1. Chromosomes and Gene Expression
  2. Plant Biology
Download icon

Repression by the Arabidopsis TOPLESS corepressor requires association with the core mediator complex

  1. Alexander R Leydon
  2. Wei Wang
  3. Hardik P Gala
  4. Sabrina Gilmour
  5. Samuel Juarez-Solis
  6. Mollye L Zahler
  7. Joseph E Zemke
  8. Ning Zheng
  9. Jennifer L Nemhauser  Is a corresponding author
  1. Department of Biology, University of Washington, United States
  2. Department of Pharmacology, United States
  3. Howard Hughes Medical Institute, University of Washington, United States
Research Article
  • Cited 0
  • Views 543
  • Annotations
Cite this article as: eLife 2021;10:e66739 doi: 10.7554/eLife.66739

Abstract

The plant corepressor TOPLESS (TPL) is recruited to a large number of loci that are selectively induced in response to developmental or environmental cues, yet the mechanisms by which it inhibits expression in the absence of these stimuli are poorly understood. Previously, we had used the N-terminus of Arabidopsis thaliana TPL to enable repression of a synthetic auxin response circuit in Saccharomyces cerevisiae (yeast). Here, we leveraged the yeast system to interrogate the relationship between TPL structure and function, specifically scanning for repression domains. We identified a potent repression domain in Helix 8 located within the CRA domain, which directly interacted with the Mediator middle module subunits Med21 and Med10. Interactions between TPL and Mediator were required to fully repress transcription in both yeast and plants. In contrast, we found that multimer formation, a conserved feature of many corepressors, had minimal influence on the repression strength of TPL.

Introduction

Control over gene expression is essential for life. This is especially evident during development when the switching of genes between active and repressed states drives fate determination. Mutations that interfere with repression lead to or exacerbate numerous cancers (Wong et al., 2014) and cause developmental defects in diverse organisms (Grbavec et al., 1998; Long et al., 2006), yet many questions remain about how cells induce, maintain, and relieve transcriptional repression. Transcriptional repression is controlled in part by a class of proteins known as corepressors that interact with DNA-binding transcription factors and actively recruit repressive machinery. Transcriptional corepressors are found in all eukaryotes and include the animal SMRT (silencing mediator of retinoic acid and thyroid hormone receptor) and NCoR (nuclear receptor corepressor) complexes (Mottis et al., 2013; Oberoi et al., 2011), the yeast Tup1 (Keleher et al., 1992; Matsumura et al., 2012; Tzamarias and Struhl, 1994), and its homologs Drosophila Groucho (Gro) and mammalian transducing-like enhancer (TLE) (Agarwal et al., 2015).

In plants, the role of Gro/TLE-type corepressors is played by TOPLESS (TPL), TOPLESS-RELATED (TPR1-4), LEUNIG (LUG) and its homolog (LUH), and High Expression of Osmotically responsive genes 15 (HOS15) (Causier et al., 2012; Lee and Golz, 2012; Liu and Karmarkar, 2008; Long et al., 2006; Zhu et al., 2008). Plant corepressors share a general structure, where at the N-terminus a LIS1 homology (LisH) domain contributes to protein dimerization (Delto et al., 2015; Kim et al., 2004). At the C-terminus, WD40 repeats form beta-propeller structures that are involved in protein-protein interactions (Collins et al., 2019; Liu et al., 2019). In TPL family corepressors, the LisH is followed by a C-terminal to LisH (CTLH) domain that binds transcriptional repressors through an Ethylene-responsive element binding factor-associated Amphiphilic Repression (EAR) motif found in partner proteins (Causier et al., 2012; Kagale et al., 2010). The N-terminal domain also contains a CT11-RanBPM (CRA) domain, which provides a second TPL dimerization interface and stabilizes the LisH domain (Ke et al., 2015; Martin-Arevalillo et al., 2017). The beta-propellers bind to the non-EAR TPL recruitment motifs found in a subset of transcriptional regulators (RLFGV- and DLN-type motifs; Collins et al., 2019; Liu et al., 2019) and may control protein interaction with other repressive machinery. Defects in the TPL family have been linked to aberrant stem cell homeostasis (Busch et al., 2010), organ development (Gonzalez et al., 2015), and hormone signaling (Causier et al., 2012; Kagale et al., 2010), especially the plant hormone auxin (Long et al., 2006).

We have previously demonstrated the recapitulation of the auxin response pathway in Saccharomyces cerevisiae (yeast) by porting individual components of the Arabidopsis auxin nuclear response (Pierre-Jerome et al., 2014). In this Arabidopsis thaliana Auxin Response Circuit in Saccharomyces cerevisiae (AtARCSc; Figure 1A), an auxin-responsive transcription factor (ARF) binds to a promoter driving a fluorescent reporter. In the absence of auxin, the ARF protein activity is repressed by interaction with a full-length Aux/IAA protein fused to the N-terminal domain of TPL. Upon the addition of auxin, the TPL-IAA fusion protein is targeted for degradation through interaction with a member of the Auxin Signaling F-box protein family and releases the transcriptional repression of the fluorescent reporter. Reporter activation can be quantified after auxin addition by microscopy or flow cytometry (Pierre-Jerome et al., 2014). In the original build and characterization of AtARCSc, it was noted that the two N-terminal truncations of TPL (N100 or N300) behave differently (Pierre-Jerome et al., 2014). While both truncations are able to repress the function of a transcriptional activator fused to an Aux/IAA, only the TPLN100 fusion shows alleviation of repression after auxin addition. TPLN300 fusions to Aux/IAAs maintain strong durable repression even under high concentrations of auxin. This disparity is not due to differential rates of protein degradation as both proteins appear to be turned over with equal efficiency after auxin addition (Pierre-Jerome et al., 2014).

Figure 1 with 1 supplement see all
The N-terminal domain of TPL contains two independent repression domains.

(A) Schematic of the ARCSc. The auxin-responsive promoter driving the fluorescent protein Venus carries binding sites for the auxin-responsive transcription factor (ARF). In the absence of auxin, the IAA-TPL-N fusion protein is bound to the ARF and maintains the circuit in a repressed state. Upon addition of auxin, the IAA-TPL protein is targeted for ubiquitination and subsequent protein degradation, activating transcription of the fluorescent reporter. (B) TPL domains are LisH (LIS1 homology motif, blue), CTLH (C-terminal LisH motif, orange), CRA (CT11-RanBPM; red, dimerization; green, foldback), and two WD40, beta-propeller motifs (purple). N-terminal domains are indicated on the solved structure of the first 202 amino acids (Martin-Arevalillo et al., 2017, 5NQS). The termini of the TPLN100 truncation used in the original ARCSc studies is indicated. (C) Diagram indicating the structure of constructs analyzed in experiments shown in subsequent panels. For constructs with identical behavior (H1-H3, H1-H5, H1-H6, H1-H7), we included only a representative member (H1-H7) for simplicity. Repression Index (Rep.) is a scaled measure of repression strength with 0 set to the level of repression observed with IAA3 and 10 set to the level of repression by TPLN188. Auxin induction level (Aux. ind.) indicates the fold change difference between reporter expression before auxin addition (time zero) and at the end of an experiment (~500 min). (D-F) Helix 1 and the CRA domain (Helix 3–Helix 8) can act independently to repress transcription. Each panel represents two independent time-course flow cytometry experiments of the TPL helices indicated, all fused to IAA3. Every point represents the average fluorescence of 5–10,000 individually measured yeast cells (a.u.: arbitrary units). Auxin (IAA-10 µM) was added at the indicated time (gray bar, +Aux).

The conservation of TPL’s repressive function in yeast suggests that the protein partners that enact repression are conserved across eukaryotes. Consistent with this speculation, the series of alpha-helices that form the N-terminal portion of TPL (Figure 1B; Martin-Arevalillo et al., 2017) is highly reminiscent of naturally occurring truncated forms of mammalian TLE (Gasperowicz and Otto, 2005), such as Amino-terminal Enhancer of Split (AES) (Zhang et al., 2010), the Groucho ortholog LSY-22 (Flowers et al., 2010), and the unrelated mouse repressor protein MXI1 (Schreiber-Agus et al., 1995). Gro/TLE family members are generally considered to repress by recruiting histone deacetylases (HDACs) to control chromatin compaction and availability for transcription (Chen and Courey, 2000; Long et al., 2006). An alternative hypothesis has been described for Tup1 in yeast, where Tup1 blocks the recruitment of RNA polymerase II (Pol II) (Wong and Struhl, 2011), possibly through contacts with Mediator complex subunits Med21 or Med3 (Gromöller and Lehming, 2000; Papamichos-Chronakis et al., 2000). However, like many of these family members, multiple repression mechanisms have been described for TPL at different genetic loci. For example, TPL has been found to recruit the repressive CDK8 Mediator complex (Ito et al., 2016), chromatin remodeling enzymes such as Histone Deacetylase 19 (HD19) (Long et al., 2006), and directly bind to histone proteins (Ma et al., 2017).

Here, we leveraged the power of yeast genetics to interrogate the mechanism of TPL repression. Using AtARCSc, we discovered that the N-terminal domain of TPL contains two distinct repression domains that can act independently. We mapped the first, weaker repression domain to the first 18 amino acids of the LisH domain (Helix 1), and the second, more potent domain to Helix 8, which falls within the CRA domain. Full repression by Helix 8 required the Mediator complex, specifically direct interaction with Med21 and Med10. The Med21 residues that interact with TPL are the same ones required for transcriptional repression by the yeast corepressor Tup1. In addition, we found that multimerization of TPL was not required for repression in yeast or in plants. Our yeast results were validated with plant assays and extended to include evidence that interaction with the middle domain of Mediator was required for TPL repression of the auxin-regulated development program giving rise to lateral roots. Our findings point to a conserved functional connection between Tup1/TPL corepressors and the Mediator complex that together create a repressed state poised for rapid activation.

Results

To understand how TPL represses transcription, we first localized repressive activity within the protein using the AtARCSc (Figure 1A). The extent of auxin-induced turnover of TPLN100 and TPLN300 fusion proteins appears similar, although neither are completely degraded (Pierre-Jerome et al., 2014). In this way, auxin sensitizes the AtARCSc to even subtle differences in the strength of repressive activity by reducing the relative concentration of the TPL fusion proteins. To pinpoint the region conferring the strong repression of TPLN300, we generated a deletion series of the N-terminus guided by the available structural information (Figure 1B, C; Ke et al., 2015; Martin-Arevalillo et al., 2017).

We started by identifying a shorter truncation, TPLN188, which behaved identically to TPLN300 (Figure 1D, Pierre-Jerome et al., 2014). Subsequently, we deleted each alpha helical domain starting with Helix 9 (constructs are named in the format Helix x – Helix y or Hx-Hy). We found that Helix 8 was required for the maximum level of repression activity and for the maintenance of repression after auxin addition (Figure 1D). All constructs lacking Helix 8 retained the ability to repress transcription, but this repression was lifted in the presence of auxin (Figure 1D) as had been observed for the original TPLN100 construct (Pierre-Jerome et al., 2014). In addition to the repressive activity of Helix 8, further deletions revealed that the 18 amino acids of Helix 1 were sufficient to confer repression on their own (H1, Figure 1E). To test whether Helix 8 activity depended on Helix 1, we analyzed a construct consisting of Helix 3 through Helix 9 (H3-H9, Figure 1E), which was able to repress transcription. Thus, Helix 1 (LisH) and Helix 8 (CRA) could contribute to TPL-mediated repression on their own (Figure 1D).

To identify the minimal domain required for Helix 8-based repression, we generated additional deletions (Figure 1C, F, Figure 1—figure supplement 1). Helix 8 and the following linker were not sufficient for repression (Figure 1F), and removal of Helix 9 or of the linker between Helix 8 and Helix 9 slightly increased sensitivity to auxin compared to TPLN188 (H1-H8Δ8L, Figure 1—figure supplement 1). A deletion that removed both the LisH and Helix 8 repression domains (H3-H7) was only able to weakly repress reporter expression (Figure 1—figure supplement 1). These results demonstrate that Helix 8, in combination with the linker between Helix 8 and Helix 9 (which folds over Helix 1), was required for maintaining repression following addition of auxin. Moreover, the repressive activity of Helix 8 and the linker were only functional in the context of the larger Helix 3-Helix 8 truncation that carries the CTLH domain and a portion of the CRA domain.

