R7 photoreceptor axon targeting depends on the relative levels of lost and found expression in R7 and its synaptic partners

  1. Jessica Douthit
  2. Ariel Hairston
  3. Gina Lee
  4. Carolyn A Morrison
  5. Isabel Holguera
  6. Jessica E Treisman  Is a corresponding author
  1. Kimmel Center for Biology and Medicine at the Skirball Institute and Department of Cell Biology, NYU School of Medicine, United States
  2. Department of Biology, New York University, United States

Abstract

As neural circuits form, growing processes select the correct synaptic partners through interactions between cell surface proteins. The presence of such proteins on two neuronal processes may lead to either adhesion or repulsion; however, the consequences of mismatched expression have rarely been explored. Here, we show that the Drosophila CUB-LDL protein Lost and found (Loaf) is required in the UV-sensitive R7 photoreceptor for normal axon targeting only when Loaf is also present in its synaptic partners. Although targeting occurs normally in loaf mutant animals, removing loaf from photoreceptors or expressing it in their postsynaptic neurons Tm5a/b or Dm9 in a loaf mutant causes mistargeting of R7 axons. Loaf localizes primarily to intracellular vesicles including endosomes. We propose that Loaf regulates the trafficking or function of one or more cell surface proteins, and an excess of these proteins on the synaptic partners of R7 prevents the formation of stable connections.

eLife digest

New nerve cells in a developing organism face a difficult challenge: finding the right partners to connect with in order to form the complex neural networks characteristic of a fully formed brain. Each cell encounters many potential matches but it chooses to connect to only a few, partly based on the proteins that decorate the surface of both cells. Still, too many cell types exist for each to have its own unique protein label, suggesting that nerve cells may also use the amount of each protein to identify suitable partners.

Douthit, Hairston et al. explored this possibility in developing fruit flies, focusing on how R7 photoreceptor cells – present in the eye to detect UV light – connect to nerve cells in a specific brain layer. It is easy to spot when the process goes awry, as the incorrect connections will be in a different layer. Experiments allowed Douthit, Hairston et al. to identify a protein baptized ‘Lost and found’ – ‘Loaf’ for short – which R7 photoreceptors use to find their partners.

Removing Loaf from the photoreceptors prevented them from connecting with their normal partners. Surprisingly though, removing Loaf from both the eye and the brain solved this problem – the cells, once again, formed the right connections. This suggests that R7 photoreceptors identify their partners by looking for cells that have less Loaf than they do: removing Loaf only from the photoreceptors disrupts this balance, leaving the cells unable to find their match. Another unexpected discovery was that Loaf is not present on the surface of cells, but instead occupies internal structures involved in protein transport. It may therefore work indirectly by controlling the movement of proteins to the cell surface.

These findings provide a new way of thinking about how nerve cells connect. In the future, this may help to understand the origins of conditions in which the brain is wired differently, such as schizophrenia and autism.

Introduction

During nervous system development, growing axons must navigate through a complex environment and select the correct synaptic partners from numerous potential choices. Recognition of cell surface molecules plays an important role in axon guidance and targeting and the establishment of specific synaptic connections (Yogev and Shen, 2014). Interactions between cell surface molecules can lead to either adhesion or repulsion, and their relative levels on different cells are important for appropriate connections to form. For instance, gradients of ephrins and their Eph receptors enable retinal axons to form a topographic map in visual areas of the brain because Eph levels determine the sensitivity to ephrins (Triplett and Feldheim, 2012). In the Drosophila olfactory system, olfactory receptor neurons preferentially connect to projection neurons that express matching levels of the adhesion molecule Teneurin (Hong et al., 2012). As defects in synaptic adhesion molecules can lead to autism and other neurodevelopmental disorders (Van Battum et al., 2015; Gilbert and Man, 2017), identifying mechanisms that regulate synaptic partner choice is likely to enhance our understanding of such human diseases.

The Drosophila visual system has been a fruitful model for investigations of circuit assembly and synaptic specificity (Plazaola-Sasieta et al., 2017). The two color photoreceptors in the fly retina, R7 and R8, project to distinct layers in the medulla, M6 and M3 respectively. The R7 growth cone first actively targets a temporary layer, and then passively reaches its final layer due to the growth of other neuronal processes (Ting et al., 2005; Özel et al., 2015). Early stabilization of the R7 and R8 growth cones in different layers depends on differences in their relative levels of the transcription factor Sequoia (Seq); the adhesion molecule N-cadherin (Ncad) is thought to be the relevant target of Seq in these cells (Petrovic and Hummel, 2008; Kulkarni et al., 2016). Both Ncad and the receptor protein tyrosine phosphatase (RPTP) Lar are required to stabilize R7 terminals in the M6 layer. In the absence of either protein they remain in the M3 layer, although defects are observed earlier in development in Ncad mutants than in Lar mutants (Clandinin et al., 2001; Lee et al., 2001; Maurel-Zaffran et al., 2001; Ting et al., 2005; Özel et al., 2015; Özel et al., 2019). Another RPTP, Ptp69D, is partially redundant with Lar, and the depth of R7 axon termination correlates with the total level of RPTP activity (Newsome et al., 2000; Hofmeyer and Treisman, 2009; Hakeda-Suzuki et al., 2017). Stabilization of R7 contacts also requires the presynaptic proteins Liprin-α and Syd-1 that act downstream of Lar (Choe et al., 2006; Hofmeyer et al., 2006; Holbrook et al., 2012; Özel et al., 2019).

The primary synaptic targets of R7 that are responsible for its function in driving the spectral preference for ultraviolet light are the Dm8 medulla interneurons (Gao et al., 2008; Takemura et al., 2013; Karuppudurai et al., 2014; Ting et al., 2014). These cells fall into two subclasses, yellow (y) and pale (p), and their survival depends on their correct pairing with the appropriate R7 cell subtype, expressing either Rh4 (yR7) or Rh3 (pR7) (Courgeon and Desplan, 2019; Menon et al., 2019). The synapses R7 cells form on Dm8 cells often include the projection neurons Tm5a (for yR7s) or Tm5b (for pR7s) as a second postsynaptic element (Gao et al., 2008; Takemura et al., 2013; Menon et al., 2019). Another interneuron, Dm9, is both pre- and postsynaptic to R7 and R8 and mediates inhibitory interactions between ommatidia (Takemura et al., 2013; Takemura et al., 2015; Heath et al., 2020). It is not known which, if any, of these cell types provide Ncad or RPTP ligands that stabilize filopodia from the R7 growth cone (Yonekura et al., 2007; Hofmeyer and Treisman, 2009; Hakeda-Suzuki et al., 2017; Özel et al., 2019). Glia are also involved in establishing the pattern of R7 synaptogenesis, as they prevent excessive synapse formation through the adhesion protein Klingon (Klg) and its partner cDIP (Shimozono et al., 2019).

Here we identify a novel CUB-LDL domain transmembrane protein, Lost and found (Loaf), that acts in photoreceptors to promote the formation of stable R7 contacts in the M6 layer. R7 mistargeting to the M3 layer is observed when loaf function is lost from photoreceptors, but not in a fully loaf mutant animal. Similar defects can be induced in loaf mutants by expressing Loaf in neurons that include Tm5a, Tm5b, Dm9, and Dm8, suggesting that R7 targeting is disrupted when Loaf is absent from R7 but present in its postsynaptic partners. Loaf does not itself promote cell adhesion and localizes primarily to endosomes. We propose that Loaf controls the trafficking or function of cell surface molecules that are used to match R7 to the correct postsynaptic neurons.

Results

lost and found is required in photoreceptors for normal R7 axon targeting

A microarray-based screen for genes with enriched expression in the R7 and R8 photoreceptors relative to R1-R6 identified CG6024, which encodes an uncharacterized transmembrane protein (Pappu et al., 2011). CG6024 is also a predicted target of Glass (Naval-Sanchez et al., 2013), a transcription factor required for photoreceptor differentiation and axon guidance (Moses et al., 1989; Selleck and Steller, 1991). To test whether CG6024 has a function in axon targeting by R7 or R8, we expressed RNAi transgenes targeting CG6024 with two different drivers: GMR-GAL4 drives expression in all differentiating cell types in the eye (Freeman, 1996), and removing a stop cassette from Actin>CD2>GAL4 with the eye-specific recombinase ey3.5-FLP (Bazigou et al., 2007) leads to RNAi expression in the entire eye disc. In both cases, R8 targeting was unaffected, but we observed a loss of R7 terminals from the M6 layer of the medulla (Figure 1A–C); 30–60% of R7 axons were mistargeted to the M3 layer (Figure 1D–F). This phenotype appears to arise during the second stage of R7 targeting, when filopodia are stabilized to form synapses (Ting et al., 2005; Özel et al., 2019). R7 axons targeted correctly to their temporary layer at 40 hr after puparium formation (APF) when CG6024 was knocked down, but many terminals did not reach or were not stabilized in their permanent target layer, M6, at 60 hr APF (Figure 1G–K). We named the gene lost and found (loaf) based on the failure of R7 axons lacking loaf to find the right target layer and on the rescue of this phenotype discussed below. The Loaf protein contains extracellular CUB and LDLa domains and a predicted transmembrane domain (Figure 2A), making it a candidate to directly mediate target recognition by R7.

loaf RNAi in photoreceptors causes R7 mistargeting.

(A–C, E, F) cryostat sections of adult heads stained for Chaoptin (Chp) to label all photoreceptor axons (magenta in A, B, green in C, E, F), Rh5-GFP and Rh6-GFP to label R8 (green in A, B), 22E09-LexA driving LexAop-myr-tdTomato to label lamina neuron L3, which projects to the M3 layer (magenta in C) or panR7-lacZ to label R7 (magenta in E, F). (A, E) wild type; (B) ey3.5-FLP, Act>CD2>GAL4; UAS-dcr2; UAS-loaf RNAiBL (P{TRiP.JF03040}attP2); (C) GMR-GAL4, UAS-dcr2; UAS-loaf RNAiBL; (F) ey3.5-FLP, Act>CD2>GAL4; UAS-dcr2; UAS-loaf RNAiKK (P{KK112220}VIE-260B). Arrows show examples of R7 mistargeting. White arrowheads indicate the M3 layer and yellow arrowheads the M6 layer. (E’, F’) show enlargements of single R7 axons from (E, F). (D) Quantification of the percentage of R7 axons that failed to reach the M6 layer in the same genotypes. n = 11 (control, GMR > RNAiBL), 16 (ey>RNAiBL), or 9 (ey>RNAiKK). ****p<0.0001 by unpaired t-test. Error bars show mean ± standard error of the mean (SEM) in this and all other graphs. (H–K) Pupal brains stained for Chp (green) and glass (gl)-lacZ, which labels all photoreceptor axons (magenta in H, I) or 22E09-LexA driving LexAop-myr-tdTomato to label L3 neuronal processes in the M3 layer (magenta in J, K). (H, I) Forty hr after puparium formation (APF); (J, K) 60 hr APF. (H, J) wild type (GMR-GAL4, UAS-dcr2/+); (I, K) GMR-GAL4, UAS-dcr2; UAS-loaf RNAiBL. Loss of loaf does not prevent the initial targeting of R7 axons to their temporary layer at 40 hr APF, but many axons fail to project beyond that layer at 60 hr APF. (G) Quantification of the percentage of R7 axons that did not reach the appropriate layer for these genotypes and stages. n = 9 (40 h control), 8 (40 h RNAi, 60 hr control), or 11 (60 h RNAi). ****, p<0.0001 by unpaired t-test with Welch’s correction; ns, not significant. Scale bars, 20 μm.

Figure 2 with 1 supplement see all
R7 is only affected by eye-specific loss of loaf.

(A) Diagrams of the loaf gene and protein. Coding exons, which are identical for the two isoforms, are shown as blue boxes and non-coding exons as white boxes. The region targeted by both RNAi lines, the MiMIC GFP insertion and the extent of the loafΔ20 and loafΔ33 deletions are indicated. These two deletions were independently generated and have minor sequence differences around the cut site. TM, transmembrane domain. (B–G) cryostat sections of adult heads stained for Chp (B, E, G’, green in C, D, red in F, magenta in G), panR7-lacZ (F’, magenta in C, D, blue in F), and GFP (green in F, G). (B) ey3.5-FLP, Act>CD2>GAL4; loaf sgRNAs; UAS-Cas9P2; (C) loafΔ20 homozygote; (D) loafΔ33 homozygote; (E) ey3.5-FLP, Act>CD2>GAL4; UAS-dcr2/UAS-loaf RNAiKK; loafΔ33; (F) loafΔ20 clones positively labeled with lGMR-GAL4, UAS-GFP; (G) loafΔ20 clones expressing UAS-LoafHA with lGMR-GAL4, positively labeled with GFP. Scale bar, 20 μm. (H) quantification of the percentage of R7 axons that failed to reach the M6 layer in the indicated genotypes. n = 10 (loafΔ33/loafΔ20; ey>Cas9, sgRNA; loafΔ20 clones, UAS-LoafHA), 5 (loafRNAi; loafΔ33), 32 (loafΔ33 clones), 12 (loafΔ33 clones, UAS-LoafHA; wild type clones, UAS-LoafHA), 11 (loafΔ33 clones, UAS-Loaf), or 9 (loafΔ20 clones). Error bars show mean ± SEM. ***, p<0.0005; ****, p<0.0001 by unpaired t-test, with Welch’s correction when variances are significantly different. loaf homozygotes show little R7 mistargeting, but are resistant to the effect of loaf RNAi. R7 mistargeting is observed when loaf sgRNAs and Cas9 are expressed in the eye, and in clones homozygous for loaf alleles. This clonal phenotype is rescued by expressing UAS-LoafHA or UAS-Loaf in the mutant cells. (I) Western blot of extracts from wild type and loafΔ33 larval brains using an antibody to the cytoplasmic domain of Loaf and β-tubulin antibody as a loading control. Loaf protein (arrow) is absent in loafΔ33 mutants.

loaf mutant R7 axons show targeting defects only when loaf is present in other cells

In the experiments above, we used two independently generated RNAi lines targeting the same region of the gene to knock down loaf (Figure 2A), both of which produced similar R7 mistargeting phenotypes (Figure 1D). To confirm that this phenotype was due to loss of loaf rather than an off-target effect of the RNAi, we used the CRISPR-Cas9 system to generate deletion alleles that removed the LDLa, transmembrane and cytoplasmic domains of the protein (Figure 2A,I). The sgRNAs were directed against a region of the gene distinct from the RNAi target sequence, and using them to delete the loaf gene in the eye by somatic CRISPR reproduced the R7 targeting defect (Figure 2A,B,H). Surprisingly, germline removal of loaf resulted in homozygous mutant flies that were viable and showed largely normal R7 targeting (Figure 2C,D,H), indicating that global loss of loaf does not affect this process. Expressing loaf RNAi had no effect in this loaf mutant background (Figure 2E,H), confirming that the RNAi phenotype was due to its effect on loaf rather than another gene. Together, these results indicate that the phenotype caused by removing loaf from the eye is dependent on the presence of loaf in the optic lobes. R7 targeting may therefore depend on the amount of Loaf in R7 relative to other cells rather than its absolute presence or absence.

