Augmentation of progestin signaling rescues testis organization and spermatogenesis in zebrafish with the depletion of androgen signaling

  1. Gang Zhai
  2. Tingting Shu
  3. Guangqing Yu
  4. Haipei Tang
  5. Chuang Shi
  6. Jingyi Jia
  7. Qiyong Lou
  8. Xiangyan Dai
  9. Xia Jin
  10. Jiangyan He
  11. Wuhan Xiao
  12. Xiaochun Liu
  13. Zhan Yin  Is a corresponding author
  1. State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, China
  2. College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, China
  3. Chinese Sturgeon Research Institute, China Three Gorges Corporation, China
  4. 5State Key Laboratory of Biocontrol, Institute of Aquatic Economic Animals and Guangdong Provincial Key Laboratory of Improved Variety Reproduction in Aquatic Economic Animals, School of Life Sciences, Sun Yat-Sen University, China
  5. College of Fisheries, Huazhong Agriculture University, China
  6. Key Laboratory of Freshwater Fish Reproduction and Development and Key Laboratory of Aquatic Science of Chongqing, School of Life Science, Southwest University, China
  7. The Innovative Academy of Seed Design, Chinese Academy of Sciences, China

Abstract

Disruption of androgen signaling is known to cause testicular malformation and defective spermatogenesis in zebrafish. However, knockout of cyp17a1, a key enzyme responsible for the androgen synthesis, in ar-/- male zebrafish paradoxically causes testicular hypertrophy and enhanced spermatogenesis. Because Cyp17a1 plays key roles in hydroxylation of pregnenolone and progesterone (P4), and converts 17α-hydroxypregnenolone to dehydroepiandrosterone and 17α-hydroxyprogesterone to androstenedione, we hypothesize that the unexpected phenotype in cyp17a1-/-;androgen receptor (ar)-/- zebrafish may be mediated through an augmentation of progestin/nuclear progestin receptor (nPgr) signaling. In support of this hypothesis, we show that knockout of cyp17a1 leads to accumulation of 17α,20β-dihydroxy-4-pregnen-3-one (DHP) and P4. Further, administration of progestin, a synthetic DHP mimetic, is sufficient to rescue testicular development and spermatogenesis in ar-/- zebrafish, whereas knockout of npgr abolishes the rescue effect of cyp17a1-/- in the cyp17a1-/-;ar-/- double mutant. Analyses of the transcriptomes among the mutants with defective testicular organization and spermatogenesis (ar-/-, ar-/-;npgr-/- and cyp17a-/-;ar-/-;npgr-/-), those with normal phenotype (control and cyp17a1-/-), and rescued phenotype (cyp17a1-/-;ar-/-) reveal a common link between a downregulated expression of insl3 and its related downstream genes in cyp17a-/-;ar-/-;npgr-/- zebrafish. Taken together, our data suggest that genetic or pharmacological augmentation of the progestin/nPgr pathway is sufficient to restore testis organization and spermatogenesis in zebrafish with the depletion of androgen signaling.

Editor's evaluation

Deletion of the androgen receptor leads to testicular malformation and defective spermatogenesis in zebrafish. Paradoxically, simultaneous deletion of the androgen receptor and cyp17a1, a key enzyme in the androgen synthesis pathway, leads to testicular hypertrophy and enhanced spermatogenesis. By analyzing a number of mutant zebrafish lines, the authors have provided new evidence suggesting that an elevation of progestin signaling can compensate for the loss of androgen receptor and progestin promotes testis organization and spermatogenesis via the nuclear progestin receptor.

https://doi.org/10.7554/eLife.66118.sa0

Introduction

Androgens and estrogens exert considerable influence on the formation of primary sex characteristic (PSC) and secondary sex characteristic (SSC) in fish. In the zebrafish model, the steroidogenic pathway in reproduction has been extensively investigated as zebrafish possess several advantages for research, including the ease of germ cells observation, gonadal dissection, fertility capacity assessment, knockout strategy (Crowder et al., 2018; Lau et al., 2016; Li et al., 2020; Lu et al., 2017; Tang et al., 2018; Tang et al., 2016; Yin et al., 2017; Yu et al., 2018; Zhai et al., 2018; Zhu et al., 2015), as well as chemical reagent administration, including estradiol (E2), testosterone (T), 11-ketotestosterone (11-KT), fadrozole, flutamide, and 17α,20β-dihydroxy-4-pregnen-3-one (DHP) (Chen et al., 2013; Fenske and Segner, 2004; Shu et al., 2020; Zhai et al., 2018; Zhai et al., 2017). Based on observations of ar- or npgr-deficient zebrafish, androgen signaling is reported to be essential for sex determination, testis organization, male-typical SSCs, and fertility (Crowder et al., 2018; Li et al., 2020; Tang et al., 2018; Yu et al., 2018; Zhai et al., 2018), while progestin signaling has been suggested to be important for female ovulation (Tang et al., 2016; Wu and Zhu, 2020).

In humans, the CYP17A1 mutation causes pseudohermaphroditism, delay in sexual maturation, and absence of masculinization (Kater and Biglieri, 1994; Marsh and Auchus, 2014; Yanase, 1995; Yanase et al., 1991). In mice, Cyp17a1 knockout leads to infertility and loss of sexual behaviors (Liu et al., 2005). In zebrafish, the knockout of ar, cyp11c1 (encoding 11β-hydroxylase) or cyp11a2 (encoding cytochrome P450 side-chain cleavage enzyme, the first and rate-limiting enzyme for steroid hormone biosynthesis) results in impaired spermatogenesis and disorganized testes, which is accompanied by androgen signaling insufficiency (Crowder et al., 2018; Li et al., 2020; Oakes et al., 2020; Tang et al., 2018; Yu et al., 2018; Zhang et al., 2020). However, as evidenced by a recent study reported from our laboratory, a phenotype of all-male cyp17a1-deficient fish that exhibited reductions of T and 11-KT in plasma and brain samples and loss of male-typical SSCs and mating behaviors with enhanced testicular development and spermatogenesis was observed (Shu et al., 2020; Zhai et al., 2018; Zhai et al., 2017). In another well-known freshwater fish model with an XX/XY genetic sex determination system, medaka, the scl mutant strain carrying a loss-of-function mutation in the cyp17a1 gene also results in the loss of male-typical SSCs while spermatozoa develop normally (Sato et al., 2008). Similarly, results were also observed in another cyprinid fish, the common carp (Cyprinus carpio L.), with cyp17a1 deletion (the cyp17a1-/- XX fish) developed normal testis structure with normal spermatogenesis and sperm capacity, and lost male-typical SSCs. Using artificial fertilization, the neomale common carp were mated with wild-type (WT) females (cyp17a1+/+ XX genotype). We confirmed that all offspring from the neomale-WT female mating have the cyp17a1±XX genotype, and 100.00% normal development of gonads to ovaries (n > 500) (Zhai et al., 2022). However, other than impaired male-typical SSCs, the disorganized testicular development and impaired spermatogenesis were not observed in the cyp17a1-deficient cyprinid fish (zebrafish and common carp) and scl mutant medaka (Sato et al., 2008; Zhai et al., 2022; Zhai et al., 2018), but in tilapia (Yang et al., 2021). Our initial hypothesis was that, compared with the male-typical SSCs and mating behaviors, testicular development and spermatogenesis may not be susceptible to androgen signaling deficiency. Nevertheless, this hypothesis is not supported by the phenotypes of the ar, cyp11a2, and cyp11c1 knockout zebrafish that show disorganized testes and impaired spermatogenesis. Therefore, an alternative pathway might exist in the cyp17a1-/- fish, facilitating testicular development and spermatogenesis when androgen signaling deteriorates.

Progestin signaling is important in mediating spermatogenesis, sperm maturation, and spermiation (Baynes and Scott, 1985; Miura et al., 1992; Tubbs and Thomas, 2008; Vizziano et al., 1996b). However, the npgr loss-of-function models diverged in phenotypes both in male mammals and fish. In mice, homozygous progesterone receptor (Pr) knockout males were fertile as WT and heterozygous male siblings (Lydon et al., 1995). Consistently, no evidence of fertility effects in the npgr knockout male zebrafish has been reported (Tang et al., 2016; Wu and Zhu, 2020). In male tilapia, npgr knockout resulted in disorganized spermatogenic cysts, decreased sperm number, motility, spermatocytes, and spermatozoa, showing the essentiality for the fertility of XY tilapia (Fang et al., 2018). The underlying mechanism of this discrepancy has been only scarcely investigated. We hypothesize that the different requirements for progestin receptors and the alternative between progestin signaling and other pathways (or factors) may contribute to it.

Although an alternative pathway might exist in the cyp17a1-/- fish to facilitate testicular development and spermatogenesis when androgen signaling deteriorates, it had not yet been proposed. The cyp17a1-/- zebrafish generated in our laboratory shows stimulated testicular development and spermatogenesis with deteriorated androgen synthesis (Zhai et al., 2018). In the cyp17a1-/- fish, the accumulation of progestins, DHP, and P4, which are the upstream products of androstenedione and testosterone, was observed, possibly due to the loss of the critical 17α-hydroxylase and 17, 20-lyase activities of Cyp17a1 during gonadal steroidogenesis (Tokarz et al., 2013; Zhai et al., 2018). To dissect the roles of androgen signaling and progestin signaling in adult zebrafish, we established and analyzed a series of deficiency models of sex steroid signaling (cyp17a1-/-, ar-/-, cyp17a1-/-;ar-/-, cyp17a1-/-;ar-/-;npgr-/-, and cyp17a1-/-;ar-/-;fshβ-/-) and initiated a concurrent study of DHP administration in ar-/- males as well. Here, we report that an augmentation of progestin/nuclear progestin receptor (nPgr) signaling can sufficiently compensate for proper spermatogenesis and testis organization when androgen signaling deteriorates in the cyp17a1-/- and cyp17a1-/-;ar-/- zebrafish.

Results

cyp17a1 knockout activates a compensatory pathway that promotes testis organization and spermatogenesis independent of Ar

In the cyp17a1-/- fish at 6 months post-fertilization (mpf), a significant increase in the number of spermatozoa and testicular development was observed (Zhai et al., 2018). We hypothesized that an alternative pathway facilitates testicular development and spermatogenesis in cyp17a1-/- fish. The ar mutation was introduced into the cyp17a1-/- fish to determine whether Ar contributes to the hypertrophic testis and the increase in the number of spermatozoa in the cyp17a1-/- fish. To generate the cyp17a1-/-;ar-/- fish, the double heterozygotes (cyp17a1+/-;ar+/-) among the F1 progeny were crossed. In agreement with previous studies, reduced testis size and defective spermatogenesis in the ar-/- male zebrafish were observed (Crowder et al., 2018; Tang et al., 2018; Yu et al., 2018; Figure 1B and G). However, anatomical examination (Figure 1A–D), Gridpoint Statistical Interpolation (GSI) statistical analysis (Figure 1E), histological analysis (Figure 1F–I), and spermatozoa number analysis (Figure 1J) demonstrated that, compared with that in the control males, the hypertrophic testis and increased spermatogenesis were observed in the cyp17a1-/-;ar-/- fish. These results support the hypothesis that cyp17a1 knockout activates a compensatory pathway that promotes testis organization and spermatogenesis independent of Ar.

The alternative compensatory pathway induced by cyp17a1 depletion is ar-independent.

(A–D) Anatomical examination of the testes from control males, ar-/- males, cyp17a1-/- fish, and cyp17a1-/-;ar-/- fish at 6 months post-fertilization (mpf). Black and green arrows indicate the normal and impaired testis in control males and ar-/- males, respectively, whereas the red arrows indicate the hypertrophic testis in the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish. (E) Gridpoint Statistical Interpolation (GSI) from the fish of the four genotypes at 6 mpf. (F–I) Histological analyses of the testes from control males, ar-/- males, cyp17a1-/- fish, and cyp17a1-/-;ar-/- fish at 6 mpf. Black and green letters of spermatozoa (SZ) indicate the normal and decreased number of SZ in control males and ar-/- males, respectively, whereas the red letters of SZ indicate the increased number of SZ in the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish. (J) Statistical analysis of the SZ number in each lumen of seminiferous tubules from the fish of the four genotypes at 6 mpf. The letters in the bar charts (E) and (J) represent significant differences. SC: spermatocytes; SG: spermatogonia.

DHP and P4 are accumulated in the cyp17a1-/- fish, not in ar-/- males

In our previous studies, we have demonstrated that the concentrations of T and 11-KT in both the plasma and brain were significantly decreased in the cyp17a1-/- fish at 3 mpf (Shu et al., 2020; Zhai et al., 2018; Zhai et al., 2017). Moreover, T and 11-KT restored the loss of male-typical anal fin coloration, breeding tubercles in the pectoral fin, and sexual behaviors when mating with females in the cyp17a1-/- fish (Shu et al., 2020). These results indicate that gonadal steroidogenesis is impaired in cyp17a1-/- fish. In the present study, the concentrations of testis T and 11-KT were evaluated in control males and cyp17a1-/- fish using ELISA. We observed that the testis T and 11-KT concentrations in the cyp17a1-/- fish at 3 mpf were significantly lower than that in the control males (Figure 2—figure supplement 1A and B). Subsequently, the whole-body contents of 11-KT, DHP, and P4 of the control males and cyp17a1-/- fish at 3, 3.5, and 4 mpf were measured using ultra performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS). Compared with their control male siblings at their corresponding stages, a significant decrease in 11-KT and an increase in DHP and P4 were observed in the cyp17a1-/- fish (Figure 2A–C). The whole-body contents of 11-KT, DHP, and P4 of the control males and ar-/- males at 3 mpf were also compared, which did not show any significant difference (Figure 2—figure supplement 2A–C). The phenomena of the increases in DHP and P4 and decrease in 11-KT in the whole-body lysates of cyp17a1-/- fish detected using UPLC-MS/MS were identical to that in the plasma or testes of cyp17a1-/- fish detected using ELISA reported previously (Zhai et al., 2018). These results not only confirmed that androgen biosynthesis is impaired in the cyp17a1-/- fish, but also reminded us that compared with the cyp17a1-/- males that have higher concentrations of DHP and P4 than their control male siblings, the ar-/- males have comparable concentrations of DHP and P4 with their control male siblings.

Figure 2 with 2 supplements see all
The 11-ketotestosterone (11-KT), 17α,20β-dihydroxy-4-pregnen-3-one (DHP), and progesterone (P4) measurements from whole-body lysates of the cyp17a1-/- fish and its control male siblings at 3 months post-fertilization (mpf), 3.5 mpf, and 4 mpf using ultra performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS).

(A) 11-KT, (B) DHP, and (C) P4. *p<0.05; **p<0.01.

Figure 2—source data 1

11-KT, DHP and P4 concentrations measured from whole-body lysate of the cyp17a1-/- fish at respective stages.

https://cdn.elifesciences.org/articles/66118/elife-66118-fig2-data1-v2.xlsx

Progestin signaling is sufficient to compensate the androgen signaling insufficiency

To confirm whether the increased concentration of DHP is responsible for testis organization and spermatogenesis in the cyp17a1-/- fish, ar-/- males were treated with 0.067 µg/mL DHP from 50 to 90 days post-fertilization (dpf). The results of anatomical examination (Figure 3A–D), GSI statistical analysis (Figure 3E), histological analyses (Figure 3F–I), and spermatozoa number analysis (Figure 3J) showed that DHP was sufficient to rescue the phenotypes of testis organization and spermatogenesis in ar-/- males (Figure 3D, E, I, and J). The effective restoration of testis organization and spermatogenesis after DHP treatment in ar-/- males confirmed that the accumulated DHP might facilitate testicular development and spermatogenesis by compensating for the efficiency of androgen signaling in the cyp17a1-/- fish. The ar-/- males after DHP administration showed a more than threefold higher concentration of DHP compared with those reared in the system water (ar-/- males reared in system water: 166.1 ± 70.46, n = 5; ar-/- males reared in DHP: 578.8 ± 379.6, n = 5) (Figure 3K). However, the fertility (sperm capacity) of ar-/- males was not rescued by DHP treatment as the fertilization ratios of ar+/+ males and ar-/- males after the DHP treatment were both significantly downregulated compared with that of ar+/+ males reared in the system water when artificial fecundation was performed with WT females (Figure 3—figure supplement 1).

Figure 3 with 1 supplement see all
17α,20β-Dihydroxy-4-pregnen-3-one (DHP) treatment rescues the testis organization and spermatogenesis in the ar-/- males.

(A, B) Anatomical examination of ar+/+ males and ar-/- males reared in system water. (C, D) Anatomical examination of ar+/+ males and ar-/- males reared in DHP. Green and black arrows indicate the decreased and normal testis, respectively, in the ar-/- males. (E) Gridpoint Statistical Interpolation (GSI) from ar+/+ males and ar-/- males reared in system water and DHP, respectively. (F, G) Histological analyses of testes from ar+/+ males and ar-/- males reared in system water. (H, I) Histological analyses of testes from ar+/+ males and ar-/- males reared in DHP. (J) Statistical analysis of the spermatozoa (SZ) number in each lumen of seminiferous tubules from the ar+/+ males and ar-/- males reared in system water and DHP, respectively. (K) The DHP concentrations measurement of the ar-/- males reared in system water and DHP, respectively. *p<0.05; **p<0.01. n.s., no significance; SC: spermatocytes; SG: spermatogonia.

Figure 3—source data 1

GSI value for Figure 3E; number of sperm per lumen for Figure 3J; DHP concentrations for Figure 3K.

https://cdn.elifesciences.org/articles/66118/elife-66118-fig3-data1-v2.xlsx

The augmentation of progestin pathway facilitates testis organization, and spermatogenesis in the cyp17a1-/-;ar-/- fish depends on nPgr

The significantly elevated concentration of DHP in the cyp17a1-/- fish and the effective restoration of testis organization and spermatogenesis of ar-/- males after DHP treatment reinforce the fact that the in vivo progestin signaling compensates for androgen signaling insufficiency (Figures 2 and 3). Therefore, the npgr mutation was introduced into the cyp17a1-/-;ar-/- fish. To generate the cyp17a1-/-;ar-/-;npgr-/- fish, the triple heterozygotes (cyp17a1+/-;ar+/-;npgr+/-) among the F1 progeny were crossed. The fish of the eight genotypes from the cyp17a1+/-;ar+/-;npgr+/- offspring, including cyp17a1+/+;ar+/+;npgr+/+ males (control males), ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish were analyzed. Compared with that in the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish, the results of the anatomical examination (Figure 4A–H), GSI statistical analysis (Figure 4I), histological analyses (Figure 4J–Q), and spermatozoa number analysis (Figure 4R) demonstrated that the GSI and spermatozoa number were both significantly decreased in the cyp17a1-/-;npgr-/- fish (Figure 4I and R). These results suggest that a potential compensatory role of progestin signaling exists in the cyp17a1-/- fish. On the other hand, compared with that in the cyp17a1-/-;ar-/- fish, testis organization and spermatogenesis failed in the cyp17a1-/-;ar-/-;npgr-/- fish (Figure 4H and Q), which showed a similar pattern in the ar-/- males and ar-/-;npgr-/- males (Figure 4B, G, K and P). In addition, compared with that in the cyp17a1-/- and cyp17a1-/-;ar-/- fish, greater spermatogonia and spermatocytes, and less spermatozoa in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish were observed in the histological analyses of testes (Figure 4J–Q). These results suggest that the compensatory pathway induced by cyp17a1 knockout to promote testis organization and spermatogenesis exists and depends on nPgr.