To determine which of the many known or predicted TPL-binding partners could mediate the repression activity of Helix8, we identified known interactors with either TPL or other Gro/TLE co-repressors, and then introduced the Arabidopsis homologs of these genes into the cytoplasmic split-ubiquitin system (cytoSUS) (Asseck and Grefen, 2018). We chose cytoSUS over yeast two-hybrid because in cytoSUS the interaction between target proteins takes place in the cytoplasm, and we had observed that the TPL N-terminus could repress activation of yeast two hybrid prototrophy reporters (Figure 2—figure supplement 1A). Putative direct interactors include HDACs (AtHDAC9, AtHDAC6; Long et al., 2006), Histone proteins (Histone H3, Histone H4; Ma et al., 2017), and the Mediator components MED13 (AtMED13; Ito et al., 2016) and MED21, which has been demonstrated to interact with Tup1, the yeast homolog of TPL (Gromöller and Lehming, 2000). We did not observe any interactions between TPLN188 and the HDACs HDA6 and HDA9; the histone protein AtHIS4; or the Mediator subunit AtMED13 (Figure 2A, Figure 2—figure supplement 1B). HDAC interaction with TPL has been previously hypothesized to occur through indirect interactions with partner proteins (Krogan et al., 2012); however, direct interactions with histones and MED13 have been detected (Ito et al., 2016; Ma et al., 2017). The absence of interaction between TPLN188 and these proteins may be due to differences between methods or interaction interfaces in the C-terminal WD40 repeats.

Figure 2 with 2 supplements see all
The Helix 8 repression domain of TPL directly interacts with AtMED21 and AtMED10B.

(A–C, E) Cytoplasmic split-ubiquitin system (CytoSUS) assays with candidate interacting proteins. Nub-3xHA is the N-terminal fragment of ubiquitin expressed with no fusion protein and is used as a negative control. Each prey protein is from Arabidopsis. -WL, -ADE: dropout lacking Trp, Leu, and Ade (growth control); -WLMH, -ADE: dropout lacking Trp, Leu, His, Met, and Ade (selective media). The plating for each panel was performed at the same day, white lines are provided when plates were cropped for clarity. (B) Alignments of the Arabidopsis (At) and Saccharomyces (Sc) MED21 proteins are shown above cytoSUS assays with the same bait shown in (A). Western blots below the colonies indicated that AtMED21 N-terminal Δ3 and Δ5 are well expressed in assay conditions. (C) CytoSUS assays with selected Mediator proteins in the middle module. (D) The TPL-ProteinA-TF fusion protein can pull down TPL, AtMED21, and AtMED10B from yeast extracts using IgG-beads. Detection of the VP16 transcriptional activator demonstrates enrichment of the fusion protein (αVP16). Each prey protein is detected via the 3xHA tag (αHA), and efficacy of purification was judged by PGK1 depletion (αPGK1). (E) A TPL-N truncation lacking the LisH domain (TPLH2-H9) could still interact with the AtMED21-N31 truncation. This bait construct interacted with IAA3, but only minimally with the negative control (free Nub-3xHA). (F) Yeast Mediator (bottom, 5N9J) and AtTPL (top, 5NQV) manually juxtaposed to compare relative domain sizes and feasibility of a TPL-MED21-MED10B interaction. TPL Helix 8–9 is colored green. MED21 is colored aqua, with the N-terminus colored red, and the IAA27 EAR peptide in orange. MED10 is colored teal, with the C-terminus colored purple. The dotted line indicates the border between TPL and Mediator structures.

Strong interaction was detected between TPLN188 and AtMED21, a component of the Mediator middle domain (Figure 2A). MED21 is one of the most highly conserved Mediator subunits (Bourbon, 2008) and has a particularly highly conserved N-terminus (Figure 2—figure supplement 2A, C–E). In yeast, Tup1 interacts with the first 31 amino acids of ScMed21, with the first 7 amino acids being absolutely required for interaction and transcriptional repression (Gromöller and Lehming, 2000). We observed that the equivalent truncation of AtMED21 (AtMED21-N31) was sufficient for interaction with TPLN188 (Figure 2A). We next created truncations of the N-terminal domain of AtMED21 to closely match those that had been made in yeast (Figure 2B) where deletion of the first five amino acids of ScMed21 (ScΔ5Med21) severely reduce the ability of the Mediator complex to co-purify with Pol II and CDK8 kinase complex (Sato et al., 2016). Interaction between TPLN188 and AtMED21 similarly required the first five amino acids of AtMED21 (Figure 2B), and, as in yeast, this was not a result of destabilization of the AtMED21 protein (Figure 2B). In fact, N-terminal Med21 deletions increased protein levels with no interaction with TPLN188; this results in high confidence that the Med21 N-terminus is required for interaction. AtMED21 interaction was specific to the Helix8-based repression domain as it interacted with TPLH3-H9 (Figure 2E), and not TPLH1-H7 (Figure 2—figure supplement 1C). Further screening of middle domain Mediator components identified an additional interaction with AtMED10B, the predominantly expressed MED10 isoform in Arabidopsis (Klepikova et al., 2016; Figure 2C). Interactions between TPLN188 and both AtMED21 and AtMED10B were confirmed by immunoprecipitation (Figure 2D).

The MED21 N-terminus lies in the hinge region of the middle module and has residues that are exterior facing and could be docking points for protein-protein interactions (Figure 2—figure supplement 2C–E). A manual juxtaposition of the yeast Mediator structure with the Arabidopsis TPL N-terminal structure shows that Helix 8 and the linker following face away from the tetramer and are therefore optimally placed to interact with Mediator components (Figure 2F). To pinpoint which residues of Helix 8 coordinate repression through interaction with MED21, we identified solution-facing amino acids (Martin-Arevalillo et al., 2017). We reasoned that such residues were most likely not involved in stabilizing the hydrophobic interactions between intra-TPL helical domains and could therefore be available to interact with partner proteins. Eight amino acids in Helix 8 were mutated to alanine in the context of the H3-H8-IAA3 fusion protein (Figure 3A, light green residues) to enable assessment of repression activity in the absence (Figure 3B) or presence (Figure 3C) of auxin. No single amino acid was essential for repression. Two mutations (R140A and K148A) slightly increased baseline expression of the reporter (Figure 3B, C). With the exception of E152A, which behaved similarly to controls, all of the mutations altered the stability of repression after auxin addition, either by increasing (S138A, V145A, E146A, K149A) or decreasing (I142A) the final fluorescence level (Figure 3C). Mutating E146 and K149 also increased the speed with which the reporter responded to auxin (Figure 3C), suggesting that these two neighboring residues could be a critical point of contact with co-repressive machinery. S138A had a small increase in auxin sensitivity, while I142 reduced auxin sensitivity (Figure 3E).

Identification of critical residues within Helix 8 repression domain.

(A) Sequence and structure of Helix 8 (5NQS). Helix 8 is colored green, and amino acids chosen for mutation are highlighted in light green in both the sequence and the structure. (B) Repression activity of indicated single- and double-alanine mutations. (C) Time-course flow cytometry of selected mutations of Helix 8 following auxin addition. TPLH3-8-IAA3 fusion proteins (black) were compared to indicated single mutations to alanine (red). Controls: Helix 1 (H1 – blue) and TPLN188 (dark green). (D) A series of alanine mutations (V145A, E146A, K148A, K149A, and the quadruple mutant QuadAAAA chosen from A–C) were introduced into the TPLN188 bait construct and tested for interaction with wild-type TPLN188, AtMED21, and controls. Each single-alanine mutation reduces TPL interaction with AtMED21, while the quad mutation abrogated interaction. (E) The Helix 8 QuadAAAA mutation was introduced into the TPLN188-IAA3 and TPLH3-8-IAA3 fusion proteins and compared to wild-type N188 in time-course flow cytometry. For all cytometry experiments, the indicated TPL construct is fused to IAA3. Every point represents the average fluorescence of 5–10,000 individually measured yeast cells (a.u.: arbitrary units). Auxin (IAA-10 µM) was added at the indicated time (gray bar, +Aux). At least two independent experiments are shown for each construct.

We next tested whether the residues in Helix 8 that were required for repression (V145, E146, K148, K149; Figure 3A–C) were also required for interaction with AtMED21. Single-alanine mutations of these four amino acids in the context of TPLN188 significantly reduced interaction with AtMED21, while the quadruple mutation (here called QuadAAAA) completely abrogated AtMED21 binding (Figure 3D). These mutations had little effect on interaction with AtMED10B (Figure 2—figure supplement 1D). Introduction of QuadAAAA mutations into the Helix 3 through Helix 8 context (H3-H8-QuadAAAA) in the AtARCSc largely phenocopied a deletion of Helix 8 (yellow and pink, Figure 3E, compare to H3-H7, Figure 1—figure supplement 1). In contrast, TPLN188-QuadAAAA largely retained the repressive activity of wild-type N188 (red and black, Figure 3E), consistent with the observation that Helix 1 is sufficient for full repression (Figure 1E). These results indicate that the CRA domain (H3-H8) requires contact with MED21 to repress, and that this is independent of repression via Helix 1.

The large Mediator complex stabilizes the pre-initiation complex (PIC) enabling transcriptional activation (Kornberg, 2005; Nozawa et al., 2017; Roeder, 1996; Schilbach et al., 2017). The connection we found between TPL, two Mediator components, and transcriptional repression raised the possibility that other parts of the Mediator complex might also contribute to corepressor function. To test this, we needed a way to measure whether loss of function of individual Mediator components led to de-repression at an individual locus. In the case of the yeast corepressor Tup1, a standard approach has been to test the level of transcription at target genes in the presence of deletion mutations of Tup1-interacting proteins (Gromöller and Lehming, 2000; Lee et al., 2000; Zhang and Reese, 2004). One challenge to such an approach for Mediator components is that loss-of-function mutants can be lethal or exhibit drastic physiological phenotypes (Biddick and Young, 2005).

To avoid these complications, we turned to the well-established Anchor Away system for inducible protein depletion (Haruki et al., 2008) and combined it with quantification of transcriptional activity at the synthetic locus in the AtARCS (Figure 4A, B). However, AtARCSc integrates components at four genomic locations using prototrophic markers that are not compatible with those needed for Anchor Away. To overcome this limitation, we re-created the ARC on a single plasmid (we refer to this plasmid as SPARC) using the Versatile Genetic Assembly System (VEGAS, Mitchell et al., 2015). SPARC behaved with similar dynamics to the original AtARCSc on both solid and liquid growth conditions (Figure 4—figure supplement 1A–C). As a first test of the Anchor Away system with SPARC, we fused Tup1 and its partner protein Cyc8 to two copies of the FKBP12-rapamycin-binding (FRB) domain of human mTOR (Haruki et al., 2008). Rapamycin treatment of strains targeting either of these proteins caused no release of repression on the SPARC reporter, providing confirmation of orthogonality of the synthetic system in yeast (Figure 4—figure supplement 1D).

Figure 4 with 4 supplements see all
Repression by TPL requires interaction with the N-terminus of MED21 at promoters.