To test this hypothesis, we generated clones of cells in the eye that were homozygous for loaf deletion alleles in an otherwise heterozygous background. As predicted, these showed mistargeting of R7 axons to the M3 layer (Figure 2F,H, Figure 2—figure supplement 1A). The mistargeting was significantly rescued by expressing either HA-tagged or untagged Loaf within the mutant clones (Figure 2G,H, Figure 2—figure supplement 1B–D), confirming that it is due to loss of loaf from photoreceptors. These results could be explained if correct targeting depends on the relative levels of Loaf in R7 and another cell type. Loss of Loaf in R7 when it is present in the other cell type would cause mistargeting. When Loaf is absent from all cells, redundant mechanisms may be sufficient to maintain R7 terminals in the correct layer.

Loaf levels in Dm8, the major synaptic target of R7, do not affect R7 targeting

The medulla interneuron Dm8, which mediates the preference for ultraviolet over visible light, was reported to be the major postsynaptic target of R7 (Gao et al., 2008; Takemura et al., 2013; Ting et al., 2014). We therefore considered the hypothesis that R7 and its postsynaptic partner Dm8 must both express Loaf to form a stable connection (Figure 3F). We first determined the effect of removing loaf function from Dm8. Expressing loaf RNAi or Cas9 and loaf sgRNAs in neurons that include Dm8 cells with DIP-γ-GAL4 or traffic jam (tj)-GAL4 (Carrillo et al., 2015; Courgeon and Desplan, 2019) did not cause any R7 targeting phenotype (Figure 3—figure supplement 1A,B). As it was difficult to assess the reduction in Loaf levels caused by these manipulations, we generated loaf mutant clones in the brain and labeled the mutant Dm8 cells with ortc2b-GAL4 (Ting et al., 2014). R7 axons that contacted the dendrites of mutant Dm8 cells correctly reached the M6 layer, and there was no obvious defect in the position or morphology of the mutant Dm8 dendrites (Figure 3A,B).

Figure 3 with 1 supplement see all
Changing the level of Loaf in Dm8 does not affect R7 targeting.

(A–D) cryostat sections of adult heads stained for Chp (A’-D’, green in A-D), GFP (A’’, B’’, magenta in A, B), panR7-lacZ (red in C), HA (C’’, blue in C), or myrTomato (magenta in D). (A) wild type clones in which Dm8 is labeled with ortc2b-GAL4, UAS-CD8GFP; (B) loafΔ33 clones in which Dm8 is labeled with ortc2b-GAL4, UAS-CD8GFP. A’’ and B’’ show enlargements of labeled Dm8 dendrites. loaf mutant Dm8 dendrites and the R7 axons that target them have the normal position and morphology. (C) UAS-LoafHA; DIP-γ-GAL4, loafΔ33/loafΔ33; (D) tj-GAL4/UAS-LoafHA; loafΔ33/loafΔ33. The arrow in (D’) indicates minor R7 mistargeting that was not statistically significant. Scale bars, 20 μm (A–D), 5 μm (A’’, B’’). (E) quantification of the percentage of R7 axons that failed to reach the M6 layer in the indicated genotypes. n = 10 (loafΔ33/loafΔ20; DIP-γ -GAL4 rescue; tj-GAL4 rescue), or 5 (drf-GAL4 rescue). Error bars show mean ± SEM. ns, not significant by unpaired t-test. Expressing Loaf in Dm8 neurons in a loaf mutant does not cause R7 mistargeting. (F) diagrams explaining the predicted results if Loaf expression in R7 has to match its expression in Dm8. R7 and Dm8 both express Loaf (orange), which is also present in other cells in the brain. Removing loaf from Dm8 (gray) or expressing Loaf in Dm8 in a loaf mutant (gray in R7 and brain) would cause a mismatch and is predicted to result in R7 mistargeting. However, (A–E) show that there is no mistargeting in these situations (observed), indicating that Loaf does not act in Dm8 to regulate R7 targeting.

We predicted that expressing Loaf in Dm8 cells in a loaf mutant background would result in a mismatch between R7 and Dm8 that would be similar to removing loaf from R7 in a wild-type background (Figure 3F). We tested this by expressing UAS-LoafHA in loaf mutant flies with the Dm8 drivers DIP-γ-GAL4, tj-GAL4 and drifter (drf)-GAL4 (Hasegawa et al., 2011; Carrillo et al., 2015; Courgeon and Desplan, 2019), as well as a combination of tj-GAL4 and DIP-γ-GAL4. However, we did not observe significant levels of R7 mistargeting (Figure 3C–E, Figure 3—figure supplement 1C,D), arguing against a requirement for matching Loaf levels in R7 and Dm8.

Loaf levels in cholinergic and glutamatergic neurons influence R7 targeting

Since the presence or absence of Loaf in Dm8 did not appear to affect R7 targeting, we searched for other Loaf-expressing cells that might interact with R7. We used several methods to examine the location of Loaf expression in the brain. RNA-Seq analysis of sorted cell types in the adult brain revealed widespread expression of loaf, although at varying levels (Konstantinides et al., 2018; Davis et al., 2020). However, Loaf translation in photoreceptors reaches its maximum at mid-pupal stages, when R7 axons are targeting the M6 layer (Ting et al., 2005; Zhang et al., 2016), so adult expression levels in other cells might not be reflective of this developmental stage. At pupal stages, we observed that a GFP protein trap insertion in loaf was expressed in many cells in the medulla (Figure 2A, Figure 4—figure supplement 1A). Finally, we generated an antibody that recognizes the cytoplasmic domain of Loaf (Figure 2I). As this antibody cross-reacted with another protein present in the cell bodies of medulla neurons (Figure 4C), we could only evaluate Loaf expression within the neuropil. In pupal brains, Loaf was enriched in specific layers of the medulla neuropil and also in R7 axons and terminals (Figure 4A; Figure 4—figure supplement 1C). This staining was absent in loaf mutants (Figure 4C), and the enrichment in R7 processes was specifically lost when loaf RNAi was expressed with GMR-GAL4 (Figure 4B; Figure 4—figure supplement 1D). The Loaf protein trap was primarily present in cell bodies and was not visibly enriched in R7 axons; we believe that this insertion disrupts the normal localization of the protein, as clones homozygous for the insertion showed R7 mistargeting (Figure 4—figure supplement 1A,B). When misexpressed in photoreceptors, LoafHA was efficiently transported to R7 axons and terminals (Figure 4—figure supplement 1F). Consistent with our findings, recent single-cell RNA-Seq data from dissociated optic lobes show that significant loaf expression is present in almost every cluster throughout the pupal stage, although its levels are generally lower in clusters identified as glia. loaf expression in photoreceptors is highest at P40 and P50, but declines at later stages (Kurmangaliyev et al., 2020; Özel et al., 2021).

Figure 4 with 1 supplement see all
Loaf levels in cholinergic and glutamatergic neurons influence R7 targeting.

(A–C) Pupal brains at 60 hr APF stained for Loaf (A-C, red in A’), Chp (green in A’) and gl-lacZ (blue in A’). (A) wild type; (B) GMR-GAL4, UAS-dcr2; UAS-loaf RNAiBL; (C) loafΔ33. Loaf antibody staining in the medulla neuropil is absent in the loaf mutant (C). Enriched staining in R7 axons (bracket in A) is lost when loaf is knocked down in photoreceptors (B). The antibody appears to cross-react with a protein present in medulla cell bodies, as this staining is still present in loaf mutant brains (C). (D) quantification of the percentage of R7 axons that failed to reach the M6 layer in the indicated genotypes. n = 10 (loafΔ33/loafΔ20; repo-GAL4 rescue), 12 (ey3.5-FLP, Act>CD2>GAL4 rescue), 8 (hth-GAL4 rescue), 11 (bsh-GAL4 rescue), 6 (Vsx-GAL4 rescue), 15 (ap-GAL4 rescue), 16 (ChAT-GAL4 rescue), or 13 (vGlut-GAL4 rescue). Error bars show mean ± SEM. *, p<0.05; **, p<0.01; ns, not significant by unpaired t-test. Expressing Loaf in cholinergic or glutamatergic neurons or in the precursors of cholinergic neurons with ap-GAL4 in a loaf mutant causes R7 mistargeting. (E, F) cryostat sections of adult heads stained for Chp (E’, F’, green in E, red in F), panR7-lacZ (E’’, F’’, red in E, blue in F), HA (blue in E), or GFP (green in F). (E) ap-GAL4/UAS-LoafHA; loafΔ33; (F) ChAT-GAL4, UAS-CD8GFP/UAS-LoafHA; loafΔ33. Scale bars, 20 μm.

Because these data did not identify a specific cell type that would be most likely to interact with R7 using Loaf, we tested whether R7 mistargeting could be induced by expressing Loaf in broad categories of cells in a loaf mutant background. We observed no phenotype when Loaf was expressed in glia with repo-Gal4, or in neuronal populations that expressed homothorax (hth)-GAL4, brain-specific homeobox (bsh)-GAL4, or Visual system homeobox (Vsx)-GAL4 (Hasegawa et al., 2011; Li et al., 2013; Erclik et al., 2017; Figure 4D). Expressing Loaf in photoreceptors with ey3.5-FLP, Act>CD2>GAL4 in a loaf mutant background likewise had no effect on R7 (Figure 4D), indicating that the presence of Loaf in R7 when it is absent in other cells did not impede its targeting. However, we did observe a significant level of R7 mistargeting when Loaf was expressed in neurons that expressed apterous (ap)-GAL4, which is active from the third larval instar (Morante et al., 2011; Li et al., 2013) or in cholinergic neurons with Choline acetyltransferase (ChAT)-GAL4, which is active from mid-pupal stages (Meissner et al., 2019), in a loaf mutant background (Figure 4D–F). ap is expressed in the majority of cholinergic neurons in the medulla (Konstantinides et al., 2018), supporting the idea that cells in this population use Loaf to interact with R7. R7 targeting defects also occurred when Loaf was expressed in glutamatergic neurons in a loaf mutant background with Vesicular glutamate transporter (VGlut)-GAL4, which is active from early pupal stages (Meissner et al., 2019; Figure 4D; Figure 4—figure supplement 1E), indicating that more than one type of neuron interacts with R7 through Loaf.

Loaf levels in the synaptic partners Tm5a/b and Dm9 influence R7 targeting

The populations of cholinergic and glutamatergic neurons include the major synaptic targets of R7, suggesting the possibility that Loaf acts in these cells to influence their interactions with R7. The synapses that R7 forms with Dm8 also include the cholinergic output neurons Tm5a and Tm5b (Gao et al., 2008; Karuppudurai et al., 2014; Menon et al., 2019; Davis et al., 2020). To test the importance of Tm5a/b neurons we used GMR9D03-GAL4, which is expressed in a subset of these cells from early in development (Han et al., 2011; Figure 5—figure supplement 1A,B) to express Loaf in a loaf mutant background. This again produced significant R7 mistargeting (Figure 5A,H), consistent with the hypothesis that Loaf levels in Tm5a/b influence R7. Although GMR9D03-GAL4 is also expressed in lamina neurons L2 and L3 (Akin et al., 2019), restoring Loaf only in lamina neurons with GH146-GAL4 (Schwabe et al., 2014) did not affect R7 (Figure 5H). Importantly, loaf mutant Tm5a/b cells did not have obvious morphological defects or cause R7 mistargeting (Figure 5D,E).

Figure 5 with 2 supplements see all
Expressing Loaf in synaptic partners of R7 in a loaf mutant causes mistargeting.

(A–C) cryostat sections of adult heads stained for Chp. (A) UAS-LoafHA; GMR9D03-GAL4, loafΔ33/loafΔ33; (B) dve-GAL4, vg-GAL4/UAS-LoafHA; loafΔ33; (C) ap-GAL4, tj-GAL4/UAS-LoafHA; loafΔ33. Expressing Loaf in populations of neurons that form synapses with R7 in a loaf mutant background causes R7 mistargeting. (D–G) cryostat sections of adult heads in which clones generated with hs-FLP are labeled in green with UAS-CD8-GFP and R1-8 are stained with anti-Chp (D’, E’, magenta in D-G). (D) wild type and (E) loafΔ33 mutant clones in which Tm5a/b/c and Tm20 are labeled with ortC1a-GAL4. The genotypes are (D) hsFLP, UAS-GFP; ortc1a-GAL4/CyO; FRT80/tub-GAL80, FRT80; (E) hsFLP, UAS-GFP; ortc1a-GAL4/CyO; loafΔ33, FRT80/tub-GAL80, FRT80. (F) wild type and (G) loafΔ33 mutant clones in which Dm9 cells are labeled with GMR64H1-GAL4. The genotypes are (F) hsFLP, UAS-GFP; GMR64H1-GAL4, FRT80/tub-GAL80, FRT 80; (G) hsFLP, UAS-GFP; GMR64H1-GAL4, loafΔ33, FRT80/tub-GAL80, FRT 80. The morphologies of wild type and loaf mutant Tm5 and Dm9 cells appear similar. (H) Quantification of the percentage of R7 axons that failed to reach the M6 layer in the indicated genotypes. n = 10 (loafΔ33/loafΔ20; dve-GAL4 rescue), 12 (GMR9D03-GAL4 rescue), 14 (GH146-GAL4 rescue), 11 (vg-GAL4 rescue), 18 (dve-GAL4 + vg GAL4 rescue), 15 (ap-GAL4 rescue), or 16 (ap-GAL4 +tj GAL4 rescue). Error bars show mean ± SEM. *p<0.05; **p<0.01; ****p<0.0001 by unpaired t-test. (I) model showing that the presence of Loaf in Dm9 or Tm5a/b when loaf is absent in R7 causes R7 mistargeting. Scale bars, 20 μm.