The alternative compensatory pathway induced by cyp17a1 depletion is npgr-dependent.

(A–H) Anatomical examination of the testes of control males, ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish at 6 months post-fertilization (mpf). Black and green arrows indicate the normal and impaired testis in control males, ar-/- males, npgr-/- males, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish, respectively, whereas the red arrows indicate the hypertrophic testis in the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish. (I) Gridpoint Statistical Interpolation (GSI) from the fish of the eight genotypes at 6 mpf. (J–Q) Histological analyses of the testes from the fish of the eight genotypes at 6 mpf. Black and green letters indicate the normal and decreased number of spermatozoa (SZ) in control males, ar-/- males, npgr-/- males, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish, respectively, whereas the red letters of SZ indicate the increased number of SZ in the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish. (R) Statistical analysis of the SZ number in each lumen of seminiferous tubules from the fish of the eight genotypes at 6 mpf. The letters in the bar charts (I) and (R) represent significant differences. SC: spermatocytes; SG: spermatogonia.

The germ cell marker, Vasa, was examined by immunofluorescence staining in cyp17a1+/+;ar+/+;npgr+/+ males (control males), ar-/- males, cyp17a1-/- fish, cyp17a1-/-;ar-/- fish, and cyp17a1-/-;ar-/-;npgr-/- fish. As reported previously, Vasa signal intensity enriched in the cytoplasm decreases with the differentiation of germ cells from spermatogonia to advanced stages of spermatids and sperm (Dai et al., 2021; Yu et al., 2018). Compared with that in the control males (Figure 5A–C), the results of Vasa immunofluorescence localization showed a reduced number of spermatozoa in the lumen of seminiferous tubules of ar-/- males (Figure 5D–F), and an increased number of spermatozoa in the cyp17a1-/- fish (Figure 5G–I) and cyp17a1-/-;ar-/- fish (Figure 5J–L), again supporting that the reduced number of spermatozoa in the lumen of seminiferous tubules of ar-/- males was rescued after the cyp17a1 knockout (in the cyp17a1-/-;ar-/- fish). However, the restoration failed in the cyp17a1-/-;ar-/- fish with deletion of npgr (in the cyp17a1-/-;ar-/-;npgr-/- fish) (Figure 5M–O), which showed greater spermatogonia, primary spermatocytes and secondary spermatocytes, and less spermatozoa filling in the lumen of seminiferous tubules of cyp17a1-/-;ar-/-;npgr-/- fish (Figure 5O) and the ar-/- males (Figure 5F). These results suggest that spermatogenesis in the ar-/- males and cyp17a1-/-;ar-/-;npgr-/- fish were impaired during the second meiosis phase.

Germ cells were visualized by immunofluorescence staining of Vasa.

(A–C) Control male. (D–F) ar-/- male. (G–I) cyp17a1-/- fish. (J–L) cyp17a1-/-;ar-/- fish. (M–O) cyp17a1-/-;ar-/-;npgr-/- fish. Nuclear DNA was stained with 4',6-diamidino-2-phenylindole (DAPI). White and yellow asterisks in panels (C), (F), and (O) indicate the normal and decreased number of spermatozoa (SZ), respectively, whereas the red asterisks in panels (I) and (L) indicate the increased number of SZ in each lumen of seminiferous tubule. SG: spermatogonia; PSP: primary spermatocyte; SSP: secondary spermatocyte.

Abnormal expression of germ cell differentiation-related genes in the cyp17a1-/-;ar-/-;npgr-/- fish

Comparisons of transcriptome in the testes of the control males, ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish, were performed. For the markers of Leydig cells, the genes related to gonadal steroidogenesis, including star, hsd3β1, cyp11a2, and cyp11c1, were all increased in the testes of ar-/- males, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish. Interestingly, the expression levels of insl3, another specific gene of the Leydig cells, were significantly decreased in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the controls (Figure 6A). For the markers of Sertoli cells, the expression levels of sox9a, amh, dmrt1, igf3, and rxfp2b (the receptor of Insl3) were all decreased in the ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the controls (Figure 6B). For the markers of the germ cells, the expression levels of dazl, vasa, dnd, nanos1, nanos2, piwil1, and piwil2 were all upregulated in the cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the controls, with divergent transcriptional expression patterns in the testes of fish with other genotypes. Notably, rxfp2a (another receptor of Insl3) and the retinoic acid-degrading enzyme cyp26a1 were downregulated and upregulated, respectively, in the cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the control males (Figure 6C and D). The expression levels of hsd3β1, insl3, igf3, dnd, and cyp26a1 were selected and further verified by qPCR (Figure 6E–I).

Figure 6 with 3 supplements see all
Gene expression analyses of testis Leydig cells, Sertoli cells, and germ cells.

(A–D) Heatmap of the candidate genes. (A) The heatmap of star, hsd3β1, cyp11a2, cyp11c1, and insl3 of Leydig cells. (B) The heatmap of sox9a, amh, dmrt1, igf3, and rxfp2b of Sertoli cells. (C) The heatmap of dazl, vasa, dnd, nanos1, nanos2, piwil1, piwil2, and rxfp2a (another receptor of Insl3) of germ cells. (D) The expression of the retinoic acid-degrading enzyme, cyp26a1. (E–H) The expression of the selected genes with qPCR for confirmation of transcriptome analyses. (E) hsd3β1. (F) insl3. (G) igf3. (H) dnd. (I) cyp26a1. The letters in the bar charts represent significant differences.

Subsequently, we analyzed the expression of genes in fish of different genotypes. Since the normal spermatogenesis has been observed in the control males, cyp17a1-/-;ar-/- fish, and cyp17a1-/- fish, while the defective spermatogenesis has been observed in cyp17a1-/-;ar-/-;npgr-/- fish. Therefore, the expressed genes in cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the control males, cyp17a1-/-;ar-/- fish, and cyp17a1-/- fish, respectively, were analyzed and presented in a Venn diagram (Figure 6—figure supplement 1A), which could be used to identify the common transcripts responsible for the normal spermatogenesis course. Out of 1380 annotated genes, we identified a total of 148 differentially expressed genes in the overlapped region, such as the downregulated gonadal somatic cell-derived factor (gsdf), npgr, axonemal dynein assembly factor 3 (dnaaf3), insl3, and upregulated inhibin subunit beta B (inhbb) (Supplementary file 1). The downregulated npgr may have resulted from the npgr deletion-mediated premature mRNA decay in the cyp17a1-/-;ar-/-;npgr-/- fish (El-Brolosy et al., 2019), and the aberrant expression of gsdf, insl3, and inhbb may contribute to the compromised testis organization and spermatogenesis in the cyp17a1-/-;ar-/-;npgr-/- fish.

On the other hand, the defective spermatogenesis has been observed in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish. Therefore, the expressed genes in ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the control males, respectively, were analyzed and summarized in Figure 6—figure supplement 1B, which can help to determine the common transcriptional changes responsible for the defective spermatogenesis. Out of 1315 annotated genes, we identified a total of 111 differentially expressed genes in the overlapped region, such as the downregulated axonemal central pair apparatus protein (hydin), RNA binding motif protein 47 (rbm47), axonemal dynein assembly factor 1 (dnaaf1), outer dense fiber of sperm tails 3B (odf3b), and insl3 (Supplementary file 1). These results demonstrated that phenotypes in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish may be caused by the dysregulated expressions of genes involved in the process of spermatogenesis and structure organization of sperm.

Discussion

Spermatogenesis is a highly coordinated developmental process involving diploid spermatogonia proliferation and differentiation, during which diploid spermatogonial stem cells produce a large number of highly differentiated spermatozoa (Schulz et al., 2010). Progestin signaling, which mainly acts via the progestin receptor expressed in Sertoli cells, is closely related to spermatogenesis (Schulz et al., 2010). First, non-flagellated germ cells in rainbow trout testes can synthesize DHP in the early phase of spermatogenesis (Vizziano et al., 1996a). In salmonid fish, the plasma concentration of DHP peaks during the progression of spermatogonial proliferation (Scott and Sumpter, 1989). Second, DHP treatment induces spermiation in Salmonidae and Cyprinidae (Ueda et al., 1985), increases milt production (Baynes and Scott, 1985), and regulates meiosis in male eels (Miura et al., 2006). In the testis of Nile tilapia, npgr was expressed in Sertoli cells surrounding spermatogonia and spermatids. The treatment with RU486, a synthetic nPgr antagonist, inhibits progestin signaling and disrupts spermatogenesis in Nile tilapia. The expression levels of piwil1, dazl, and sycp3 genes were found to be downregulated in the testes of RU486-treated fish (Liu et al., 2014). The GSI and the expression levels of the germ cell markers piwil1, dazl, and the meiotic marker, sycp3, increased after 2-week E2 exposure in the presence of DHP (Chen et al., 2013). Third, npgr-knockout male tilapia exhibited disorganized spermatogenic cysts, decreased sperm number and motility, as well as spermatocytes and spermatozoa (Fang et al., 2018). Although progestin signaling may play important roles in spermatogenesis, the in vivo evidence and its relationship with androgen signaling are yet to be elucidated, especially in the species that the males with npgr mutation did not exhibit obvious phenotypes in reproduction.

To our knowledge, the cyp17a1-/- zebrafish generated by us is a unique model exhibiting deteriorated androgen signaling but enhanced testicular development and spermatogenesis (Li et al., 2020; Zhai et al., 2018). In our newly generated cyp17a1-/-;ar-/- fish, the phenotype with testicular development and spermatogenesis similar to cyp17a1-/- fish was observed. The introduction of cyp17a1 knockout successfully rescued the impaired testis organization and spermatogenesis in ar-/- males, clearly demonstrating the existence of an alternative androgen-independent signaling pathway promoting testis organization and spermatogenesis in the cyp17a1-/- fish (Figure 1). Zebrafish Ar showed an affinity for the non-androgenic steroid progesterone in the high nanomolar range (de Waal et al., 2008). The abnormalities in the ar-/- male zebrafish rescued by a compensatory mechanism demonstrated that the restorations of the testicular development and spermatogenesis after the introduction of the cyp17a1-deletion are not dependent on Ar (Figure 1). DHP and P4 are the androgen upstream products and accumulate in the cyp17a1-/- fish as measured using ELISA (Zhai et al., 2018) and UPLC-MS/MS (Figure 2). DHP is a fish-specific progestin that might play critical roles in spermatogenesis, sperm maturation, and spermiation (Fang et al., 2018). The administration of DHP effectively restored the phenotypes of GSI and the number of spermatozoa in ar-/- males (Figure 3). In addition, compared with the cyp17a1-/-;ar-/- fish that showed the hypertrophic testis and enhanced spermatogenesis, the cyp17a1-/-;ar-/-;npgr-/- fish exhibited phenotypes of defective spermatogenesis and testis organization, which are also seen in the ar-, cyp11a2-, or cyp11c1-deficient male zebrafish (Li et al., 2020; Oakes et al., 2020; Tang et al., 2018; Yu et al., 2018). These suggest that the accumulated progestin may play an alternative signaling role in promoting testis organization and spermatogenesis, which is independent of androgen signaling (in cyp17a1-/- fish and cyp17a1-/-;ar-/- fish) (Figures 4 and 5).

In mice with knockout of Pr, a member of the nuclear receptor superfamily of transcription factors, homozygous females displayed defects in reproductive tissues. These defects included the inability to ovulate, uterine hyperplasia and inflammation, severely limited mammary gland development, and loss of stereotypical sexual behavior (Lydon et al., 1996). In fact, larger testes and greater sperm production have been observed in male Pr-/- mice (Lue et al., 2013; Schneider et al., 2005). Combined with the observations in the cyp17a1-/- fish and Pr-/- male mice, we speculate that the stimulated effects on spermatogenesis in the testis are not caused by the depleted actions of progestin or androgen signaling. These effects are likely to stem from the highly coordinatively regulated actions of androgen and progestin signaling cascades. In teleosts, various effects of progestins, including oocyte maturation, ovulation, spermatogenesis initiation, and spermatogenesis stimulation, have been previously reported (Chen et al., 2013; Miura et al., 2006; Nagahama and Yamashita, 2008). However, most early studies on teleosts have been conducted through progestin administration without robust genetic studies. Considering this evidence, the unimpaired fertility observed in the npgr homozygous males may be attributed to the presence of androgen signaling (Tang et al., 2016; Zhu et al., 2015). Recently, subfertility has been observed in npgr-deficient male tilapia (Oreochromis niloticus), which provides the first genetic evidence of the functions of progestin signaling in teleost spermatogenesis (Fang et al., 2018). The decreased levels of pituitary follicle-stimulating hormone subunit β (fshβ) and testis follicle stimulating hormone receptor (fshr) in the npgr-deficient tilapia were attributed to impaired spermatogenesis, the decline of milting, and livability of offspring (Fang et al., 2018). Nevertheless, the npgr-deficient male tilapia can successfully sire offspring, which might be due to the presence of androgen signaling, as evidenced by the increased concentration of 11-KT (Fang et al., 2018). On the other hand, the CYP17A1 deficiency in humans and mice results in disorders of sex development and absence of masculinization (Kater and Biglieri, 1994; Liu et al., 2005; Marsh and Auchus, 2014; New, 2003; Yanase, 1995; Yanase et al., 1991), as well as accumulated P4, 11-deoxycorticosterone, and corticosterone (Auchus, 2017). We believe that the role of progestin signaling in facilitating spermatogenesis and testis organization to compensate for androgen signaling insufficiency is highly divergent between fish and mammals. Unfortunately, the DHP content in people with 17-hydroxylase/17,20-lyase deficiency was not measured and analyzed in that previous study (Auchus, 2017).

It has been reported that the activation of the gonadal-pituitary feedback axis was observed in cyp17a1 and cyp19a1a knockout fish, as evidenced by the significant upregulation of pituitary fshβ and lhβ (Li et al., 2020; Tang et al., 2017; Zhai et al., 2018). These mutants also displayed impaired sex steroid biosynthesis, as measured by sex steroid concentrations in homozygous fish (Li et al., 2020; Tang et al., 2017; Zhai et al., 2018). The upregulation of gonadotropins observed in these knockout zebrafish could be attributed to the absence of negative feedback due to androgen or estrogen deficiency (Chen et al., 2017; Tang et al., 2017; Zhai et al., 2018). In the testes of adult zebrafish, Fshβ stimulates the proliferation and differentiation of spermatogonia and its entry into meiosis (Holdcraft and Braun, 2004; Nobrega et al., 2015; Patiño et al., 2001; Ramaswamy and Weinbauer, 2014). This supports the observations in the cyp17a1-/- fish and cyp19a1a-/- fish, as well as our newly generated cyp17a1-/-;ar-/- fish, in which testicular development and spermatogenesis were stimulated (Figure 6—figure supplement 2D, F and J). Compared with that in the cyp17a1-/-;ar-/- fish, the normal GSI and spermatozoa number displayed in cyp17a1-/-;ar-/-; fshβ-/- fish (Figure 6—figure supplement 2E, F and K) also support that the upregulated Fshβ contributes to the hypertrophic testicular development and overactivated spermatogenesis in the cyp17a1-/-;ar-/- zebrafish. By monitoring the expression of pituitary fshβ in fish of the aforementioned eight genotypes, we found that the expression of fshβ was upregulated in the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish. This was an expected result based on our previous study (Zhai et al., 2018). The npgr depletion did not affect pituitary fshβ expression as npgr-/- males and ar-/-;npgr-/- males exhibited comparable fshβ expression to the control males. However, the additional deletion of cyp17a1 significantly upregulated fshβ expression in the males of these genotypes (in the cyp17a1-/-;npgr-/- fish and cyp17a1-/-;ar-/-;npgr-/- fish) (Figure 6—figure supplement 3). These results demonstrated that cyp17a1-/-;ar-/-;npgr-/- fish have impaired spermatogenesis and testis organization, and upregulated pituitary fshβ.

The upregulations of gonadal steroidogenesis-related genes, star, hsd3β1, cyp11a2, and cyp11c1, in Leydig cells were observed in the ar-/- males, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish. The upregulated expression of steroidogenesis-related genes in the ar-/- males has been reported previously (Tang et al., 2018), which may be attributed to the positive feedback effect caused by androgen or progestin signaling insufficiency. Another marker of the Leydig cells, insl3, which has been reported to be essential for maintaining germ cell differentiation, was significantly decreased in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (the lowest), the only three genotype groups examined with impaired spermatogenesis and testis organization (Figure 6A). Considering the downregulation of insl3 expression shown in the Venn diagram (Figure 6—figure supplement 1A and B), and reported in both cyp11c1 and cyp11a2 mutant male zebrafish, which are associated with disorganized testicular structure and significantly decreased numbers of mature spermatozoa (Li et al., 2020; Zhang et al., 2020), it is reasonable to speculate that insl3 may be a target that is co-regulated by androgen signaling and high level of progestin signaling. Among the upstream signals of the insl3, the role of the accumulated progestin may be a compensatory signaling pathway that regulates testis organization and spermatogenesis in the absence of androgen signaling. The expression levels of the markers of Sertoli cells, sox9a, amh, dmrt1, and igf3 were decreased in the ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (Figure 6B), indicating impaired functions of Sertoli cells in these fish. The divergent expression patterns of the germ cell markers, dazl, vasa, dnd, nanos1, nanos2, piwil1, and piwil2, were observed in the fish of different genotypes, except cyp17a1-/-;ar-/-;npgr-/- fish (Figure 6C). These results might indicate that the upregulated expression levels of germ cell markers are not critical for the restoration of the defective phenotypes of the testis organization and spermatogenesis caused by the lack of androgen signaling in these various mutant lines (Tang et al., 2018). The Insl3 receptors, rxfp2a and rxfp2b, expressed in type A spermatogonia and Sertoli cells/myoid cells, respectively, were also decreased in the cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the control males (Figure 6B and C), suggesting compromised Insl3 signaling in cyp17a1-/-;ar-/-;npgr-/- fish. The upregulated expression of the retinoic acid-degrading enzyme, cyp26a1, decreased GSI and disrupted testis morphology in the cyp17a1-/-;ar-/-;npgr-/- fish (Figures 6D and 4H and I), correlating with the observations in the insl3-/- males (Crespo et al., 2021).