(A) Model of the proposed interaction between the TPL N-terminus with Mediator, where TPL interaction with Mediator 21 and 10 inhibits the recruitment of Pol II. Proteins in this complex that were tested by Anchor Away are listed on the right. (B) Schematic of AtARCSc combined with methods for inducible expression and nuclear depletion of MED21. In Anchor Away, the yeast ribosomal protein 13A (RPL13A) is fused to the rapamycin-binding protein FKBP. Addition of rapamycin induces dimerization between FKBP and any target protein fused to 2xFRB, resulting in removal of the target protein from the nucleus. For these experiments, AtARCSc was assembled into a single plasmid (SPARC) rather than being integrated into separate genomic loci (Figure 4—figure supplement 1). (C) 2xHA-TPLN188-IAA3 and MED21-FRB association with the ARC and the ScSUC2 and ScPMA1 promoters. ChIP was performed with αHA and αFRB before qPCR was used to quantify enrichment at specified loci. (D) Association of FRB-tagged components of Mediator and the transcriptional machinery with the SPARC plasmid and the ScSUC2 promoters. ChIP was performed with αFRB, and qPCR was used to quantify enrichment at specified loci. (E–I) Time-course flow cytometry analysis of SPARCN188 in Mediator Anchor Away yeast strains with rapamycin (orange bar, +Rapa). Two Med21 strains were compared in the Middle domain (E), 21 (generated in this study) and 21* (generated in Petrenko et al., 2017). Both 21 and 21* demonstrated similar increases in reporter expression. (J) Quantification of Venus fluorescence from SPARCN188 in wild-type and N-terminal ScMed21 deletions with and without auxin. The x-axis indicates strain and which FRB fusion protein is being tested. Yeast was grown for 48 hr on synthetic drop out (SDO) media with or without auxin, and colony fluorescence was quantified and plotted with the auxin-responsive SPARCH1-H5 in wild type as a reference. Background: red autofluorescence was used as a reference for total cell density. (K) Time-course flow cytometry analysis of SPARCN188 in wild-type and N-terminal ScMed21 deletions with and without rapamycin. Genotypes are indicated in the colored key inset into the graph. For (E–I, K) a.u.: arbitrary units. Rapamycin was added at the indicated time (orange bar, +Rapa). Every point represents the average fluorescence of 5–10,000 individually measured yeast cells. (L) Association of MED21-FRB or Δ5-MED21-FRB with SPARC plasmids. ChIP was performed with αFRB, and qPCR was used to quantify enrichment at specified loci. (C, D, L) A region of the ACT1 gene body or a gene-free region of chromosome V (Chr.V) was arbitrarily defined as background, and data is presented as fold enrichment over the control gene. Averages and standard errors of four replicates are shown.

Before testing repressive function, we first performed chromatin immunoprecipitation using the Anchor Away FRB tag to ask whether Mediator proteins or specific Mediator modules were detectable at the promoters of TPL-repressed genes. We began by assaying the integrated AtARCSc locus and comparing it to a Tup1-repressed locus, SUC2 (Carlson and Botstein, 1982; Fleming and Pennings, 2007; Trumbly, 1992), and to an active locus enriched for Mediator, PMA1 (Petrenko et al., 2017; Schmitt et al., 2006; Serrano et al., 1986). We generated a yeast strain with an integrated MED21-FRB fusion protein and an integrated AtARCSc locus with a 2xHA epitope-tagged TPLN188-IAA3 repressor protein. We observed enrichment of both MED21-FRB and the 2xHA-TPLN188-IAA3 fusion protein at the AtARCSc locus (Figure 4C, Figure 4—figure supplement 2A–C). We also observed a modest enrichment of MED21-FRB at the SUC2 promoter (approximately twofold) and higher enrichment of MED21-FRB at the active PMA1 promoter (approximately eightfold). Next, we introduced the fully repressed SPARC plasmid containing TPLN188 (SPARCN188) into a library of Anchor Away yeast strains that allow specific depletion of Mediator components (see Figure 4A, B; Haruki et al., 2008; Petrenko et al., 2017). We tested representatives of the mediator complex (tail – Med15, head – Med18, middle – Med21 and Med14, kinase – CDK8, general transcription factors – TBP1, TFIIA, and RNA Pol II – Rpb1) by ChIP-qPCR. We observed enrichment of all tested core mediator complex members, as well as general transcription factors, at both the SPARC and the SUC2 loci, with very little enrichment of RNA Pol II (Figure 4D). In general, MED21 was detected in lower levels at repressed loci than at the active PMA1 promoter (Figure 4D). Consistent with this observation, Mediator is highly enriched at the SPARC promoter when TPL is absent (Figure 4—figure supplement 2D). Higher enrichment of members of the middle module at repressed promoters (i.e., Med21, Med14, Figure 4D) may point to these subunits nucleating assembly of the entire complex.

We next tested whether the association of Mediator complex components was required for TPL-mediated repression (Figure 4A, B). Nuclear depletion of Mediator components from the tail, head, and middle domain triggered clear activation of the SPARCN188 reporter (Figure 4E–I). Depletion of the Mediator kinase module component CDK8 had a more modest effect (Figure 4H). One caveat to this approach is that nuclear depletion of components that are absolutely required for transcriptional activation, such as RNA Pol II Anchor Away (Rpb1; Figure 4I), cannot be assayed for impacts on repression using transcription of the reporter as the output.

To further interrogate the impact of Mediator on repression, we next focused on the other side of the interaction, namely which region of MED21 was required for interaction with TPL. Deletion of the first seven amino acids of ScMed21 (Δ7Med21) partially activates genes that are normally repressed by Tup1 (Gromöller and Lehming, 2000), so we first tested if the same held true for TPL-mediated repression. We introduced SPARCs with different TPL constructs into strains where wild-type ScMed21 or N-terminal deletions were targets of Anchor Away. Importantly, the addition of the FRB tag did not alter ScMED21 function (Figure 4J, Figure 4—figure supplement 1E, F). We observed that deletion of either five or seven of the N-terminal residues of ScMed21 increased the expression of the reporter in SPARCN188 to a level similar as what is observed with TPL H1-H5 (Figure 4J, Figure 4—figure supplement 1E, F). No mutation increased the SPARC’s sensitivity to auxin. As Δ7ScMed21 had a noticeable impact on growth, as has been reported previously (Gromöller and Lehming, 2000; Hallberg et al., 2006), we removed it from further studies. Δ5ScMed21 had no observable growth defects, although this deletion is known to be sufficient to alter Mediator assembly and disrupt binding of Pol II and the CDK8 kinase module (Hallberg et al., 2006; Sato et al., 2016).

The fully repressed SPARCN188 in Δ3ScMed21 or Δ5ScMed21 mutants showed elevated reporter transcription when compared to strains carrying wild-type ScMED21 (Figure 4K). The addition of rapamycin further increased reporter expression, particularly in the Δ3ScMed21 strains, suggesting that this deletion could only partially disrupt the TPLN188-Med21 interaction. We used chromatin immunoprecipitation to directly test whether Δ5Med21 showed a change in association with the SPARCN188 promoter. While this deletion would be expected to reduce Med21 association with TPL, the resulting de-repression of the locus should lead to an increase in Mediator association with the activated promoter. Indeed, we observed an ~1.6×-fold increase in Δ5Med21-FRB promoter binding compared to wild type (Figure 4L). While this enrichment was modest compared to a repressor-free SPARCIAA14 (Figure 4L, no TPL; dark gray bar), it was similar to the magnitude of transcriptional activation of the reporter in the Δ5Med21 genotype (Figure 4J, K). The well-documented PMA1 promoter had a substantial enrichment of wild-type MED21, as expected, and was unaffected by the presence of TPL (Figure 4L, dark and light gray bars). To confirm that the interaction with TPL was not unique to ScMed21, we replaced the first five amino acids of ScMed21-FRB with the corresponding sequence from AtMED21. The strain carrying this chimeric protein had an identical repression profile as the one with native ScMed21 (Figure 4—figure supplement 3B) and showed no difference in growth or viability (Figure 4—figure supplement 3C).

To minimize any possible off-target impact of ScMed21 deletions, we introduced estradiol-inducible versions of ScMed21 (iScMed21) into the Anchor Away SPARCN188 strains (Figure 4—figure supplement 4; McIsaac et al., 2013). The combination of all three synthetic systems – ARCSc, Anchor Away, and estradiol inducibility – made it possible to rapidly deplete the wild-type ScMed21-FRB from the nucleus while simultaneously inducing ScMed21 variants and visualizing the impact on a single auxin-regulated locus. Depletion of nuclear ScMed21 by rapamycin increased levels of the reporter in all genotypes examined (Figure 4G, K) while increasing cell size even in short time courses, consistent with its essential role in many core pathways (Figure 4—figure supplement 4A; Gromöller and Lehming, 2000). When wild-type iScMed21 was induced, there was a rescue of both reporter repression and cell size (Figure 4—figure supplement 4C, D), whereas induction of either Δ3 and Δ5 variants resulted in significantly less reporter repression (Figure 4—figure supplement 4D). iΔ3Med21 was induced and accumulated at a comparable level to wild-type Med21, while iΔ5Med21 is less stable (Figure 4—figure supplement 4E, F). In the time courses with both rapamycin and estradiol, we did not observe the cell size increases observed in the rapamycin treatments alone (populations were evenly distributed around a single mean), suggesting that we were observing the immediate effects of the Med21 deletions (Figure 4—figure supplement 4G, H).

Several lines of evidence suggest that, in addition to interactions with other partners, homomultimerization modulates TPL repression potential. First, structures of the N-terminal domains of TPL (Martin-Arevalillo et al., 2017) and a rice homolog OsTPR2 (Ke et al., 2015) reveal high conservation of residues that coordinate formation of homotetramers and connect tetramer formation to Aux/IAA binding. Second, the dominant TPL mutant tpl-1 altered a single amino acid in the ninth helix of the TPL-N terminus (N176H) that induces aggregation of TPL and its homologs (TPR1-4), reducing total activity (Long et al., 2006; Ma et al., 2017). Third, TPL recruitment motifs found in the rice strigolactone signaling repressor D53 induce higher-order oligomerization of the TPL N-terminus, which increases histone binding and transcriptional repression (Ma et al., 2017). Our studies in yeast suggest that there may be a more complex relationship between tetramer formation and repression as we have measured strong repressive activity in several constructs that are unlikely (TPLN100; Pierre-Jerome et al., 2014) or unable (H1, H3-8; Figure 1C) to form tetramers (compare Figure 1B with Figure 5A). To quantify the potential for interaction among our constructs, we used the cytoSUS assay (Asseck and Grefen, 2018). Helix 8 was required for strongest interaction between TPL constructs (Figure 5—figure supplement 1A), although this assessment was complicated by the fact that some of the shorter constructs accumulated to significantly lower levels (Figure 5—figure supplement 1B). The weak interaction we could observe between full-length TPL-N and the Helix 1 through Helix 3 construct (H1-3) indicated that the TPL LisH domain is sufficient for dimerization. Therefore, while auxin-insensitive repression may require multimeric TPL, this higher-order complex was not required for auxin-sensitive repression mediated by Helix 1 (Figure 1E).

Figure 5 with 1 supplement see all
Multimerization is not required for repression in yeast.

(A) TPL can form a homotetramer via the CRA (red) and LisH (blue) domains. Asterisks indicate mutations that block or diminish these interactions. (B, C) Locations of critical positions in Helix 1 are highlighted for two interacting TPL monomers (shown in light and dark blue). Interacting amino acids share the same color (adapted from 5NQV). (D–G) Time-course flow cytometry analysis of TPLN-IAA3 fusion proteins carrying selected single point mutations in N188-LDimer-IAA3 (D) and the TPLH1-2 truncation (E). The F15Y mutation had little effect on repression activity for either TPL construct. Double mutations (F15Y, L8S in LDimer) (F) or the quadruple Monomer mutations (S5A, L8S, F15Y, E19S in LDimer) (G) showed repression activity that was indistinguishable from LDimer or wild-type N188 fused to IAA3. For all cytometry experiments, the indicated TPL construct is fused to IAA3. Every point represents the average fluorescence of 5–10,000 individually measured yeast cells (a.u.: arbitrary units). Auxin (IAA-10 µM) was added at the indicated time (gray bar, +Aux). At least two independent experiments are shown for each construct. (H) Size exclusion chromatography on TPLN188 wild-type (green), LDimer (purple), and Monomer (orange) tetramerization mutants. (I) Cytoplasmic split-ubiquitin system (CytoSUS) on TPL tetramerization mutants.

To avoid any potential artifacts from analysis of truncated forms of the N-terminus, we next generated site-specific mutations that disrupted multimerization in the context of TPLN188. Martin-Arevalillo et al. had previously identified a quadruple mutation (K102S-T116A-Q117S-E122S) that abrogated the ability of the CRA domain (Helix 6 and Helix 7) to form inter-TPL interactions (Martin-Arevalillo et al., 2017). As this mutant form of TPL is only capable of dimerizing through its LisH domain, we refer to it here as LDimer (Figure 5A). The LDimer mutations in TPLN188 retained the same auxin-insensitive repression behavior as wild-type TPLN188 (Figure 5D), supporting the finding from the deletion series.