Among glutamatergic neurons, both Dm8 and Dm9 are synaptic partners of R7. Dm9 is a multicolumnar neuron that tracks R7 axons closely and mediates inhibition between neighboring ommatidia (Nern et al., 2015; Heath et al., 2020). The transcription factors Vestigial (Vg) and Defective proventriculus (Dve) are strongly enriched in Dm9 cells (Davis et al., 2020), and dve-GAL4 drives expression in Dm9 (Figure 5—figure supplement 1C), although vg-GAL4 expression was not detectable in the adult brain. When used to express Loaf in a loaf mutant background, neither driver alone significantly affected R7 targeting, but the combination had a significant effect (Figure 5B,H), making Dm9 a candidate to provide Loaf that affects R7 targeting. Again, loaf mutant Dm9 cells and their presynaptic R7 axons appeared normal (Figure 5F,G). Finally, we tested whether a contribution of Dm8 might be detectable in combination with other R7 synaptic target cells by restoring Loaf to loaf mutants with both ap-GAL4 and tj-GAL4. This produced significantly more R7 mistargeting than ap-GAL4 alone (Figure 5C,H), suggesting that Dm8 or another tj-GAL4 expressing neuron such as Dm11 (Courgeon and Desplan, 2019), which also projects to the M6 layer (Nern et al., 2015; Figure 5—figure supplement 1D), may contribute to the pool of Loaf that influences R7 targeting. However, Tm5a/b and Dm9 appear to play a more significant role (Figure 5I). Overexpressing Loaf with the GMR9D03-GAL4, dve-GAL4 and vg-GAL4, or ap-GAL4 and tj-GAL4 drivers in a wild-type background did not cause R7 mistargeting (Figure 5—figure supplement 2); because Loaf is normally enriched in R7 terminals, it is possible that the Loaf levels produced in the processes of synaptic partner cells in these overexpression experiments did not exceed those present in R7.

Loaf may act indirectly through cell-surface molecules

To determine whether Loaf could function as a homophilic cell adhesion molecule, we transfected HA-tagged Loaf into S2 cells and conducted cell aggregation assays (Ting et al., 2005; Astigarraga et al., 2018). We did not observe significant aggregation of the transfected cells, although the positive control Sidekick (Sdk) (Astigarraga et al., 2018) induced aggregation under the same conditions (Figure 6A,B, Figure 6—figure supplement 1A). Unlike Sdk, neither tagged nor untagged Loaf showed strong localization to the plasma membrane; most Loaf was present in punctate structures inside the cells (Figure 6C–E). These structures showed partial colocalization with Hepatocyte growth-factor-regulated tyrosine kinase substrate (Hrs) and Rab7 (Figure 6D,E), two markers of late endosomes, but did not colocalize with the recycling endosome marker Rab11-GFP (Figure 6—figure supplement 1C). When expressed in the retina in vivo, LoafHA also partially colocalized with Rab7 and Hrs, but not with the lysosomal markers ADP-ribosylation factor-like 8 (Arl8) or Vacuolar H+-ATPase 55kD subunit (Vha55) (Figure 6F,G,J), and untagged Loaf again showed a similar localization (Figure 6—figure supplement 1D). In clones of cells mutant for the ESCRT complex component Tumor susceptibility gene 101 (TSG101), endocytosed proteins such as Notch accumulate in late endosomes (Moberg et al., 2005), and we found that LoafHA colocalized with Notch (Figure 6—figure supplement 1E), confirming its presence in the endocytic pathway.

Figure 6 with 1 supplement see all
Loaf localizes to endosomes.

(A, B) S2 cells transfected with Act-GAL4, UAS-GFP, and UAS-HASdk (A) or UAS-LoafHA (B) and allowed to aggregate, stained for GFP (green), HA (red) and the ER marker Calnexin 99A (Cnx99A, blue). Sdk localizes to cell contacts and induces aggregation, but Loaf does not. (C) S2 cells transfected with Act-GAL4 and UAS-Loaf, stained with anti-Loaf (green) and Phalloidin (magenta). (D, E) S2 cells transfected with Act-GAL4 and UAS-LoafHA, stained for HA (D’, E’, green in D, magenta in E), Hrs (D’’, magenta in D), or Rab7 (E’’, green in E). Loaf localizes to intracellular vesicles that show some colocalization with Hrs and Rab7. (F, G) Ommatidia from 42 hr APF pupal retinas in clones expressing UAS-LoafHA, stained for HA (F’, G’, green in F, G) Rab7 (F’’, blue in F), Vha55 (red in F), Hrs (G’’, blue in G), and Arl8 (red in G). Loaf colocalizes with the endosomal markers Rab7 and Hrs, but not the lysosomal markers Vha55 and Arl8, in photoreceptors in vivo. (H, I) S2 cells transfected with Act-GAL4, UAS-HASdk, and UAS-V5Loaf and incubated with antibodies to HA (magenta) and V5 (green) at room temperature prior to fixation (H) or after fixation and permeabilization (I). Sdk is detected on the cell surface and in internalized vesicles without fixation, but Loaf is not. (J) Quantification of the colocalization of LoafHA with Hrs, Rab7, Arl8, and Vha55 in 42 hr APF retinas by Pearson’s correlation. n = 131 ommatidia from 19 retinas (Hrs), 100 ommatidia from 19 retinas (Rab7), 85 ommatidia from 16 retinas (Arl8) or 59 ommatidia from 11 retinas (Vha55). Error bars show mean ± SEM. ****p<0.0001. Scale bars, 20 μm (A) or 5 μm (C–I).

GFP-tagged endogenous Loaf appeared to localize to the cytoplasm of all photoreceptors, but unlike overexpressed Loaf, it was primarily found close to the plasma membrane rather than in late endosomes (Figure 6—figure supplement 1B); as noted above, this tag disrupts the function of the Loaf protein. As a more stringent test of whether Loaf ever reaches the plasma membrane, we transfected S2 cells with a form of Loaf tagged at its extracellular N-terminus with the V5 epitope, and incubated live cells with antibodies to V5. No staining was observed in these conditions (Figure 6H). As controls for this experiment, V5 staining was detected in cells that were fixed and permeabilized, and antibodies to HA detected cotransfected HASdk on the surface of live cells as well as in vesicles internalized during the incubation (Figure 6H,I). These results suggest that Loaf is not itself a cell surface adhesion molecule, but could regulate the trafficking or cell surface localization of proteins involved in cell adhesion or synapse formation.

Loaf interacts with Lar and enhances the function of Lrp4

We next searched for candidate proteins that might be regulated by Loaf. One possibility we considered was Lar, an RPTP that is required for normal R7 targeting (Clandinin et al., 2001; Maurel-Zaffran et al., 2001; Hofmeyer and Treisman, 2009). Lar acts in R7 and not the target region (Clandinin et al., 2001; Maurel-Zaffran et al., 2001), so its ligand, which remains unknown, would also have to be regulated by Loaf to account for the effect of Loaf in synaptic partners of R7. To test for a genetic interaction between loaf and Lar, we knocked down these genes using the photoreceptor driver long GMR-GAL4 (lGMR-GAL4) (Wernet et al., 2003). Expression of either loaf RNAi or Lar RNAi with this driver affected only a subset of R7 axons, but simultaneous expression of both RNAi lines had a synergistic effect, causing almost all R7 axons to terminate in the M3 layer (Figure 7A–D). This suggests that Loaf and Lar are involved in the same process. Similarly, loaf knockdown enhanced the mistargeting phenotype of mutations in the downstream gene Liprin-α, although this effect could simply be additive (Figure 7—figure supplement 1G–J). Overexpression of Lar in photoreceptors, either alone or together with Loaf, did not cause any significant defects (Figure 7—figure supplement 1A,B,D). However, overexpression of Lar in loaf mutant photoreceptors could rescue R7 targeting (Figure 7—figure supplement 1C,D), indicating that Lar can compensate for the lack of loaf and is thus unlikely to be its primary effector. Consistent with this conclusion, we found that loaf was not required for HA-tagged Lar to be transported into photoreceptor axons (Figure 7—figure supplement 1E,F).

Figure 7 with 2 supplements see all
loaf genetically interacts with Lar and Lrp4.

(A–C) Cryostat sections of adult heads stained for Chp (green) and panR7-lacZ (magenta). (A) lGMR-GAL4, UAS-dcr2/UAS-Lar RNAi; (B) lGMR-GAL4, UAS-dcr2; UAS-loaf RNAiBL; (C) lGMR-GAL4, UAS-dcr2/UAS-Lar RNAi; UAS-loaf RNAiBL. With this driver, Lar RNAi induces moderate and loaf RNAi mild R7 mistargeting, but the combination has a severe phenotype. (D) Quantification of the percentage of R7 axons that failed to reach the M6 layer in the indicated genotypes. n = 12 (Lar RNAi, Lar RNAi +loaf RNAi) or 11 (loaf RNAi). ****, p<0.0001 by unpaired t-test. (E–G) Cryostat sections of adult heads with clones positively labeled with GFP, stained for Chp (E’, F’, G’, magenta in E-G) and GFP (green). (E) Clones expressing UAS-Lrp4 with lGMR-GAL4. (F) Clones expressing UAS-Lrp4 and UAS-LoafHA with lGMR-GAL4. (C) loafΔ33 clones in which UAS-Lrp4 is expressed with lGMR-GAL4. (H) Quantification of the percentage of labeled R7s of each genotype that show R7 axons clumping together in the M3 (asterisk in F) or M6 (asterisk in E) layers or overshooting the M6 layer (arrow in F). n = 9 heads (UAS-Lrp4, UASLoafHA; loafΔ33 clones, UAS-Lrp4) or 10 (UAS-Lrp4). Error bars show mean ± SEM. ***p<0.001; ****p<0.0001 by multiple t-tests with two-stage linear step-up procedure. Scale bars, 20 μm.

We also investigated LDL receptor related protein 4 (Lrp4), based on its role as a presynaptic organizer in the olfactory system (Mosca et al., 2017), its postsynaptic signaling function at the vertebrate neuromuscular junction (Yumoto et al., 2012), and the requirement for chaperones to promote the trafficking of other LDL family members (Culi et al., 2004; Wagner et al., 2013). We found evidence that the level of Lrp4 can affect R7 targeting and that its effect on R7 is regulated by Loaf. Overexpressing Lrp4 in photoreceptors caused R7 axons to contact each other or hyperfasciculate either in the M3 or M6 layers of the medulla (Figure 7E,H). These defects were more severe, and included overshooting of the M6 layer by some R7 axons, when Lrp4 was coexpressed with Loaf (Figure 7F,H), but were almost absent when Lrp4 was expressed in loaf mutant photoreceptors (Figure 7G,H). Lrp4 overexpression also resulted in abnormal numbers and arrangements of cone and pigment cells in the retina (Figure 7—figure supplement 2A). Again, these defects were more severe when Lrp4 was coexpressed with Loaf, and were not observed when Lrp4 was expressed in loaf mutant cells (Figure 7—figure supplement 2B,C). Although Lrp4HA had a more granular appearance in loaf mutant than in wild-type photoreceptor cell bodies (Figure 7—figure supplement 2D,F), it was still transported into their axons (Figure 7—figure supplement 2E,G), and its level of expression appeared unaffected (Figure 7—figure supplement 2H).

Despite the effect of Loaf on Lrp4 function, Lrp4 is unlikely to fully explain the effects of loaf on R7 targeting, as R7 axons projected normally in Lrp4 mutant clones (Figure 7—figure supplement 2I). Moreover, expressing loaf RNAi in photoreceptors resulted in R7 mistargeting even in an Lrp4 null mutant background (Figure 7—figure supplement 2J,K). These results show that Loaf can affect the function of cell surface proteins, and suggest that it could act by regulating Lrp4 and/or other cell surface molecules that act as a readout of its levels to control the interactions between R7 and its postsynaptic partners.

Discussion

Tm5a/b and Dm9 cells provide cues for R7 targeting

The layered arrangement of neuronal processes in the medulla makes R7 axon targeting a sensitive model system in which to elucidate how growth cones select the correct postsynaptic partners. However, it has not been clear which cells are responsible for retaining R7 axons in the M6 layer. The RPTP Lar, which forms a hub for the assembly of presynaptic structures through the adaptor protein Liprin-α (Choe et al., 2006; Hofmeyer et al., 2006; Takahashi and Craig, 2013; Bomkamp et al., 2019), acts in R7 to stabilize filopodia in the M6 layer by promoting synapse formation (Clandinin et al., 2001; Maurel-Zaffran et al., 2001; Özel et al., 2019). Our findings that Lar and loaf show a strong genetic interaction and that Lar overexpression can rescue the loss of loaf suggest that like Lar, Loaf stabilizes synaptic contacts. Although Lar family RPTPs can recognize a variety of ligands (Han et al., 2016), the ligand involved in R7 targeting and its cellular source remain unknown (Hofmeyer and Treisman, 2009). One candidate is Ncad, which is required at an early stage of development in both R7 and medulla neurons, but its widespread expression has made it difficult to determine in which neurons it acts to promote R7 synapse stabilization (Lee et al., 2001; Ting et al., 2005; Yonekura et al., 2007; Özel et al., 2015).