The sperm fertilities of the ar+/+ males and ar-/- males after treatment with DHP were also measured. Unfortunately, both experiments showed impaired fertility after DHP treatment via artificial fecundation assays with WT females (Figure 3—figure supplement 1). Based on our observations and several previous publications, the chemical reagents of sex steroids used in the animal administration would result in developmental abnormalities, such as the E2 usually leads to abnormal body growth, enlarged abdomen and liver, and a large amount of liquid in the peritoneal cavity induced by 10 nM E2 treatment from 20 dpf to 40 dpf (Chen et al., 2017), and 10 μg/L (36.71 nM) E2 treatment from 18 dpf to 90 dpf, as well as DHP treatment in the present study (data not shown). On the other hand, based on the results in Figure 2B, the dynamic levels of the elevated DHP seen in the cyp17a1-/- fish might suggest the failure of rescued fertility due to being unable to precisely match in vivo DHP dynamic levels or the potential side effects of the constant levels of exogenous DHP exposure. However, partial restoration of the testicular phenotypes of ar-/- males via DHP administration supports the mechanism by which an enhancement of progestin signaling pathway is an alternative to testis organization and spermatogenesis to androgen signaling (probably via Insl3) in cyp17a1-/- fish. Therefore, a high level of endogenous or exogenous DHP can compensate for androgen signaling insufficiency to facilitate testis organization and spermatogenesis (Figure 7C–E).

The potential regulatory network of androgens and progestins regulating testis organization and spermatogenesis via Insl3.

(A) Androgen signaling is essential in promoting testis organization and spermatogenesis in the control males. (B) Testis organization and spermatogenesis is impaired in the ar-/- males. (C) The impaired testis organization and spermatogenesis in the ar-/- males could be rescued by 17α,20β-dihydroxy-4-pregnen-3-one (DHP) supplement. (D) Testis organization and spermatogenesis proceeded normally in the cy17a1-/- fish, resulting from the enhanced progestin signaling caused by cyp17a1 depletion. (E) The alternative compensatory pathway induced by cyp17a1 depletion is ar-independent. (F) The alternative compensatory pathway induced by cyp17a1 depletion is npgr-dependent, demonstrating a high progestin/nuclear progestin receptor (nPgr) signaling pathway in promoting testis organization and spermatogenesis independent of androgen signaling. Red letters and lines indicate the upregulation of the progestin/nPgr signaling pathway, while green letters indicate the decreased concentration of androgens or downregulated insl3. The dotted lines indicate the brief description with omission or the potential existence of the proposed model.

In summary, our present study with a series of sex steroid signaling deficiency models and DHP administration provides compelling evidence demonstrating that an augmentation of progestin/nPgr signaling can sufficiently compensate for proper spermatogenesis and testis organization when androgen signaling is depleted in zebrafish.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent (Danio rerio)cyp17a1 knockoutPMID:30202919RRID:ZFIN_ZDB-GENO-191029-6Dr. Zhan Yin (Institute of Hydrobiology, Chinese Academy of Sciences)
Genetic reagent (D. rerio)fshβ knockoutPMID:30202919RRID:ZFIN_ZDB-GENO-191029-7Dr. Zhan Yin (Institute of Hydrobiology, Chinese Academy of Sciences)
Genetic reagent (D. rerio)ar knockoutPMID:29849943RRID:ZFIN_ZDB-GENO-190307-7Dr. Wuhan Xiao (Institute of Hydrobiology, Chinese Academy of Sciences)
Genetic reagent (D. rerio)npgr knockoutPMID:27333837RRID:ZFIN_ZDB-GENO-170907-1Dr. Xiaochun Liu (Sun Yat-Sen University)
Chemical compound, drug11-KTEfebioCat# E092432
Chemical compound, drugDHPTRCCat# P712080
Chemical compound, drugP4AladdinCat# P106426
Chemical compound, drugDMSOSigma-AldrichCat# D2650
Chemical compound, drugTRIzol reagentAmbionCat# 15596
Commercial assay or kitT ELISA kitCayman ChemicalsCat# 582701
Commercial assay or kit11-KT ELISA kitCayman ChemicalsCat# 582751
Commercial assay or kitFirst-strand cDNA synthesis kitFermentasCat# K1621
AntibodyAnti-Vasa (rabbit polyclonal)GeneTexCat# GTX128306RRID:AB_2847856IF: (1:500)

Animals

The zebrafish were maintained under standard conditions at 28.5°C. cyp17a1, ar, fshβ, and npgr knockout lines were established as previously described (Tang et al., 2016; Yu et al., 2018; Zhai et al., 2018; Zhai et al., 2017). The cyp17a1 heterozygote was crossed with an ar heterozygote to generate the cyp17a1/ar double heterozygous fish. The cyp17a1/ar double heterozygote was crossed with the fshβ heterozygote to generate the cyp17a1/ar/fshβ triple heterozygous fish. The cyp17a1/ar double heterozygote was crossed with the npgr heterozygote to generate the cyp17a1/ar/npgr triple heterozygous fish. Double and triple heterozygous fish were used to generate homozygous fish. Male zebrafish were sampled and analyzed from the genotypes mentioned above at 6 mpf. Fish genotypes from the population were examined as previously described (Tang et al., 2016; Yu et al., 2018; Zhai et al., 2018).

Steroid hormones measurement using UPLC-MS/MS

Request a detailed protocol

The concentrations of 11-KT, DHP, and P4 from whole-body lysates were measured using UPLC-MS/MS (Wang et al., 2022). Briefly, the whole body of each fish was placed in a tube containing magnetic beads in a high-speed vortex destroyer instrument (Tissue Cell-destroyer 1000, Xinzhongke viral Disease Control Bio-Tech Ltd, Hubei, China), and then ice-cold acetonitrile (1.5 mL) was added. The centrifugation was performed at 4°C with the highest speed after the high-speed vortex and ultrasonic disruption. The upper layer was placed into a glass tube and evaporated at 30°C under a gentle stream of nitrogen. After dissolving with 0.6 mL of methanol, 2.4 mL of double-distilled water was added, mixed, and purified with C18 solid-phase extraction cartridges (100 mg sorbent per cartridge, RNSC1003-C18, Lvmeng, Jiangsu, China) for further measurement using UPLC-MS/MS (ACQUITY UPLC, Quattro Premier XE, Waters, USA). Then the purified products were evaporated with nitrogen and dissolved with 40% methanol. The 11-KT (E092432, Efebio, Shanghai, China), DHP (P712080, TRC, North York, Canada), and P4 (P106426, Aladdin, Shanghai, China) at a series of concentrations were used as standard samples for standard curve establishment. The standard samples (powders) were dissolved in DMSO (D2650, Sigma-Aldrich, St. Louis, MO) to a concentration of 1 mg/mL, and the gradient dilution with 40% methanol was performed. R > 0.995 was considered as qualified linear of the gradient dilution of the standard samples.

Steroid hormones measurement using ELISA

Request a detailed protocol

The concentrations of T and 11-KT in testis were measured using commercial ELISA kits (T: 582701; and 11-KT: 582751, Cayman Chemicals, Ann Arbor, MI). Briefly, testis samples were isolated and homogenized in phosphate-buffered saline (PBS). After homogenization, an organic solvent was used to extract the sex steroids according to the manufacturer’s instructions. The layers were separated by vortexing and centrifugation, the organic layer was transferred to a fresh tube, and the extraction was repeated four times. The organic part was evaporated by heating to 30°C under a gentle stream of nitrogen. Finally, the extracts were dissolved in 200 µL ELISA buffer and prepared for measurement according to the manufacturer’s instructions.

Histological analyses (H&E staining) and spermatozoa number analysis

Request a detailed protocol

The dissected testes were fixed in 4% paraformaldehyde in PBS at room temperature, followed by dehydration and infiltration. The sectioning and staining procedures were performed as previously described (Lau et al., 2016). Briefly, the samples were embedded and processed for transverse sectioning in paraffin using a Leica RM2235 microtome (Leica Biosystems). Paraffin sections (5 µm in thickness) were mounted on slides, deparaffinized, rehydrated, and washed with deionized water. The sections were stained with hematoxylin and eosin (H&E), dehydrated, mounted, and visualized under a Nikon Eclipse Ni-U microscope (Nikon, Tokyo, Japan). Scale bars are provided for each image. For the spermatozoa number analysis, ImageJ software was used. Briefly, the area in each integrative lumen of seminiferous tubules containing spermatozoa was cut and saved as a new image file for further analysis. After the image was reloaded, the image was transferred to 8-bit gray, and the threshold was selected for sperm selection. The particle number was analyzed after the defining point under the binary submenu to dissect the stacked sperm.

DHP administration

Request a detailed protocol

The population of ar heterozygotes containing ar+/+, ar+/-, and ar-/- fish was administered with DHP (P712080, TRC) from 50 to 90 dpf. Briefly, the population from ar heterozygotes was placed in a 3.5 L tank containing DHP (0.067 µg/mL). After the treatment, each fish was genotyped with a tail fin cut and subjected to anatomical examination, GSI analysis, testis HE staining, and spermatozoa number analysis.

Immunofluorescence staining

Request a detailed protocol

Immunofluorescence staining was performed using an anti-Vasa rabbit polyclonal antibody (GTX128306-S, GeneTex, Irvine, CA) as the primary antibody (Zhu et al., 2019). Fluorescein (FITC)-conjugated goat anti-rabbit IgG (H+L) was used as the secondary antibody (SA00003, Proteintech, Rosemont, IL). As previously described, zebrafish testes were fixed, embedded, sectioned, and stained using standard protocols (Zhu et al., 2019). Nuclear DNA was stained with 4',6-diamidino-2-phenylindole (DAPI). Sections were visualized using ×40 objective lenses of an NOL-LSM 710 microscope (Carl Zeiss, Germany). Scale bars are provided for each image.

Transcriptome analyses

Request a detailed protocol

Testis RNA was isolated from the testes of zebrafish by extraction with TRIzol reagent (15596, Ambion, Austin, TX). Using an Illumina NovaSeq 6000 system, RNA-seq reads were generated by sequencing. High-quality mRNA reads were mapped to the Danio rerio genome (GRCz11) using HISAT2 (version 2.2.4, http://daehwankimlab.github.io/hisat2/). Differential expression analysis was performed using the DESeq2 package (v1.30.1) with a fold change of 2 and a p-value cutoff of 0.05. Venn diagram analysis of differentially expressed genes was performed by the R package VennDiagram (version 1.7.1). A heatmap for candidate genes was plotted in R (version 4.1.0) using the heatmap package.

Quantitative real-time PCR (qPCR)

Request a detailed protocol

Independent of the RNA samples for transcriptome analyses, another group of RNA samples was extracted and used for cDNA synthesis for qPCR to confirm the transcriptome results. According to the manufacturer’s instructions, a total of 1.5 μg of RNA template was used for reverse transcription to synthesize cDNA using a first-strand cDNA synthesis kit (K1621, Fermentas, Waltham, MA). The qPCR primers for hsd3β1, insl3, igf3, dnd, cyp26a1, and ef1a were used as previously described and are listed in Table 1. For amplification, the TransStart Tip Green qPCR SuperMix (AQ141-01, TransGen, Beijing, China) and Bio-Rad real-time system (Bio-Rad Systems, Berkeley, CA) were used. All mRNA levels were calculated as the fold expression relative to the housekeeping gene ef1a and expressed as a fold change compared to the control group.

Table 1
Primers for qPCR used in this study.
GenePrimer direction and sequence (5′–3′)Reference
hsd3β1F: GATCCGACTGCTGGATAGAAACACrespo et al., 2021
R: CCCGGCAATCATCAAGAGA
insl3F: CGGACGGTGGTCGCATCGTGZhai et al., 2018
R: CTCTCTGGTGCACAACGAG
igf3F: CCAGGATTCATGCTGAAGGTGZhai et al., 2018
R: CTACGAGCTGCTCCAGGTTTG
dndF: TCGTGGAAGCTTTTCGGAACCGGLin et al., 2017
R: TGTCCTCGACGCGCTTGGAC
cyp26a1F: TGGGCTTGCCGTTCATTGCrespo et al., 2021
R: CATGCGCAGAAACTTCCTTCTC
ef1aF: GCCGTCCCACCGACAAGCrespo et al., 2021
R: CCACACGACCCACAGGTACAG
  1. F = forward; R = reverse.

Statistical analysis

Request a detailed protocol

All the experiments were conducted at least two times. Data were analyzed using GraphPad Prism 8 software. All results are reported as mean ± SD. The statistical significance of differences was determined using Student’s t-test for paired comparisons and one-way ANOVA, followed by Fisher’s LSD test for multiple comparisons. For all statistical analyses, p<0.05 indicated a significant difference. Significant differences marked with asterisks and letters were analyzed using Student’s t-test for paired comparisons and one-way ANOVA, followed by Fisher’s LSD test for multiple comparisons, respectively.

Data availability

The knockout fish and genes involved in this study have been cited and clearly listed in the references. The transcriptomics raw data files in this article are available in Sequence Read Archive (SRA) at NCBI, and the BioProject is PRJNA796639.

The following data sets were generated
    1. Chinese Academy of Sciences
    (2022) NCBI Sequence Read Archive
    ID PRJNA796639. Augmentation of progestin signaling rescues testis organization and spermatogenesis in zebrafish with the depletion of androgen signaling.

References

    1. Kater CE
    2. Biglieri EG
    (1994)
    Disorders of steroid 17 alpha-hydroxylase deficiency
    Endocrinology and Metabolism Clinics of North America 23:341–357.
    1. Yanase T
    (1995) 17 alpha-Hydroxylase/17,20-lyase defects
    The Journal of Steroid Biochemistry and Molecular Biology 53:153–157.
    https://doi.org/10.1016/0960-0760(95)00029-y

Decision letter

  1. Cunming Duan
    Reviewing Editor; University of Michigan, United States
  2. Didier YR Stainier
    Senior Editor; Max Planck Institute for Heart and Lung Research, Germany

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

Thank you for submitting your article "Progestin signaling facilitates testicular development and spermatogenesis independently from androgen signaling in fish" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Didier Stainier as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Summary

Previous studies from this group showed that androgen deficient (cyp17a1-/-) fish are all male with intact spermatogenesis. This is in good agreement with earlier findings by others: in fish, spermatogenesis can be supported by other than androgen-driven signaling pathways. While progestin-mediated stimulation of spermatogenesis in fish has been described previously including zebrafish, convincing genetic data and the underlying mechanisms are still lacking. In this study, using a number of zebrafish mutant fish lines, the authors provide genetic data suggesting a possible role of progestins (P and DHP) in regulating spermatogenesis via the nPgr. The reviewers feel that there are merits and potentials in this study. At present, however, this manuscript is still premature, descriptive, and lacks mechanistic insights. Several major issues/concerns were raised by the reviewers.

The following concerns and suggestions should be addressed.

Essential revisions:

1) The lack of anatomical and histological data on the cyp17a1/npr double mutant fish. In contrast to other mutant lines, only the expression of selected testicular genes was studied in the cyp17a1/npr double mutant fish. In order to answer the question, the anatomical and histological data of these testis must be included.

2) In zebrafish, both Fsh and Lh can signal through the Fsh receptor. Both Fsh and Lh levels are elevated in the crp17a1 mutant fish. Therefore, the crp17a1/ar/fsh triple mutant data is insufficient. The Fsh receptor instead of Fsh β subunit should have been removed in the triple mutant analysis.

3) A key issue raised is the reported P and DHP levels and the steroid assays used. One reviewer felt that the reported progestin concentration may be too low to activate the Ar. Another suggested to measure P and DHP levels using LC/MSMS, which is preferable when measuring P and DHP in this low concentration range as in zebrafish. Whole body extracts contain several compounds co-extracted with steroids that can disturb the assays. The extraction process will lose some P and DHP. If the authors choose to use the same kit, the approach used to extract steroids from tissue samples needs to be specified and quality control experiments/data should be included.

4) The authors showed that P4 and DHP treatment increased GSI and spermatozoa number. It is pointed out that the doses used in P and DHP treatments may be too low to be effective or the P and DHP quantification may be way off. It would also be important to assess the P4 and DHP concentrations in pharmacologically treated fish. Did they look at the mature sperm number, motility and fertility?

5) Relevant in normal physiology. It would have been useful to compare the presented directly with npgr-/- mutants throughout and compare the cyp17a1-/-; npgr-/- to the ar-/-; npgr-/- and the single mutants. This plus treatment would have clearly answered if progestins play a role in normal physiology. Furthermore, is it possible to inhibit progestin synthesis/secretion in cyp17a1-/- fish or use progestin antagonists (e.g., mifepristone, ORG3170 etc.?) If possible, it will provide further evidence that the elevated levels of progestins is indeed critical.

6) Histological analysis: Figures 2, 3 and 4 show quantitative data (the ordinates are labelled with, "number of sperm per cyst"). However, it is not clear how the quantitative histological data were obtained and what exactly they show.

7) Immunofluorescence staining: The authors used an antibody against mouse vasa protein on zebrafish testis sections. The antibody used has not been characterized. The ICC procedure has not been described. No proof is provided that the antibody against a mammalian protein reliably detects zebrafish vasa protein.

8) RNA extraction and qPCR: The authors report to have used a single 'housekeeping gene' (ef1a). However, the cellular composition of testis tissue varies in the different mutants, so that it cannot be excluded that also the readings for ef1a changed, depending on the genotype.

9) Statistical analysis: The statistical analyses appear incomplete and may even be flawed. This makes it difficult to assess reproducibility of the quantitative measurements, the claims and conclusions made in this study. The authors should consult a statistician to resolve this issue.

10) Titles: It is surprising that the authors repeatedly mentioned "testicular development", including in the title, since the data presented covers adult fish only.