To make a fully monomeric form of TPL, we introduced mutations into the dimerization interface of the LisH domain in the context of LDimer. We first mutated one of a pair of interacting residues (F15) to a series of amino acids (tyrosine – Y, alanine – A, arginine – R, or aspartic acid – D) in the context of either LDimer (Figure 5D), or H1-2 (Figure 5B, E). Conversion of F15 to the polar and charged aspartic acid (D) completely abolished repression activity, while the positively charged arginine was better tolerated (Figure 5D, E). The conversion of F15 to tyrosine had no effect on LDimer (Figure 5D), and only a minimal increase in auxin sensitivity in the context of H1-2 (Figure 5E). We then combined LDimer-F15Y with a mutation of the coordinating residue L8 to serine with the intention of stabilizing the now solvent-facing residues. The repressive behavior of this mutant was indistinguishable from that of LDimer (Figure 5F).

To further push the LDimer towards a monomeric form, we introduced two additional mutations (S5A, E19S, Figure 5C, G). Size-exclusion chromatography confirmed that this combination of mutations (S5A-L8S-F15Y-E19S-K102S-T116A-Q117S-E122S, hereafter called Monomer) successfully shifted the majority of the protein into a monomeric state (Figure 5H); however, this shift had no observable impact on repression strength before or after auxin addition (Figure 5G). To test whether these mutations had a similar impact on in vivo TPL complexes, we introduced the LDimer and Monomer mutations into the cytoSUS assay. In contrast to the in vitro chromatography results with purified proteins, Monomer expressed in yeast retained measurable interaction with wild-type TPL, LDimer or Monomer, albeit at a reduced level than what was observed between wild-type TPLN188 constructs (Figure 5I). A caveat to this apparent difference between assays is that the Monomer mutations led to a striking increase in protein concentration in yeast (Figure 5—figure supplement 1C), likely partially compensating for the decrease in affinity.

To ascertain which of our findings about TPL required the sensitivity and simplicity of the synthetic context and which could be observed in the full complexity of intact plant systems, we performed a set of experiments in Nicotiana benthamiana (tobacco) and Arabidopsis. Bimolecular fluorescence complementation (BiFC) confirmed the interaction between TPL and MED21 (Figure 6A), which was further validated by co-immunoprecipitation using tobacco extracts (Figure 6B). We were also able to pull down MED21 and TPL using MED10B (Figure 6—figure supplement 1A). BiFC also confirmed the importance of the same TPL Helix 8 residues for the TPL-AtMed21 interaction (Figure 6A, TPLH8QuadA). Similarly, the Δ5AtMED21 N-terminal truncation eliminated interaction with full-length TPL (Figure 6A). We next developed a quantitative repression assay based on UAS/GAL4-VP16 (Brand and Perrimon, 1993; Figure 6C). To block potentially confounding interactions with endogenous TPL/TPRs or TIR1/AFBs, we engineered a variant of IAA14 with mutations in the two EAR domains (EARAAA) and in the degron (P306S) (IAA14mED; Figure 6C). After prototyping the system in yeast (Figure 6—figure supplement 1B, C), we quantified repression strength of constructs carrying TPLN-IAA14mED variants using the well-characterized synthetic auxin-responsive promoter DR5 (Ulmasov et al., 1997). As expected, DR5 was strongly induced by co-transformation with AtARF19, and this induction was sharply reduced by the inclusion of UAS-TPLN188-IAA14mED and GAL4-VP16 (Figure 6—figure supplement 1D). Overall, we observed strong correlation in repression activity between what was observed in yeast and in tobacco.

Figure 6 with 2 supplements see all
The TPL CRA repression domain behaves similarly in yeast and plants.

(A) Bimolecular fluorescence complementation assay performed in tobacco. Each image is an epi-fluorescent micrograph taken at identical magnification from tobacco epidermal cells at 2 days post injection. The YFP image is colored green (left panel). p35S:H2B-RFP was used as a control and is false-colored magenta (right panel). (B) Co-immunoprecipitation of MED21 and TPL from tobacco leaves. MED21-YFP-HA was immunoprecipitated using anti-HA, and YFP-TPL was detected using the YFP fusion. Actin was used to demonstrate that the purification had removed non-specific proteins. Numbers on the left of blots indicate sizes of protein standards in kilodaltons. (C) Design of UAS-TPL-IAA14mED and UAS-MED21 constructs. Mutation of the conserved lysine residues in the EAR domain disrupted potential interactions with endogenous TPL/TPR proteins. The IAA14 degron has been mutated (P306S) to render it auxin insensitive. UAS: upstream activating sequence; ttRBCS: Rubisco terminator sequence. (D) Auxin-induced degradation of IAA14 is absolutely required for initiation of lateral root development (cartoon, left). An enhancer trap line (J0121) expresses GAL4-VP16 and UAS-GFP in in xylem pole pericycle cells. (E) N-terminal domains of TPL were sufficient to repress the development of lateral roots in Arabidopsis seedlings. The density of emerged lateral roots was measured in T1 seedlings at 14 days after germination. (F) N-terminal deletions in AtMED21 were sufficient to dominantly increase the development of lateral roots in Arabidopsis seedlings. The density of emerged lateral roots was measured in T1 seedlings at 14 days after germination. (E, F) Lowercase letters indicate significant difference (ANOVA and Tukey HSD multiple comparison test; p<0.001).

To connect the observed differences in repression strength to a developmental context, we generated transgenic Arabidopsis lines where the UAS-TPL-IAA14mED constructs were activated in the cells where IAA14 normally acts to regulate the initiation of lateral root primordia (Figure 6D; Gala et al., 2021; Laplaze et al., 2005). Expression of functional TPL-IAA14mED fusion proteins in these xylem pole pericycle cells should strongly suppress production of lateral roots, phenocopying the solitary root (slr) mutant, which carries an auxin-resistant form of IAA14 (Fukaki et al., 2002). Indeed, TPLN188 fusion constructs sharply decreased lateral root density (Figure 6E), while transformants expressing either IAA14mED (with no TPL fusion) or TPLN188 (with no IAA14 fusion) had no effect on lateral root production (Figure 6E). TPLH3-H9 decreased lateral root density albeit not as effectively as TPLN188, suggesting that Helix 1 is required for full repression in a native context (Figure 6E). Both LDimer and Monomer constructs (Figure 6E) were able to repress lateral root development to the same extent as TPLN188, meaning that multimer formation is not required for TPL-mediated repression in this context. The fusion containing the Helix 8 quadruple mutant demonstrated a clear loss of repression, indicating that the TPL-MED21 interaction is critical for repression when expressed in lateral root-forming cells (Figure 6E).

Given this result, we wanted to directly test the role of AtMed21 in auxin-regulated development in the presence of native isoforms of TPL and Aux/IAAs. This was complicated by the fact that, as in yeast, AtMED21 is essential in plants. While homozygous loss-of-function mutations are embryo lethal (Dhawan et al., 2009), plants heterozygous for Atmed21 mutations appear wild type (Figure 6—figure supplement 2A, B). To overcome this obstacle, we took two approaches that relied on the same xylem pole pericycle driver as described for the TPL functional assays. First, we expressed N-terminal deletion variants of MED21 that should weaken or sever interaction with TPL (Figure 6F; Δ3MED21, Δ5MED21, Δ7MED21). If MED21-TPL interaction is critical to maintain normal expression of the lateral root program, reduced interaction should trigger an increase in lateral root density. This was exactly what we observed for transgenic lines expressing any of the three deletions. Second, we repressed transcription of AtMED21 by introducing a dCAS9-TPLN300 synthetic repressor under the control of a UAS promoter along with three sgRNAs complementary to the AtMED21 promoter. Similar to the predictions above, reduced expression of AtMED21 in xylem pole pericycle cells should stimulate lateral root development. This is indeed what we observed (Figure 6—figure supplement 2C–E).

Previous reports connected the Mediator kinase module, and specifically the function of AtMED13/GRAND CENTRAL (GCT), to repression by TPL (Ito et al., 2016). We did not find evidence for this relationship in our yeast assays and wanted to investigate further. Although embryo lethality is seen in the majority of homozygous med13/gct individuals, a small percentage survive. This made it possible to examine the effect of expressing wild-type and monomeric forms of TPLN188 in xylem pole pericycle cells in the absence of MED13/GCT activity (Figure 6—figure supplement 1E, F). Loss of med13 function was unable to rescue the production of lateral roots in these lines, leading to the conclusion that TPLN188 requires AtMED21 but not AtMED13 for repression, at least in this context.

Discussion

A review of the current literature on corepressors gives the conflicting impressions that (a) corepressor function is broadly conserved and (b) that every organism (and perhaps even every corepressor) has a distinct mode for transcriptional repression (Adams et al., 2018; Mottis et al., 2013; Perissi et al., 2010; Wong and Struhl, 2011). We hoped that the AtARCSc could facilitate a resolution to this apparent contradiction by targeting repression to a single synthetic locus. We focused our initial efforts on the analysis of the N-terminal portion of TPL, which has multiple known protein-protein interaction surfaces (Ke et al., 2015; Martin-Arevalillo et al., 2017). Experiments with the AtARCSc identified two independent repression domains (Figure 1), and we focused additional study on the stronger of the two that was localized to the CRA domain. Within this domain, we were able to identify two interacting partners that are part of the middle module of the Mediator complex: MED21 and MED10 (Figure 2). Four amino acids within Helix 8 with R-groups oriented away from the hydrophobic core of the TPL structure were found to be required for both Med21-binding and repressive function (Figure 3). Indeed, the entire core Mediator complex (head, middle, tail) appears to be recruited to TPL-repressed loci and required to maintain repression (Figure 4). Contrary to our initial hypothesis, the monomeric form of TPL was sufficient for strong repression in yeast and in plants (Figure 5), leaving open the question of the role of higher-order TPL complex formation. Finally, we were able to confirm that our insights from synthetic assays in yeast were relevant to regulation of the auxin-mediated lateral root development pathway in intact plants (Figure 6).

Corepressors coordinate multiple mechanisms of repression through discrete protein interactions, leading to robust control over eukaryotic transcription by combining repression modalities. Corepressor function has variously been linked to (a) altering chromatin confirmation, often through interaction with histone-modifying proteins or histone proteins themselves, (b) direct interference with transcription factor binding or function, and (c) physical spreading of long-range oligomeric corepressor complexes across regions of regulatory DNA (Perissi et al., 2010). Dissection of the importance of each modality in Tup1 repression has been challenging (Lee et al., 2000; Zhang and Reese, 2004). The tour-de-force of corepressor mechanism studies in yeast concluded that the primary function of Tup1 was to physically block activators (Wong and Struhl, 2011). In their work, the authors utilized the Anchor Away approach to correlate the importance of HDACs, transcriptional machinery, and chromatin remodeling enzymes to the repression state of endogenously repressed Cyc8-Tup1 target genes. They observed that Tup1 did not block the binding of transcription factors but inhibited the recruitment of one Mediator component in the tail domain, GAL11/MED15, as well as Pol II and the chromatin remodelers Snf2 and Sth1. They additionally observed that HDACs had only a supportive role in reinforcing Tup1 repression. These results led to their hypothesis that Tup1 blocks the activation domains of transcription factors and suggested this was through direct binding to activation domains (Wong and Struhl, 2011).

The synthetic system used here allowed us to build on this model and further refine our understanding of TPL’s repressive activity. In our experiments, we see a similar set of conditions, with TPL recruited to the DNA-bound transcriptional activator (ARF), and several possible mechanisms of repression. Unlike Tup1, we have subdivided the TPL protein to identify interactions between TPL and individual protein interactors with no effect on yeast function. In these experiments, we can eliminate the possibility that TPL blocks ARF activation by directly blocking the transcription factor activation domains because we see a loss of repression only when TPL-MED21 binding is eliminated through specific point mutations (Figure 4J–L). Our estradiol-inducible replacement assays where different isoforms of Med21 are expressed also corroborate these findings (Figure 4—figure supplement 4) as the SPARC remains genetically identical in these strains, indicating that TPL-MED21 interaction is regulating Mediator activity not a TPL-ARF interaction. Furthermore, our results correlate well with findings that repressed targets are reactivated when this portion of MED21 is deleted in yeast (TPL, Figure 4; Tup1; Gromöller and Lehming, 2000). Therefore, we suggest that instead of directly binding activation domains that TPL (and likely Tup1) binds to components of Mediator (MED21, MED10B, and possibly others) recruited by the transcription factor. Indeed, it is easier to rationalize that the repressor binds the same domains of the Mediator complex recruited by the transcription factor’s activation domain (with the same affinity) as opposed to binding each diverse activation domain (with varying affinity). In this model, corepressor binding blocks formation of a fully active Mediator complex, thereby limiting Pol II recruitment and promoter escape (Petrenko et al., 2017).

