Unfortunately, the study is rather descriptive and the authors did not pursue further molecular analysis of cardiac and diaphragm lymphatic endothelial cells to better characterize the molecular changes imposed by failing heart and treatment with VEGF-C.

1) An important distinguishing feature of the current manuscript is systemic delivery of VEGFR-3 ligand, as opposed to cardiac delivery in previous publications. Therefore the authors should provide better characterization of the effects of systemic VEGF-C administration on lymphatic vasculature both in heart and other organs, such as skin. Notably, they should establish whether their infusion method leads to the expansion of initial capillary network or, perhaps enlargement of pre-collecting or collecting vessels. At least one publication demonstrated that recombinant VEGF-C156S promoted lymphatic contractility (Breslin et al., 2007), hence improved lymphatic draining function upon VEGF-C156S administration can be potentially uncoupled from its lymphangiogenic activity. Indeed, in the lymphoangiography images of Figure 3 the angII effects on the heart and the vessel leakiness are clear, however the Qdot images do not show much expansion of lymphatic vascular network. Furthermore, increased skin lymphangiogenesis has been shown to improve outcomes in salt-induced hypertension model (Machnik et al., 2009), therefore lymphatic vessel expansion in organs other than heart is potentially directly relevant.

We appreciate this constructive comment from the reviewer and have significant additional data to include to address this point in the manuscript revision. To address this comment, we first conducted an additional analysis on the podoplanin-positive lymphatic vessel quantification in heart to evaluate the average podoplanin-positive lymphatic vessel lumen area. Indeed, as the reviewer pointed out, there was a significant enlargement of the podoplanin-positive pre-collector vessel lumen in VEGFCc156s-treated angiotensin II-infused hearts compared with hearts treated with angiotensin II alone (Figure 2K), which was consistent with the significant improvement we observed in cardiac lymphatic transport in VEGFCc156s-treated hearts using lymphangiography (Figure 3) and indicated a functional change in the collecting vessels.

In addition, we examined the effect of VEGFCc156s on the lymphatic vessels in ear skin 6 weeks after treatment. Similar to the effects of VEGFCc156s on the lymphatic vessels in heart at this timepoint, VEGFCc156s treatment significantly increased lymphatic vessel diameter and lymphatic vascular density in the ear skin of angiotensin II-infused animals, supporting a systemic lymphangiogenic response induced by VEGFCc156s treatment (Figure 2—figure supplement 1O-R). We agree that the changes in the lymphatics in skin induced by VEGFCc156s treatment could contribute to the effect of the treatment on hypertension, and we have added a point on this in the Discussion.

2) The beneficial effects of VEGFC156S infusion in AngII-infusion model are encouraging. However, AngII and VEGF-C156S were infused simultaneously. To know if lymphangiogenic treatment can be used as therapy, ideally it would be important to know whether VEGFC-156S administration helps after establishment of cardiac dysfunction. In the very least, the timeline of cardiac and other organ lymphangiogenesis should be documented in more detail.

We agree with the reviewer that a therapeutic reversal of the cardiac disease using VEGFCc156s would be a very compelling experiment. However, due to the minipump administration of angiotensin II and VEGFCc156s, this is very difficult to achieve, as our IACUC limits the number of surgical procedures on mice (only one surgery per animal allowed). Therefore unfortunately, we are unable to conduct a reversal experiment using the infusion method. We also agree with the reviewer that a more careful assessment of the lymphangiogenesis timeline should be performed. Following this suggestion, we conducted in vivo studies to characterize the timecourse of the beneficial effect of VEGFCc156s on angiotensin II-induced cardiac dysfunction. We specifically examined the effect of VEGFCc156s 1-week post-infusion, at which time, the blood pressure was equally high in both angiotensin II-infused and VEGFCc156s-treated angiotensin II-infused mice based on the telemetry study result from Figure 5. We found that at this early time point, whereas VEGFCc156s does not have an effect on blood pressure, it significantly reduced angiotensin II-induced gene expression in pathways involved in cardiac hypertrophy, fibrosis, and inflammation. Furthermore, VEGFCc156s infusion alleviated angiotensin II-induced cardiac fibrosis and inflammation as assessed by histological staining at this early 1-week timepoint. These new results are included in Figure 7 and Figure 7—figure supplement 1 and 2. We feel that these new data significantly improve the quality of the manuscript and solidify the conclusions drawn. We thank the reviewer for the constructive advice.

3) Do the authors check the effect of VEGFC156s alone? It would have been great added value to include it as control in all in vivo experimentation.