R7 cells form numerous synapses with Dm8 interneurons, which are essential for ultraviolet spectral preference (Gao et al., 2008; Takemura et al., 2013) and fall into two classes that are postsynaptic to either yR7 or pR7 cells (Carrillo et al., 2015). Each R7 subtype promotes the survival of the class of Dm8 cells (y or pDm8) with which it synapses (Courgeon and Desplan, 2019; Menon et al., 2019). The Dm8 dendrites that remain in the absence of R7 cells still project to the M6 layer (Courgeon and Desplan, 2019), but it is not known whether R7 relies on Dm8 for targeting or survival information. Many synapses between R7 and Dm8 also include the projection neurons Tm5a (yR7) or Tm5b (pR7) as a second postsynaptic element (Gao et al., 2008; Takemura et al., 2015; Menon et al., 2019). In addition, Dm9 interneurons are both pre- and postsynaptic to R7 and mediate center-surround inhibition, similarly to horizontal cells in the mammalian retina (Takemura et al., 2013; Takemura et al., 2015; Heath et al., 2020). Our data indicate that the level of Loaf in Tm5a/b and Dm9 is more important for R7 targeting than its level in Dm8, suggesting that these cells may determine the stability of R7 contacts in the M6 layer. However, we cannot rule out the possibility that the drivers we used to express Loaf in Dm8 did not cause a phenotype because the level or timing of expression was not optimal.

An excess of Loaf in the postsynaptic cells may destabilize R7 connections

Our observation that the absence of Loaf from R7 only causes a phenotype when Loaf is present in its postsynaptic partners implies that Loaf is not essential for R7 targeting. In loaf mutants, redundant mechanisms must stabilize R7 terminals in the M6 layer; cell surface protein interactions often only specify a preference for one synaptic partner over another (Xu et al., 2019). Synaptic connections may not form entirely normally in these conditions, as loaf mutants show a reduced sensitivity to ultraviolet light when compared to isogenic controls (C.-H. Lee, pers. comm.). Importantly, R7 mistargeting is much more striking when loaf is absent from photoreceptors, but present in the brain. We were able to reproduce this mistargeting by expressing loaf only in subsets of neurons in the brain that include the major postsynaptic partners of R7. The most parsimonious explanation for these phenotypes is that a mismatch in Loaf expression between R7 and its partners results in mistargeting. A similar phenomenon was observed for the homophilic cell adhesion molecule Klingon, which affects synapse formation when removed from either R7 or glial cells, but not when removed from both simultaneously (Shimozono et al., 2019). Matching pre- and postsynaptic levels are also important for the Drosophila Teneurin proteins to promote synapse formation (Hong et al., 2012; Mosca et al., 2012). This type of level matching, in which the presence of a protein in only one of the two partners is more deleterious than its absence from both, is well suited to refining synaptic specificity by eliminating inappropriate connections.

Interestingly, Loaf matching seems to be asymmetric; R7 mistargeting results if Loaf is absent in R7 and present in the postsynaptic cell, but not if it is absent in the postsynaptic cell and present in R7 (Figure 5I). It is possible that matching levels in some way neutralize the activity of Loaf, or of a cell surface molecule regulated by Loaf. An excess of this molecule on the postsynaptic cell might prevent it from initiating or stabilizing synapses with R7, or drive it to preferentially connect with other neurons. However, the asymmetry could also reflect the presence of Loaf in multiple postsynaptic cells; loss of loaf from only one cell type may not be sufficient to disrupt R7 targeting.

Loaf may control the trafficking of a cell surface molecule

Our results suggest that Loaf does not itself act as a cell surface adhesion molecule. When epitope-tagged or untagged forms of Loaf are overexpressed in photoreceptors or cultured cells, they localize to intracellular vesicles that include endosomes and do not appear to reach the cell surface. In addition, they do not induce cell aggregation, further arguing against a homophilic adhesion function. CUB domains are present in a variety of functionally distinct proteins, and are thought to bind protein ligands, sometimes in combination with calcium ions (Gaboriaud et al., 2011). Some CUB domain proteins are involved in endocytosis of other molecules (Moestrup and Verroust, 2001; Xu and Wang, 2016), while members of the Neuropilin and Tolloid-like (Neto) family of CUB-LDL proteins are required for the normal localization and activity of glutamate receptors and other postsynaptic proteins (Zheng et al., 2004; Kim et al., 2012; Ramos et al., 2015; Sheng et al., 2015). It is thus possible that Loaf controls the level of other proteins on the cell surface by mediating their trafficking or endocytosis. The endosomal protein Commissureless functions in this manner, by trafficking the Roundabout axon guidance receptor directly from the Golgi to endosomes so that it does not reach the cell surface (Keleman et al., 2002). In another example, Rab6 and its activator Rich traffic Ncad to the cell surface, facilitating R7 targeting (Tong et al., 2011). Differences in Neurexin levels between axons and dendrites are also dependent on endocytosis and sorting (Ribeiro et al., 2019), and trafficking of synaptic adhesion molecules in general is highly regulated (Ribeiro et al., 2018).

Consistent with this model, we found that loss or gain of Loaf affects the function of coexpressed Lrp4, a presynaptic organizer in the olfactory system that has postsynaptic functions at mammalian neuromuscular junctions (Yumoto et al., 2012; Mosca et al., 2017). However, Lrp4 alone cannot explain the effects of Loaf, as removing loaf from photoreceptors still affects R7 targeting in an Lrp4 null mutant. Loaf may act through a protein similar to Lrp4, or through a combination of proteins. Alternatively, it is possible that under some conditions, perhaps in the presence of other interacting proteins, Loaf itself can reach the cell surface and function there. Some synaptic organizing molecules are transported to axons in lysosome-related vesicles and secreted in a regulated manner (Arantes and Andrews, 2006; Vukoja et al., 2018; Ibata et al., 2019). Further study of the mechanism of Loaf action will provide insight into the cellular mechanisms that enable synaptic connections to be stabilized only on the appropriate cells as neural circuits develop.

Note added in proof

Further studies by the authors have revealed that GMR9D03-GAL4 is also expressed in other transmedullary neurons such as Tm15 and Tm25, raising the possibility that Loaf in these neurons could contribute to R7 targeting.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Drosophila melanogaster)loafFlybaseFLYB: FBgn0036202CG6024
Genetic reagent (D. melanogaster)Rh5-GFPBloomington Drosophila Stock CenterBDSC:8600
FLYB: FBti0038634
FlyBase Symbol: P{Rh5-EGFP.P}
Genetic reagent (D. melanogaster)Rh6-GFPBloomington Drosophila Stock CenterBDSC:7461
FLYB: FBti0038637
FlyBase Symbol: P{Rh6-EGFP.P}
Genetic reagent (D. melanogaster)gl-lacZMoses and Rubin, 1991FLYB: FBtp0001226FlyBase Symbol: Ecol\lacZ5xglBS.38-1
Genetic reagent (D. melanogaster)R22E09-LexAPecot et al., 2013FLYB: FBtp0108724FlyBase Symbol: P{R22E09-nlsLexA::GADfl}
Genetic reagent (D. melanogaster)LexAop:myrTomatoPecot et al., 2013FLYB: FBtp0141256FlyBase Symbol: M{13xlexAop-tdTomato.IVS.Myr}
Genetic reagent (D. melanogaster)GMR-GAL4Pecot et al., 2013FLYB: FBtp0001315FlyBase Symbol: P{GAL4-ninaE.GMR}
Genetic reagent (D. melanogaster)ey3.5-FLPBloomington Drosophila Stock CenterBDSC:35542
FLYB: FBti0141243
FlyBase Symbol: P{ey3.5-FLP.B}
Genetic reagent (D. melanogaster)Act>CD2>GAL4Bloomington Drosophila Stock CenterBDSC:4780
FLYB: FBti0012408
FlyBase Symbol: P{GAL4-Act5C(FRT.CD2).P}S
Genetic reagent (D. melanogaster)lGMR-GAL4Bloomington Drosophila Stock CenterBDSC: 8605
FLYB: FBti0058798
FlyBase Symbol: P{longGMR-GAL4}
Genetic reagent (D. melanogaster)UAS-loaf RNAiBLBloomington Drosophila Stock CenterBDSC: 28625
FLYB: FBti0127178
FlyBase Symbol: RNAiBL P{TRiP.JF03040}attP2
Genetic reagent (D. melanogaster)UAS-loaf RNAiKKViennna Drosophila Resource CenterVDRC: 102704
FLYB: FBst0474570
FlyBase Symbol: P{KK112220}VIE-260B
Genetic reagent (D. melanogaster)UAS-LarRNAiViennna Drosophila Resource CenterVDRC: 107996
FLYB: FBst0479809
FlyBase Symbol: P{KK100581}VIE-260B
Genetic reagent (D. melanogaster)UAS-dcr2Bloomington Drosophila Stock CenterBDSC: 24650
FLYB: FBti0100275
FlyBase Symbol: P{UAS-Dcr-2.D}
Genetic reagent (D. melanogaster)panR7-lacZHofmeyer et al., 2006FLYB: FBtp0022109FlyBase Symbol: P{PanR7-lacZ}
Genetic reagent (D. melanogaster)nos-Cas9Bloomington Drosophila Stock CenterBDSC: 54591 FLYB: FBti0159183FlyBase Symbol: M{nos-Cas9.P}ZH-2A
Genetic reagent (D. melanogaster)UAS-Cas9-P2Bloomington Drosophila Stock CenterBDSC: 58986
FLYB: FBti0166500
FlyBase Symbol: P{UAS-Cas9.P2}attP2
Genetic reagent (D. melanogaster)DIP-γ-GAL4Carrillo et al., 2015FLYB: FBal0319064FlyBase Symbol: DIP-γMI03222-GAL4
Genetic reagent (D. melanogaster)tj-GAL4NP1624Kyoto Drosophila Stock CenterKyoto: 104055 FLYB: FBst0302922FlyBase Symbol: P{GawB}NP1624/CyO
Genetic reagent (D. melanogaster)drf-GAL4Brody et al., 2012FLYB: FBal0270054FlyBase Symbol: GAL4vvl.43
Genetic reagent (D. melanogaster)loafMiMIC-GFSTFBloomington Drosophila Stock CenterBDSC: 64464 FLYB: FBti0181845FlyBase Symbol: Mi{PT-GFSTF.1}CG6024MI00316-GFSTF.1
Genetic reagent (D. melanogaster)ap-GAL4Bloomington Drosophila Stock CenterBDSC: 3041 FLYB: FBti0002785FlyBase Symbol: P{GawB}apmd544
Genetic reagent (D. melanogaster)ChAT-GAL4Bloomington Drosophila Stock CenterBDSC: 6798 FLYB: FBti0024050FlyBase Symbol: P{ChAT-GAL4.7.4}
Genetic reagent (D. melanogaster)repo-GAL4Bloomington Drosophila Stock CenterBDSC: 7415 FLYB: FBti0018692FlyBase Symbol: P{GAL4}repo
Genetic reagent (D. melanogaster)hth-GAL4Wernet et al., 2003FLYB: FBti0058519FlyBase Symbol: P{GawB}hthGAL4
Genetic reagent (D. melanogaster)bsh-GAL4Hasegawa et al., 2011FLYB: FBtp0069756FlyBase Symbol: P{bsh-GAL4.H}
Genetic reagent (D. melanogaster)Vsx-GAL4Bloomington Drosophila Stock CenterBDSC: 29031 FLYB: FBti0037957FlyBase Symbol: P{GawB}MzVum
Genetic reagent (D. melanogaster)VGlut-GAL4Bloomington Drosophila Stock CenterBDSC: 26160 FLYB: FBti0076967FlyBase Symbol: P{GawB}VGlutOK371
Genetic reagent (D. melanogaster)GMR9D03-GAL4Bloomington Drosophila Stock CenterBDSC: 40726 FLYB: FBti0152068FlyBase Symbol: P{GMR9D03-GAL4}attP2
Genetic reagent (D. melanogaster)GH146-GAL4Bloomington Drosophila Stock CenterBDSC: 30026 FLYB: FBti0016783FlyBase Symbol: P{GawB}GH146
Genetic reagent (D. melanogaster)dveNP3428-GAL4Kyoto Drosophila Stock CenterKyoto: 113273 FLYB: FBti0035416FlyBase Symbol: P{GawB}dveNP3428
Genetic reagent (D. melanogaster)vg-GAL4Bloomington Drosophila Stock CenterBDSC: 6819 FLYB: FBal0047077FlyBase Symbol: GAL4vg.PM
Genetic reagent (D. melanogaster)ortC1a-GAL4Bloomington Drosophila Stock CenterBDSC: 56519 FLYB: FBti0161257FlyBase Symbol: P{ort-GAL4.C1a}
Genetic reagent (D. melanogaster)ortC2b-GAL4Ting et al., 2014FLYB: FBtp0093983FlyBase Symbol: P{ort-GAL4.C2b}
Genetic reagent (D. melanogaster)GMR64H01-GAL4Bloomington Drosophila Stock CenterBDSC: 39322 FLYB: FBti0137495FlyBase Symbol: P{GMR64H01-GAL4}attP2
Genetic reagent (D. melanogaster)UAS-LarHAHofmeyer and Treisman, 2009FLYB: FBal0193546FlyBase Symbol: LarUAS.Tag:HA
Genetic reagent (D. melanogaster)UAS-Lrp4HAMosca et al., 2017FLYB: FBal0326704FlyBase Symbol: Lrp4UAS.Tag:HA,Tag:FLAG
Genetic reagent (D. melanogaster)Lrp4dalekMosca et al., 2017FLYB: FBal0326703FlyBase Symbol: Lrp4dalek
Genetic reagent (D. melanogaster)Liprin-αoosHofmeyer et al., 2006FLYB: FBal0193553FlyBase Symbol: Liprin-αoos
Genetic reagent (D. melanogaster)GMR9D03-DBDBloomington Drosophila Stock CenterBDSC: 68766 FLYB: FBti0192157FlyBase Symbol: P{R9D03-GAL4.DBD}attP2
Genetic reagent (D. melanogaster)GMR38H04-ADBloomington Drosophila Stock CenterBDSC: 75758 FLYB: FBti0188278FlyBase Symbol: P{R38H04-p65.AD}attP40
Genetic reagent (D. melanogaster)MCFO-1Nern et al., 2015FLYB: FBti0169283FlyBase Symbol: PBac{10XUAS(FRT.stop)myr::smGdP-HA}VK00005-P{10xUAS(FRT.stop)myr::smGdP-V5-THS-10xUAS(FRT.stop)myr::smGdP-FLAG}su(Hw)
Genetic reagent (D. melanogaster)TSG1012Moberg et al., 2005FLYB: FBal0212938FlyBase Symbol: TSG1012
Genetic reagent (D. melanogaster)loafΔ33This paperCRISPR deletion allele; see Materials and methods
Genetic reagent (D. melanogaster)loafΔ20This paperCRISPR deletion allele; see Materials and methods
Genetic reagent (D. melanogaster)UAS-LoafHAThis paperInserted at VK1 attP site
Genetic reagent (D. melanogaster)UAS-LoafThis paperInserted at VK1 attP site
Genetic reagent (D. melanogaster)pCFD4-loaf sgRNAsThis paperInserted at attP40 site
Cell line (D. melanogaster)S2Laboratory of Ruth LehmannFLYB:FBtc0000181; RRID:CVCL_Z992FlyBase symbol: S2-DRSC.
AntibodyAnti-Chp (Mouse monoclonal)Developmental Studies Hybridoma BankCat# 24B10, RRID:AB_528161IF(1:50)
AntibodyAnti-GFP (Chicken polyclonal)Life TechnologiesCat# A10262, RRID:AB_2534023IF(1:400)
AntibodyAnti-HA (Rat monoclonal)Sigma (Roche 3F10)Cat# 11 867 423 001, RRID:AB_390918IF(1:400)
AntibodyAnti-β-galactosidase (Rabbit polyclonal)FisherCat# A11132, RRID:AB_221539IF(1:100)
AntibodyAnti-Ncad (Rat monoclonal)Developmental Studies Hybridoma BankCat# DN-Ex #8, RRID:AB_528121IF(1:50)
AntibodyAnti-DsRed (Rabbit polyclonal)Takara BioCat# 632496, RRID:AB_10013483IF(1:50)
AntibodyAnti-Loaf (Guinea pig polyclonal)Proteintech (this paper)IF(1:400)
WB(1:1000)
See Materials and methods
AntibodyAnti-Cnx99A (Mouse monoclonal)Developmental Studies Hybridoma BankCat# Cnx99A 6-2-1, RRID:AB_2722011IF(1:10)
AntibodyAnti-Hrs (Mouse monoclonal)Developmental Studies Hybridoma BankCat# Hrs 27–4, RRID:AB_2618261IF(1:10)
AntibodyAnti-Rab7 (Mouse monoclonal)Developmental Studies Hybridoma BankCat# Rab7, RRID:AB_2722471IF(1:10)
AntibodyAnti-ATP6V1B1 (Rabbit polyclonal)AbgentCat# AP11538C, RRID:AB_10816749IF(1:200)
AntibodyAnti-Arl8 (Rabbit polyclonal)Developmental Studies Hybridoma BankCat# Arl8, RRID:AB_2618258IF(1:200)
AntibodyAnti-Elav (Rat monoclonal)Developmental Studies Hybridoma BankCat# Rat-Elav-7E8A10 anti-elav, RRID:AB_528218IF(1:100)
AntibodyAnti-Notch (Mouse monoclonal)Developmental Studies Hybridoma BankCat# C17.9C6, RRID:AB_528410IF(1:10)
AntibodyAnti-Arm (Mouse monoclonal)Developmental Studies Hybridoma BankCat# N2 7A1 Armadillo, RRID:AB_528089IF(1:10)
AntibodyAnti-GFP (Sheep polyclonal)BioRadCat# 4745–1051, RRID:AB_619712IF(1:200)
AntibodyAnti-RFP (Rabbit polyclonal)MBL InternationalCat# PM005, RRID:AB_591279IF(1:500)
AntibodyAnti-V5 (Rabbit polyclonal)AbcamCat# ab9116, RRID:AB_307024IF(1:1000)
AntibodyAnti-FLAG (Mouse monoclonal)SigmaCat# F3165, RRID:AB_259529IF(1:500)
AntibodyAnti-Dac (Mouse monoclonal)Developmental Studies Hybridoma BankCat# mAbdac2-3, RRID:AB_528190IF(1:40)
AntibodyAnti-Bsh (Rabbit polyclonal)Özel et al., 2021IF(1:1800)
AntibodyAnti-Runt (Guinea pig polyclonal)Genscript (this paper)IF(1:600)
See Materials and methods
AntibodyAnti-β-tubulin (Mouse monoclonal)SigmaCat# T4026, RRID:AB_477577WB (1:10,000)
Recombinant DNA reagentUAS-HASdkAstigarraga et al., 2018In UASt-attB
Recombinant DNA reagentUAS-LoafHADrosophila Genomics Resource CenterClone UFO07678In UASt-attB
Recombinant DNA reagentUAS-LoafThis paperSee Materials and methods
Recombinant DNA reagentUAS-V5LoafThis paperSee Materials and methods
Sequence-based reagentLoaf_FThis paperPCR primerCGCACGAACTTTGTGACACT
Sequence-based reagentLoaf_RThis paperPCR primerCTCAAGTCAATCGGTCCTTCC
Commercial assay or kitSuperSignal WestPicoThermoFisherCat # 34579
Software, algorithmFiji-ImageJNIHhttps://fiji.sc/