The Mediator complex is a multi‐subunit complex that connects DNA‐bound transcription factors and the RNA Pol II complex to coordinate gene expression (Flanagan et al., 1991; Kim et al., 1994; Kornberg, 2005). The yeast Mediator subunits are organized into four separate modules, head, middle, tail, and kinase, with a strong conservation of module components in plants (Dolan and Chapple, 2017; Maji et al., 2019; Malik et al., 2017; Samanta and Thakur, 2015). Med21 forms a heterodimer with Med7 and interacts with Med10, among others, to create the central region of the middle region of the Mediator complex. The Med21 N-terminus is centered on a flexible hinge region (Baumli et al., 2005), which is required for recruitment of Pol II and the CDK8 kinase module (Sato et al., 2016). The protein interaction between TPL and MED21 occurs at the N-terminus of MED21, highlighting the importance of this region as a signaling hub (Sato et al., 2016). Other lines of evidence support this role as this region binds the yeast homolog of TPL, Tup1 (Gromöller and Lehming, 2000), through a completely different protein domain as no homology can be found between TPL Helix 8 and Tup1 in any region by primary amino acid homology (i.e., BLAST).

As suggested by Ito and colleagues (Ito et al., 2016) and supported by our synthetic system, auxin-induced removal of TPL is sufficient to induce changes in the activity of the Mediator complex; however, multiple points of contact likely exist between the Mediator complex and other parts of the transcriptional machinery in both transcriptionally repressed and active states. For auxin response, specifically, there are several lines of evidence to support this model, including documented association between the structural backbone of Mediator, MED14, and activated and repressed auxin loci in Arabidopsis (Ito et al., 2016). In addition, MED12 and MED13 are required for auxin-responsive gene expression in the root, and MED12 acts upstream of AUX1 in the root growth response to sugar (Raya-González et al., 2018). MED18 in the head module represses auxin signaling and positively regulates the viability of the root meristem (Raya-González et al., 2018). PFT1/MED25 regulates auxin transport and response in the root (Raya-González et al., 2014). MED7, MED21’s partner protein in the hinge domain, is required for normal root development, and loss of MED7 function impacts expression of auxin signaling components (Kumar et al., 2018). Previous research identified the Mediator CDK8 module, specifically MED13 (MAB2), as an interactor with the full-length TPL protein (Ito et al., 2016). We could not observe interaction between the N-terminal domain of TPL and AtMED13, AtCYC8, or AtCYCC (Figure 2—figure supplement 1B), suggesting that any direct interactions occur outside the N-terminal region.

The conserved interaction of both TPL and Tup1 with Mediator has implications for modeling eukaryotic transcription (e.g., Estrada et al., 2016). By stabilizing the Mediator complex, TPL (and by extension Tup1) may create a ‘pre-paused’ state that allows rapid recruitment of Pol II and activation once TPL is removed. This would be compatible with the multiple repression mechanisms described for TPL at different genetic loci. TPL recruitment of the repressive CDK8 Mediator complex (Ito et al., 2016), chromatin remodeling enzymes such as HD19 (Long et al., 2006), and contact with histone proteins (Ma et al., 2017) would be removed with TPL upon relief of repression. It will be critical in the future to understand how these various forms of repression interact, and especially to map the dynamics of assembly and disassembly of complexes as loci transition from repressed to active states and back to repressed once again.

Code availability statement

All codes are available through Github: https://github.com/achillobator/TPL_Structure_Function/ (Leydon, 2021 copy archived at swh:1:rev:141d7d05fe0c23be55af5050563d160f019d6d65).

Materials and methods

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Gene (Arabidopsis thaliana)TOPLESS, TPLGenBankAT1G15750
Gene (Arabidopsis thaliana)MEDIATOR 21, MED21GenBankAT4G04780
Strain, strain background (Saccharomyces cerevisiae)Anchor Away strainsEURO- SCARF euroscarf.deHHY168See Yeast Strain list (Supplementary file 3)
Strain, strain background (Saccharomyces cerevisiae)cytoSUS strainsAsseck and Grefen, 2018THY.AP4, THY.AP5See Yeast Strain list (Supplementary file 3)
Strain, strain background (Escherichia coli)Rosetta 2 strainSigma-Aldrich71400Electrocompetent cells
Strain, strain background (Nicotiana benthamiana)Nicotiana benthamiana (wild-type)GenBankNCBI: txid4100
Strain, strain background (Agrobacterium tumefaciens)GV3101GenBankNCBI: txid358Electrocompetent cells
Genetic reagent (Arabidopsis thaliana)J0121
(in Col-0 accession)
Gala et al., 2021J0121
Genetic reagent (Arabidopsis thaliana)slrTAIRSLR-1, AT4G14550
Genetic reagent (Arabidopsis thaliana)med21-1Arabidopsis Biological Resource CenterWiscDsLox461-464K13
Genetic reagent (Arabidopsis thaliana)med21i214GThis paper
AntibodyAnti-HA-HRP (Rat Monoclonal)Roche/Millipore SigmaRRID:AB_390917, REF-12013819001, Clone 3F10WB (1:1000)
AntibodyAnti-FLAG (Mouse Monoclonal)Millipore SigmaRRID:AB_259529, F3165WB (1:5000)
AntibodyAnti-FRB (Rabbit Polyclonal)Enzo Life Sciences, (Haruki et al., 2008)RRID:AB_2051920, ALX-215-065-1WB (1:10,000)
AntibodyAnti-VP16 (1-21) (Mouse Monoclonal)Santa Cruz BiotechnologyRRID:AB_628443, sc-7545WB (1:5000)
AntibodyAnti-GFP (Rabbit Polyclonal)AbCamRRID:AB_303395, ab290WB (1:10,000)
AntibodyAnti-MYC (Rabbit Monoclonal)Cell SignalingRRID:AB_490778, 71d10, 2278SWB (1:5000)
AntibodyAnti-PGK1 (Mouse Monoclonal)AbCamRRID:AB_10861977, ab113687WB (1:10,000)
Recombinant DNA reagentRPL13A-FKBP fusion proteinsHaruki et al., 2008See Plasmid list (Supplementary file 2)
Peptide, recombinant proteinTPL-6xHThis paperTPL-6xHis tagged fusion proteins
Commercial assay or kitDNA SequencingGenewizGenewiz.com
Chemical compound, drugRapamycinLC LaboratoriesR-50001 µM for Anchor Away
Chemical compound, drugβ-estradiolSigmaE2758-1G
Chemical compound, drugAuxinplantMedia, plantmedia.comCAT#705490(IAA-10 µM)
Chemical compound, drugGeneticinThermo Fisher ScientificG418
Software, algorithmCLC Sequence Viewer 7QIAGEN
Software, algorithmRR Studiorstudio.com/
Software, algorithmImageJSchneider et al., 2012https://imagej.nih.gov/ij/
Software, algorithmSmartRootJülich Research Centre and ROot and Soil/Shoot Interactions virtual grouphttps://smartroot.github.io/
Software, algorithmNeuronJErik Meijeringhttps://imagescience.org/meijering/software/neuronj/manual/

Cloning

Request a detailed protocol

Construction of TPL-IAA3 and TPL-IAA14 fusion proteins was performed by Golden Gate cloning as described in Pierre-Jerome et al., 2014. Variant and deletion constructs were created using PCR-mediated site-directed mutagenesis. Site-directed mutagenesis primers were designed using NEBasechanger and implemented through Q5 Site-Directed Mutagenesis (NEB, Cat #E0554S). TPL interactor genes were amplified as cDNAs from wild-type Col-0 RNA using reverse transcriptase (SuperScript IV Reverse Transcriptase, Invitrogen) and gene-specific primers from IDT (Coralville, IA), followed by amplification with Q5 polymerase (NEB). These cDNAs were subsequently cloned into plasmids for cytoSUS using a Gibson approach (Gibson et al., 2009) through the Aquarium Biofabrication facility (Ben Keller et al., 2019). The coding sequence of the genes of interest was confirmed by sequencing (Genewiz; South Plainfield, NJ). For UAS-driven constructs, the TPLN188-IAA14 coding sequence was amplified with primers containing engineered BsaI sites and introduced into the pGII backbone with the UAS promoter and RBSC terminator (Siligato et al., 2016) using Golden Gate cloning (Weber et al., 2011). Subsequent mutations were performed on this backbone using PCR-mediated site-directed mutagenesis (see above). Construction of C-terminal 2xFRB fusions for Anchor Away was done as described in Haruki et al., 2008. Inducible MED21 was constructed as described in McIsaac et al., 2013. For cell type-specific knockdown mediated by dCas9-TPLN300, Gibson cloning was used to modify the pHEE401E plasmid, replacing the egg-specific promoter and Cas9 from pHEE401E (Wang et al., 2015) with the GAL4-UAS promoter and dCas9-TPLN300 fusion protein (Khakhar et al., 2018). The resulting plasmid is used as starting point to clone three sgRNAs targeting the AtMED21 promoter (identified using CHOP-CHOP Labun et al., 2019). (sgRNAs: GACGCAGAGTCTGTTGGGTGTGG, TTTAAAATGGGCTTTTAAGGTGG, AACACTGAAGTAGAATTGGGTGG ranging from −170 to +90 region from the TSS) using PCR and Golden Gate cloning strategy described in Wang et al., 2015.

Flow cytometry

Request a detailed protocol

Fluorescence measurements were taken using a Becton Dickinson (BD) special order cytometer with a 514 nm laser exciting fluorescence that is cut off at 525 nm prior to photomultiplier tube collection (BD, Franklin Lakes, NJ). Events were annotated, subset to singlet yeast using the FlowTime R package (Wright et al., 2019). A total of 10,000–20,000 events above a 400,000 FSC-H threshold (to exclude debris) were collected for each sample and data exported as FCS 3.0 files for processing using the flowCore R software package and custom R scripts (Supplementary file 1; Havens et al., 2012; Pierre-Jerome et al., 2017). Data from at least two independent replicates were combined and plotted in R (ggplots2).

Yeast methods

Request a detailed protocol

Standard yeast drop-out and yeast extract–peptone–dextrose plus adenine (YPAD) media were used, with care taken to use the same batch of synthetic complete (SC) media for related experiments. A standard lithium acetate protocol (Gietz and Woods, 2002) was used for transformations of digested plasmids. All cultures were grown at 30°C with shaking at 220 rpm. Anchor Away approaches were followed as described in Haruki et al., 2008, and Anchor Away strains were obtained from EURO-SCARF (euroscarf.de). Endogenous genomic fusions of ScMed21-FRB were designed by fusing MED21 homology to the pFA6a-FRB-KanMX6 plasmid for chromosomal integration into the parental Anchor Away strain as in Petrenko et al., 2017, selectable through G418 resistance (G418, Geneticin, Thermo Fisher Scientific). Tup1-FRB and Cyc8-FRB were constructed as described in Wong and Struhl, 2011. Mediator Anchor Away strains were created in Petrenko et al., 2017 and kindly donated by Dr. Kevin Struhl. SPARC construction required a redesign of promoters and terminators used in the AtARCSc to eliminate any repetitive DNA sequences (see Figure 4—figure supplement 1), using a Golden Gate cloning approach into level 1 vectors. Subsequent assembly of individual transcriptional units into a larger plasmid utilized VEGAS assembly, which was performed as described in Mitchell et al., 2015. To create an acceptor plasmid for the assembled transcriptional units, we synthesized a custom vector containing VA1 and VA2 homology sites for recombination (Twist Bioscience, South San Francisco, CA). In between these sites, we incorporated a pLac:mRFP cassette to allow identification of uncut destination plasmid in Escherichia coli, flanked by EcoRI sites for linearization. Finally, the CEN6/ARSH4 was transferred from pRG215 (Addgene #64525) into the acceptor plasmid by Golden Gate reaction using designed BsmBI sites engineered into the acceptor plasmid and the primers used to amplify the CEN/ARS (see Figure 4—figure supplement 1). For the cytoplasmic split-ubiquitin protein-protein interaction system, bait and prey constructs were created using the plasmids pMetOYC and pNX32, respectively (Addgene, https://www.addgene.org/Christopher_Grefen/). Interaction between bait and prey proteins was evaluated using a modified version of the split ubiquitin technique (Asseck and Grefen, 2018). After 2 days of growth on control and selection plates, images were taken using a flatbed scanner (Epson America, Long Beach, CA). Inducible ScMed21 strains (iMed21) were grown overnight, and then diluted back to 100 events per microliter as determined by flow cytometry and grown at 30°C with 250 rpm in a deepwell 96-well plate format. Strains were supplemented with β-estradiol (20 µM) for 4 hr followed by rapamycin addition. Samples were analyzed by flow cytometry throughout these growth experiments.