We agree that a VEGFCc156s alone arm would have added value in our studies. Following this advice, we added a treatment arm in new data added here that assesses one week of infusion of VEGFCc156s alone. In this assessment, a lymphangiogenic response in heart was observed in VEGFCc156s-alone infused animals, which was similar to animals that were infused with VEGFCc156s and angiotensin II concurrently. These new results are included in Figure 7 and Figure 7—figure supplement 1 and 2.

4) The authors made a number of broad conclusions based on bulk RNAseq data of cardiac and diaphragm LECs. However, I am not convinced that they monitor cell-autonomous effects in their analyses. For example, several genes that they report to be modulate in LECs in their models are to the best of my knowledge, expressed in immune cells and not in LECs, such as PF4, ITGAM, CD276 etc. One potential explanation, and we observed this effect also in our models, is that bulk sorted LECs can be contaminated with small number of immune cells (and of course other cell types, depending on the organ). Please provide evidence of the purity of isolated populations by analysing the expression of established markers, such as CD31 and CDH5 (endothelial identity), Prox1, Flt1 and Nrp1 (lymphatic and blood endothelial cell markers), Ptprc (immune cells), collagen 6 subunits (fibroblasts) and confirm that at least some of the functionally relevant transcripts, identified as differentially expressed in LECs by bioinformatics analyses, are indeed expressed in lymphatic endothelial cells by immunostaining. Similarly, the suggestions that N-Myc drives VEGF-C effects and that AngII induces and Vegf-C repress activation of TLR, Hif1A and Gli1 pathways in LECs, are intriguing, but they are not substantiated by any other means, and therefore remains speculative.

We appreciate the reviewer’s concern regarding the purity of the cell isolations used for RNAseq. We used several methods to ensure purity of sorted cells. First, we digested the hearts and did a slow spin to isolate heavy cells such as cardiomyocytes. We then flow sorted for CD45.2 (encoded by Ptprc) negative cells, which should ensure that we are not identifying immune cells, and we set stringent gates to ensure the sorted cell populations were expressing the correct markers (cell sorting workflow and gating parameters are detailed in Figure 4—figure supplement 1D). We conducted multiple tests to optimize the cell isolation workflow and performed qPCR to assess various marker genes in the sorted cell populations to assess purity. We provide a figure to the reviewer here from one of our test runs (Author response image 1) demonstrating that the cardiomyocyte population (isolated by low speed centrifugation, which is relatively impure and may contain other cell types in addition to cardiomyocytes) expressed high levels of cardiac markers (Myh7, Actn2), whereas endothelial cells (sorted by CD45.2 negative, CD31 positive) did not express Ptprc (CD45) and expressed Pecam1 (CD31). In addition, lymphatic endothelial cell populations (sorted by CD45.2 negative, CD31 positive, GFP positive) expressed high levels of lymphatic endothelial markers (Lyve1, Pdpn, Flt4 and Prox1) (shown in Author response image 1).

Author response image 1
Analysis of cell-specific marker expression in isolated cardiomyocytes (CMs), cardiac lymphatic endothelial cells (ECs), cardiac blood ECs and diaphragm lymphatic ECs.

The cells were isolated from the heart and diaphragm of a Prox1-eGFP mouse following the cell isolation procedure shown in Figure 4—figure supplement 1D in main manuscript. RNA was isolated from the cells, and quantitative RT-PCR was performed for Myh7, Actn2, Ptprc, Pecam1, Lyve1, Prox1, Flt4, Pdpn and normalized to the expression of housekeeping gene Hprt(n=1/group).

For our RNAseq analysis, a PCA analysis indicated that each isolated cell population clustered together and showed distinct expression profiling (Figure 4—figure supplement 1E). In addition, consistent with our pilot optimization test result, our RNAseq analysis could not detect ptprc (CD45) expression and detected high counts of Pecam1 (CD31) (TPM count 410-530 for lymphatic ECs, 740-850 for blood ECs and 137-138 for cardiomyocytes) and Cdh5 (TPM count 65-90 for lymphatic ECs, 164-220 for blood ECs and 22-29 for cardiomyocytes) in our isolated blood and lymphatic endothelial cell populations. Moreover, the lymphatic endothelial cell populations showed high counts/expression of lyve1(TPM count 1300-4200), Prox1 (TPM count 159-254), Pdpn (TPM count 63-131) and Flt4 (TPM count 428-1073) compared with other cell populations (Lyve1 TPM count 17-51, Prox1 TPM count 1-5, Pdpn TPM count 2-6, Flt4 TPM count 8-57 for BECs and cardiomyocytes). The cardiomyocyte population (isolated by centrifugation, relatively impure) showed a relatively high expression of collagen 6 subunits (Col6a1 TPM count 100-210, Col6a2 TPM count 100-220) while lymphatic endothelial cell populations showed a low expression of collagen 6 subunits (Col6a1 TPM count 10-34, Col6a2 TPM count 12-27). We could only isolate 800-1200 lymphatic endothelial cells/heart and 1000-2000 lymphatic endothelial cells/diaphragm with the stringent cell isolation protocol, and the cell amount was just enough for a low-input RNAseq method for the transcriptional profiling of the distinct cell populations. Therefore unfortunately, we don’t have extra cells for additional immunostaining tests to confirm the identity of each isolated cell population. However, based on our stringent isolation and gating procedures described above as well as the RNAseq TPM count data, we suggest that the cell populations we isolated for RNAseq were relatively pure. We agree with the reviewer that the RNAseq results and pathway analysis need to be validated with more experiments, and that will fall into the scope of future studies.