Fly stocks and genetics

Request a detailed protocol

Fly stocks used were Rh5-GFP (Bloomington Drosophila Stock Center [BDSC] #8600); Rh6-GFP (BDSC #7461); gl-lacZ (Moses and Rubin, 1991), R22E09-LexA, LexAop-myrTomato; GMR-GAL4 (Pecot et al., 2013); ey3.5-FLP, Act>CD2>GAL4 (BDSC #35542 and #4780); lGMR-GAL4 (BDSC #8605); UAS-loaf RNAiBL P{TRiP.JF03040}attP2 (BDSC #28625); UAS-loaf RNAiKK P{KK112220}VIE-260B (Vienna Drosophila Resource Center [VDRC] #102704); UAS-Lar RNAi P{KK100581}VIE-260B (VDRC #107996); UAS-dcr2 (BDSC #24650); panR7-lacZ (Hofmeyer et al., 2006); nos-Cas9 (BDSC #54591); UAS-Cas9-P2 (BDSC #58986); DIP-γ-GAL4 (Carrillo et al., 2015); tj-GAL4NP1624 (Kyoto Stock Center #104055); drf-GAL4 (Brody et al., 2012); Mi{PT-GFSTF.1}CG6024MI00316-GFSTF.1 (BDSC #64464); apmd544-GAL4 (BDSC #3041); ChAT-GAL4 (BDSC #6798); repo-GAL4 (BDSC #7415); hth-GAL4 (Wernet et al., 2003); bsh-GAL4 (Hasegawa et al., 2011); Vsx-GAL4 (BDSC #29031); VGlut-GAL4 (BDSC #26160); GMR9D03-GAL4 (BDSC #40726); GH146-GAL4 (BDSC #30026); dveNP3428-GAL4 (Kyoto Stock Center #113273); vg-GAL4 (BDSC #6819); ortC1a-GAL4 (BDSC #56519); ortC2b-GAL4 (Ting et al., 2014); GMR64H01-GAL4 (BDSC #39322); UAS-LarHA (Hofmeyer and Treisman, 2009); UAS-Lrp4HA; Lrp4dalek (Mosca et al., 2017); Liprin-αoos (Hofmeyer et al., 2006); GMR9D03-DBD (BDSC #68766); GMR38H04-AD (BDSC #75758); MCFO-1 (Nern et al., 2015), and TSG1012 (Moberg et al., 2005). loaf mutant clones and loaf mutant clones overexpressing other proteins were generated using ey3.5-FLP, UAS-CD8GFP; lGMR-GAL4; FRT80, tub-GAL80. loafMiMIC-GFSTF clones were generated using eyFLP; lGMR-GAL4, UAS-myr-tdTomato; FRT80, tub-GAL80. Clones in which specific cell types were labeled were generated by crossing ortC2b-GAL4 (or other GAL4 lines); FRT80 (or FRT80, loafΔ33) to hs-FLP122, UAS-CD8GFP; FRT80, tub-GAL80. Overexpression clones were generated by crossing UAS-LoafHA (or UAS-Loaf, UAS-LarHA or UAS-Lrp4HA); FRT82 to ey3.5-FLP, UAS-CD8GFP; lGMR-GAL4; FRT82, tub-GAL80. To obtain sparse labeling of Tm5a/b/c neurons, flies with the genotype hsflp2PEST; UAS>stop>CD4-tdGFP/CyO; GMR9D03-GAL4 were heat-shocked for 7 min at late L3 stage and dissected in the adult. loaf mutant clones in a background of Lrp4 overexpression were generated by crossing UAS-Lrp4HA; lGMR-GAL4, FRT80, loafΔ33 to eyFLP; FRT80, ubi-RFP. Lrp4 mutant clones were generated using ey-FLP, tub-GAL80, FRT19; lGMR-GAL4, UAS-CD8-GFP. To restore Loaf to specific cell types in a loaf mutant background, tj-GAL4 (or other GAL4 lines); loafΔ33/SM6-TM6B was crossed to UAS-LoafHA, UAS-myrTomato; loafΔ33/SM6-TM6B or to UAS-LoafHA; panR7-lacZ, loafΔ33/SM6-TM6B. GAL4 lines on the third chromosome were recombined with loafΔ33 and recombinants carrying loaf were identified by PCR, except for GAL4 lines inserted at the attP2 site, which is very close to loaf. In these cases, new loaf alleles were directly introduced by CRISPR onto the GAL4 chromosome using nos-Cas9 and our transgenic loaf sgRNA flies, and identified by PCR.

Immunohistochemistry

Request a detailed protocol

Adult heads were dissected in cold 0.1 M sodium phosphate buffer (PB) pH 7.4, fixed in 4% formaldehyde in PB for 4 hr at 4°C and washed in PB. Heads were then submerged in a sucrose gradient (5%, 10%, 20%) and left in 25% sucrose overnight at 4°C for cryoprotection. Heads were embedded in OCT tissue freezing medium and frozen in dry ice/ethanol, and 12 μm sections were cut on a cryostat. Sections were post-fixed in 0.5% formaldehyde in PB for 30 min at room temperature and washed three times in PB with 0.1% Triton (PBT) before incubation with primary antibodies overnight at 4°C. Sections were washed four times for 20 min with PBT and incubated with secondary antibodies for 2 hr at room temperature. Sections were washed again four times for 20 min before mounting in Fluoromount-G (Southern Biotech).

Pupal and adult whole brains were fixed in 4% paraformaldehyde in PBS for 30 min at room temperature, washed 3 times for 10 min in PBST (PBS + 0.4% Triton-X 100) and blocked in PBST +10% donkey serum prior to incubation with primary antibodies overnight at 4°C. For Loaf staining of pupal brains, this incubation was extended to 4 days. Samples were washed in PBST three times for at least 1 hr each and incubated with secondary antibodies for 2.5 hr at room temperature. Samples were washed three times for 20 min in PBST and once in PBS before mounting in SlowFade Gold AntiFade reagent (Life Technologies) on bridge slides. Pupal retinas were fixed in 4% paraformaldehyde in PBS for 30 min on ice, washed for 15 min in PBT and incubated with primary antibodies overnight at 4°C. Retinas were washed three times for 5 min with PBT, incubated with secondary antibodies for 2 hr at 4°C and washed again three times for 5 min before mounting in 80% glycerol in PBS. Confocal images were collected with Leica SP8 and Zeiss LSM510 confocal microscopes.

The primary antibodies used were mouse anti-Chp (1:50; Developmental Studies Hybridoma Bank [DSHB] 24B10), chicken anti-GFP (1:400; Life Technologies), rat anti-HA (1:50; Roche 3F10), rabbit anti-β galactosidase (1:100, Fisher), rat anti-Ncad (1:50; DSHB), rabbit anti-dsRed (1:500; Takara Bio), guinea pig anti-Loaf (1:400, Proteintech), mouse anti-Cnx99A (1:10, DSHB 6-2-1), mouse anti-Hrs (1:10, DSHB 27–4), mouse anti-Rab7 (1:10, DSHB), rabbit anti-ATP6V1B1 (Vha55; 1:200, Abgent), rabbit anti-Arl8 (1:200; DSHB), rat anti-Elav (1:100, DSHB), mouse anti-Notch (1:10; DSHB C17.9C6), mouse anti-Arm (1:10; DSHB N2 7A1), sheep anti-GFP (1:200, Bio-Rad #4745–1051), rabbit anti-RFP (1:500; MBL International #PM005), rabbit anti-V5 (1:1000; Abcam ab9116), mouse anti-FLAG (1:500, Sigma F3165), mouse anti-Dac (1:40; DSHB mAbdac2-3), rabbit anti-Bsh (1:1800)(Özel et al., 2021), and guinea pig anti-Runt (1:600; GenScript). Rhodamine-phalloidin (Invitrogen R415) was used at 1:20. The Loaf polyclonal antibody was made by Proteintech using the cytoplasmic domain (aa 292–378) as an antigen. Guinea pig anti-serum was affinity purified. Guinea pig anti-Runt was made by GenScript using the full-length protein as an antigen. Secondary antibodies (Jackson Immunoresearch and Life Technologies) were coupled to the fluorochromes Cy3, AlexaFluor 488, or AlexaFluor 647.

Quantifications

Request a detailed protocol

To quantify the R7 targeting defect, fluorescent image stacks of 12 μm adult head sections labeled for gl-lacZ, Rh3/4-lacZ, or anti-24B10 were gathered in 0.5 μm steps. Maximum intensity projections were obtained and termini projecting beyond the R8 layer were counted as ‘R7 correctly targeted’ and those stopping in the R8 layer were counted as ‘R7 incorrectly targeted.’ Termini in the R8 layer were counted as total cartridge number per section. The percentage of mistargeting R7s was calculated for each section, except that when the phenotype was scored in photoreceptor clones, the percentage was calculated from all mistargeting R7 axons within clones from all sections. To quantify defects in UAS-LRP4 clones, GFP-labeled R7 termini that contacted each other in the M3 layer were counted as ‘M3 clumping’, while termini hyperfasciculating in the M6 layer were counted as ‘M6 clumping.’ Three termini contacting each other were counted as two instances of M3 or M6 clumping depending on in which layer the clumps resided. GFP-labeled R7 termini that extended past the M6 layer were counted as ‘overshooting.’ A terminus that extended past the M6 layer and turned to contact another clone was counted both as ‘M6 clumping’ and ‘overshooting.’ The percentage of R7s belonging to each of these groups was calculated from all the R7 clones within each section.