Western blot

Request a detailed protocol

Yeast cultures that had been incubated overnight in SC media were diluted to OD600 = 0.6 and incubated until cultures reached OD600 ∼1. Cells were harvested by centrifugation. Cells were lysed by vortexing for 5 min in the presence of 200 µl of 0.5 mm diameter acid washed glass beads and 200 µl SUMEB buffer (1% SDS, 8 M urea, 10 mM MOPS, pH 6.8, 10 mM EDTA, 0.01% bromophenol blue, 1 mM PMSF) per 1 OD unit of original culture. Lysates were then incubated at 65° for 10 min and cleared by centrifugation prior to electrophoresis and blotting. Antibodies: anti-HA-HRP (REF-12013819001, Clone 3F10, Roche/Millipore Sigma, St. Louis, MO), anti-FLAG (F3165, Monoclonal ANTI-FLAG M2, Millipore Sigma, St. Louis, MO), anti-FRB (ALX-215-065-1, Enzo Life Sciences, Farmingdale, NY; Haruki et al., 2008), anti-VP16 (1-21) (sc-7545, Santa Cruz Biotechnology, Dallas TX), anti-GFP (ab290, AbCam, Cambridge, UK), anti-MYC (71d10, 2278S, Cell Signaling, Danvers, MA), and anti-PGK1 (ab113687, AbCam).

Protein expression and purification

Request a detailed protocol

All multimer-deficient TPL proteins were expressed in E. coli Rosetta 2 strain. Bacteria cultures were grown at 37°C until they achieved an OD600 nm of 0.6–0.9. Protein expression was induced with isopropyl-β-D-1-thyogalactopiranoside (IPTG) at a final concentration of 400 μM at 18°C overnight. Bacteria cultures were centrifuged and the pellets were resuspended in the buffer A (CAPS 200 mM pH 10.5, NaCl 500 mM, TCEP 1 mM), where cells were lysed by sonication. His-tagged AtTPL188 (wt and mutants) bacteria pellets were resuspended in buffer A with EDTA-free antiprotease (Roche). The soluble fractions recovered after sonication were passed through a Ni-sepharose (GE Healthcare) column previously washed with buffer A, and the bound proteins were eluted with buffer A with 250 mM imidazole. A second purification step was carried out on Gel filtration Superdex 200 10/300 GL (GE Healthcare) equilibrated with buffer A.

Co-immunoprecipitation

Request a detailed protocol

Co-IP from yeast was performed using the cytoSUS strains. Cultures were grown to OD600 0.5 (~1E7 cells/ml) using selective media, harvested, and resuspended in 200 μl extraction buffer (1% SDS, 10 mM MOPS, pH 6.8, 10 mM EDTA) with protease inhibitors. Cells were lysed by vortexing 3 × 1 min full speed with 100 μl of 0.5 mm Acid Washed Glass Beads, clarified by centrifugation (1 min, 1000 rpm), and supernatant was mixed with 1 ml IP buffer (15 mM Na2HPO4, mw 142; 150 mM NaCl, mw 58; 2% Triton X-100, 0.1% SDS, 0.5% DOC, 10 mM EDTA, 0.02% NaN3) with protease inhibitors and incubated with 100 μl of IgG sepharose at 25°C for 2 hr with rotation. The beads were washed 1× with IP buffer and 2× with IP-wash buffer (50 mM NaCl, mw58; 10 mM TRIS, mw 121; 0.02% NaN3) with protease inhibitors. Protein was eluted with 50 μl of SUME (1% SDS, 8 M urea, 10 mM MOPS, pH 6.8, 10 mM EDTA) buffer +0.005% bromophenol blue by incubation at 65°C for 10 min and run on handmade 12% acrylamide SDS-PAGE gels, and western blotted accordingly. Co-IPs from tobacco were performed on leaves 2 days after injection as described in Song et al., 2014 using 35S:MED21-YFP-HA, 35S:TPL-YFP (full length), and 35S:MED10B-MEC-ProtA constructs. For co-IPs with HA, extracts were incubated with Anti-HA-Biotin (High Affinity [3F10], Sigma, 12158167001) and Streptavidin conjugated magnetic beads (Life Technologies, Dynabeads M-280 Streptavidin, 112.05D). For co-IPs with MED10B-MEC-ProtA, we used IgG Sepharose 6 Fast Flow (Sigma, GE17-0969-01) beads and increased washing steps (1× IP buffer, 5× wash buffer, six total). The only modification to buffers was an addition of the detergent NP-40 at 0.1% in the IP and wash buffer. Samples were run on handmade 10% acrylamide SDS-PAGE gels and western blotted accordingly.

Bimolecular fluorescence complementation

Request a detailed protocol

BiFC experiments were performed on 3‐week‐old N. benthamiana plants grown at 22°C under long days (16 hr light/8 hr dark) on soil (Sunshine #4 mix) as per Martin et al., 2009. pSITE vectors were used to generate BiFC constructs for MED21, Δ5-MED21, TPL, and TPLH8QuadA – proteins (Martin et al., 2009). In all cases, the combinations are N‐terminal fusions of either the nEYFP or cEYFP to the cDNA of MED21 or TPL. RFP fused Histone H2B was used as a nuclear marker (Goodin et al., 2002). Injection of Agrobacterium strains into tobacco leaves was performed as in Goodin et al., 2002, but the OD600 of the Agrobacterium culture used was adjusted to 0.5. Two days after transfection, plant leaves were imaged using an epifluorescence microscope (Leica Biosystems, model: DMI 3000B).

Chromatin immunoprecipitation and qPCR

Request a detailed protocol

Yeast were inoculated in liquid YPD and grown at 30°C with shaking at 225 rpm. After 18 hr of growth, cultures were diluted 1:50 in fresh YPD to a final volume of 200 ml. 4 hr post-dilution, cells were treated with 20 ml of fix solution (11% [vol/vol] formaldehyde, 0.1 M NaCl, 1 mM EDTA, 50 mM HEPES–KOH) for 20 min at room temperature with shaking. Cultures were further treated with 36 ml of 2.5 M glycine for 5 min to quench the cross-linking. Cells were then pelleted at 4°C, washed twice with ice-cold TBS, and flash-frozen in liquid nitrogen. Cells were lysed in breaking buffer (100 mM Tris, pH 8.0, 20% [vol/vol] glycerol, and 1 mM PMSF) on a bead beater before sonication. Samples were processed in a Bioruptor Plus sonication device at 50% for 30 cycles. Following centrifugation (to pellet cellular debris), the supernatant was used for the IP reaction. Biotin-conjugated Anti-HA (High Affinity [3F10], Sigma, 12158167001) coupled to Streptavidin-coated Dynabeads Streptavidin conjugated magnetic beads (Life Technologies, Dynabeads M-280 Streptavidin, 112.05D) was used to probe for HA-tagged TPLN188. Anti-FRB coupled to Protein A Dynabeads (Life Technologies, 100.02D) was used for ChIP on FRB-tagged yeast proteins. Following elution from the beads, samples were incubated overnight at 65°C to reverse cross-links. DNA was purified using a Monarch PCR purification kit (NEB). qPCR for three independent replicates was performed using iQ SYBR Green Supermix (Biorad) in a C100 thermocycler fitted with a CFX96 Real-Time Detection System (Biorad). To calculate fold enrichment, the delta CT (dCT) between input and IP was calculated for each sample for both the control locus (Either ACT1 3′ gene body or a new control primer from a well-characterized gene-free region on Sc chromosome V; Wong and Struhl, 2011) and the target locus (i.e., the ARF binding site of the ARC). The delta delta CT (ddCT) was then identified for the (Ct IP) – (Ct control locus) to create the non-specific adjustment. Then the fold enrichment is calculated (2-DDCt).

Protein alignments

Request a detailed protocol

The MED21 protein sequence was aligned to homologs using CLC Sequence Viewer 7, a tree was constructed using a neighbor-joining method, and bootstrap analysis performed with 10,000 replicates.

Plant growth

Request a detailed protocol

For synthetic repression assays in tobacco, Agrobacterium-mediated transient transformation of N. benthamiana was performed as per Yang et al., 2000. 5 ml cultures of Agrobacterium strains were grown overnight at 30°C shaking at 220 rpm, pelleted, and incubated in MMA media (10 mM MgCl2, 10 mM MES pH 5.6, 100 µM acetosyringone) for 3 hr at room temperature with rotation. Strain density was normalized to an OD600 of 1 for each strain in the final mixture of strains before injection into tobacco leaves. Leaves were removed, and eight different regions were excised using a hole punch, placed into a 96-well microtiter plate with 100 µl of water. Each leaf punch was scanned in a 4 × 4 grid for yellow and red fluorescence using a plate scanner (Tecan Spark, Tecan Trading AG, Switzerland). Fluorescence data was quantified and plotted in R (ggplots). For Arabidopsis thaliana experiments using the GAL4-UAS system (Laplaze et al., 2005), J0121 was introgressed eight times into Col-0 accession from the C24 accession and rigorously checked to ensure root growth was comparable to Col-0 before use. UAS-TPL-IAA14mED constructs were introduced to J0121 introgression lines by floral dip method (Clough and Bent, 1998). T1 seedlings were selected on 0.5× LS (Caisson Laboratories, Smithfield, UT)+ 25 µg/ml Hygromycin B (company) + 0.8% phytoagar (Plantmedia; Dublin, OH). Plates were stratified for 2 days, exposed to light for 6 hr, and then grown in the dark for 3 days following a modification of the method of Harrison et al., 2006. Hygromycin-resistant seedlings were identified by their long hypocotyl, enlarged green leaves, and long root. Transformants were transferred by hand to fresh 0.5× LS plates + 0.8% Bacto agar (Thermo Fisher Scientific) and grown vertically for 14 days at 22°C. Plates were scanned on a flatbed scanner (Epson America, Long Beach, CA) at day 14. slr and med21/MED21 (WiscDsLox461-464K13) seeds were obtained from the Arabidopsis Biological Resource Center (Columbus, OH). CRISPR/CAS9-based mutations in AtMED2 were generated as described in Wang et al., 2015. We created a novel mutation in AtMED21 that introduces a single base-pair insertion of G at nucleotide 214 after the A of the start codon (i214G). This mutation alters the amino acid sequence starting at residue 25 and creates an early stop codon after 11 random amino acids (Figure 6—figure supplement 1D).

Data submissions

Request a detailed protocol

All flow cytometry data will be deposited at https://flowrepository.org/. All plasmids will be deposited through Addgene at https://www.addgene.org/Jennifer_Nemhauser/.

Data availability

All flow cytometry data is deposited at https://flowrepository.org/. Repository IDS: FR-FCM-Z2GM, FR-FCM-Z2GR, FR-FCM-Z2GQ, FR-FCM-Z2GX, FR-FCM-Z2GT, FR-FCM-Z2W2. All protein interactions have been deposited to IntAct, under the accession code, IM-28972. All code is available through Github: https://github.com/achillobator/TPL_Structure_Function/ (copy archived at https://archive.softwareheritage.org/swh:1:rev:141d7d05fe0c23be55af5050563d160f019d6d65).