11) A number of substantive concerns were raised with the statements/overstatements in the text. These should be addressed.Reviewer #1:

The authors were intrigued by the observation that loss of the androgen receptor (ar) in zebrafish has a clear impact on spermatogenesis while spermatogenesis remained intact after blocking androgen production through loss of the enzyme cyp17a1. This supports an earlier conclusion also proposed by others: in fish, spermatogenesis can be supported by other than androgen-driven signaling pathways. Since the authors found progestin levels to be higher in cyp17a1 mutants, and since results published previously by others showed that progestins stimulated different aspects of spermatogenesis (spermatogonial development, meiosis, sperm capacitation) in different fish species (eel, tilapia, trout, zebrafish), the authors asked if removing also the nuclear progesterone receptor (npr) from cyp17a1 mutants would result in a spermatogenesis phenotype in zebrafish after all. To answer this valid question, the authors generated mutant lines to seek support for the hypothesis that progestin signaling via its nuclear receptor can maintain spermatogenesis in androgen-depleted cyp17a1 mutants. Also ar-KO zebrafish were subjected to progesterone treatment, although the reasons for that were less clear. Surprisingly, the mutant most pertinent to the main question, the cyp17a1/npr double mutant, was only used to analyze the expression of selected testicular genes. No anatomical or histological data were included, in contrast to all other lines, thus leaving the main question unanswered regarding effects on spermatogenesis. Instead, triple mutants were generated by removing also the androgen receptor (cyp17a1/npr/ar) or the Fsh β subunit (cyp17a1/npr/fshb). Unfortunately, the loss of a third gene does not allow to draw "clean" conclusions regarding the consequences of the loss of npr in males unable to produce androgens; also, it is not clear what led to the choice of ar or fshb as third genes to be removed. These points are further discussed in the following.

Follicle-stimulating hormone β subunit (fshb)

Referring to works published by others, the authors state correctly that Fsh can stimulate spermatogenesis independent of sex steroid signaling. Since elevated levels of both Lh and Fsh have been reported in cyp17a1 KO zebrafish, the authors decided to remove the Fsh β subunit gene (reminiscent of work in their 2018 paper), attempting to study the contribution, if any, of Fsh signaling to maintaining spermatogenesis. However, in the cyp17a1/ar/fshb triple mutant, the Fsh receptor is still present. Since the also elevated Lh levels can cross-activate the Fsh receptor (Xie et al., 2017, DOI: 10.1530/JOE-17-0079), it is conceivable that Fsh receptor-mediated signaling remained relevant. Therefore, it seems that removal of the receptor, instead of the ligand, would have been the option to choose for investigating the role of Fsh signaling.

The authors concluded that removing fshb had no effect on spermatogenesis, referring to GSI levels being similar to controls (L290). However, the authors did not point out that in the cyp17a1/ar/fshb triple mutant, GSI values were halved compared to the cyp17a1/ar double mutant, i.e. removal of fshb apparently did have an effect.

Androgen receptor

The authors mention the possibility that elevated levels of low affinity ligands might activate the Ar in the absence of androgens, such as the elevated progestin levels of found in cyp17a1 mutants. Based on the data presented in Figure 1, the reviewer calculated the combined concentrations of P and DHP to be ~60 nM (data from Figure 1). This is 10- to 20-fold lower than the progestin concentration required to induce some activity of the zebrafish Ar; moreover, the progestin-induced Ar activity is only ~1/10th of the activity induced by androgens (based on the data cited by the authors as de Waal et al., 2008). Hence, available information suggested that progestin concentrations were too low and could only marginally activate the Ar, and therefore seem irrelevant for cross-activating the zebrafish Ar. The reviewer wonders about potential other reasons for carrying out the experiments shown in Figure 2.

A question requiring attention is the treatment with progestins (Figure 2) also relating to Figure 1. It shows the endogenous progestin levels in ar-KO mutants being ~5-10ng/g = 5-10µg/kg, equivalent to 5-10µg/L. In Figure 2 and the associated text, the authors report clear effects following exposure of ar-KO fish to P or DHP at a concentration of 0.1µg/L. Reporting clear treatment effects using progestin concentrations 50-100 times lower than the endogenous concentrations would require a careful discussion.

Other results obtained with fish carrying a mutated ar await being discussed. For example, the authors find, similar to others, that spermatogenesis is compromised in ar-KO zebrafish and claim (L193 and following) that testicular gene expression analysis (Figure 6) supports this finding. However, the five 5 germ cell genes quantified seem clearly elevated in ar-KO fish showing compromised spermatogenesis after loss of the ar. How to reconcile increased germ cell gene expression with compromised spermatogenesis remains unclear. Similarly, germ cell gene expression is reported to be upregulated in the cyp17a1/npr/ar triple mutants compared to cyp17a1/npr double mutant, i.e. the combination of impaired spermatogenesis and increased germ cell gene expression following removal of the ar gene comes up again. This time, however, not all five germ cell genes but only four were responding, and it is unclear why is there an "odd one out" in this specific genetic model.

More comprehensive discussion is perhaps also required regarding the Tgf β family member Amh. The authors did discuss the role of Amh in spermatogonial differentiation, but may have overlooked Amh-promoted transition into meiosis (https://doi.org/10.1016/j.mce.2020.110963).

The authors repeatedly make the point, including in the title, that progestin signaling stimulates spermatogenesis independently from androgen signaling. This wording is not sufficiently precise. The genetic evidence presented is based on fish that are unable to produce androgens. This does not exclude the possibility that the Ar protein can exert biological activity in the absence of androgens (or any other type of ligand). Ligand-independent Ar action may indeed be related to changes in gene expression induced by removing the ar from the cyp17a1/npr double mutants (see above). Therefore, the conclusion/point (progestin stimulates spermatogenesis independently from androgen signaling) should be restricted to fish unable to produce androgens. Another reason to do so is that in the presence of androgens (the physiological situation), androgen/Ar-mediated effects may very well interact with progestin/Npr effects on spermatogenesis.

A repeatedly occurring statement requiring attention is the mentioning of testis development or testicular development in the manuscript. It would be appropriate to remove all of this from the manuscript, including the title, because respective data is not presented. The datasets in the manuscript refer exclusively to adult males.

Another point refers to an alternative understanding of the phenotype of the cyp17a1 mutant. First mentioned in L96-97, this mutant is described as presenting stimulated or enhanced spermatogenesis. The reviewer assumes that the authors refer to the GSI levels and spermatozoa number being higher than in WT adults older than 3 months. The age is relevant since in young adults up to 3 months of age, the GSI is still similar to WT controls. However, neither in the previous study (Zhai et al., 2018) nor in the present manuscript, spermatogenic activity has been studied in detail. The fact that the phenotype of increased GSI/sperm number developed with time after 3 months of age (as described in Zhai et al., 2018) and the histological pictures shown in Zhai et al., 2018 and in the present manuscript, suggests that the weight gain is based on progressively accumulating spermatozoa. Since cyp17a1 mutants don't show reproductive behavior/spawning, the reviewer understands the slowly increasing GSI by progressively accumulating sperm formed at a normal rate. Claiming enhanced spermatogenesis requires research into the dynamics of this cellular development that is missing as yet.

The accumulation of sperm may also explain increased DHP levels. The enzyme converting 17aP to DHP, 20bHSD, is highly active in spermatozoa of salmonid and cyprinid species, including the zebrafish relatives carp and goldfish. In this regard, elevated DHP levels may reflect an "accidental side-effect" of sperm with their associated 20bHSD activity, accumulating in the testes of cyp17a1 mutants, and then metabolizing the substrate 17aP that is available in high levels due to the loss of cyp17a1.

Overall, the reviewer considers it as a pity that the manuscript does not report also first results regarding mechanisms underlying the progestin-stimulated maintenance of spermatogenesis in cyp17a1 KO zebrafish. Such data would elevate the manuscript from its descriptive nature. Nevertheless, the authors have generated valuable genetic models that may allow, in the future, not only to provide the previously reported, progestin-mediated stimulation of spermatogenesis with a firm genetic basis in zebrafish, but also to broaden our knowledge on the mechanisms underlying progestin effects on spermatogenesis.

Materials and methods section

Steroid assays: The approach used to extract steroids from tissue samples needs to be specified and quality control experiments/data are missing. Contrary to the authors' statement, the procedure is not specified by the manufacturer. Looking up the manufacturer's specifications showed that these assays are meant for aqueous samples (plasma, serum, whole blood, urine samples, in vitro medium samples are mentioned, but not tissue or whole body extracts). Therefore, validation of the techniques for a new type of samples is required. This also includes the point that the authors apparently did not control for procedural losses. In addition, whole body extracts contain several compounds co-extracted with steroids that can disturb the assays, as indicated by the manufacturer, who suggested to remove the impurities even from much less complex samples such as blood plasma extracts, before introducing the samples into the assay. Has this been done? Finally, the authors do not report validation and standardization of the assays (e.g. extraction efficiency and potential correction for procedural losses, or reliability [i.e. is a spiked amount of steroid found back at the expected concentration?]). As reported now, results on steroid quantifications cannot be accepted as sufficiently reliable or accurate.

Histological analysis: Figures 2, 3 and 4 show quantitative data (the ordinates are labelled with, "number of sperm per cyst"). However, the respective M and M section does not detail how the data was obtained and processed. Regarding the label on the ordinate, please refer to literature on spermatogenesis in fish, the point being that after completion of spermiogenesis, the spermatogenic cysts open and germ cells are released by the Sertoli cells into the lumen of the spermatogenic tubules. From then on, the germ cells are called spermatozoa, which are no longer in cysts. Hence, "sperm per cyst" is a contradiction in terms, leading to the question if "sperm" or "per cyst" is not correct? These points require clarification for the data to be kept in the manuscript. Also the legend to Figure 5 requires attention in this regard. The authors state that scale bars are provided in each image – this is not correct, since for example on Figure 2, there are no scales; the scales on Figure 4, on the other hand, are probably not correct. In L342, please replace size by thickness.

P4 and DHP treatment: Please refer to the point made above in this context in Public Review (100-fold lower concentration used for treatments than found in the fish).

Immunoflourescence staining: The authors report to have used an antibody against mouse vasa protein on zebrafish testis sections. The antibody used has not been characterized. The ICC procedure has not been described. No proof is provided that the antibody against a mammalian protein reliably detects zebrafish vasa protein. In the Results section, the authors state in L182 that the ICC data demonstrate "…a reduced number of spermatozoa…in ar-/- males…but increased number of spermatozoa … in … cyp17a1 fish". However, spermatozoa do not express vasa protein. Moreover, since the ICC results in Figure 5 have neither been quantified nor normalized, statements referring to differences in cell numbers should be avoided.

RNA extraction and qPCR: The authors report to have used a single 'housekeeping gene' (ef1a). However, the cellular composition of testis tissue varies in the different mutants, so that it cannot be excluded that also the readings for ef1a changed, depending on the genotype. The request is to include the ef1a data as a separate graph in Figure 6 (e.g. as Figure 6K) for the different genotypes and subject them to statistical analysis. If differences are detected between genotypes, it is possible to use the approach explained in the following. For the future (or in case ef1a shows changes here), consider using at least three different reference genes, showing a large range of expression levels, and calculate qPCR results using their geometric mean as normalization.

Statistical analysis: This is one of the more critical points in the manuscript, since the potential problems here prevent evaluation of all quantitative data presented in the manuscript. The number of replicates per experiment/treatment group has not been provided. It is mentioned that experiments were repeated three times. However, how were the data obtained from these three experiments then used for statistical analysis and plotting of the graphs? In most graphs presenting quantitative data, the authors compare more than 2 groups with each other, usually 4-6 groups. The authors state in L369 that "differences were assessed using Student's t-test." With this test, however, only differences between two groups can be assessed, under the condition that the data is distributed normally. However, neither was data distribution tested, nor were there only two groups. Therefore, all statistical analyses need to be repeated.

Introduction

As indicated above, this following list mentions selected points independent of the re-analysis of the data. The term "selected" is used also because the number of points requiring comments is high and the list is far from complete. Hence, the authors will have to identify the points not mentioned below during a thorough re-writing process.

In the reviewer's opinion, the complete 1st paragraph of the Introduction can be removed.

L49-56: This sentence contains several unclear or awkward statements (e.g. "the reproduction research" – grammar; "advantage of gonadal dissection" – ??; "successfully adopted KO strategy" – applies to virtually thousands of species; "pharmacological utilization" – ???).

Conclusions in L57-61: the 1st conclusion is irrelevant in the present context; the 2nd conclusion is in part wrong (see following point); the 3rd conclusion is irrelevant in the present context

L58-61: Contrary to the authors' statement androgen signaling is not essential for testicular differentiation and development or for spermatogenesis in fish and the papers cited do not make this claim either. After all, the authors did study testis tissue from ar-KO mutants and this tissue contained all types of germ cells including sperm (e.g. Figure 2K). This wrong statement is repeated in L62 (wrong regarding testis development in fish).

L79-82: A series of statements is made but not supported by citations.

L103-104: The authors state that "administration of P4 and DHP effectively restored … GSI and spermatozoa number…". However looking at the graphs in Figure 2 G and N, the formulation is not correct since the controls showed higher levels (pending the re-analysis of the data, significantly higher in the controls). This type of error/overstatement occurs frequently.

L110: Another example for an overstatement is to use the term "arrested" to describe the effect of ar loss on spermatogenesis. While this is correct for mammals, it is not for zebrafish (see the authors' data in Figure 2K, showing an ar-KO testis with all types of germ cells including spermatozoa, i.e. no arrest).

Overall, the introduction contains passages that rather read like Results or Discussion section. Please amend.

Results and Discussion

Both sections contain statements that would require comments. However, the contents of these statements have been touched upon already, in one way or another, in the points discussed above. Therefore, the reviewer does not make specific comments to these sections, also considering the statistical/data uncertainties and technical questions remaining to be solved, which will likely result in several changes in these two sections.

Reviewer #2:

The authors present a paper suggesting that progestin facilitates testicular development in zebrafish. Overall, the paper tries to explain interesting observations made in their cyp17a1-/- lines that are different compared to fish with androgen deficiency and androgen resistance. Interestingly, the specific block in steroidogenesis led to an increase of progestins and the authors work up the hypothesis that progestins represent an androgen-independent regulator of testicular development and spermatogenesis. Is this a compensated "disease" state or a mechanism that is relevant under normal physiological circumstances?

The authors present quite some detailed analysis of a structured combination of various mutants/ double/ triple mutants to explore their hypothesis, which appears a major strength of the paper. There some aspects such as the effect pf progestin treatment on wildtypes and the discussion if these are physiological, pathophysiological or pharmacological effects that would need further analysis and clarification. A major weakness of the paper is that no direct comparison with npgr-/- lines have been made to explore the questions not only from the angle of androgen deficiency and resistance with progestin excess.

Overall this paper might form the basis some interesting novel research investigating the interplay between androgens and progestins in zebrafish gonadal development and function. The work is convincing, but despite the fact that progestins are known to play an important role in spermatogenesis, it is remains unclear if progestins play the same significant roles in wildtype fish.

Despite a number of very interesting experiments that clearly show a role progestins in testicular development in androgen-deficient/ resistant zebrafish, it remains unclear if this is relevant in normal physiology or only to explain overserved phaenomena in mutant lines. It would have been useful to compare the presented directly with npgr-/- mutants throughout and compare the cyp17a1-/-; npgr-/- to the ar-/-; npgr-/- and the single mutants. This plus treatment would have clearly answered if progestins play a role in normal physiology. Importantly, how high are concentrations in the treated zebrafish? Are these physiological or pharmacological effects?

Overall, it appears that the progestin excess does not compensate it rather leads to hyperplastic testes, which in itself appears interesting and could be further addressed. Could this be relevant to answer environmental questions/ exogenous progestin exposure?

Lines 253-257: This raises the key question of progestins are really required for testicular developments and spermatogenesis.

I disagree with this statement. The authors demonstrate is that progestins can override defective androgen synthesis and the effects on testicular development. It would have been very interesting see if sperm from the various mutant lines can fertilise eggs. In addition, the assessment of mature sperm count and their motility would have been vital to understand the phenotype better.

If progestins are required in a way that the authors suggest then a direct comparison with the npgr-/- in their representations would be very useful I not essential.

It remained unclear why effects on the hypothalamic pituitary gonadal axis have not been assessed? This could provide further evidence about the degree of compensation by progestins. It would have been interesting if there could be synergistic effect of gonadotrophs or if there is a downregulation or even more interestingly if lh and fsh are differentially affected.

This could be very different to the upregulation of the HPG axis in recently described androgen deficiency fish is secondary. Parts of the discussion are not entirely clear as it cannot be expected to restore testicular development in other species. The message of this part of the discussion appears not entirely clear.

The steroid assays are not well described. How have they been validated? Assays to measure all compound by LC/MSMS are available and preferable when measuring analytes in this low concentration range as in zebrafish. The use of ELISAs for specific hormones appears outdated and less robust than LC/MSMS assay. This appears to be a real weakness of the paper.

It would be very important to assess the P4 and DHP concentrations in pharmacologically treated fish. The GSI does not seems to change; are the treated animals with larger testes heavier/ longer?

Over long stretches, I have asked myself why the authors did generate a triple mutant rather and only a double mutant cyp17a1-/-; ngpr -/-? This double mutant appears out of the blue in figure 6; why has no other data been provided on the double mutant? It appears vital to present data on that double mutant. As stated above several times it would have been important to get an idea about the phenotype of the npgr-/- to see what happens to spermatogenesis.

Reviewer #3:

Previous studies from this group showed that cyp17a1-/- fish are all male with enhanced testicular development and spermatogenesis. Since the testosterone (T) and 11-KT levels are lower in the mutant fish, it was postulated that there is an androgen-independent signaling pathway. In this study, the authors showed the levels of progestins (P4 and DHP) were elevated in cyp17a1-/- fish and treatment of ar-/- fish with exogenous P4 and DHP partially restored spermatogenesis and testicular development. By generating and analysis of cyp17a1, ar, npr double and triple mutant fish lines, they concluded that the elevated levels of progestins functions as an additional and Ar-independent pathway regulating zebrafish spermatogenesis and testicular development.

Overall, the findings are new and interesting. The genetic rescue crossing data are quite convincing. The manuscript is well written and the data nicely presented.

The following are my comments and questions:

1) The authors showed that P4 and DHP treatment increased GSI and spermatozoa number. Did they look at the mature sperm number, their motility and fertility in the treated fish? If yes, please include the data. If not, please discuss possible outcome.

2) Is it possible to inhibit progestin synthesis/secretion in cyp17a1-/- fish or use progestin antagonists (e.g. mifepristone, ORG3170 etc.? If possible, it will provide further evidence that the elevated levels of progestins is critical.

3) Figure 5 can be better described. For instance, how the authors identify SG, PSP, SSP, and SZ cells? This will help the general eLife readers. It will also be helpful to quantify the results.