To quantify cell aggregates in S2 cell culture experiments, fluorescent image stacks from fixed cells that had been labeled for GFP and HA were gathered in 0.5 μm steps. Each image was examined for GFP positive (control) or GFP and HA-positive (Sdk or Loaf) cells that contacted each other as aggregates. The number of cells in each aggregate was counted for each image. To measure intracellular colocalization, single confocal slices were processed with a median filter with neighborhood of 1 in ImageJ and each channel was linear contrast enhanced to spread values evenly from 0 to 255. A rectangular ROI was drawn around the central region of a single ommatidium and ImageJ was used to calculate Pearson’s correlation coefficient on each region with pixel intensity above a threshold of 16 out of a range of 255, to eliminate background.

Western blotting

Request a detailed protocol

To extract proteins, adult heads were dissected and frozen on dry ice, and then homogenized in Laemmli buffer (4% SDS, 20% glycerol, 120 mM Tris-Cl pH 6.8, 0.02% bromophenol blue, 10% beta-mercaptoethanol). Samples were heated at 95°C for 5 min and loaded onto a SDS-PAGE gel. Gels were run first at 80 volts for 20 min, then 100 volts for the remainder of the time and transferred onto nitrocellulose membranes (Bio-Rad) for one hour at 100 volts. Membranes were washed for 5 min in TBST (20 mM Tris (pH 7.6), 136 mM NaCl, 0.2% Tween-20), and blocked in 5% low-fat milk in TBST solution for one hour. Membranes were incubated overnight with primary antibody in TBST with 5% milk at 4°C, washed three times for 10 min in TBST and incubated in horseradish peroxidase-conjugated secondary antibodies (1:10,000; Jackson ImmunoResearch) at room temperature in TBST with 5% milk for 2 hr. Membranes were washed three times for 10 min in TBST and once for 10 min in TBS. Enhanced chemiluminescence (Thermo SuperSignal WestPico) was used to develop the blots. Primary antibodies used were guinea pig anti-Loaf (1:1000, Proteintech) and mouse anti ß-tubulin (1:10,000; Sigma, T4026).

Cloning and transgenic lines

Request a detailed protocol

UAS-Loaf-FLAG-HA is clone UFO07678 (Drosophila Genomics Resource Center). UAS-Loaf was cloned by inserting an Nhe I/Xba I fragment of clone UFO07678 into the Xba I site of pUAST-attB. Both constructs were integrated into the VK1 PhiC31 site at position 59D3. The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on http://www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al., 2014) by Gibson assembly. The construct was integrated into the attP40 site at 25C6. These flies were crossed to nos-Cas9 flies to make germline mosaic flies. The progeny of these flies were crossed to balancer flies and screened by PCR using primers outside the expected deletion (CGCACGAACTTTGTGACACT and CTCAAGTCAATCGGTCCTTCC). In loafΔ20, the deletion extends from TACGTCGGTGA in gRNA1 through TGCGGG in sgRNA2, creating a frameshift and a stop codon after 30 novel amino acids. loafΔ33 has the final CGGTGA of sgRNA replaced by GATT, and then deletes through TGCGGG in sgRNA2, creating a stop codon immediately following Thr 208 at the end of the CUB domain. Injections and screening of transgenic flies were carried out by Genetivision. A V5-Loaf construct in which the V5 epitope tag (GKPIPNPLLGLDST) was inserted following H90, four residues after the predicted signal peptide cleavage site, was synthesized by GenScript and cloned into pUASTattB using the EcoRI and XbaI sites.

S2 cell culture and aggregation assay

Request a detailed protocol

S2 cells were grown in Schneider’s Drosophila Medium (GIBCO Invitrogen) with 10% heat inactivated fetal bovine serum and 50 units/ml penicillin-50 g/ml streptomycin (GIBCO Invitrogen) at 25°C. Cells were spun down and resuspended in PBS. Poly-L-lysine-treated slides were covered with 0.1–0.2 ml of the cell suspension. Cells were fixed for 10 min at room temperature with 4% paraformaldehyde, permeabilized for 15 min with 0.2% PBT, then blocked with 10% normal donkey serum. Slides were incubated with primary antibodies overnight at 4°C in a humid chamber, washed four times with PBS, and incubated with secondary antibody at room temperature for 1–2 hr. Samples were washed three times with PBS before mounting with Vectashield (Vector Labs). To stain cell surface proteins, cells were incubated with primary antibody in PBS for 2 hr at room temperature prior to fixation. Pictures were collected on a Leica SP8 confocal microscope.

For aggregation assays, S2 cells were pelleted 48 hr after transient transfection using Effectene Transfection Reagent (Qiagen) and washed in fresh medium. A total of 2.5 ml of cells at a concentration of 4 × 106 cells/ml were rocked at 50 rpm for at least 3 hr. Plates were then analyzed for the presence of cell aggregates. Pictures were collected on a Zeiss AxioZoom microscope.

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting files.

References

Decision letter

  1. Carol A Mason
    Reviewing Editor; Columbia University, United States
  2. Utpal Banerjee
    Senior Editor; University of California, Los Angeles, United States
  3. Takashi Suzuki
    Reviewer; Tokyo Institute of Technology, Japan

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

Your study on the requirement for the CUB-LDL protein Lost and found (Loaf) in the Drosophila R7 photoreceptor interactions with its target neurons sheds light on our understanding of axon-target cell matching via cell surface proteins, indeed, poorly understood in all species. You demonstrate that when Loaf is absent in R7, the presence of Loaf in synaptic partner neurons is in fact detrimental to R7 targeting. Your precise analyses and model indicate that proper matching depends on the relative levels of Loaf expression in R7 and its synaptic partners. The reviewers were pleased with your amendments and found the results exciting.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting your work entitled "R7 photoreceptor axon targeting requires matching levels of the lost and found protein in R7 and its synaptic partners" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Takashi Suzuki (Reviewer #3).

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered for publication in eLife at this time.

Your study pointing to trafficking of a putative transmembrane protein, to attain matched levels of this protein on R7 and its synaptic partners, in mediating stable synapse formation, was viewed overall favorably by the reviewers. This study could be valuable because although cell surface proteins are thought to mediate cell-cell recognition, few have detected these proteins, or addressed whether quantitative comparisons of the levels of such proteins could mediate synaptic specificity.

Nonetheless, as you can see from the reviews below, and comments in the reviewer consultation session, we thought that while the work is promising, it will require additional data and significant effort before the suggested model is substantiated. Several controls are missing to support the matched levels/competition model, and developmental analysis of expression patterns, levels and mistargeting phenotypes should be included to bolster your arguments. In addition, the language around synaptogenesis needs to be changed unless direct evidence related to synapse development is provided.

Therefore, while we consider the work to have potential, essential additional data is required to support the central claims of the paper. Thus, we request revisions (without a deadline) and encourage you to post the paper to a preprint server along with the reviews from eLife.

Reviewer #1:

In this manuscript the authors focus on the role of Lost and found (Loaf), a CUB-LDL domain protein in R7 axon targeting. The context-specific nature of whether Loaf LOF in photoreceptors causes an R7 mistargeting effect is an interesting result and the authors have proposed a conceptually interesting model to explain the data, i.e. Quantitative comparisons of the levels of Loaf between R7s and their synaptic partners determine appropriate R7 targeting when Loaf levels are matched. However, while the data presented in this manuscript is consistent with the model, the model itself has not been tested sufficiently. Overall, I believe the work is interesting and has potential but requires essential additional data to support the central claims of the paper.

1. The authors suggest that the R7 mistargeting phenotype is the consequence of lower loaf levels in R7s relative to R7 synaptic partners (Tm5a/b and/or Dm9) since removing Loaf from photoreceptors alone results in mistargeting and likewise restoring Loaf in synaptic partners of R7 (Tm5a/b or Dm9) in a loaf mutant also results in mistargeting.

a. If quantitative comparisons of the levels of Loaf are indeed relevant, then an essential experiment is to test whether increasing Loaf levels in the synaptic partners of R7 in a WT background cause mistargeting phenotypes.

b. Similarly, it is important to show that restoring Loaf in photoreceptors only in a loaf mutant background does not result in R7 mistargeting.

c. The authors do not distinguish between a 'matching' vs 'competition' model but data on when during development the mistargeting phenotype occurs may help clarify this- is it a mis-targeting phenotype or a maintenance phenotype?

2. The last section of the manuscript on the potential function of Loaf is largely speculative, though the authors are careful in their use of language.

Reviewer #2:

Our understanding of the molecular mechanisms that control circuit wiring processes remains limited. Using the Drosophila visual system as a model, Jessica Douthit and colleagues in Jessica Treisman's laboratory uncovered a key role for the CUB-LDLa protein Lost and found (Loaf) in regulating the targeting of R7 photoreceptor axons to their correct synaptic layer M6 in the medulla. The authors propose that Loaf, localized in endosomes, regulates the trafficking or function of cell surface molecules, such as the Lrp4 receptor, and, in this way, the formation of stable synapses. The genetic analysis of loaf requirements in adult R7 axons is detailed and thorough. The identification of a novel determinant mediating R7 axon targeting is significant and of wide interest for scientists studying neural circuit wiring. However, by focusing on the analysis of adult phenotypes, the core function of loaf remains unclear.

1. The authors use the term "restoring" loaf to neurons…, but is it indeed restoring? This would imply a removal and subsequent re-expression. Is it rather ectopic expression to increase levels, as only some experiments described rely on rescue approaches?

2. Loaf RNA interference (RNAi) mediated knockdown is described to lead to 30-70% of adult R7 axon mistargeting to the M3 layer. But what is the nature of this defect – is it a failure to stabilize axons followed by subsequent retraction? Or a failure to extend? It is crucial to assess phenotypes during developmental stages to determine as to which step is disrupted and when.

3. The authors test the hypothesis whether Loaf levels need to be matched between R7 axons and putative targets neurons in the medulla, focusing initially on R7 axons and their synaptic partners Dm8. However, this notion would only be justified, if one would know about expression levels of Loaf in pre- and postsynaptic neurons. Indeed, there does not seem to be any detailed information about Loaf expression levels in R7 neurons/cell bodies or axons. Moreover, the authors describe that Loaf is widely expressed in optic lobe neuron cell bodies in the 72 h APF pupal medulla. This seems late, considering that some cell surface molecules mediating targeting in the optic lobe cease expression from mid-pupal development onwards. It would therefore be important to examine expression at stages when defects begin to occur during development compared to controls. The provided image seems to show a gradient of cell body staining in a potentially damaged medulla cortex, and it is therefore not clear to what extent the antibody labeling reflects the real distribution of expression.

4. No defects could be detected when manipulating Loaf expression in specific neurons such as Dm8. However, when knockdown was achieved in large neuron populations such as glutamatergic or cholinergic neurons or those expression apt-Gal4, R7 axon targeting defects would occur. The authors then use this information to pinpoint the relevant partner neurons as Tm5a and b and Dm9. However, again it may seem a question of numbers rather than specificity. This would need to be addressed, possibly by taking into account how many neurons would be affected by each genetic manipulation.

5. The authors argue that R7 neurons match/compare its Loaf levels with multiple synaptic target neurons. But how would this be possible? It would be safer to state that levels may need to be similar, instead of implying an active matching process. Moreover, it is a concern that roles in medulla neurons have been assessed following over-expression of loaf, while reduction or loss do not seem to have an effect.

6. Loaf is localized in endosomes following over-expression. However, endogenous expression appears to be different. What is the evidence that the reporter – CG6024MI00316-GFSTF.1 is reflecting endogenous expression, and truly functioning as a protein trap? And could the authors test whether the ectopic protein was correctly expressed in neurons and their branches? Could the antibody help to get more insights?

7. The authors describe that Loaf regulates the activity of Lrp4. But is it indeed affecting activity or rather trafficking or correct spatio-temporal localization?

8. Defects for Lrp4 over-expression seem to be qualitatively different compared to Loaf related phenotypes. While there is some form of genetic interaction, it could be independent. It is also a concern that Loaf does not seem to affect expression of Lrp4 in line with the proposed role for Loaf. Moreover the "matching" hypothesis, would somehow require that loaf is regulating levels of the same or related molecules on the pre- and post-synaptic side.

9. The authors discuss and propose a role in synapse stabilization, but the study does not assess synapse formation, as the developmental emergence of phenotypes and requirements have not been addressed. The manuscript also alludes to a role in competition for a ligand or space, but this would require a deeper understanding of mutant phenotypes caused by manipulations on the pre- and postsynaptic side to support conclusions in this direction.

Reviewer #3:

The study by Treisman and colleagues addresses the developmental assembly of afferent axons into columnar circuit units, a highly conserved structural feature throughout nervous systems. From gene expression search, authors identified CUB-LDL cell surface protein (and named Loaf (Lost and found)) as a strong candidate for R7 photoreceptor axon guidance. Based on genetic manipulation, gene expression analysis, cell biological studies and cell type specific manipulations of the loaf gene, the authors could show that R7 axons terminate prematurely when the Loaf protein expression level is lower in R7 axons than in that of synaptic partner neurons. Author claims that Loaf localization is limited to intracellular vesicles where it may modulate the trafficking or modification of a transmembrane protein, and, in some way, the molecular system compares the levels of this protein on R7 and its synaptic partner whether or not to form a stable connection.

The manuscript is well written and the presented data are of high quality. The identification of novel players in axon circuit formation provides a new level of understanding about the complexity of the nervous system development. However, regarding the proposed gene function, the manuscript could be more convincing by addressing some issues regarding the function and the localization of Loaf protein.