5) Since patients with hypertension harbour lower VEGFC serum levels, did the authors analysed what were the serum levels of endogenous VEGF-C in their hypertension model for angII and angII+ VEGFC156s conditions?

VEGFC concentration was assessed in plasma of the animals from our in vivo studies at both the 1-week and 6-week timepoints, and the results are included in Figure 2—figure supplement 1B and Figure 7—figure supplement 1A. There was no significant difference in serum VEGFC levels between ctrl animals ang angiotensin II-infused animals. However, the human study we cited in the Discussion indicated that low serum VEGFC level was associated with a higher risk of hypertension, which is consistent with our finding that increasing serum VEGFC level could be beneficial for hypertension. In addition, the data from the human study we cited were from patients with refractory hypertension that doesn’t respond to regular anti-hypertensive therapy and there could be differences in pathogenesis and disease mechanisms between refractory hypertension in human and our angiotensin II model. We agree that further investigations are needed to understand the detailed mechanisms underlying these observations.

6) The authors show that in concordance with reduction of hypertension, VEGFC156s improved kidney dysfunction. But what is the effect of VEGFC156s in renal lymphatics? Only expression levels of lymphatic markers and density analysis was performed. The authors confirm previous studies showing that in response to hypertension there is expansion of lymphatic vessels in kidneys and observe a decrease LEC markers expression upon VEGFC156s. This part is controversial, how do the authors explain the decrease on lymphatic markers expression upon VEGF156s? The authors suggest this is a result of the low dose used, however this dose was enough to recover lymphatic function, inflammation and hypertension and poor retention in the kidney would justify no differences, however there is a decrease of lymphatic endothelial cell markers when comparing angII and angII+ VEGFC. Indeed, in the kidney the effect of angII and angII +VEGFC156s on lymphatic markers is opposite to what is observed in the heart. How do the authors explain this point?

We agree with the reviewer that the lymphatic marker qPCR and lyve1 staining data in the kidney at the 6-week timepoint are intriguing. As new data with this revision, we conducted in vivo studies to profile the time-course of the protective effects of VEGFCc156s on angiotensin II-induced cardiac dysfunction and characterized the changes induced by the treatment at 1 week after treatment. In this new study, VEGFCc156s treatment in healthy and angiotensin II-infused animals induced a trend towards increased lymphatic vessel density in skin and a significant increase in podoplanin-positive lymphatic vessel density in heart, indicating that VEGFCc156s can indeed induce lymphangiogenesis (Figure 7—figure supplement 1I-L). However, at this time point, Lyve1 expression and Lyve1-positive lymphatic vessel density was not altered in the kidney of animals treated with VEGFCc156s alone (Figure 7—figure supplement 1F-H), confirming that the VEGFCc156s treatment did not induce lymphangiogenesis in kidney at the dose we use for our studies. These new data along with the data on kidney lymphatics at 6 weeks after angiotensin II infusion (Figure 6E, F, Figure 6—figure supplement 1E-H) suggest that the increase in renal lyve1 gene expression and lymphatic vessel density in this model could be secondary to the hypertension status of the animals and not a direct effect of VEGFCc156s on the kidney. At 1 week, the hypertension is not sufficient to drive this change, and by 6 weeks, hypertension has caused an adaptation in angiotensin II-infused animals to induce lymphangiogenesis that is ameliorated by the reduced hypertension in VEGFCc156s-infused, angiotensin II-treated animals. In addition, it is possible that the systemic infusion of VEGFCc156s did not significantly affect kidney lymphatics due to the low dose and poor local kidney retention, whereas transgenic overexpression of VEGFD specifically in kidney as in previous reports would sustain high local expression and therefore produce a greater local effect. We have discussed these hypotheses in the Discussion section.