The following data sets were generated
    1. Leydon AR
    2. Nemhauser JL
    (2020) Flow Repository
    ID FR-FCM-Z2GM. TPL Helix-By-Helix deletion series.
    1. Leydon AR
    2. Nemhauser JL
    (2020) Flow Repository
    ID FR-FCM-Z2GR. TPL Helix-By-Helix deletion series 2.
    1. Leydon AR
    2. Nemhauser JL
    (2020) Flow Repository
    ID FR-FCM-Z2GQ. TPL Dimerization Mutants 2.
    1. Leydon AR
    2. Nemhauser JL
    (2020) Flow Repository
    ID FR-FCM-Z2GX. TPL Dimerization Mutants 1.
    1. Leydon AR
    2. Nemhauser JL
    (2020) Flow Repository
    ID FR-FCM-Z2GT. TPL Helix-By-Helix deletion series 3.
    1. Leydon AR
    2. Nemhauser JL
    (2020) Flow Repository
    ID FR-FCM-Z2W2. TPL Helix-By-Helix deletion series 4.
    1. Leydon AR
    (2021) EBI
    ID IM-28972. Repression by the Arabidopsis TOPLESS corepressor requires association with the core Mediator complex.

References

    1. Wong MM
    2. Guo C
    3. Zhang J
    (2014)
    Nuclear receptor corepressor complexes in Cancer: mechanism, function and regulation
    American Journal of Clinical and Experimental Urology 2:169–187.

Decision letter

  1. Irwin Davidson
    Reviewing Editor; Institut de Génétique et de Biologie Moléculaire et Cellulaire, France
  2. James L Manley
    Senior Editor; Columbia University, United States
  3. Irwin Davidson
    Reviewer; Institut de Génétique et de Biologie Moléculaire et Cellulaire, France
  4. Lucia Strader
    Reviewer; Duke University, United States

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Acceptance summary:

In this study, Leydon et al., use an elegant multi-component genetic system to address the mechanisms of repression by the Arabadopsis TOPLESS (Tpl) protein. Taking advantage of the genetic tools and knowledge of the structure of the Tpl protein the authors determine two short α helical regions that act as independent repression domains. They provide evidence that the target of one of these domains is the N-terminal region of the Med21 subunit of the mediator complex. Chromatin immunoprecipitation experiments, anchor-away loss of function and co-immunoprecipitation assays indicate that Tpl mediated repression involves formation of a promoter complex comprising the mediator complex along with several general transcription factors, but lacking RNA polymerase II. The authors also show that Tpl-Med21 interactions are involved in Tpl mediated repression in plants.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting your work entitled "Structure-function analysis of Arabidopsis TOPLESS reveals conservation of repression mechanisms across eukaryotes" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Irwin Davidson as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen a Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Lucia Strader (Reviewer #3).

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

This is an interesting study that uses an elegant multi-component genetic system to address the mechanisms of repression by the Arabadopsis TOPLESS (Tpl) protein. Taking advantage of the genetic tools and knowledge of the structure of the Tpl protein the authors determine two short α helical regions that act as independent repression domains. They provide evidence that the target of one of these domains is the N-terminal region of the Med21 subunit of the mediator complex. They then use the phylogenetic relationships amongst the Tpl proteins to identify a short repression domain in the human TBL1 protein.

Despite defining Tpl repression domains at amino acid resolution and at least in case of Helix 8 one of its targets, the referees were not convinced that the study provided novel insights into the mechanisms of repression. Almost all of the experiments are based on the same AtARC(Sc) system and the cytoSUS interaction assay, but were not supported by more direct biochemical interaction assays or ChIP experiments to address key events in preinitiation complex formation and RNA polymerase II recruitment that may underlie the repressive mechanism. The referees feel that such insight is required for the study to be of general interest to readers of eLife.

Reviewer #1:

This is an interesting study that uses an elegant multi-component genetic system to address the mechanisms of repression by the Arabadopsis TOPLESS (Tpl) protein. Taking advantage of the genetic tools and knowledge of the structure of the Tpl protein the authors determine two short α helical regions that act as independent repression domains. They provide evidence that the target of one of these domains is the N-terminal region of the Med21 subunit of the mediator complex. They then use the phylogenetic relationships amongst the Tpl proteins to identify a short repression domain in the human TBL1 protein.

Several issues should be addressed.

One of the major conclusions of this study is that the repression domain in helix 8 functions through interaction with the N-terminal domain of Med21. While all of the genetic setup provides strong evidence for this hypothesis, it would have been important to demonstrate this interaction using an independent method, co-immunoprecipitation, recombinant proteins etc. The authors could also address whether Tpl is capable of capturing the entire Med complex or only a sub-complex comprising Med21.

A second major issue is that while the study defines repression domains at amino acid resolution and at least in case of Helix 8 one of its targets, the reader is still left with questions concerning the mechanism of repression. Could the authors perform ChIP studies under the appropriate experimental conditions to assess how the Helix1 and Helix 8 repression domains affect pre-initiation complex formation when they are targeted to a promoter. Do they affect PIC formation Pol II recruitment, promoter release or some other process? It seems the authors have developed a complex and robust genetic reporter system to analyse domains involved in repression. This system can be further exploited to address more mechanistic questions and perhaps even their kinetics. This is particularly important when considering helix 8 and interaction with the Med21. It is not clear to the reader, how this interaction results in repression. This aspect should be further investigated.

Reviewer #2:

In this manuscript, the authors studied the specific domains of the plant A. thaliana TPL corepressor using a synthetic auxin response circuit (ARC) in the yeast S. cerevisiae reported in their previous paper (Pierre-Jerome 2014 PNAS). This artificial system combines plant components including TPL domain fused to IAA domain with auxin-responsive plant promoter and relies on the use of the yeast degradation and transcriptional machinery allowing to monitor the repression and response to auxin of the reporter expression. Based on published structure, the authors identified two domains of TPL corepressor that independently contribute to repression in this system. One of these domains interacts with Med21 Mediator subunit in cytoSUS interaction assay. The authors provide a lot of work with many constructions to study different domains or point amino acid substitutions in TPL-mediated auxin-responsive repression. The question of molecular mechanisms of transcription repression is certainly very important biological question that still remains poorly answered. However, the work did not provide any mechanistic insights and the artificial AtARC(Sc) system and the cytoSUS interaction assay used did not allow to address the repression mechanism in physiological context. Moreover, the role of Mediator complex through its CDK8 kinase module in TPL-mediated repression with a change in Mediator composition previously reported by Furutani laboratory (Ito 2016 PNAS) has not been addressed and integrated with regards to TPL-Med21 interaction.

On my opinion, the work is more suitable for a specialized journal. Many experiments and more direct evidences are needed to support the author conclusions. Without additional evidence, their title that contains "conservation of repression mechanisms" is not supported by experiments. An extensive experimental work should be done to provide at least some mechanistic insights on repression of auxin-responsive gene promoters that could not be achieved within 2 months.

1. The synthetic auxin response circuit (ARC) system is heterological making difficult the interpretation of the results. This artificial system combines plant components including TPL domain fused to IAA domain with auxin-responsive plant promoter and relies on the use of the endogenous, yeast degradation and transcriptional machinery. It was used previously to analyze the implication of different components of auxin response regulation from different plants and their functional annotation or for synthetic biology purposes. However, in this work the use of this system, especially to propose a molecular mechanism of transcription repression and to investigate the implication of Mediator complex is not sufficient and should be completed by additional experiments in plants in more physiological conditions (see below). The authors presented the fact that this system relies on endogenous S. cerevisiae proteins of degradation and transcriptional machinery as an argument for conservation of the mechanisms. At the same time, the interaction assay with plant proteins in the yeast is presented as a direct interaction, but one could not exclude the involvement of endogenous proteins in this assay.

2. A direct analysis of gene expression and direct genetic experiments in plants are missing. It should be feasible since many genetic, genomic and biochemical tools are available in A. thaliana.

3. The interaction cytoSUS assay is not sufficient to prove the direct interaction between TPL and Med21 Mediator subunit and should be confirmed by additional biochemical experiments with purified proteins or plant crude extracts (for example, by CoIP). In general, TPL interaction with Mediator complex should be analyzed.

4. A direct analysis of Mediator composition, especially with regards to the publication by Ito and colleagues (2016, PNAS) demonstrating the role of Mediator CDK8 kinase module in auxin-responsive repression with TPL-CDK8 module interaction and dissociation of this module for active transcription, is necessary. More generally, the role of this Mediator module in repression mechanisms should be taken into account.

5. The recruitment of transcriptional machinery including Mediator to promoter and regulatory regions of auxin-responsive genes should be analyzed by ChIP. RNA polymerase II recruitment and state should be directly tested in native system.

6. Physiological consequences of the changes in TPL domains and TPL-Med21 interaction should be studied.

7. The results are difficult to follow. First of all, the AtARC(Sc) system should be described at the beginning of the results indicating exactly which construction was used from the previous paper of the authors (Pierre-Jerome 2014 PNAS) and emphasizing the possibility to measure reporter fluorescence to evaluate reporter repression and also the response of the system to auxin (induction in the presence of auxin). The results should be profoundly rewritten for clarity and the figure organization should be readjusted.

For example, why the first figure cited in the results is Figure 1C?

Why some but not all constructions are summarized on Figure 1B with corresponding repression index and auxin induction level? The main figure summarizing all truncations tested would help.

In general, Figure 1 is a complex mix between different panels and constructions.

8. The authors did not provide any direct evidence to claim that "these results indicate that the CRA domain (H3-H8) requires contact with MED21 to drive repression" (p. 12, l. 284). No direct evidence was provided that TPL interaction with Med21 is involved in repression. Med21 is not the only interacting partner of TPL. Moreover, amino acid substitutions in TPL-N188 used in cytoSUS assay that reduced TPL-Med21 interaction also reduced TPL-IAA3 interaction.

9. The protein level of Med21 in wt is lower compared to Med21∆3 and ∆5 (Figure 3B) that should be explained/commented to indicate how this could influence the interpretation of the results.

10. The part of the manuscript on Med21 Anchor Away constructions in AtARC(Sc) system seems very methodological. The combined system is extremely artificial and heterological with three synthetic constructions (AA yeast Med21, inducible yeast Med21, auxin-responsive system with plant components ARF, IAA, TPL-N, plant promoter and endogenous, yeast degradation and transcriptional machinery). There are too many modifications and treatments (rapamycin, auxin, b-estradiol). This is the problem especially since Med21 is a part of the Mediator complex. What happens with Mediator in these conditions? The results are difficult to interpret. The complicated experimental procedure is not clear. The result description is unclear with mistakes (for example, Figure 5E cited on p. 14, l. 371 instead of Figure 4). Why no differences occur between mock and +Rapa for ∆5-MED21-FRB in blue on Figure 4 D? In general, the potential conclusions from this part are not clear.

Alternative strategies, for example point Med21 mutations directly tested in plants should be considered.

11. The part of the results on TPL multimerization and potential conclusions are unclear. It is not well integrated into the manuscript. The authors indicate a caveat in the use of heterological systems that further illustrates the limitations of their use and difficult interpretation of the results. The authors also indicate that "there are important differences between the synthetic and native systems" (p. 19, l. 474). This is the problem for result interpretation. It is not clear why the authors then used another conditional expression system in another plant (tobacco)? (p. 19) Why they use this additional model instead of A. thaliana and native gene expression? Finally, they decided to use transgenic Arabidopsis lines and obtained a negative result suggesting that multimer formation is not required for repression.

12. The last part on minimal repression domains in synthetic circuits is not within the general scope of the manuscript. It is not clear why this part was included. One of the possibilities would be to focus the manuscript on synthetic biology purposes and to choose an appropriate journal.