1. While phenotypic analysis of adult R7 axons are shown, the sequence of developmental events are less clear. The difference between the 2 phenotypes is of importance: whether loaf mutant R7 stops prematurely or retract back from the synaptic layer. The author should show the loaf phenotype in pupal stages to demonstrate that the phenotype is premature stop and retraction. If it is a retraction, it suggests that the loaf function is the stabilization of R7 termini with the synaptic partner, and that the comparison of the Loaf protein is directly taking place at the synaptic sites. And again, if it is a retraction, I would like to see whether there is a strong genetic interaction with Lar hypomorphic mutant, where R7 are partially retracted from M6 layer to M3.

2. I am not 100% convinced from the current data that Loaf protein is not localised at the cell membrane. I must say that some of the transmembrane proteins appear to be strongly localized at internal membranes when transfected to S2 cells. I would like to suggest the authors to "surface label" the transfected S2 cells with antibodies of tagged protein without detergents. I also would like to see how the localization looks like when loaf transgene (UAS-loaf) is over-expressed in R7. The author showed whole-mount brain staining with anti-Loaf antibody (Figure 4B), but it seems that the antibody is trapped at the brain surface due to the high expression at the cortex. I would like to ask the authors to repeat this staining with longer incubation time (3-7 days) and/ or stronger detergents. Since the Mimic localization is shown, but I noticed some of the Mimic-GFP insertion lines cause mislocalization of the transmembrane protein (e.g localization at the cell body only) , I have to say that the Mimic-GFP localization is unreliable in this case.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "R7 photoreceptor axon targeting requires matching levels of lost and found expression in R7 and its synaptic partners" for further consideration by eLife. Your revised article has been reviewed by 3 reviewers and the evaluation has been overseen by Utpal Banerjee as the Senior Editor, and a Reviewing Editor.

In your revised manuscript, you have examined the role of Lost and found (Loaf), a CUB-LDL domain protein in R7 axon targeting. You initially proposed a model to explain the context specific nature of whether Loaf LOF in photoreceptors causes an R7 mistargeting effect that involves comparisons of the levels of Loaf between R7s and (some) of its synaptic partners, resulting in appropriate R7 targeting when Loaf levels are matched. The reviewers all believe that your data are of high quality and provide a new level of understanding of circuit formation.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

Previously, the reviewers were not convinced that the model proposed was sufficiently supported by the data and asked for additional experiments. Now that you have successfully performed these experiments, you have found that the results don't support the original model and in the paper itself, while you qualify your text, it is not clear how loaf levels and matching actually works in this system.

As you state in your rebuttal letter and in the revised Discussion, that "R7 mistargeting results from the presence of Loaf in postsynaptic cells when it is absent in R7, and not necessarily from a quantitative comparison of relative Loaf levels in different cell types". And you further add: "Although the effect of Loaf on Lrp4 cannot fully explain its effect on R7, it at least provides proof of principle that Loaf could act by modulating the function of a cell surface protein." The reviewers and I believe that your paper indeed "makes a good start towards understanding the mechanism of action of this interesting molecule", but that "elucidating its mechanism is likely to be a long-term project."

That said, the reviewers and I in consultation believe that you could amend your very interesting paper primarily through textual changes, toward making the study appropriate for publication.

1. The reviewers did not feel that the model, though intriguing, is sufficiently supported by the data presented. The rebuttal letter is more in line with expressing (and arguing) the findings as they relate to your models and hypothesis, and thus we suggest you draw on you statements in the rebuttal letter that are clear and align with the current data. The Discussion would not need more detail, but it would help to remove complex models and hypotheses about the function of loaf in the Results, and recap a careful interpretation of the findings and a working model in the Discussion.

2. The developmental phenotype is not characterized in depth. You report a lack of defects early, but indeed the image showing this is a different stage than the control, and thus we do not know whether defects therefore represent a "retraction"/stabilization defect. We expect that it should be readily feasible to provide matching images for stages (and the authors might have them already) to strengthen the conclusion about developmental defects.

https://doi.org/10.7554/eLife.65895.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Reviewer #1:

In this manuscript the authors focus on the role of Lost and found (Loaf), a CUB-LDL domain protein in R7 axon targeting. The context-specific nature of whether Loaf LOF in photoreceptors causes an R7 mistargeting effect is an interesting result and the authors have proposed a conceptually interesting model to explain the data, i.e. Quantitative comparisons of the levels of Loaf between R7s and their synaptic partners determine appropriate R7 targeting when Loaf levels are matched. However, while the data presented in this manuscript is consistent with the model, the model itself has not been tested sufficiently. Overall, I believe the work is interesting and has potential but requires essential additional data to support the central claims of the paper.

1. The authors suggest that the R7 mistargeting phenotype is the consequence of lower loaf levels in R7s relative to R7 synaptic partners (Tm5a/b and/or Dm9) since removing Loaf from photoreceptors alone results in mistargeting and likewise restoring Loaf in synaptic partners of R7 (Tm5a/b or Dm9) in a loaf mutant also results in mistargeting.

a. If quantitative comparisons of the levels of Loaf are indeed relevant, then an essential experiment is to test whether increasing Loaf levels in the synaptic partners of R7 in a WT background cause mistargeting phenotypes.

The reviewer wanted us to test whether overexpression of Loaf in the synaptic partners of R7 in a wild-type context caused R7 mistargeting. We have tried overexpressing Loaf using the same GAL4 drivers that produced phenotypes in the rescue experiment: GMR9D03-GAL4, dve-GAL4 + vg-GAL4, and ap-GAL4 + tj-GAL4, but have not observed targeting defects (Figure 5—figure supplement 2). This may be due to the limited sensitivity of our assay, as the mistargeting we observe when Loaf is misexpressed in a loaf mutant background is significant but not severe. It might therefore be difficult for us to detect the effect of a more subtle difference in expression levels. In addition, we now observe that Loaf is normally enriched in R7 terminals, raising the possibility that the overexpression we are able to achieve with these GAL4 lines does not exceed the normal level in R7. In light of these uncertainties, we have revised the Discussion to emphasize that R7 mistargeting results from the presence of Loaf in postsynaptic cells when it is absent in R7, and not necessarily from a quantitative comparison of relative Loaf levels in different cell types.

b. Similarly, it is important to show that restoring Loaf in photoreceptors only in a loaf mutant background does not result in R7 mistargeting.

The reviewer asked us to show that restoring Loaf only in photoreceptors in a loaf mutant background does not cause R7 mistargeting. We have added these data to Figure 4G.

c. The authors do not distinguish between a 'matching' vs 'competition' model but data on when during development the mistargeting phenotype occurs may help clarify this- is it a mis-targeting phenotype or a maintenance phenotype?

The reviewer asked when in development the mistargeting occurs. We have examined 40h APF and 60h APF pupae in which loaf is knocked down in photoreceptors. The first stage of R7 targeting to its temporary layer at 40h appears normal, but there is significant mistargeting at 60h. This suggests that the defect occurs when the initial contacts of R7 and its target cells are first being formed and stabilized, consistent with our matching hypothesis. We have added these data as Figure 1G-K.

2. The last section of the manuscript on the potential function of Loaf is largely speculative, though the authors are careful in their use of language.

The reviewer found the section on the potential function of Loaf largely speculative, but did not suggest a way for us to remedy this. Determining its mechanism of action is technically very challenging, considering its intracellular localization, the absence of information about potential partners, and the difficulty of expressing genes in specific cell types early enough for them to affect synaptogenesis. Although the effect of Loaf on Lrp4 cannot fully explain its effect on R7, it at least provides proof of principle that Loaf could act by modulating the function of a cell surface protein. We think that our paper makes a good start towards understanding the mechanism of action of this interesting molecule, and fully elucidating its mechanism is likely to be a long-term project.

Reviewer #2:

Our understanding of the molecular mechanisms that control circuit wiring processes remains limited. Using the Drosophila visual system as a model, Jessica Douthit and colleagues in Jessica Treisman's laboratory uncovered a key role for the CUB-LDLa protein Lost and found (Loaf) in regulating the targeting of R7 photoreceptor axons to their correct synaptic layer M6 in the medulla. The authors propose that Loaf, localized in endosomes, regulates the trafficking or function of cell surface molecules, such as the Ldl4 receptor, and, in this way, the formation of stable synapses. The genetic analysis of loaf requirements in adult R7 axons is detailed and thorough. The identification of a novel determinant mediating R7 axon targeting is significant and of wide interest for scientists studying neural circuit wiring. However, by focusing on the analysis of adult phenotypes, the core function of loaf remains unclear.

1. The authors use the term "restoring" loaf to neurons…, but is it indeed restoring? This would imply a removal and subsequent re-expression. Is it rather ectopic expression to increase levels, as only some experiments described rely on rescue approaches?

The reviewer questioned our use of the term “restoring” Loaf function. We only use this term for experiments in which we supply Loaf to specific cell types in a loaf mutant background, which the reviewer appears to agree is an appropriate use of the word.

2. Loaf RNA interference (RNAi) mediated knockdown is described to lead to 30-70% of adult R7 axon mistargeting to the M3 layer. But what is the nature of this defect – is it a failure to stabilize axons followed by subsequent retraction? Or a failure to extend? It is crucial to assess phenotypes during developmental stages to determine as to which step is disrupted and when.

The reviewer thought that we should look at the effects of loss of loaf earlier in development to determine whether the phenotype is a failure of axonal extension or a later retraction. As described in the response to reviewer 1 point 1c, we have now shown that the phenotype arises during the second stage of R7 targeting (Figure 1G-K). Other studies have shown that there is no active axonal extension during the second stage, and phenotypes that arise at this time, as in Lar mutants, have been interpreted as a failure to form stable synaptic contacts. This results in R7 terminals becoming separated from their target dendrites as these are displaced down to the M6 layer (Ozel et al., 2015, 2019).

3. The authors test the hypothesis whether Loaf levels need to be matched between R7 axons and putative targets neurons in the medulla, focusing initially on R7 axons and their synaptic partners Dm8. However, this notion would only be justified, if one would know about expression levels of Loaf in pre- and postsynaptic neurons. Indeed, there does not seem to be any detailed information about Loaf expression levels in R7 neurons/cell bodies or axons. Moreover, the authors describe that Loaf is widely expressed in optic lobe neuron cell bodies in the 72 h APF pupal medulla. This seems late, considering that some cell surface molecules mediating targeting in the optic lobe cease expression from mid-pupal development onwards. It would therefore be important to examine expression at stages when defects begin to occur during development compared to controls. The provided image seems to show a gradient of cell body staining in a potentially damaged medulla cortex, and it is therefore not clear to what extent the antibody labeling reflects the real distribution of expression.

The reviewer wanted us to provide more information about Loaf expression in R7 and in medulla neurons. This is quite difficult to do, because of the widespread expression of Loaf in the optic lobes and the cross-reactivity of our antibody with a protein present in cell bodies. This was our second attempt to make an antibody; the first did not work at all. The reviewer also asked us to look at Loaf expression in the medulla at earlier pupal stages. We have now found that in 40h and 60h APF pupae, Loaf is enriched in R7 axons and terminals in the medulla, and that this enrichment is lost when loaf is knocked down in photoreceptors. We have replaced the original Figure 4B, C with these data, which are shown in Figure 4A-C and Figure 4—figure supplement 1C, D.

4. No defects could be detected when manipulating Loaf expression in specific neurons such as Dm8. However, when knockdown was achieved in large neuron populations such as glutamatergic or cholinergic neurons or those expression apt-Gal4, R7 axon targeting defects would occur. The authors then use this information to pinpoint the relevant partner neurons as Tm5a and b and Dm9. However, again it may seem a question of numbers rather than specificity. This would need to be addressed, possibly by taking into account how many neurons would be affected by each genetic manipulation.

The reviewer thought that the effects of loaf restoration with different GAL4 drivers might depend on the number of cells expressing the driver rather than on their identity. Although we cannot fully rule this out, GMR9D03-GAL4 has a strong effect despite being expressed in relatively few cells (Figure 5—figure supplement 1A, B), and dve-GAL4 also appears quite specific to Dm9 (Figure 5—figure supplement 1C).

5. The authors argue that R7 neurons match/compare its Loaf levels with multiple synaptic target neurons. But how would this be possible? It would be safer to state that levels may need to be similar, instead of implying an active matching process. Moreover, it is a concern that roles in medulla neurons have been assessed following over-expression of loaf, while reduction or loss do not seem to have an effect.

The reviewer thought we were overstating our results by saying that R7 must match its Loaf levels to its target neurons, since loss of loaf from medulla neurons does not have an effect on R7. We have now emphasized the asymmetry of this matching process; targeting is abnormal when R7 has less Loaf than its partner neurons, but not vice versa. It is possible that an excess of Loaf in the synaptic partners prevents the contact from being stabilized.

6. Loaf is localized in endosomes following over-expression. However, endogenous expression appears to be different. What is the evidence that the reporter – CG6024MI00316-GFSTF.1 is reflecting endogenous expression, and truly functioning as a protein trap? And could the authors test whether the ectopic protein was correctly expressed in neurons and their branches? Could the antibody help to get more insights?

The reviewer was concerned about the difference in localization between overexpressed Loaf and the tagged endogenous protein. Our improved antibody staining has enabled us to show that there is indeed a difference; the tagged protein shows less localization to the neuropil and no visible enrichment in R7 terminals (Figure 4—figure supplement 1A). We believe that the tag disrupts the localization and function of the protein, as clones homozygous for the MiMIC insertion show R7 mistargeting (Figure 4—figure supplement 1B).

7. The authors describe that Loaf regulates the activity of Lrp4. But is it indeed affecting activity or rather trafficking or correct spatio-temporal localization?

The reviewer asked whether Loaf could be affecting the trafficking or localization of Lrp4 rather than its activity. We meant to use the term “activity” broadly to include all of these possibilities. We have now clarified this in the text. However, we have not been able to detect an effect of loaf on Lrp4 localization to photoreceptor axons (Figure 7—figure supplement 2E, G).