7) AngII infusion is known to induce extensive interstitial fibrosis. What was the effect of VEGF-C156S administration on this important pathophysiological parameter?

We are pleased to provide significant new data to address this point. PSR staining of mouse kidney sections indicated angiotensin II infusion induced significant kidney fibrosis after 6 weeks of infusion, which was significantly reduced in VEGFCc156s-treated animals(Figure 6—figure supplement 1A, C, D), indicating a beneficial effect of VEGFCc156s on kidney fibrosis and supporting an overall beneficial effect of VEGFCc156s on angiotensin II-induced kidney dysfunction at this timepoint. In addition, we also observed that VEGFCc156s treatment significantly reduced angiotensin II-induced pro-fibrotic gene expression and trended to reduce the level of cardiac fibrosis in the heart as early as 1-week post-treatment (Figure 7I-L, Figure 7—figure supplement 1P, Q). These new results indicate that VEGFCc156s improved the cardiac function in angiotensin II-infused animals by alleviating cardiac fibrosis in addition to the other mechanisms proposed in this manuscript. We thank the reviewer for this suggestion.


Article and author information

Author details

  1. LouJin Song

    Internal Medicine Research Unit, Pfizer Inc, Cambridge, United States
    Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Writing - original draft, Writing - review and editing
    Competing interests
    is an employee at Pfizer inc
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1646-8121
  2. Xian Chen

    1. Comparative Medicine, Pfizer Inc, Cambridge, United States
    2. Drug Safety Research & Development, Pfizer Inc, Groton, United States
    Competing interests
    is an employee at Pfizer inc
  3. Terri A Swanson

    Early Clinical Development, Pfizer Inc, Cambridge, United States
    Competing interests
    is an employee at Pfizer inc
  4. Brianna LaViolette

    Comparative Medicine, Pfizer Inc, Cambridge, United States
    Competing interests
    is an employee at Pfizer inc
  5. Jincheng Pang

    Internal Medicine Research Unit, Pfizer Inc, Cambridge, United States
    Formal analysis, Methodology
    Competing interests
    is an employee at Pfizer inc
  6. Teresa Cunio

    1. Internal Medicine Research Unit, Pfizer Inc, Cambridge, United States
    2. Acceleron Pharma, Cambridge, United States
    Present address
    Acceleron Pharmaceuticals
    Competing interests
    was an employee at Pfizer inc and is currently an employee at Acceleron Pharma
  7. Michael W Nagle

    1. Internal Medicine Research Unit, Pfizer Inc, Cambridge, United States
    2. Eisai Inc, Cambridge, United States
    Present address
    Eisai Pharmaceuticals
    Formal analysis, Methodology, Writing - review and editing
    Competing interests
    was an employee at Pfizer Inc and is currently an employee at Eisai Inc
  8. Shoh Asano

    Internal Medicine Research Unit, Pfizer Inc, Cambridge, United States
    Competing interests
    is an employee at Pfizer Inc
  9. Katherine Hales

    Internal Medicine Research Unit, Pfizer Inc, Cambridge, United States
    Competing interests
    is an employee at Pfizer Inc
  10. Arun Shipstone

    Inflammation and Immunology Research Unit, Pfizer Inc, Cambridge, United States
    Investigation, Methodology
    Competing interests
    is an employee at Pfizer Inc
  11. Hanna Sobon

    Inflammation and Immunology Research Unit, Pfizer Inc, Cambridge, United States
    Investigation, Methodology
    Competing interests
    is an employee at Pfizer Inc
  12. Sabra D Al-Harthy

    1. Comparative Medicine, Pfizer Inc, Cambridge, United States
    2. Drug Safety Research & Development, Pfizer Inc, Groton, United States
    Competing interests
    is an employee at Pfizer Inc
  13. Youngwook Ahn

    Target Sciences, Emerging Science and Innovation, Pfizer Inc, Cambridge, United States
    Investigation, Methodology
    Competing interests
    is an employee at Pfizer Inc
  14. Steven Kreuser

    Comparative Medicine, Pfizer Inc, Cambridge, United States
    Competing interests
    is an employee at Pfizer Inc
  15. Andrew Robertson

    Drug Safety Research & Development, Pfizer Inc, Groton, United States
    Competing interests
    is an employee at Pfizer Inc
  16. Casey Ritenour

    Drug Safety Research & Development, Pfizer Inc, Groton, United States
    Competing interests
    is an employee at Pfizer Inc
  17. Frank Voigt