4) The description and discussion about Figure 6 are not as clear as the other figures. For instance, the sycp3 results are different from those of vasa,, dnd, nano and piwill. What are these data telling us? Likewise, the patterns of star, hsd3b and cyp11a2 expression are different? What are these results saying and how do they related to the spermatogenesis phenotypes?

5) Line 154: "…confirm that the accumulated progestins, P4 and DHP, acts directly to facilitate testicular development and spermatogenesis …". Please remove the word "directly". This is too strong since no data suggesting the exogenously add P4 and DHP act indirectly or indirectly.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "High level of progestin signaling facilitates testis organization and spermatogenesis independently from androgen signaling in fish" for further consideration by eLife. Your revised article has been evaluated by Didier Stainier (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

In this revised manuscript, the authors have provided a significant amount of new data, including

a) Generating the triple mutant fish and all single and double mutants and performing phenotypic and RNAseq analysis;

b) Re-measuring the steroid hormone levels using UPLC-MS/MS, and

c) Provided new data on Fshb levels. While they did not or could not generate Fsh receptor double and triple mutants, they made a good argument that should not affect their main conclusion. These new data have addressed most of the major concerns raised by the reviewers.

There, however, remaining issues that need to be addressed, as outlined below:

1) The current version of the manuscript is very difficult to read. Many sentences are hard to understand or can be interpreted in different ways. I suggest the authors to seek help from colleagues/professionals to edit the manuscript thoroughly. They can also choose to work with an eLife copyeditor to address this issue.

2) Another reason is presentational. Instead of presenting the data based on a chronological order, I suggest them to present the data following the order of Figure 7. For instance, it would be much easier for the readers to follow if they change Figure 3 into Figure 1, F1->2, and F2->.

3) The fertility data should be included.

4) The RNAseq data presentation. It is clear this is a huge amount of information. What is unclear is what do these data mean? I suggest the authors to dig into this dataset and present the data in relationship to the main conclusion/model (see Figure 7). For example, is it possible to see any changes in genes involved in the progestin/androgen biosynthesis (in addition to cyp17a1), nPgr target genes, and/or Ar target genes in these mutants?While it is okay to presenting all 8 groups together, it may be more meaningful to also compare the transcriptomic changes among different pairs of genotypes (in relationship to the main conclusion in Figure 7).

https://doi.org/10.7554/eLife.66118.sa1

Author response

Essential revisions:

1) The lack of anatomical and histological data on the cyp17a1/npr double mutant fish. In contrast to other mutant lines, only the expression of selected testicular genes was studied in the cyp17a1/npr double mutant fish. In order to answer the question, the anatomical and histological data of these testis must be included.

Good suggestion! According to this suggestion, we have analyzed the fish of the eight genotypes from the offspring of the crossed cyp17a1+/-;ar+/-;npgr+/- fish, including cyp17a1+/+;ar+/+;npgr+/+ males (control males), ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (Line 183-186).

For the anatomical examinations and histological analyses, we found that GSI and spermatozoa number were both significantly decreased in the cyp17a1-/-;npgr-/- fish (Figure 4I and R). These results suggest that a potential compensatory role of progestin signaling exists in cyp17a1-/- fish. On the other hand, compared with the cyp17a1-/-;ar-/- fish, testis organization and spermatogenesis failed in the cyp17a1-/-;ar-/-;npgr-/- fish (Figure 4H and Q), as they displayed a similar pattern in testicular morphology and spermatogenesis as the ar-/- males and ar-/-;npgr-/- males (Figure 4B, G, K, and P). In addition, compared with the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish, the observations of greater spermatogonia and spermatocytes, but fewer spermatozoa in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish were observed in the histological analyses of testes (Figure 4J-Q). These results suggest that the compensatory pathway in promoting testis organization and spermatogenesis induced by cyp17a1 knockout exists and is npgr-dependent (Line 183-198).

Transcriptome analyses of the testes of the control males, ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish, were performed (Line 215-232). For the markers of Leydig cells, the genes related to gonadal steroidogenesis, including star, hsd3β1, cyp11a2, and cyp11c1, were all increased in the testes of ar-/- males, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish. However, another gene of the Leydig cells, insl3, was significantly decreased in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (Figure 6A). For the markers of Sertoli cells, the genes including sox9a, amh, Dmrt1, igf3, and rxfp2b (the receptor of Insl3) were all decreased in the ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (Figure 6B). For the markers of the germ cells, the genes, dazl, vasa, dnd, nanos1, nanos2, piwil1, and piwil2, were all upregulated in the cyp17a1-/-;ar-/-;npgr-/- fish, with different transcriptional expression patterns in the testes of other genotypes. Notably, rxfp2a (another receptor of Insl3) and the retinoic acid-degrading enzyme cyp26a1 were downregulated and upregulated, respectively, in the cyp17a1-/-;ar-/-;npgr-/- fish (Figure 6C and D). The expression levels of hsd3β1, insl3, igf3, dnd, and cyp26a1 were selected and further verified by qPCR (Figure 6E-I).

Then, the gene expression analyses of testis in fish with different genotypes were also discussed (Line 333-362). Increased expression of gonadal steroidogenesis-related genes, star, hsd3β1, cyp11a2, and cyp11c1, in Leydig cells was observed in the ar-/- males, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish. The upregulated expression of steroidogenesis-related genes in the ar-/- males was observed in the ar mutant males (Tang et al., 2018), which may be attributed to the positive feedback effect caused by androgen or progestin signaling insufficiency. Another marker of the Leydig cells, insl3, which has been reported to be essential for maintaining germ cell differentiation, was significantly decreased in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (which is the lowest), which are the only three genotype groups examined with impaired spermatogenesis and testis organization (Figure 6A). Considering that the downregulation of insl3 expression has also been reported in both cyp11c1 and cyp11a2 mutant male zebrafish, which are associated with disorganized testicular structure and significantly decreased numbers of mature spermatozoa (Li et al., 2020; Zhang et al., 2020), it is reasonable to speculate that insl3 may be a target that is synergistically regulated by androgen signaling and high level of progestin signaling. Among the upstream signals of the insl3, the role of the high level of progestin may be an alternative signaling pathway, other than androgen signaling, for the regulation of testis organization and spermatogenesis. The markers of Sertoli cells, sox9a, amh, Dmrt1, and igf3 were decreased in the ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (Figure 6B), indicating impaired function in Sertoli cells in these fish. The divergent expression patterns of the germ cell markers, dazl, vasa, dnd, nanos1, nanos2, piwil1, and piwil2, were observed in the fish of different genotypes, except cyp17a1-/-;ar-/-;npgr-/- fish (Figure 6C), which might indicate that the upregulated expression of germ cell markers was not critical for the restoration of the defective phenotypes of the testis organization and spermatogenesis resulting from the efficiency of androgen signaling in these various mutant lines (Tang et al., 2018). The Insl3 receptors, rxfp2a and rxfp2b, expressed in type A spermatogonia and Sertoli cells/myoid cells, respectively, were also decreased in the cyp17a1-/-;ar-/-;npgr-/- fish compared to control males (Figure 6B and C), suggesting compromised Insl3 signaling in cyp17a1-/-;ar-/-;npgr-/- fish. The upregulated expression of the retinoic acid-degrading enzyme, cyp26a1, decreased GSI, disrupted testis morphology in the cyp17a1-/-;ar-/-;npgr-/- fish (Figure 6D, 2H, and I) correlated with the observations in the insl3-/- males (Crespo et al., 2021).

2) In zebrafish, both Fsh and Lh can signal through the Fsh receptor. Both Fsh and Lh levels are elevated in the crp17a1 mutant fish. Therefore, the crp17a1/ar/fsh triple mutant data is insufficient. The Fsh receptor instead of Fsh β subunit should have been removed in the triple mutant analysis.

It has been found that the hypertrophic testicular development and over-activated spermatogenesis in our cyp17a1-/- and cyp17a1-/-;ar-/- zebrafish, and both Fsh and Lh levels are elevated in these mutant fish (Zhai et al., 2018, PMID: 30202919 and the present study). So, it is needed to figure out the exact course of this phenotype whether is due to elevated Fsh or Lh. We also agree with the fact reported previously that both Fsh and Lh can signal through the Fsh receptor (Zhang et al., 2015, PMID: 25396299 and Xie et al., 2017, PMID: 28611209). That is why the cyp17a1-/-;fsh-/- double KO fish (Zhai et al., 2018), and cyp17a1-/-;ar-/-;fsh-/- triple KO mutant fish (Figure 6—figure supplement 1) have been generated. In both our double KO and triple KO mutants, the Fsh receptor are still presented, which indicated that Fsh-Fsh Receptor signaling and probably Fsh-Lh receptor signaling are missing in these mutants, while Lh-Fsh Receptor signaling or/and Lh-Lh receptor signaling are still present in these double or triple KO mutants. However, the phenotype of the hypertrophic testicular development and over-activated spermatogenesis seen in the cyp17a1-/- or cyp17a1-/-;ar-/- mutant has been successfully rescued in the cyp17a1-/-;fsh-/- double KO fish (Zhai et al., 2018), and cyp17a1-/-;ar-/-;fsh-/- triple KO mutant fish (Figure 6—figure supplement 1). That is sufficient to demonstrated that it is the course of the elevated Fsh levels responsible for the phenotype of the hypertrophic testicular development and over-activated spermatogenesis seen in the cyp17a1-/- or cyp17a1-/-;ar-/- mutant, but not because of the elevated levels of Lh signaling, no matter through Lh receptor or Fsh Receptor, which are still presented in our mutant fish. Therefore, to clarify the role of the elevated levels of Fsh or the elevated levels of Lh on the phenotype, we think that the removal of Fsh from the cyp17a1-/-;ar-/- fish is sufficient and necessary. On the contrary, the depletion of Fshr would not dissect the role of the elevated levels of Fsh through Fsh-Lh receptor signaling or elevated Lh though Lh-Fsh receptor signaling, as they remain.

3) A key issues raised is the reported P and DHP levels and the steroid assays used. One reviewer felt that the reported progestin concentration may be too low to activate the Ar.

For the concentration of the DHP administration, we apologize for the typo error of the concentration description (0.1 µg/L), which should be 0.067 µg/mL. We have corrected this in the revised manuscript (Line 441-446).

Another suggested to measure P and DHP levels using LC/MSMS, which is preferable when measuring P and DHP in this low concentration range as in zebrafish. Whole body extracts contain several compounds co-extracted with steroids that can disturb the assays. The extraction process will lose some P and DHP. If the authors choose to use the same kit, the approach used to extract steroids from tissue samples needs to be specified and quality control experiments/data should be included.

Thanks for the suggestion! In the revised manuscript, the whole-body 11-KT, DHP, and P4 of the control males and cyp17a1-/- fish at 3, 3.5, and 4 mpf were measured using Ultra Performance Liquid Chromatography Tandem Mass Spectrometry (UPLC-MS/MS) (Line 133-141). Compared with their control male siblings at their corresponding stages, a significant decrease in 11-KT but an increase in DHP and P4 were observed in the cyp17a1-/- fish (Figure 1A-C). The whole-body 11-KT, DHP, and P4 of the control males and ar-/- males at 3 mpf were also evaluated, but no significant difference was observed (Figure 1—figure supplement 2). Using the UPLC-MS/MS, we observed that the ar-/- males after DHP administration showed a more than threefold concentration of DHP than those reared in the system water (ar-/- males reared in system water: 166.1 ± 70.46, n = 5; ar-/- males reared in DHP: 578.8 ± 379.6, n = 5) (Figure 2K).

4) The authors showed that P4 and DHP treatment increased GSI and spermatozoa number. It is pointed out that the doses used in P and DHP treatments may be too low to be effective or the P and DHP quantification may be way off. It would also be important to assess the P4 and DHP concentrations in pharmacologically treated fish. Did they look at the mature sperm number, motility and fertility?

We appreciate the reviewer for pointing out this. For the concentration of the DHP administration, we apologize for the typo error of the concentration description (0.1 µg/L), which should be 0.067 µg/mL. We have corrected this in the revised manuscript (Line 441-446).

As is shown in the UPLC-MS/MS results, ar-/- males after DHP administration showed a more than threefold concentration of DHP than those reared in the system water (ar-/- males reared in system water: 166.1 ± 70.46, n = 5; ar-/- males reared in DHP: 578.8 ± 379.6, n = 5) (Figure 2K).

We feel sorry for not having the sperm analysis system; instead, we performed fertility (sperm capacity) analysis to assess the sperm fertility of the ar+/+ males and ar-/- males after treatment with DHP (Line 363-378). Unfortunately, both experiments showed impaired fertility after DHP treatment via artificial fecundation assays with WT females. Based on our observations and several previous publications, the chemical reagents of sex steroids used in the animal administration would result in developmental abnormalities, such as the E2 usually leads to abnormal body growth, enlarged abdomen and liver, and a large amount of liquid in the peritoneal cavity induced by 10 nM E2 treatment from 20 dpf to 40 dpf (Chen et al., 2017), and 10 μg/L (36.71 nM) E2 treatment from 18 dpf to 90 dpf, as well as DHP treatment in the present study (data not shown). On the other hand, based on the results in Figure 1B, the dynamic levels of the elevated DHP seen in the cyp17a1-/- fish might suggest that the failure of rescued fertility due to the mismatch with the precise in vivo DHP dynamic levels, or potential side effects of the constant levels of exogenous DHP exposure.

5) Relevant in normal physiology. It would have been useful to compare the presented directly with npgr-/- mutants throughout and compare the cyp17a1-/-; npgr-/- to the ar-/-; npgr-/- and the single mutants. This plus treatment would have clearly answered if progestins play a role in normal physiology. Furthermore, is it possible to inhibit progestin synthesis/secretion in cyp17a1-/- fish or use progestin antagonists (e.g., mifepristone, ORG3170 etc.?) If possible, it will provide further evidence that the elevated levels of progestins is indeed critical.

According to this suggestion, we have analyzed the fish of the eight genotypes from the offspring of the crossed cyp17a1+/-;ar+/-;npgr+/- fish, including cyp17a1+/+;ar+/+;npgr+/+ males (control males), ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (Line 183-186).

According to this suggestion, we have performed the anatomical examination and histological analyses (Line 183-198), and gene expression analyses (Line 215-232) in the fish of the eight genotypes from the offspring of the crossed cyp17a1+/-;ar+/-;npgr+/- fish. Then, the testis gene expression levels in different genotypes were also discussed (Line 333-362) (Please see the response to essential revision 1).

Actually, before the submission of the manuscript, we have administrated the cyp17a1-/-;ar-/- fish with 1 µM mifepristone (RU486) from 60 dpf to 90 dpf. However, no obvious effect on testis organization and spermatogenesis impairment was observed. We think it is possible that the mifepristone treatment for the inhibitory effect of progestin signaling may be concentration-, stage-dependent or the combination of both. On the other hand, though the progestins concentration in the cyp17a1-/- fish is higher than that of its control siblings, it varies at different stages (Figure 1B and C). Therefore, a series administrations of mifepristone on cyp17a1-/-;ar-/- fish at different concentrations or different stages still need further investigation. It also could not be excluded that though mifepristone has been reported as an antagonist for progestin receptor, the inhibitory effect on DHP may not be observed, as it has been reported that RU486 did not block DHP-induced oocyte maturation and adamts9 expression in zebrafish (Liu et al., 2018, PMID: 30279677).

6) Histological analysis: Figures 2, 3 and 4 show quantitative data (the ordinates are labelled with, "number of sperm per cyst"). However, it is not clear how the quantitative histological data were obtained and what exactly they show.

The quantitation of the data was performed with Image J software, and the details were provided in the Materials and methods section of the revised manuscript (Line 436-440). Briefly, the area in each integrative lumen of seminiferous tubules containing spermatozoa was cut and saved as a new image file for further analysis. After the image was re-loaded, the image was transferred to 8-bit gray, and the threshold was selected for sperm selection. The particle number was analyzed after the watershed under the binary submenu was used to dissect the stacked sperm.

7) Immunofluorescence staining: The authors used an antibody against mouse vasa protein on zebrafish testis sections. The antibody used has not been characterized. The ICC procedure has not been described. No proof is provided that the antibody against a mammalian protein reliably detects zebrafish vasa protein.

As the reviewer doubt whether the antibody we previously used (3008, DIA-AN, Wuhan, Hubei, China) is specific in zebrafish, the immunofluorescence staining with the Vasa antibody purchased from Genetex company (GTX128306-S, United States of America) were performed (which has been identified workability for the immunofluorescence staining in zebrafish) (Zhu et al., 2019, PMID: 31533925).

The ICC procedure has been provided in the Materials and methods (Line 447-454). Immunofluorescence staining was performed using an anti-Vasa rabbit polyclonal antibody (GTX128306-S, GeneTex, Irvine, CA, USA) as the primary antibody (Zhu et al., 2019). Fluorescein (FITC)-conjugated goat anti-rabbit IgG (H+L) was used as the secondary antibody (SA00003, Proteintech, Rosemont, IL). As previously described, zebrafish testes were fixed, embedded, sectioned, and stained using standard protocols (Zhu et al., 2019). Nuclear DNA was stained with 4',6-diamidino-2-phenylindole (DAPI). Sections were visualized using 40× objective lenses of an NOL-LSM 710 microscope (Carl Zeiss, Germany). Scale bars are provided for each image.

From the results of immunofluorescence staining, the similar pattern of the Vasa immunofluorescence staining was observed (Line 204-213): the Vasa immunofluorescence localization showed a reduced number of spermatozoa in the lumen of seminiferous tubules of ar-/- males (Figure 5D-F), but an increased number of spermatozoa could be observed in the lumen of seminiferous tubules of cyp17a1-/- fish (Figure 5G-I) and cyp17a1-/-;ar-/- fish (Figure 5J-L), again supporting that the reduced number of spermatozoa in the lumen of seminiferous tubules of ar-/- males was rescued by the further cyp17a1 knockout (in the cyp17a1-/-;ar-/- fish). However, the restoration failed in the cyp17a1-/-;ar-/- fish with further depletion of npgr (in the cyp17a1-/-;ar-/-;npgr-/- fish) (Figure 5M-O), as evidenced by the greater spermatogonia, primary spermatocytes and secondary spermatocytes, but fewer spermatozoa filling in the lumen of seminiferous tubules of cyp17a1-/-;ar-/-;npgr-/- fish (Figure 5O) and the ar-/- males (Figure 5F).

In addition, compared with the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish, the observations of greater spermatogonia and spermatocytes, but fewer spermatozoa in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish were observed in the histological analyses of testes (Figure 4J-Q) (Line 194-197).