8. Defects for Lrp4 over-expression seem to be qualitatively different compared to Loaf related phenotypes. While there is some form of genetic interaction, it could be independent. It is also a concern that Loaf does not seem to affect expression of Lrp4 in line with the proposed role for Loaf. Moreover the "matching" hypothesis, would somehow require that loaf is regulating levels of the same or related molecules on the pre- and post-synaptic side.

The reviewer points out that the effects of Loaf on Lrp4 would not explain the R7 phenotype caused by loaf, because Lrp4 is only on one side of the synapse and has distinct phenotypes. We did not mean to imply that Lrp4 is the only Loaf-dependent protein relevant for the R7 phenotype; we agree that this is unlikely, since we show that loaf knockdown still disrupts R7 targeting in an Lrp4 mutant background (Figure 7—figure supplement 2J, K). We simply used it as an example to show that Loaf can affect the function of a cell surface protein involved in synapse organization. We have now clarified this in the text.

9. The authors discuss and propose a role in synapse stabilization, but the study does not assess synapse formation, as the developmental emergence of phenotypes and requirements have not been addressed. The manuscript also alludes to a role in competition for a ligand or space, but this would require a deeper understanding of mutant phenotypes caused by manipulations on the pre- and postsynaptic side to support conclusions in this direction.

The reviewer pointed out that we had not addressed synapse formation or the developmental emergence of the phenotype. We have now looked at when the phenotype arises (see point 2) and have removed the language about synaptogenesis. It is difficult to look at synapse formation directly, since simply assessing the distribution of some synaptic markers would not show that the synapse is functional.

Reviewer #3:

[…] The manuscript is well written and the presented data are of high quality. The identification of novel players in axon circuit formation provides a new level of understanding about the complexity of the nervous system development. However, regarding the proposed gene function, the manuscript could be more convincing by addressing some issues regarding the function and the localization of Loaf protein.

1. While phenotypic analysis of adult R7 axons are shown, the sequence of developmental events are less clear. The difference between the 2 phenotypes is of importance: whether loaf mutant R7 stops prematurely or retract back from the synaptic layer. The author should show the loaf phenotype in pupal stages to demonstrate that the phenotype is premature stop and retraction. If it is a retraction, it suggests that the loaf function is the stabilization of R7 termini with the synaptic partner, and that the comparison of the Loaf protein is directly taking place at the synaptic sites. And again, if it is a retraction, I would like to see whether there is a strong genetic interaction with Lar hypomorphic mutant, where R7 are partially retracted from M6 layer to M3.

The reviewer asked us to look at the timing of the mistargeting caused by loss of loaf to determine whether the phenotype is a premature stop or a retraction. As described in the response to reviewer 1 point 1c, we have now shown that the phenotype arises between the first and second stages of R7 targeting (Figure 1G-K). Other studies have shown that there is no active axonal extension during the second stage, and phenotypes that arise during this time, as in Lar mutants, have been interpreted as a failure to stabilize synaptic contacts. This results in R7 terminals becoming separated from their target dendrites as these are displaced down to the M6 layer (Ozel et al., 2015, 2019). The reviewer wanted us to look for a genetic interaction with Lar hypomorphic mutants. Since the loaf phenotype can only be observed with photoreceptor-specific RNAi or in clones, we have done this experiment by combining loaf RNAi with Lar RNAi. We find that with the lGMR-GAL4 driver, loaf RNAi has a weak effect on R7 and Lar RNAi an intermediate one, but combining the two produces almost complete R7 mistargeting (Figure 7A-D). This synergistic effect suggests that both genes contribute to the same process. Consistent with this conclusion, we find that loaf knockdown also increases R7 mistargeting in Liprin-α mutants, although this effect could simply be additive (Figure 7—figure supplement 1G-J).

2. I am not 100% convinced from the current data that Loaf protein is not localised at the cell membrane. I must say that some of the transmembrane proteins appear to be strongly localized at internal membranes when transfected to S2 cells. I would like to suggest the authors to "surface label" the transfected S2 cells with antibodies of tagged protein without detergents. I also would like to see how the localization looks like when loaf transgene (UAS-loaf) is over-expressed in R7. The author showed whole-mount brain staining with anti-Loaf antibody (Figure 4B), but it seems that the antibody is trapped at the brain surface due to the high expression at the cortex. I would like to ask the authors to repeat this staining with longer incubation time (3-7 days) and/ or stronger detergents. Since the Mimic localization is shown, but I noticed some of the Mimic-GFP insertion lines cause mislocalization of the transmembrane protein (e.g localization at the cell body only), I have to say that the Mimic-GFP localization is unreliable in this case.

The reviewer thought we should investigate whether some Loaf is present on the plasma membrane by surface labeling of transfected cells. Using a V5 tag at the N-terminus of Loaf to look at surface expression in S2 cells, we have found that Loaf cannot be detected on unpermeabilized cells, although another extracellularly tagged cell surface protein, Sdk, is detectable (Figure 6H, I). He or she also suggested staining pupal brains with a longer incubation time and stronger detergents. We thank the reviewer for these helpful suggestions. Our improved pupal brain staining showed that in 40h APF and 60 h APF pupae, Loaf is enriched in R7 axons and terminals in the medulla, and this enrichment is lost when loaf is knocked down in photoreceptors. We have replaced the original Figure 4B, C with these data, which are shown in Figure 4A-C and Figure 4—figure supplement 1C, D. The reviewer also asked to see the localization of Loaf when it is overexpressed in R7. We find that HA-Loaf expressed in clones of photoreceptors is transported to the axons and terminals of R7 and R8 (Figure 4—figure supplement 1F).

[Editors’ note: what follows is the authors’ response to the second round of review.]

[…] The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

Previously, the reviewers were not convinced that the model proposed was sufficiently supported by the data and asked for additional experiments. Now that you have successfully performed these experiments, you have found that the results don't support the original model and in the paper itself, while you qualify your text, it is not clear how loaf levels and matching actually works in this system.

As you state in your rebuttal letter and in the revised Discussion, that "R7 mistargeting results from the presence of Loaf in postsynaptic cells when it is absent in R7, and not necessarily from a quantitative comparison of relative Loaf levels in different cell types". And you further add: "Although the effect of Loaf on Lrp4 cannot fully explain its effect on R7, it at least provides proof of principle that Loaf could act by modulating the function of a cell surface protein." The reviewers and I believe that your paper indeed "makes a good start towards understanding the mechanism of action of this interesting molecule", but that "elucidating its mechanism is likely to be a long-term project."

That said, the reviewers and I in consultation believe that you could amend your very interesting paper primarily through textual changes, toward making the study appropriate for publication.

1. The reviewers did not feel that the model, though intriguing, is sufficiently supported by the data presented. The rebuttal letter is more in line with expressing (and arguing) the findings as they relate to your models and hypothesis, and thus we suggest you draw on you statements in the rebuttal letter that are clear and align with the current data. The Discussion would not need more detail, but it would help to remove complex models and hypotheses about the function of loaf in the Results, and recap a careful interpretation of the findings and a working model in the Discussion.

The reviewers asked us to rewrite the paper to remove the more complex models and bring the interpretations of our results more in line with the way we stated them in the rebuttal letter. We have done this by removing our discussion of the competition model and the diagram of this model in Figure 4, in order to focus on the importance of the relative levels of Loaf in R7 and its synaptic partners. We have also made it clear in the Abstract, Introduction, Results and Discussion sections that we have only shown that the presence of Loaf in synaptic partner neurons when it is absent in R7 is detrimental to R7 targeting, and not that the levels of Loaf in R7 and its synaptic partners need to be precisely matched. We have kept the diagrams in Figures 3 and 5 and included additional panels in Figure 5 to make it a more comprehensive working model, because we think these diagrams will help readers to understand the rationale for and interpretation of the experiments we performed.

2. The developmental phenotype is not characterized in depth. You report a lack of defects early, but indeed the image showing this is a different stage than the control, and thus we do not know whether defects therefore represent a "retraction"/stabilization defect. We expect that it should be readily feasible to provide matching images for stages (and the authors might have them already) to strengthen the conclusion about developmental defects.

The reviewers pointed out that Figure 1I showed GMR-GAL4>loaf RNAi at a later stage of pupal development than the control in Figure 1H. We apologize for this oversight. We had intended to replace these images with better stage-matched examples, but somehow neglected to do so. We have now replaced them with images that more clearly show normal R7 targeting at 40 h APF when loaf is knocked down in photoreceptors, indicating that the defect arises at the second stage when synaptic contacts are stabilized and the R7 terminal passively moves down to the M6 layer.

https://doi.org/10.7554/eLife.65895.sa2

Article and author information

Author details

  1. Jessica Douthit

    Kimmel Center for Biology and Medicine at the Skirball Institute and Department of Cell Biology, NYU School of Medicine, New York, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing - review and editing
    Contributed equally with
    Ariel Hairston
    Competing interests
    No competing interests declared
  2. Ariel Hairston

    Kimmel Center for Biology and Medicine at the Skirball Institute and Department of Cell Biology, NYU School of Medicine, New York, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Writing - review and editing
    Contributed equally with
    Jessica Douthit
    Competing interests
    No competing interests declared
  3. Gina Lee

    Kimmel Center for Biology and Medicine at the Skirball Institute and Department of Cell Biology, NYU School of Medicine, New York, United States
    Contribution
    Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  4. Carolyn A Morrison

    Kimmel Center for Biology and Medicine at the Skirball Institute and Department of Cell Biology, NYU School of Medicine, New York, United States
    Contribution
    Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
  5. Isabel Holguera

    Department of Biology, New York University, New York, United States
    Contribution
    Investigation, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-2796-6596
  6. Jessica E Treisman

    Kimmel Center for Biology and Medicine at the Skirball Institute and Department of Cell Biology, NYU School of Medicine, New York, United States
    Contribution
    Conceptualization, Data curation, Supervision, Funding acquisition, Investigation, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    Jessica.Treisman@med.nyu.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7453-107X

Funding

National Institutes of Health (R01GM089799)

  • Jessica E Treisman

National Institutes of Health (R01NS112211)

  • Jessica E Treisman

National Institutes of Health (F31EY025568)

  • Jessica Douthit

Human Frontier Science Program (LT000757/2017)

  • Isabel Holguera

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Steve Cohen, Max Courgeon, Chi-Hon Lee, Ken Moberg, Tim Mosca, Larry Zipursky, the Bloomington Drosophila Stock Center, the Vienna Drosophila Resource Center, the Kyoto Stock Center, the Drosophila Genomics Resource Center and the Developmental Studies Hybridoma Bank for fly stocks and reagents, and Flybase for invaluable information. We thank Michael Cammer of the NYU Langone Microscopy Laboratory, which is supported by grant P30CA016087, for help with quantifying colocalization. We are grateful to Justine Oyallon for her contributions to the early stages of the project, and to Hui Hua Liu and DanQing He for technical assistance. The manuscript was improved by the critical comments of Hongsu Wang. This work was supported by NIH grants R01GM089799 and R01NS112211 to J.E.T. and by fellowship F31EY025568 to J.D. I.H. was supported by a Human Frontier Science Program postdoctoral fellowship (LT000757/2017).

Senior Editor

  1. Utpal Banerjee, University of California, Los Angeles, United States

Reviewing Editor

  1. Carol A Mason, Columbia University, United States

Reviewer

  1. Takashi Suzuki, Tokyo Institute of Technology, Japan

Version history

  1. Received: December 18, 2020
  2. Accepted: May 17, 2021
  3. Accepted Manuscript published: May 18, 2021 (version 1)
  4. Version of Record published: June 15, 2021 (version 2)

Copyright

© 2021, Douthit et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,289
    Page views
  • 119
    Downloads
  • 1
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jessica Douthit
  2. Ariel Hairston
  3. Gina Lee
  4. Carolyn A Morrison
  5. Isabel Holguera
  6. Jessica E Treisman
(2021)
R7 photoreceptor axon targeting depends on the relative levels of lost and found expression in R7 and its synaptic partners
eLife 10:e65895.
https://doi.org/10.7554/eLife.65895

Further reading

    1. Developmental Biology
    2. Neuroscience
    Xiong Yang, Rong Wan ... Ke Tang
    Research Article

    The hippocampus executes crucial functions from declarative memory to adaptive behaviors associated with cognition and emotion. However, the mechanisms of how morphogenesis and functions along the hippocampal dorsoventral axis are differentiated and integrated are still largely unclear. Here, we show that Nr2f1 and Nr2f2 genes are distinctively expressed in the dorsal and ventral hippocampus, respectively. The loss of Nr2f2 results in ectopic CA1/CA3 domains in the ventral hippocampus. The deficiency of Nr2f1 leads to the failed specification of dorsal CA1, among which there are place cells. The deletion of both Nr2f genes causes almost agenesis of the hippocampus with abnormalities of trisynaptic circuit and adult neurogenesis. Moreover, Nr2f1/2 may cooperate to guarantee appropriate morphogenesis and function of the hippocampus by regulating the Lhx5-Lhx2 axis. Our findings revealed a novel mechanism that Nr2f1 and Nr2f2 converge to govern the differentiation and integration of distinct characteristics of the hippocampus in mice.

    1. Developmental Biology
    2. Evolutionary Biology
    Nico Posnien, Vera S Hunnekuhl, Gregor Bucher
    Review Article

    Gene expression has been employed for homologizing body regions across bilateria. The molecular comparison of vertebrate and fly brains has led to a number of disputed homology hypotheses. Data from the fly Drosophila melanogaster have recently been complemented by extensive data from the red flour beetle Tribolium castaneum with its more insect-typical development. In this review, we revisit the molecular mapping of the neuroectoderm of insects and vertebrates to reconsider homology hypotheses. We claim that the protocerebrum is non-segmental and homologous to the vertebrate fore- and midbrain. The boundary between antennal and ocular regions correspond to the vertebrate mid-hindbrain boundary while the deutocerebrum represents the anterior-most ganglion with serial homology to the trunk. The insect head placode is shares common embryonic origin with the vertebrate adenohypophyseal placode. Intriguingly, vertebrate eyes develop from a different region compared to the insect compound eyes calling organ homology into question. Finally, we suggest a molecular re-definition of the classic concepts of archi- and prosocerebrum.