    Drug Safety Research & Development, Pfizer Inc, Groton, United States
    Competing interests
    is an employee at Pfizer Inc
  18. Magalie Boucher

    Drug Safety Research & Development, Pfizer Inc, Groton, United States
    Competing interests
    is an employee at Pfizer Inc
  19. Furong Sun

    Early Clinical Development, Pfizer Inc, Cambridge, United States
    Formal analysis
    Competing interests
    is an employee at Pfizer Inc
  20. William C Sessa

    Department of Pharmacology, Vascular Biology and Therapeutics Program, Yale University School of Medicine, New Haven, United States
    Supervision, Visualization, Writing - review and editing
    Competing interests
    consultant for Pfizer.
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-5759-1938
  21. Rachel J Roth Flach

    Internal Medicine Research Unit, Pfizer Inc, Cambridge, United States
    Conceptualization, Supervision, Funding acquisition, Visualization, Project administration, Writing - review and editing
    For correspondence
    Competing interests
    is an employee at Pfizer Inc
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-2754-828X



  • Rachel J Roth Flach

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank Dr. Kendra Bence for helpful discussions and suggestions for the project. We thank Rob Webster and John Litchfield for their help with the pharmacokinetic analysis for the studies. We thank Donald Bennett for helpful advice on biostatistics. We thank Matthew Peloquin and Dr. Federico Damilano for their helpful advice on experiments. We thank the genetically engineered murine model (GEMM) facility at Pfizer Inc for their support in transgenic animal model generation. The project is supported by funding from Pfizer, Inc


Animal experimentation: The ethics statement has been included in the method section of the manuscript: "All animal experimental procedures were carried out in accordance with regulations and established guidelines and were reviewed and approved by the Pfizer Institutional Animal Care and Use Committee (AUP # KSQ-2013-00895)".

Senior Editor

  1. Matthias Barton, University of Zurich, Switzerland

Reviewing Editor

  1. Gou Young Koh, Institute of Basic Science and Korea Advanced Institute of Science and Technology (KAIST), Republic of Korea


  1. Gou Young Koh, Institute of Basic Science and Korea Advanced Institute of Science and Technology (KAIST), Republic of Korea

Publication history

  1. Received: April 29, 2020
  2. Accepted: November 16, 2020
  3. Accepted Manuscript published: November 17, 2020 (version 1)
  4. Version of Record published: November 27, 2020 (version 2)


© 2020, Song et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 867
    Page views
  • 98
  • 0

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cell Biology
    Zherui Xiong et al.
    Tools and Resources Updated

    Protein interaction networks are crucial for complex cellular processes. However, the elucidation of protein interactions occurring within highly specialised cells and tissues is challenging. Here, we describe the development, and application, of a new method for proximity-dependent biotin labelling in whole zebrafish. Using a conditionally stabilised GFP-binding nanobody to target a biotin ligase to GFP-labelled proteins of interest, we show tissue-specific proteomic profiling using existing GFP-tagged transgenic zebrafish lines. We demonstrate the applicability of this approach, termed BLITZ (Biotin Labelling In Tagged Zebrafish), in diverse cell types such as neurons and vascular endothelial cells. We applied this methodology to identify interactors of caveolar coat protein, cavins, in skeletal muscle. Using this system, we defined specific interaction networks within in vivo muscle cells for the closely related but functionally distinct Cavin4 and Cavin1 proteins.

    1. Cell Biology
    2. Chromosomes and Gene Expression
    Lorraine De Jesus Kim et al.
    Research Article

    The committed step of eukaryotic DNA replication occurs when the pairs of Mcm2-7 replicative helicases that license each replication origin are activated. Helicase activation requires the recruitment of Cdc45 and GINS to Mcm2-7, forming Cdc45-Mcm2-7-GINS complexes (CMGs). Using single-molecule biochemical assays to monitor CMG formation, we found that Cdc45 and GINS are recruited to loaded Mcm2-7 in two stages. Initially, Cdc45, GINS, and likely additional proteins are recruited to unstructured Mcm2-7 N-terminal tails in a Dbf4-dependent kinase (DDK)-dependent manner, forming Cdc45-tail-GINS intermediates (CtGs). DDK phosphorylation of multiple phosphorylation sites on the Mcm2‑7 tails modulates the number of CtGs formed per Mcm2-7. In a second, inefficient event, a subset of CtGs transfer their Cdc45 and GINS components to form CMGs. Importantly, higher CtG multiplicity increases the frequency of CMG formation. Our findings reveal molecular mechanisms sensitizing helicase activation to DDK levels with implications for control of replication origin efficiency and timing.