8) RNA extraction and qPCR: The authors report to have used a single 'housekeeping gene' (ef1a). However, the cellular composition of testis tissue varies in the different mutants, so that it cannot be excluded that also the readings for ef1a changed, depending on the genotype.

According to the suggestion, transcriptome analyses and qPCR verification of the testes of the control males, ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish, were performed (Line 215-232).

The primers for ef1a were referenced from the previous publication (Crespo et al., 2021, PMID: 33589679) (Table 1). We kept using the ef1a as the internal reference, as the expressions of hsd3β1, insl3, igf3, dnd and cyp26a1 of qPCR with ef1a as the internal reference perfectly matched the expression pattern of the transcriptome analysis (Figure 6E-I). In fact, the qPCR of gonads with ef1a as the internal reference is common in the field (Tang et al., 2018, PMID: 29228103. Crespo et al., 2021, PMID: 33589679. Wu et al., 2020, PMID: 32001440. Lu et al., 2017, PMID: 28398516). On the contrary, the expression of β-actin in the testes of the fish with the eight genotypes showed more differentiated expression patterns than ef1a (Please see Author response image 1).

Author response image 1

9) Statistical analysis: The statistical analyses appear incomplete and may even be flawed. This makes it difficult to assess reproducibility of the quantitative measurements, the claims and conclusions made in this study. The authors should consult a statistician to resolve this issue.

Thanks for the pointing out this. In the revised manuscript, the statistical analysis was clarified and performed (modified) as follows: the statistical significance of differences was determined using Student’s t-test for paired comparisons and one-way ANOVA, followed by Fisher’s LSD test for multiple comparisons. For all statistical analyses, P < 0.05 indicated a significant difference. Significant differences marked with asterisks were analyzed using Student’s t-test for paired comparisons, and letters were analyzed using one-way ANOVA, followed by Fisher’s LSD test for multiple comparisons (Line 475-480) (Figures 1, 2, 3, 4 and 6).

10) Titles: It is surprising that the authors repeatedly mentioned "testicular development", including in the title, since the data presented covers adult fish only.

We found that testes of cyp17a1-/-;ar-/-;npgr-/- fish were structurally disorganized with impaired seminiferous tubules and significantly decreased numbers of mature spermatozoa, similar with the previous observations in ar-/- males (Crowder et al., 2017. PMID: 29272351) and cyp11a2-/- males (Li et al., 2020. PMID: 31693487). According to this suggestion, we have changed "testicular development" to "testis organization" in the revised manuscript, as referred to the previous study (Crowder et al., 2017. PMID: 29272351. Li et al., 2020. PMID: 31693487).

11) A number of substantive concerns were raised with the statements/overstatements in the text. These should be addressed.

We are sorry for the minor concerns. The revised manuscript has been edited with Elsevier Webshop and double checked by us

Reviewer #1:

The authors were intrigued by the observation that loss of the androgen receptor (ar) in zebrafish has a clear impact on spermatogenesis while spermatogenesis remained intact after blocking androgen production through loss of the enzyme cyp17a1. This supports an earlier conclusion also proposed by others: in fish, spermatogenesis can be supported by other than androgen-driven signaling pathways. Since the authors found progestin levels to be higher in cyp17a1 mutants, and since results published previously by others showed that progestins stimulated different aspects of spermatogenesis (spermatogonial development, meiosis, sperm capacitation) in different fish species (eel, tilapia, trout, zebrafish), the authors asked if removing also the nuclear progesterone receptor (npr) from cyp17a1 mutants would result in a spermatogenesis phenotype in zebrafish after all. To answer this valid question, the authors generated mutant lines to seek support for the hypothesis that progestin signaling via its nuclear receptor can maintain spermatogenesis in androgen-depleted cyp17a1 mutants. Also ar-KO zebrafish were subjected to progesterone treatment, although the reasons for that were less clear.

Based on our previous study (Zhai et al., 2018, PMID: 30202919), we hypothesize that the accumulated progestin, DHP, which is upstream product of the androgen, due to cyp17a1 knockout, may contributed to the normally developed testis, as DHP has been reported as the major, potent, and biologically relevant progestin in teleosts (Wang et al., 2016, PMID: 27113852. Scott, 2010, PMID: 20738705). Therefore, the 11-KT, DHP, and P4 measurements in cyp17a1-/- fish and ar-/- fish, as well as their control siblings were performed (Figure 1 and Figure 1—figure supplement 2). The assay of the DHP administration of ar-/- males (Figure 2) is based on Figure 1 and Figure 1—figure supplement 2. This has been clarified in Line 147-149.

Surprisingly, the mutant most pertinent to the main question, the cyp17a1/npr double mutant, was only used to analyze the expression of selected testicular genes. No anatomical or histological data were included, in contrast to all other lines, thus leaving the main question unanswered regarding effects on spermatogenesis.

Thanks for the suggestion. According to this suggestion, we have analyzed the fish of the eight genotypes from the offspring of the crossed cyp17a1+/-;ar+/-;npgr+/- fish, including cyp17a1+/+;ar+/+;npgr+/+ males (control males), ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish. Please see the response to essential revision 1.

Instead, triple mutants were generated by removing also the androgen receptor (cyp17a1/npr/ar) or the Fsh β subunit (cyp17a1/npr/fshb). Unfortunately, the loss of a third gene does not allow to draw "clean" conclusions regarding the consequences of the loss of npr in males unable to produce androgens; also, it is not clear what led to the choice of ar or fshb as third genes to be removed. These points are further discussed in the following.

To our knowledge, compared with the knockdown or chemical reagents administration, the knockout strategy is the most potent method to draw the conclusions. And we would point out that the third gene we knockout from cyp17a1-/-;ar-/- fish is npgr and fshb respectively, not ar or fshβ from cyp17a1-/-;npgr-/- fish as reviewer mentioned. And the reason we choose to knockout npgr or fshb on cyp17a1-/-;ar-/- fish is based on the accumulated DHP and upregulated expression of the pituitary gonadotropin fshb in the cyp17a1-/- fish, these have been given clearly (Figure 1 and Line 179-180 and 313-324).

Follicle-stimulating hormone β subunit (fshb)

Referring to works published by others, the authors state correctly that Fsh can stimulate spermatogenesis independent of sex steroid signaling. Since elevated levels of both Lh and Fsh have been reported in cyp17a1 KO zebrafish, the authors decided to remove the Fsh β subunit gene (reminiscent of work in their 2018 paper), attempting to study the contribution, if any, of Fsh signaling to maintaining spermatogenesis. However, in the cyp17a1/ar/fshb triple mutant, the Fsh receptor is still present. Since the also elevated Lh levels can cross-activate the Fsh receptor (Xie et al., 2017, DOI: 10.1530/JOE-17-0079), it is conceivable that Fsh receptor-mediated signaling remained relevant. Therefore, it seems that removal of the receptor, instead of the ligand, would have been the option to choose for investigating the role of Fsh signaling.

Please see response to essential revision 2.

The authors concluded that removing fshb had no effect on spermatogenesis, referring to GSI levels being similar to controls (L290). However, the authors did not point out that in the cyp17a1/ar/fshb triple mutant, GSI values were halved compared to the cyp17a1/ar double mutant, i.e. removal of fshb apparently did have an effect.

The statement that upregulated Fshβ contributed to the hypertrophic testicular development and over-activated spermatogenesis in the cyp17a1-/-;ar-/- zebrafish given by us it is certainly based on the facts that cyp17a1/ar/fshb triple mutant showed decreased GSI compared to the cyp17a1/ar double mutant (Line 318-324).

Before the generation of the cyp17a1/ar/fshb triple mutant and the analysis, the Fshb contribution in testis organization or spermatogenesis of cyp17a1-/-;ar-/- could not be concluded. For example, unlike fshβ, the knockout of lhβ has not any obvious restoration on hypertrophic testis or enhanced spermatogenesis in the cyp17a1-/- fish (Data not shown). Therefore, the dissection of the upregulated lhβ and fshβ in our generated mutants based on these genetic data is very important and could not be assumed, as we could not make the conclusion (the upregulated Fshβ contributed to the hypertrophic testicular development and over-activated spermatogenesis in the cyp17a1-/-;ar-/- zebrafish) until we actually further depleted fshβ from the cyp17a1/ar double mutant and analyzed.

Androgen receptor

The authors mention the possibility that elevated levels of low affinity ligands might activate the Ar in the absence of androgens, such as the elevated progestin levels of found in cyp17a1 mutants. Based on the data presented in Figure 1, the reviewer calculated the combined concentrations of P and DHP to be ~60 nM (data from Figure 1). This is 10- to 20-fold lower than the progestin concentration required to induce some activity of the zebrafish Ar; moreover, the progestin-induced Ar activity is only ~1/10th of the activity induced by androgens (based on the data cited by the authors as de Waal et al., 2008). Hence, available information suggested that progestin concentrations were too low and could only marginally activate the Ar, and therefore seem irrelevant for cross-activating the zebrafish Ar. The reviewer wonders about potential other reasons for carrying out the experiments shown in Figure 2.

We would remind that the affinity between progestin and Ar was not relevant in the present study, as we think that the accumulated progestin in the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish execute its function with nPgr. Thus, the concentration of the progestins, the reviewer think that is too low (~60 nM) to activate Ar is not related, as we are trying to say throughout the manuscript is that nPgr is the receptor of accumulated progestin in facilitating testis organization and spermatogenesis, which is independent from androgen signaling. Moreover, though the reviewer think that the whole-body progestin concentration is too low, we would remind that it could not reflect the concentration status of progestins in the gonads as well.

A question requiring attention is the treatment with progestins (Figure 2) also relating to Figure 1. It shows the endogenous progestin levels in ar-KO mutants being ~5-10ng/g = 5-10µg/kg, equivalent to 5-10µg/L. In Figure 2 and the associated text, the authors report clear effects following exposure of ar-KO fish to P or DHP at a concentration of 0.1µg/L. Reporting clear treatment effects using progestin concentrations 50-100 times lower than the endogenous concentrations would require a careful discussion.

We appreciate the reviewer for pointing out this. We apologize for the typo error of the progestin concentration description (0.1 µg/L), which should be 0.067 µg/mL for the administration of fish from 50 to 90 dpf. We have corrected the mistake in the revised version of the manuscript (Line 444).

Other results obtained with fish carrying a mutated ar await being discussed. For example, the authors find, similar to others, that spermatogenesis is compromised in ar-KO zebrafish and claim (L193 and following) that testicular gene expression analysis (Figure 6) supports this finding. However, the five 5 germ cell genes quantified seem clearly elevated in ar-KO fish showing compromised spermatogenesis after loss of the ar. How to reconcile increased germ cell gene expression with compromised spermatogenesis remains unclear. Similarly, germ cell gene expression is reported to be upregulated in the cyp17a1/npr/ar triple mutants compared to cyp17a1/npr double mutant, i.e. the combination of impaired spermatogenesis and increased germ cell gene expression following removal of the ar gene comes up again. This time, however, not all five germ cell genes but only four were responding, and it is unclear why is there an "odd one out" in this specific genetic model.

Please see the response to essential revision 1.

More comprehensive discussion is perhaps also required regarding the Tgf β family member Amh. The authors did discuss the role of Amh in spermatogonial differentiation, but may have overlooked Amh-promoted transition into meiosis (https://doi.org/10.1016/j.mce.2020.110963).

Based on the transcriptome analyses and qPCR verification, the gene expression analyses have been re-written in the revised manuscript (Line 215-232, 333-362). Please see the response to essential revision 1.

The authors repeatedly make the point, including in the title, that progestin signaling stimulates spermatogenesis independently from androgen signaling. This wording is not sufficiently precise. The genetic evidence presented is based on fish that are unable to produce androgens. This does not exclude the possibility that the Ar protein can exert biological activity in the absence of androgens (or any other type of ligand). Ligand-independent Ar action may indeed be related to changes in gene expression induced by removing the ar from the cyp17a1/npr double mutants (see above). Therefore, the conclusion/point (progestin stimulates spermatogenesis independently from androgen signaling) should be restricted to fish unable to produce androgens. Another reason to do so is that in the presence of androgens (the physiological situation), androgen/Ar-mediated effects may very well interact with progestin/Npr effects on spermatogenesis.

Though Ar has ligand-independent action, i.e., Ar protein can exert biological activity in the absence of androgens (or any other type of ligand), the following evidence support the hypothesis that the cyp17a1 knockout activated the compensatory pathway in promoting testis organization and spermatogenesis, which is ar-independent, but npgr-dependent: first, the testis organization and spermatogenesis of ar-/- males were evidently rescued by DHP administration (Figure 2). Second, the enhanced spermatogenesis could be achieved in cyp17a1-/-;ar-/- zebrafish, which clearly indicates that this phenotype of the enhanced spermatogenesis can be independent from the presence of the androgen/ar signaling in zebrafish (Figure 3). Third, compared with the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish, the GSI and spermatozoa number were both significantly declined in cyp17a1-/-;npgr-/- fish (Figure 4). Four, compared with the cyp17a1-/-;ar-/- fish, the testis organization and spermatogenesis failed in the cyp17a1-/-;ar-/-;npgr-/- fish (Figure 4). Besides, no significantly differences between the levels of the specific gene markers of the testis samples from the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish (Figure 6), which suggesting no evident effects of ligand-independent Ar action has been seen in the course of the spermatogenesis.

Considering the comments raised by the reviewer, to emphasize that the statement is based on the premise of accumulated progestin in the cyp17a1-/- fish, we have changed the title to "High level of progestin signaling facilitates testis organization and spermatogenesis independently from androgen signaling in fish".

A repeatedly occurring statement requiring attention is the mentioning of testis development or testicular development in the manuscript. It would be appropriate to remove all of this from the manuscript, including the title, because respective data is not presented. The datasets in the manuscript refer exclusively to adult males.

Please see the response to essential revision 10.

Another point refers to an alternative understanding of the phenotype of the cyp17a1 mutant. First mentioned in L96-97, this mutant is described as presenting stimulated or enhanced spermatogenesis. The reviewer assumes that the authors refer to the GSI levels and spermatozoa number being higher than in WT adults older than 3 months. The age is relevant since in young adults up to 3 months of age, the GSI is still similar to WT controls. However, neither in the previous study (Zhai et al., 2018) nor in the present manuscript, spermatogenic activity has been studied in detail. The fact that the phenotype of increased GSI/sperm number developed with time after 3 months of age (as described in Zhai et al., 2018) and the histological pictures shown in Zhai et al., 2018 and in the present manuscript, suggests that the weight gain is based on progressively accumulating spermatozoa. Since cyp17a1 mutants don't show reproductive behavior/spawning, the reviewer understands the slowly increasing GSI by progressively accumulating sperm formed at a normal rate. Claiming enhanced spermatogenesis requires research into the dynamics of this cellular development that is missing as yet.

The accumulation of sperm may also explain increased DHP levels. The enzyme converting 17aP to DHP, 20bHSD, is highly active in spermatozoa of salmonid and cyprinid species, including the zebrafish relatives carp and goldfish. In this regard, elevated DHP levels may reflect an "accidental side-effect" of sperm with their associated 20bHSD activity, accumulating in the testes of cyp17a1 mutants, and then metabolizing the substrate 17aP that is available in high levels due to the loss of cyp17a1.

We would remind that the increased GSI and stimulated spermatogenesis, as well as normal fertility (sperm capacity) as evidenced with artificial fecundation, is common in the field. As histological analysis, anatomical observation, germ cell distribution analysis, etc. are common in the field (Crowder et al., 2018; Lau et al., 2016; Li et al., 2020; Lu et al., 2017; Tang et al., 2018; Tang et al., 2016; Yin et al., 2017; Yu et al., 2018; Zhai et al., 2018; Zhu et al., 2015). On the contrary, to our knowledge, the spermatogenic activity mentioned by the reviewer is rarely used in zebrafish.

In fact, only the males of cyp17a1+/+, cyp17a1+/- and cyp17a1-/- zebrafish were kept in the fish systems for the further analyses at 3 mpf. Thus, there is no difference of the reproductive behavior/spawning of the test male fish between different genotype fish from 3 mpf. It should not be related with the accumulating sperms during the 3 mpf to 6 mpf.

In addition, it has been reported that the elevated levels of fshβ transcriptional expression if responsible for the increased GSI and spermatogenesis in our early report (Zhai et al., 2018). We would remind that at 3 mpf, the cyp17a1-/- fish has increased GSI, though the statistical difference is not significant (Zhai et al., 2018, Figure 1K). On the other hand, the levels of fshβ transcriptional expression kept increasing during the 3 to 6 mpf (Zhai et al., 2018, Figure 6F).

Finally, some of our unpublished data also provide evidence indicating the promotion function of Fshβ on differentiation of the spermatozoa at early stage (at 45 dpf, before the onset of the puberty in WT male zebrafish), the spermatozoa could be observed in the testis of cyp17a1-/- fish, which could not be observed in the control males until 50-55 dpf. More specifically, the accelerated spermatogenesis onset of cyp17a1-/- fish was rescued when fshb is removed (in the cyp17a1-/-;fshb-/- fish) (Please see Author response image 2).

Author response image 2

Overall, the reviewer considers it as a pity that the manuscript does not report also first results regarding mechanisms underlying the progestin-stimulated maintenance of spermatogenesis in cyp17a1 KO zebrafish. Such data would elevate the manuscript from its descriptive nature. Nevertheless, the authors have generated valuable genetic models that may allow, in the future, not only to provide the previously reported, progestin-mediated stimulation of spermatogenesis with a firm genetic basis in zebrafish, but also to broaden our knowledge on the mechanisms underlying progestin effects on spermatogenesis.

We agree that we did not reveal the mechanisms underlying the progestin-mediated promotion of spermatogenesis in cyp17a1 KO zebrafish in the present study. However, we provide the evidence for the capacity of the progestin-mediated promotion of spermatogenesis, and which can be effective independent from the androgen/androgen receptor signaling. The mechanism would be elucidated in further studies.

Materials and methods section

Steroid assays: The approach used to extract steroids from tissue samples needs to be specified and quality control experiments/data are missing. Contrary to the authors' statement, the procedure is not specified by the manufacturer. Looking up the manufacturer's specifications showed that these assays are meant for aqueous samples (plasma, serum, whole blood, urine samples, in vitro medium samples are mentioned, but not tissue or whole body extracts). Therefore, validation of the techniques for a new type of samples is required. This also includes the point that the authors apparently did not control for procedural losses. In addition, whole body extracts contain several compounds co-extracted with steroids that can disturb the assays, as indicated by the manufacturer, who suggested to remove the impurities even from much less complex samples such as blood plasma extracts, before introducing the samples into the assay. Has this been done? Finally, the authors do not report validation and standardization of the assays (e.g. extraction efficiency and potential correction for procedural losses, or reliability [i.e. is a spiked amount of steroid found back at the expected concentration?]). As reported now, results on steroid quantifications cannot be accepted as sufficiently reliable or accurate.

Thanks for the suggestion. In the revised manuscript, the whole-body 11-KT, DHP, and P4 of the control males and cyp17a1-/- fish at 3, 3.5, and 4 mpf were measured using Ultra Performance Liquid Chromatography Tandem Mass Spectrometry (UPLC-MS/MS) (Line 133-141). Compared with their control male siblings at their corresponding stages, a significant decrease in 11-KT but an increase in DHP and P4 were observed in the cyp17a1-/- fish (Figure 1A-C). The whole-body 11-KT, DHP, and P4 of the control males and ar-/- males at 3 mpf were also evaluated, but no significant difference was observed (Figure 1—figure supplement 2). These results not only confirmed that androgen biosynthesis is impaired in the cyp17a1-/- fish, but also reminded us that compared with the cyp17a1-/- males, which demonstrated higher concentrations of DHP and P4 than its control male siblings, the ar-/- males exhibited comparable concentrations of DHP and P4 with its control male siblings.

Histological analysis: Figures 2, 3 and 4 show quantitative data (the ordinates are labelled with, "number of sperm per cyst"). However, the respective M and M section does not detail how the data was obtained and processed. Regarding the label on the ordinate, please refer to literature on spermatogenesis in fish, the point being that after completion of spermiogenesis, the spermatogenic cysts open and germ cells are released by the Sertoli cells into the lumen of the spermatogenic tubules. From then on, the germ cells are called spermatozoa, which are no longer in cysts. Hence, "sperm per cyst" is a contradiction in terms, leading to the question if "sperm" or "per cyst" is not correct? These points require clarification for the data to be kept in the manuscript. Also the legend to Figure 5 requires attention in this regard. The authors state that scale bars are provided in each image – this is not correct, since for example on Figure 2, there are no scales; the scales on Figure 4, on the other hand, are probably not correct. In L342, please replace size by thickness.

Please see response to essential revision 4.

Thanks for pointing out this. We have changed "spermatogenic cyst" to "lumen of seminiferous tubules", which has been reported contains developing sperm surrounding mature sperm (Crowder et al., 2017).

Following the suggestions, the scale bars in each image has been added in the revised version of the manuscript (Figure 2-5). Besides, the "size" has been replaced with "thickness" (Line 433).

P4 and DHP treatment: Please refer to the point made above in this context in Public Review (100-fold lower concentration used for treatments than found in the fish).

For the concentration of the DHP administration, we apologize for the typo error of the concentration description (0.1 µg/L), which should be 0.067 µg/mL. We have corrected this in the revised manuscript (Line 441-446).

Immunoflourescence staining: The authors report to have used an antibody against mouse vasa protein on zebrafish testis sections. The antibody used has not been characterized. The ICC procedure has not been described. No proof is provided that the antibody against a mammalian protein reliably detects zebrafish vasa protein. In the Results section, the authors state in L182 that the ICC data demonstrate "…a reduced number of spermatozoa…in ar-/- males…but increased number of spermatozoa … in … cyp17a1 fish". However, spermatozoa do not express vasa protein. Moreover, since the ICC results in Figure 5 have neither been quantified nor normalized, statements referring to differences in cell numbers should be avoided.

Please see response to essential revision 7.

We agree that spermatozoa do not express vasa protein; therefore, this was utilized for distinguishing the SZ from SG and SC cells (Line 201-203).

We described the cell with "greater" in the manuscript, not mentioned with "statistically difference". Please note that this is common in the field, especially in some special situations that it is hard to perform the statistical analysis (Crowder et al., 2018; Tang et al., 2018; Yu et al., 2018; Zhang et al., 2020).

RNA extraction and qPCR: The authors report to have used a single 'housekeeping gene' (ef1a). However, the cellular composition of testis tissue varies in the different mutants, so that it cannot be excluded that also the readings for ef1a changed, depending on the genotype. The request is to include the ef1a data as a separate graph in Figure 6 (e.g. as Figure 6K) for the different genotypes and subject them to statistical analysis. If differences are detected between genotypes, it is possible to use the approach explained in the following. For the future (or in case ef1a shows changes here), consider using at least three different reference genes, showing a large range of expression levels, and calculate qPCR results using their geometric mean as normalization.

Please see response to essential revision 8.

Statistical analysis: This is one of the more critical points in the msnuscript, since the potential problems here prevent evaluation of all quantitative data presented in the manuscript. The number of replicates per experiment/treatment group has not been provided. It is mentioned that experiments were repeated three times. However, how were the data obtained from these three experiments then used for statistical analysis and plotting of the graphs? In most graphs presenting quantitative data, the authors compare more than 2 groups with each other, usually 4-6 groups. The authors state in L369 that "differences were assessed using Student's t-test." With this test, however, only differences between two groups can be assessed, under the condition that the data is distributed normally. However, neither was data distribution tested, nor were there only two groups. Therefore, all statistical analyses need to be repeated.

Thanks for the pointing out this. In the revised version of the manuscript, the statistical analysis was performed as follows: the statistical significance of differences was determined using Student’s t-test for paired comparisons and one-way ANOVA, followed by Fisher’s LSD test for multiple comparisons. For all statistical analyses, P < 0.05 indicated a significant difference. Significant differences marked with asterisks were analyzed using Student’s t-test for paired comparisons, and letters were analyzed using one-way ANOVA, followed by Fisher’s LSD test for multiple comparisons (Figures 1, 2, 3, 4 and 6, Line 475-480).

Introduction

As indicated above, this following list mentions selected points independent of the re-analysis of the data. The term "selected" is used also because the number of points requiring comments is high and the list is far from complete. Hence, the authors will have to identify the points not mentioned below during a thorough re-writing process.

In the reviewer's opinion, the complete 1st paragraph of the Introduction can be removed.

Following the suggestion, we have re-written the 1st paragraph in our revised manuscript. We think it is necessary to summarize the current information about the knowledge of functions of androgen and progestin in zebrafish revealed with KO models. Especially for the 3rd conclusion, which we think that it is necessary (the reviewer think it should be removed, please see below), as the function of progestin signaling has only be focused on ovulation in female zebrafish previously. We think that the revised 1st paragraph, in which the current information of the androgen and progestin signaling in zebrafish has been introduced, is helpful for understanding the significance of our finding (Line 53-65).

L49-56: This sentence contains several unclear or awkward statements (e.g. "the reproduction research" – grammar; "advantage of gonadal dissection" – ??; "successfully adopted KO strategy" – applies to virtually thousands of species; "pharmacological utilization" – ???).

Following the suggestions, this paragraph has been re-written in our revised manuscript (Line 52-61). As we are not native English speakers, the revised manuscript has been proofread by Elsevier English Language Editing Webshop.

Conclusions in L57-61: the 1st conclusion is irrelevant in the present context; the 2nd conclusion is in part wrong (see following point); the 3rd conclusion is irrelevant in the present context

For the 3rd conclusion, it is necessary as the function of progestin signaling has only be focused on ovulation in female zebrafish previously. Following the suggestions, this paragraph has been re-written in our revised manuscript (Line 61-65).

L58-61: Contrary to the authors' statement androgen signaling is not essential for testicular differentiation and development or for spermatogenesis in fish and the papers cited do not make this claim either. After all, the authors did study testis tissue from ar-KO mutants and this tissue contained all types of germ cells including sperm (e.g. Figure 2K). This wrong statement is repeated in L62 (wrong regarding testis development in fish).

Following the suggestions, Line 58-61 has been re-written in our revised manuscript, and Line 62 has been removed (Line 61-65).

L79-82: A series of statements is made but not supported by citations.

The citations have been provided (Line 88).

L103-104: The authors state that "administration of P4 and DHP effectively restored … GSI and spermatozoa number…". However looking at the graphs in Figure 2 G and N, the formulation is not correct since the controls showed higher levels (pending the re-analysis of the data, significantly higher in the controls). This type of error/overstatement occurs frequently.

We agree that the number of spermatozoa in each lumen of seminiferous tubules of ar-/- fish after DHP administration is still significantly lower than those of the control fish (Figure 2J). However, the impaired phenotypes have been significantly improved when compared with the ar-/- males reared in system water supplemented with the vehicle. It is hard to rescue the spermatogenesis in zebrafish fully with the in vitro administration of steroid. As seen in the Figure 1B, the in vitro immersion of DHP could be difficult to precisely match the dynamic of progestin production in vivo. On the other hand, based on our observations and several previous publications, the rescue effects of steroids, such as the E2 usually leads to abnormal body growth, enlarged abdomen and liver, and large amount of liquid in the peritoneal cavity induced by 10 nM E2 treatment from 20 dpf to 40 dpf (Chen et al., 2017, PMID: 29055862), and 10 μg/L (36.713 nM) E2 treatment from 18 dpf to 90 dpf (Data not shown in our previous study). E2 have been widely stated for its rescue effects on the ovarian differentiation of the cyp17a1-/- fish or cyp19a1a-/- fish (Zhai et al., 2018, PMID: 30202919; Lau et al., 2016, PMID: 27876832; Yin et al., 2017, PMID: 28575219), though the fertility could not be successfully restored. Even though, the observations can still support the role of estradiol on ovarian differentiation. Likewisely, we would like to remind that the function of the administration of the DHP in the present study is meaningful. The improvement of the testis organization and spermatogenesis is statistically recovered, which supports our statement, as we have illustrated the statistical significance after statistical analysis in the Figure 2.

L110: Another example for an overstatement is to use the term "arrested" to describe the effect of ar loss on spermatogenesis. While this is correct for mammals, it is not for zebrafish (see the authors' data in Figure 2K, showing an ar-KO testis with all types of germ cells including spermatozoa, i.e. no arrest).

Thanks for the pointing out this. The "arrested" has been replaced with "impaired" throughout the manuscript and highlighted in red.

Overall, the introduction contains passages that rather read like Results or Discussion section. Please amend.

Thanks for the pointing out this. The introduction has been re-organized and re-written (Line 52-119).

Results and Discussion

Both sections contain statements that would require comments. However, the contents of these statements have been touched upon already, in one way or another, in the points discussed above. Therefore, the reviewer does not make specific comments to these sections, also considering the statistical/data uncertainties and technical questions remaining to be solved, which will likely result in several changes in these two sections.

Thanks for the efforts in reviewing the manuscript and provide the valuable suggestions. We have carefully revised the manuscript and addressed the comments point by point. We hope you will find it ideally suited for the journal.

Reviewer #2:

The authors present a paper suggesting that progestin facilitates testicular development in zebrafish. Overall, the paper tries to explain interesting observations made in their cyp17a1-/- lines that are different compared to fish with androgen deficiency and androgen resistance. Interestingly, the specific block in steroidogenesis led to an increase of progestins and the authors work up the hypothesis that progestins represent an androgen-independent regulator of testicular development and spermatogenesis. Is this a compensated "disease" state or a mechanism that is relevant under normal physiological circumstances?

The authors present quite some detailed analysis of a structured combination of various mutants/ double/ triple mutants to explore their hypothesis, which appears a major strength of the paper. There some aspects such as the effect pf progestin treatment on wildtypes and the discussion if these are physiological, pathophysiological or pharmacological effects that would need further analysis and clarification. A major weakness of the paper is that no direct comparison with npgr-/- lines have been made to explore the questions not only from the angle of androgen deficiency and resistance with progestin excess.

Overall this paper might form the basis some interesting novel research investigating the interplay between androgens and progestins in zebrafish gonadal development and function. The work is convincing, but despite the fact that progestins are known to play an important role in spermatogenesis, it is remains unclear if progestins play the same significant roles in wildtype fish.

Despite a number of very interesting experiments that clearly show a role progestins in testicular development in androgen-deficient/ resistant zebrafish, it remains unclear if this is relevant in normal physiology or only to explain overserved phaenomena in mutant lines. It would have been useful to compare the presented directly with npgr-/- mutants throughout and compare the cyp17a1-/-; npgr-/- to the ar-/-; npgr-/- and the single mutants. This plus treatment would have clearly answered if progestins play a role in normal physiology. Importantly, how high are concentrations in the treated zebrafish? Are these physiological or pharmacological effects?

According to this suggestion, we have analyzed the fish of the eight genotypes from the offspring of the crossed cyp17a1+/-;ar+/-;npgr+/- fish, including cyp17a1+/+;ar+/+;npgr+/+ males (control males), ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish. Please see response to essential revision 1.

As is shown with the UPLC-MS/MS result, the ar-/- males after DHP administration showed a more than threefold concentration of DHP than those reared in the system water (ar-/- males reared in system water: 166.1 ± 70.46, n = 5; ar-/- males reared in DHP: 578.8 ± 379.6, n = 5) (Figure 2K) (Line 155-157).

The origin thin and transparent testis of ar-/- males become white and full-grown after DHP treatment, indicating an improved testis development (Figure 2B, D, E, G, I and J); however, based on our observations, for the ar+/+ males with or without DHP treatment, the GSI and sperm number analysis seems largely unaffected (Figure 2A, C, E, F, H and J). This may be the presence of androgen signaling in ar+/+ males, which has been reported to be necessary for proper sex differentiation and development in vertebrates.

It would be very interesting to see the effects of synthetic progestins, such as medroxyprogesterone, levonorgestrel, dydrogesterone, etc, on the ar-/- males. We are also looking forward to seeing whether these chemicals are capable in rescuing the defective testis organization and spermatogenesis in ar-/- males in the further studies. However, as we mentioned in the manuscript (Line 363-378), the in vitro progestins exposure of ar-/- males could be difficult to match precisely the in vivo dynamic DHP production of cyp17a1-/- fish, and the potential side effects of the constant levels of exogenous progestins exposure might affect body growth, development, or reproduction of ar-/- males.

Overall, it appears that the progestin excess does not compensate it rather leads to hyperplastic testes, which in itself appears interesting and could be further addressed. Could this be relevant to answer environmental questions/ exogenous progestin exposure?

Lines 253-257: This raises the key question of progestins are really required for testicular developments and spermatogenesis.

I disagree with this statement. The authors demonstrate is that progestins can override defective androgen synthesis and the effects on testicular development. It would have been very interesting see if sperm from the various mutant lines can fertilise eggs. In addition, the assessment of mature sperm count and their motility would have been vital to understand the phenotype better.

We have re-written this section (Line 363-378). Please see response to essential revision 4.

If progestins are required in a way that the authors suggest then a direct comparison with the npgr-/- in their representations would be very useful I not essential.

Thanks for the suggestion. We agree that the additional analysis of the other genotypes is helpful; therefore, for the anatomical analysis, histological analysis and gene expression analysis, we have analyzed the fish of the eight genotypes from the offspring of the crossed cyp17a1+/-;ar+/-;npgr+/- fish, i.e., control males, ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/-, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (Figures 4 and 6, Line 183-198, 215-232 and 333-362). The comparison results have been provided in our revised manuscript (Figures 4 and 6). Since the progestin level was significant higher in cyp17a-/- and cyp17a-/-; ar-/- males compared with their control males respectively, the facts of the impaired testis organization and spermatogenesis could be caused by further depletion of npgr in either cyp17a1-/- or cyp17a-/-;ar-/- background, clearly indicating that the high level of progestins/npgr signaling resulted from cyp17a1-deficiency is required for the proper testis organization and spermatogenesis.

It remained unclear why effects on the hypothalamic pituitary gonadal axis have not been assessed? This could provide further evidence about the degree of compensation by progestins. It would have been interesting if there could be synergistic effect of gonadotrophs or if there is a downregulation or even more interestingly if lh and fsh are differentially affected.

The expression analysis of pituitary fshβ in fish of the cyp17a1+/+;ar+/+;npgr+/+ males, ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish were performed. The expression of pituitary fshβ in fish of the eight genotypes mentioned above was also examined (Line 324-332). We found that the expression of fshβ was upregulated in the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish, as expected based on our previous study (Zhai et al., 2018). The npgr depletion did not affect pituitary fshβ expression, as npgr-/- males and ar-/-;npgr-/- males exhibited comparable fshβ expression to control males; however, the addition of cyp17a1 depletion significantly upregulated fshβ expression in the males of these genotypes (in the cyp17a1-/-;npgr-/- fish and cyp17a1-/-;ar-/-;npgr-/- fish) (Figure 6—figure supplement 2). From these results, we observed the impaired spermatogenesis and testis organization, and the upregulated expression of pituitary fshβ in cyp17a1-/-;ar-/-;npgr-/- fish.

This could be very different to the upregulation of the HPG axis in recently described androgen deficiency fish is secondary. Parts of the discussion are not entirely clear as it cannot be expected to restore testicular development in other species. The message of this part of the discussion appears not entirely clear.

We agree. This paragraph has been re-written. In the revised manuscript, the gonadal-pituitary feedback axis in the cyp17a1-/- fish and cyp19a1a-/- fish were retained and discussed, to remind the readers that the upregulated Fshβ contributed to the hypertrophic testicular development and over-activated spermatogenesis in the cyp17a1-/-;ar-/- zebrafish, which were also observed in the cyp17a1-/- fish and cyp19a1a-/- fish (Figure 6—figure supplement 1 and Line 309-324).

The steroid assays are not well described. How have they been validated? Assays to measure all compound by LC/MSMS are available and preferable when measuring analytes in this low concentration range as in zebrafish. The use of ELISAs for specific hormones appears outdated and less robust than LC/MSMS assay. This appears to be a real weakness of the paper.

Thanks for the suggestion! In the revised manuscript, the whole-body 11-KT, DHP, and P4 of the control males and cyp17a1-/- fish at 3, 3.5, and 4 mpf were measured using Ultra Performance Liquid Chromatography Tandem Mass Spectrometry (UPLC-MS/MS) (Line 133-141). Compared with their control male siblings at their corresponding stages, a significant decrease in 11-KT but an increase in DHP and P4 were observed in the cyp17a1-/- fish (Figure 1A-C). The whole-body 11-KT, DHP, and P4 of the control males and ar-/- males at 3 mpf were also evaluated, but no significant difference was observed (Figure 1—figure supplement 2A-C).

It would be very important to assess the P4 and DHP concentrations in pharmacologically treated fish. The GSI does not seems to change; are the treated animals with larger testes heavier/ longer?

Using the UPLC-MS/MS, we observed that the ar-/- males after DHP administration showed a more than threefold concentration of DHP than those reared in the system water (ar-/- males reared in system water: 166.1 ± 70.46, n = 5; ar-/- males reared in DHP: 578.8 ± 379.6, n = 5) (Figure 2K) (Line 155-157).

The origin thin and transparent testis of ar-/- males become white and full-grown after DHP treatment, indicating an improved testis development (Figure 2B, D, E, G, I and J); however, based on our observations, for the ar+/+ males with or without DHP treatment, the GSI and sperm number analysis seems largely unaffected (Figure 2A, C, E, F, H and J). This may be the presence of androgen signaling in ar+/+ males, which has been reported to be necessary for proper sex differentiation and development in vertebrates.

Over long stretches, I have asked myself why the authors did generate a triple mutant rather and only a double mutant cyp17a1-/-; ngpr -/-? This double mutant appears out of the blue in figure 6; why has no other data been provided on the double mutant? It appears vital to present data on that double mutant. As stated above several times it would have been important to get an idea about the phenotype of the npgr-/- to see what happens to spermatogenesis.

Thanks for the suggestion. Please see response to essential revision 1.

Reviewer #3:

Previous studies from this group showed that cyp17a1-/- fish are all male with enhanced testicular development and spermatogenesis. Since the testosterone (T) and 11-KT levels are lower in the mutant fish, it was postulated that there is an androgen-independent signaling pathway. In this study, the authors showed the levels of progestins (P4 and DHP) were elevated in cyp17a1-/- fish and treatment of ar-/- fish with exogenous P4 and DHP partially restored spermatogenesis and testicular development. By generating and analysis of cyp17a1, ar, npr double and triple mutant fish lines, they concluded that the elevated levels of progestins functions as an additional and Ar-independent pathway regulating zebrafish spermatogenesis and testicular development.

Overall, the findings are new and interesting. The genetic rescue crossing data are quite convincing. The manuscript is well written and the data nicely presented.

The following are my comments and questions:

1) The authors showed that P4 and DHP treatment increased GSI and spermatozoa number. Did they look at the mature sperm number, their motility and fertility in the treated fish? If yes, please include the data. If not, please discuss possible outcome.

Good suggestion! Please see response to essential revision 4.

2) Is it possible to inhibit progestin synthesis/secretion in cyp17a1-/- fish or use progestin antagonists (e.g. mifepristone, ORG3170 etc.? If possible, it will provide further evidence that the elevated levels of progestins is critical.

This is a very good suggestion! Please see response to essential revision 5.

3) Figure 5 can be better described. For instance, how the authors identify SG, PSP, SSP, and SZ cells? This will help the general eLife readers. It will also be helpful to quantify the results.

According to this suggestion, the identification standards for SG, PSP, SSP and SZ cells have been provided: It has been reported that, with the differentiation of germ cells from spermatogonia to advanced stages of spermatids and sperm, Vasa signal intensity enriched in the cytoplasm decreases (Dai et al., 2021; Yu et al., 2018) (Line 201-203).

Compared with control males (Figure 5A-C), the Vasa immunofluorescence localization showed a reduced number of spermatozoa in the lumen of seminiferous tubules of ar-/- males (Figure 5D-F), but an increased number of spermatozoa could be observed in the lumen of seminiferous tubules of cyp17a1-/- fish (Figure 5G-I) and cyp17a1-/-;ar-/- fish (Figure 5J-L), again supporting that the reduced number of spermatozoa in the lumen of seminiferous tubules of ar-/- males was rescued by the further cyp17a1 knockout (in the cyp17a1-/-;ar-/- fish). However, the restoration failed in the cyp17a1-/-;ar-/- fish with further depletion of npgr (in the cyp17a1-/-;ar-/-;npgr-/- fish) (Figure 5M-O), as evidenced by the greater spermatogonia, primary spermatocytes and secondary spermatocytes, but fewer spermatozoa filling in the lumen of seminiferous tubules of cyp17a1-/-;ar-/-;npgr-/- fish (Figure 5O) and the ar-/- males (Figure 5F) (Line 199-213).

Compared with the cyp17a1-/- fish and cyp17a1-/-;ar-/- fish, the observations of greater spermatogonia and spermatocytes, but fewer spermatozoa in the ar-/- males, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish were observed in the histological analyses of testes (Figure 4J-Q) (Line 194-197).

4) The description and discussion about Figure 6 are not as clear as the other figures. For instance, the sycp3 results are different from those of vasa,, dnd, nano and piwill. What are these data telling us? Likewise, the patterns of star, hsd3b and cyp11a2 expression are different? What are these results saying and how do they related to the spermatogenesis phenotypes?

According to this suggestion, the transcriptome analyses of the testes of the control males, ar-/- males, cyp17a1-/- fish, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish, were performed and discussed (Line 215-232, 333-362). Please see response to essential revision 1.

5) Line 154: "…confirm that the accumulated progestins, P4 and DHP, acts directly to facilitate testicular development and spermatogenesis …". Please remove the word "directly". This is too strong since no data suggesting the exogenously add P4 and DHP act indirectly or indirectly.

Good suggestion! To avoid confusing the readers, we have removed the word "directly" or "direct" according to the suggestion.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

There, however, remaining issues that need to be addressed, as outlined below:

1) The current version of the manuscript is very difficult to read. Many sentences are hard to understand or can be interpreted in different ways. I suggest the authors to seek help from colleagues/professionals to edit the manuscript thoroughly. They can also choose to work with an eLife copyeditor to address this issue.

We feel sorry for the language problem. As we are not native English speakers, the manuscript has been proofread by three colleagues in USA and has been double-checked by us when the manuscript was in revision. The re-worded title, the revised and detailed descriptions and discussions in the manuscript, and modifications on the figures are also made in the revised manuscript.

2) Another reason is presentational. Instead of presenting the data based on a chronological order, I suggest them to present the data following the order of Figure 7. For instance, it would be much easier for the readers to follow if they change Figure 3 into Figure 1, F1->2, and F2->.

We appreciate the suggestion. The orders of the figures have been updated according to the suggestion.

3) The fertility data should be included.

The fertility data has been included in New Figure 3—figure supplement 1. The original data has been provided in Figure 3—figure supplement 1 – Source data.

4) The RNAseq data presentation. It is clear this is a huge amount of information. What is unclear is what do these data mean? I suggest the authors to dig into this dataset and present the data in relationship to the main conclusion/model (see Figure 7). For example, is it possible to see any changes in genes involved in the progestin/androgen biosynthesis (in addition to cyp17a1), nPgr target genes, and/or Ar target genes in these mutants?While it is okay to presenting all 8 groups together, it may be more meaningful to also compare the transcriptomic changes among different pairs of genotypes (in relationship to the main conclusion in Figure 7).

Good suggestion! Accordingly, we explored the potential impact on the expression of genes in fish of different genotypes (Line 242-267). From our previous observations, the changes in genes involved in the progestin/androgen biosynthesis (gonadal steroidogenesis), including star, hsd3β1, cyp11a2, and cyp11c1, were all increased in the testes of ar-/- males, npgr-/- males, cyp17a1-/-;ar-/- fish, cyp17a1-/-;npgr-/- fish, ar-/-;npgr-/- males, and cyp17a1-/-;ar-/-;npgr-/- fish (Line 225-228, Figure 6A). We also analyzed the expression of genes in fish of different genotypes based on more specific comparisons. Since the normal spermatogenesis has been observed in the control males, cyp17a1-/-;ar-/- fish and cyp17a1-/- fish, while the defective spermatogenesis has been observed in cyp17a1-/-;ar-/-;npgr-/- fish. Therefore, the expressed genes in cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the control males, cyp17a1-/-;ar-/- fish and cyp17a1-/- fish respectively, were analyzed and presented in a Venn diagram (Figure 6-supplement figure 1A), which could be used to identify the common transcripts responsible for the normal spermatogenesis course. Out of 1380 annotated genes, we identified a total of 148 differentially expressed genes in the overlapped region, such as the downregulated gonadal somatic cell derived factor (gsdf), npgr, axonemal dynein assembly factor 3 (dnaaf3), insl3 and upregulated inhibin subunit β B (inhbb) (Supplemental Table 1). The downregulated npgr may be resulted from the npgr deletion-mediated premature mRNA decay in the cyp17a1-/-;ar-/-;npgr-/- fish (El-Brolosy et al., 2019), and the aberrant expression of gsdf, insl3 and inhbb may contribute to the compromised testis organization and spermatogenesis in the cyp17a1-/-;ar-/-;npgr-/- fish.

On the other hand, the defective spermatogenesis has been observed in the ar-/- males, ar-/-;npgr-/- males and cyp17a1-/-;ar-/-;npgr-/- fish. Therefore, the expressed genes in ar-/- males, ar-/-;npgr-/- males and cyp17a1-/-;ar-/-;npgr-/- fish compared with that in the control males respectively, were analyzed and summarized in Figure 6-supplement figure 1B, which can help to determine the common transcriptional changes responsible for the defective spermatogenesis. Out of 1315 annotated genes, we identified a total of 111 differentially expressed genes in the overlapped region, such as the downregulated axonemal central pair apparatus protein (hydin), RNA binding motif protein 47 (rbm47), axonemal dynein assembly factor 1 (dnaaf1), outer dense fiber of sperm tails 3B (odf3b) and insl3 (Supplemental Table 2). These results demonstrated that phenotypes in the ar-/- males, ar-/-;npgr-/- males and cyp17a1-/-;ar-/-;npgr-/- fish may be caused by the dysregulated expressions of genes involved in the process of spermatogenesis and structure organization of sperm.

Considering the downregulation of insl3 expression shown in the Venn diagram (Figure 6—figure supplement 1A and B), and reported in both cyp11c1 and cyp11a2 mutant male zebrafish, which are associated with disorganized testicular structure and significantly decreased numbers of mature spermatozoa (Li et al., 2020; Zhang et al., 2020), it is reasonable to speculate that insl3 may be a target that is co-regulated by androgen signaling and high level of progestin signaling. Among the upstream signals of the insl3, the role of the accumulated progestin may be a compensatory signaling pathway that regulates testis organization and spermatogenesis in the absence of androgen signaling (Line 375-382).

During the transcriptomic analyses, we did not identify common features in the progestin/androgen biosynthesis among our various mutant genotypes. We know that the direct evidence supports the hypothesis is still lacking; therefore, the description in the Figure legends has also been corrected (Line 812-813, "The dissected regulatory network" has been changed to "The potential regulatory network"). To further our understanding of the roles of androgen and progestin in regulating testis organization and spermatogenesis via Insl3, it would be useful for future studies to obtain more genetic and biochemical evidence.

https://doi.org/10.7554/eLife.66118.sa2

Article and author information

Author details

  1. Gang Zhai

    1. State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    2. College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing, China
    Contribution
    Data curation, Funding acquisition, Investigation, Methodology, Validation, Visualization, Writing – original draft
    Contributed equally with
    Tingting Shu
    Competing interests
    No competing interests declared
  2. Tingting Shu

    1. State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    2. College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing, China
    3. Chinese Sturgeon Research Institute, China Three Gorges Corporation, Hubei, China
    Contribution
    Investigation, Methodology, Validation, Visualization, Writing – review and editing
    Contributed equally with
    Gang Zhai
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3020-9329
  3. Guangqing Yu

    1. State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    2. College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing, China
    Contribution
    Methodology, Resources
    Competing interests
    No competing interests declared
  4. Haipei Tang

    5State Key Laboratory of Biocontrol, Institute of Aquatic Economic Animals and Guangdong Provincial Key Laboratory of Improved Variety Reproduction in Aquatic Economic Animals, School of Life Sciences, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Resources
    Competing interests
    No competing interests declared
  5. Chuang Shi

    1. State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    2. College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing, China
    Contribution
    Investigation, Methodology, Visualization
    Competing interests
    No competing interests declared
  6. Jingyi Jia

    College of Fisheries, Huazhong Agriculture University, Wuhan, China
    Contribution
    Investigation, Methodology, Software
    Competing interests
    No competing interests declared
  7. Qiyong Lou

    State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    Contribution
    Investigation
    Competing interests
    No competing interests declared
  8. Xiangyan Dai

    Key Laboratory of Freshwater Fish Reproduction and Development and Key Laboratory of Aquatic Science of Chongqing, School of Life Science, Southwest University, Chongqing, China
    Contribution
    Validation, Visualization
    Competing interests
    No competing interests declared
  9. Xia Jin

    State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    Contribution
    Resources, Supervision
    Competing interests
    No competing interests declared
  10. Jiangyan He

    State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    Contribution
    Methodology, Project administration, Resources
    Competing interests
    No competing interests declared
  11. Wuhan Xiao

    1. State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    2. College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing, China
    3. The Innovative Academy of Seed Design, Chinese Academy of Sciences, Wuhan, China
    Contribution
    Resources
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-2978-0616
  12. Xiaochun Liu

    5State Key Laboratory of Biocontrol, Institute of Aquatic Economic Animals and Guangdong Provincial Key Laboratory of Improved Variety Reproduction in Aquatic Economic Animals, School of Life Sciences, Sun Yat-Sen University, Guangzhou, China
    Contribution
    Resources
    Competing interests
    No competing interests declared
  13. Zhan Yin

    1. State Key Laboratory of Freshwater Ecology and Biotechnology, Chinese Academy of Sciences, Wuhan, China
    2. College of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, Beijing, China
    3. The Innovative Academy of Seed Design, Chinese Academy of Sciences, Wuhan, China
    Contribution
    Conceptualization, Funding acquisition, Methodology, Project administration, Resources, Supervision, Writing – review and editing
    For correspondence
    zyin@ihb.ac.cn
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7969-3967

Funding

National Key Research and Development Program of China (2018YFD0900205)

  • Zhan Yin

Chinese Academy of Sciences (Pilot Program A Project XDA24010206)

  • Zhan Yin

National Natural Science Foundation of China (31972779)

  • Gang Zhai

National Natural Science Foundation of China (31530077)

  • Zhan Yin

National Natural Science Foundation of China (31702027)

  • Xiangyan Dai

Youth Innovation Promotion Association of CAS (2020336)

  • Gang Zhai

State Key Laboratory of Freshwater Ecology and Biotechnology (2016FBZ05)

  • Zhan Yin

Research and Development

  • Zhan Yin

Chinese Academy of Sciences

  • Zhan Yin

Youth Innovation Promotion Association (2020336)

  • Gang Zhai

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Mr. Shibo Ma, Institute of Hydrobiology, Chinese Academy of Sciences, for taking care of the zebrafish stocks. We thank Jun Men (Center for Instrumental Analysis and Metrology, Institute of Hydrobiology, Chinese Academy of Sciences) for technical assistance with UPLC-MS/MS. This work was supported by the National Key Research and Development Program, China (no. 2018YFD0900205), the Pilot Program A Project from the Chinese Academy of Sciences (no. XDA24010206) and National Natural Science Foundation, China (no. 31972779, no. 31530077, and 31702027), the Youth Innovation Promotion Association of CAS (2020336), and the State Key Laboratory of Freshwater Ecology and Biotechnology (2016FBZ05). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Ethics

Animal experimentation: All fish experiments were conducted in accordance with the Guiding Principles for the Care and Use of Laboratory Animals and were approved by the Institute of Hydrobiology, Chinese Academy of Sciences (Approval ID: IHB 2013724).

Senior Editor

  1. Didier YR Stainier, Max Planck Institute for Heart and Lung Research, Germany

Reviewing Editor

  1. Cunming Duan, University of Michigan, United States

Publication history

  1. Received: December 29, 2020
  2. Accepted: February 26, 2022
  3. Accepted Manuscript published: February 28, 2022 (version 1)
  4. Version of Record published: March 10, 2022 (version 2)

Copyright

© 2022, Zhai et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 462
    Page views
  • 138
    Downloads
  • 1
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Gang Zhai
  2. Tingting Shu
  3. Guangqing Yu
  4. Haipei Tang
  5. Chuang Shi
  6. Jingyi Jia
  7. Qiyong Lou
  8. Xiangyan Dai
  9. Xia Jin
  10. Jiangyan He
  11. Wuhan Xiao
  12. Xiaochun Liu
  13. Zhan Yin
(2022)
Augmentation of progestin signaling rescues testis organization and spermatogenesis in zebrafish with the depletion of androgen signaling
eLife 11:e66118.
https://doi.org/10.7554/eLife.66118

Further reading

    1. Developmental Biology
    Julia Falo-Sanjuan, Sarah Bray
    Research Article

    Cells sense and integrate external information from diverse sources that include mechanical cues. Shaping of tissues during development may thus require coordination between mechanical forces from morphogenesis and cell-cell signalling to confer appropriate changes in gene expression. By live-imaging Notch-induced transcription in real time we have discovered that morphogenetic movements during Drosophila gastrulation bring about an increase in activity-levels of a Notch responsive enhancer. Mutations that disrupt the timing of gastrulation resulted in concomitant delays in transcription up-regulation that correlated with the start of mesoderm invagination. As a similar gastrulation-induced effect was detected when transcription was elicited by the intracellular domain NICD, it cannot be attributed to forces exerted on Notch receptor activation. A Notch independent vnd enhancer also exhibited a modest gastrulation-induced activity increase in the same stripe of cells. Together, these observations argue that gastrulation-associated forces act on the nucleus to modulate transcription levels. This regulation was uncoupled when the complex linking the nucleoskeleton and cytoskeleton (LINC) was disrupted, indicating a likely conduit. We propose that the coupling between tissue level mechanics, arising from gastrulation, and enhancer activity represents a general mechanism for ensuring correct tissue specification during development and that Notch dependent enhancers are highly sensitive to this regulation.

    1. Developmental Biology
    2. Medicine
    Derek C Sung et al.
    Short Report Updated

    During formation of the mammalian placenta, trophoblasts invade the maternal decidua and remodel spiral arteries to bring maternal blood into the placenta. This process, known as endovascular invasion, is thought to involve the adoption of functional characteristics of vascular endothelial cells (ECs) by trophoblasts. The genetic and molecular basis of endovascular invasion remains poorly defined, however, and whether trophoblasts utilize specialized endothelial proteins in an analogous manner to create vascular channels remains untested. Vascular endothelial (VE-)cadherin is a homotypic adhesion protein that is expressed selectively by ECs in which it enables formation of tight vessels and regulation of EC junctions. VE-cadherin is also expressed in invasive trophoblasts and is a prime candidate for a molecular mechanism of endovascular invasion by those cells. Here, we show that VE-cadherin is required for trophoblast migration and endovascular invasion into the maternal decidua in the mouse. VE-cadherin deficiency results in loss of spiral artery remodeling that leads to decreased flow of maternal blood into the placenta, fetal growth restriction, and death. These studies identify a non-endothelial role for VE-cadherin in trophoblasts during placental development and suggest that endothelial proteins may play functionally unique roles in trophoblasts that do not simply mimic those in ECs.