13. Many sentences in discussion are not supported by the results. For example, the authors should not say that their result "suggests a fundamental conservation in at least one corepressor mechanism across species" (p. 22, l. 596). No mechanistic insights were provided and conservation from yeast to plants was not directly addressed. No recruitment experiments were done for TLP, Mediator and RNA polymerase II. No direct experiments were done to demonstrate that TPL-Med21 interaction is directly involved in repression and to propose a molecular mechanism or to integrate their data into previously proposed model for Cdk8 module-containing Mediator. Mediator complex composition and its implication was not directly addressed.

More appropriate references should be cited for the main roles of Mediator complex.

No evidence for stabilization of Mediator complex by TPL were provided.

It is completely incorrect to say that in plants and yeast there is "more primitive form of pausing".

Reviewer #3:

In this manuscript, authors seek to resolve conflicting models for corepressor function using the elegant synthetic auxin response system. Auxin signaling is governed by a de-repression paradigm and is ideally suited to interrogate co-repressor function – in this case, the TOPLESS (TPL) co-repressor. Several contradicting models have been put forward for the mechanism of TPL-mediated gene repression, ranging from a requirement for protein oligomerization for activity, interaction with distinct partners, and even which regions of the protein are required for repressive activity. Leydon et al., use the yeast-based synthetic auxin response system to interrogate these models using a single reporter locus, allowing for straight-forward examination of TPL function.

Strengths of this study include the use of a simplified model to study a complex problem and the broad implications for study results (ie, findings likely hold true across organisms). There were a few pieces of data that I found confusing, which I have outlined below. Clarifying these points would strengthen the manuscript.

1. In Figure 1E, it appears that IAA3 alone can repress the reporter to some degree, or at least the maximal reporter activity cannot be achieved with IAA3 present. However, a lack of increased reporter expression with auxin treatment suggests that IAA3 degradation is insufficient to allow for maximal reporter expression (for example, what is seen for the H1-H7 line). I find this to be a curious result; can the authors expand on this?

2. In many cases, experiments to differentiate between variant effects on TPLN activity versus TPLN protein stability are lacking. This data would be helpful for interpreting some of the results. Note: this is included for some assays/variants, but not others.

3. It seems that the images presented for the split ubiquitin assays are stitched together from multiple images. This should be made clear in both the figure legend. In addition, it should be clear whether these were performed as a single experiment or images put together from distinct experiments. If from distinct experiments, I suggest that these be repeated as a single experiment.

4. I don't understand why N188 repression is not relieved by auxin treatment, when both the H1 and H3-H8 truncations are relieved. Maybe this is explained in the text, but if so, I missed this.

5. I also don't understand why H3-H8-QuadAAA is more auxin responsive than H3-H8.

6. I am confused by the data presented in Figure 4D. The text on lines 354-354 suggest that auxin sensitivity of the system is being examined, but it is not apparent that auxin treatment is involved in either the figure or the legend.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Repression by the Arabidopsis TOPLESS corepressor requires association with the core Mediator complex" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Irwin Davidson as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by a Reviewing Editor and James Manley as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Lucia Strader (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

The referees agreed that overall this new version of the manuscript is much improved over the original and many important issues have been addressed. However, a number of serious issues remain. If the authors do decide to submit a revision, it is essential that these concerns are fully addressed.

Essential Revisions:

1. As previously requested, the authors included ChIP experiments to directly show the presence of pre-initiation complex components at the repressed promoter. Nevertheless, it is not clear how the ChIP experiments were quantified, what is enrichment over background, this is not explained in the text. In addition, it is essential to include ChIP controls at an actively transcribed promoter, this is an especially important positive control for RA polymerase II that was not detected at the repressed promoters. Furthermore, Med21 Mediator subunit and TPLN188 were analyzed on chromosome-integrated AtARC locus (Figure 4C) while other ChIP experiments for Mediator subunits, some GTFs and Pol II were done with SPARC plasmid. Chromosomal ACT1 gene body is completely inappropriate as a background for Pol II ChIP, since this region is enriched for Pol II. Appropriate control regions, regulatory, core promoter and transcribed regions, as well as experiments with untagged control strains should be added. Percentage of IP over input values should be presented for untagged control strains and for several regions (negative control, regulatory, core promoter and transcribed regions). Sequences and positions of qPCR primers should be indicated. Mediator is mainly enriched on regulatory (UAS) regions, GTFs are bound on core promoters and Pol II signal in yeast is mostly on transcribed regions. Well-identified UAS enriched by Mediator should be added as positive controls and for comparison. The growth conditions should be clearly indicated to specify that they correspond to repressed state. The ChIP occupancy was analyzed only in transcriptionally repressed state and no results were provided for transition to the active state. This should be analyzed in detail.

2. The co-immunoprecipitation experiments in plant extracts lack a negative control to conclude on the specificity of CoIP signal. For Figure 6B, a control IP without HA tag or antibody should be added to evaluate non-specific binding of YFP-tagged TPL to beads. A condition Med21-YFP-HA "-" YFP-TPL "-" could not serve as a negative control, since no detection with anti-GFP is possible. Using actin depletion as a specificity control is not sufficient and not an accepted control. For CoIP in Figure 6 —figure supplement 1A, a negative control is not appropriate. A control IP is needed to evaluate non-specific binding of YFP-tagged proteins to beads. Furthermore, it would be important to perform co-immunoprecipitation of the Tpl quad AAAA mutant with Med21 to confirm loss of interaction and of Tpl with the N-terminal deletions of Med21.

3. It would be appropriate to remove the dimerization/multimerization experiments either completely or at least relegating them to the supplementary data and move the estradiol inducible experiments (Figure 4 Sup. 3) to main figures. This data appears more pertinent to the message of the paper than the ability of Tpl to form tetramers. Also, the colours in Figure 4 Sup. 3 are difficult to distinguish, can this be improved?

https://doi.org/10.7554/eLife.66739.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Reviewer #1:

This is an interesting study that uses an elegant multi-component genetic system to address the mechanisms of repression by the Arabadopsis TOPLESS (Tpl) protein. Taking advantage of the genetic tools and knowledge of the structure of the Tpl protein the authors determine two short α helical regions that act as independent repression domains. They provide evidence that the target of one of these domains is the N-terminal region of the Med21 subunit of the mediator complex. They then use the phylogenetic relationships amongst the Tpl proteins to identify a short repression domain in the human TBL1 protein.

We thank the reviewer for their positive comments.

Several issues should be addressed.

One of the major conclusions of this study is that the repression domain in helix 8 functions through interaction with the N-terminal domain of Med21. While all of the genetic setup provides strong evidence for this hypothesis, it would have been important to demonstrate this interaction using an independent method, co-immunoprecipitation, recombinant proteins etc. The authors could also address whether Tpl is capable of capturing the entire Med complex or only a sub-complex comprising Med21.

We thank the reviewer for this recommendation, and we have extensively addressed the protein-protein interaction question through the inclusion of several independent methods in both yeast (Co-IP, yeast two hybrid), and plants (BiFC, Co-IP).

A second major issue is that while the study defines repression domains at amino acid resolution and at least in case of Helix 8 one of its targets, the reader is still left with questions concerning the mechanism of repression. Could the authors perform ChIP studies under the appropriate experimental conditions to assess how the Helix1 and Helix 8 repression domains affect pre-initiation complex formation when they are targeted to a promoter. Do they affect PIC formation Pol II recruitment, promoter release or some other process? It seems the authors have developed a complex and robust genetic reporter system to analyse domains involved in repression. This system can be further exploited to address more mechanistic questions and perhaps even their kinetics. This is particularly important when considering helix 8 and interaction with the Med21. It is not clear to the reader, how this interaction results in repression. This aspect should be further investigated.

We fully agree that mechanism of repression is of great interest, and we appreciate the suggestion to investigate the nature of the repressed state. To this end, we performed two types of experiments. First, we performed ChIP-qPCR using Anchor.

Away strains for multiple Mediator subunits, basal transcription factors and RNA Polymerase II--importantly all fused to the same epitope tag. These experiments indicated that: (1) MED21 is indeed associated with the synthetic auxin circuit promoter, and (2) there is significant enrichment of the core Mediator complex and PIC components (minus PolII) at both our synthetic TPL-regulated locus and at a Tup1bound loci (ScSUC1). Second, we used an even more expanded set of strains for Anchor Away analysis in the presence of the Auxin circuit. These experiments connected components from all of the core Mediator subcomplexes to maintenance of transcriptional repression. These two assays complement each other, and greatly strengthen the model that TPL (and likely Tup1) facilitate pre-assembly of the PIC in the absence of PolII, and that this assembly is required for repression.

Reviewer #2:

In this manuscript, the authors studied the specific domains of the plant A. thaliana TPL corepressor using a synthetic auxin response circuit (ARC) in the yeast S. cerevisiae reported in their previous paper (Pierre-Jerome 2014 PNAS). This artificial system combines plant components including TPL domain fused to IAA domain with auxin-responsive plant promoter and relies on the use of the yeast degradation and transcriptional machinery allowing to monitor the repression and response to auxin of the reporter expression. Based on published structure, the authors identified two domains of TPL corepressor that independently contribute to repression in this system. One of these domains interacts with Med21 Mediator subunit in cytoSUS interaction assay. The authors provide a lot of work with many constructions to study different domains or point amino acid substitutions in TPL-mediated auxin-responsive repression. The question of molecular mechanisms of transcription repression is certainly very important biological question that still remains poorly answered. However, the work did not provide any mechanistic insights and the artificial AtARC(Sc) system and the cytoSUS interaction assay used did not allow to address the repression mechanism in physiological context. Moreover, the role of Mediator complex through its CDK8 kinase module in TPL-mediated repression with a change in Mediator composition previously reported by Furutani laboratory (Ito 2016 PNAS) has not been addressed and integrated with regards to TPL-Med21 interaction.

On my opinion, the work is more suitable for a specialized journal. Many experiments and more direct evidences are needed to support the author conclusions. Without additional evidence, their title that contains "conservation of repression mechanisms" is not supported by experiments. An extensive experimental work should be done to provide at least some mechanistic insights on repression of auxin-responsive gene promoters that could not be achieved within 2 months.

As summarized at the top of this document, we took the critiques from Reviewer 2 very seriously, and have added a number of new experiments to address their concerns. Below, we will detail the specific experiments. Please note that we have also changed the title of the manuscript to address the concern that our claims were too bold for our findings.

1. The synthetic auxin response circuit (ARC) system is heterological making difficult the interpretation of the results. This artificial system combines plant components including TPL domain fused to IAA domain with auxin-responsive plant promoter and relies on the use of the endogenous, yeast degradation and transcriptional machinery. It was used previously to analyze the implication of different components of auxin response regulation from different plants and their functional annotation or for synthetic biology purposes. However, in this work the use of this system, especially to propose a molecular mechanism of transcription repression and to investigate the implication of Mediator complex is not sufficient and should be completed by additional experiments in plants in more physiological conditions (see below). The authors presented the fact that this system relies on endogenous S. cerevisiae proteins of degradation and transcriptional machinery as an argument for conservation of the mechanisms. At the same time, the interaction assay with plant proteins in the yeast is presented as a direct interaction, but one could not exclude the involvement of endogenous proteins in this assay.

We thank the reviewer for their recommendations. We have extensively addressed the protein-protein interaction question through the inclusion of several independent methods in both yeast (Co-IP, yeast two hybrid), and plants (BiFC, Co-IP). We have also added additional experiments in plants that support the importance of the TPL-MED21 interaction for control of auxin-regulated development.

2. A direct analysis of gene expression and direct genetic experiments in plants are missing. It should be feasible since many genetic, genomic and biochemical tools are available in A. thaliana.

We appreciate the reviewer’s desire for more evidence of the relevance of the yeast work for understanding plant biology, and have added a number of experiments with this concern in mind. We have also made many changes to the text to make sure that our claims are stated clearly and conservatively. As both TPL and MED21 play critical roles in a large and diverse set of gene regulatory networks, it is actually quite challenging to address their direct impacts (or the impact of their interaction) on the expression of any one gene or developmental program. To address this significant challenge, we have employed a variety of complementary methods in the synthetic and in the native contexts to accumulate evidence that supports (but could have just as easily have refuted) our model. We have employed more genetic and biochemical assays in the revised text, including cell-type-specific repression and expression lines in plants, as well as BIFC and Co-IP tests for interactions. We did not perform gene expression analysis on these lines, as it would be unlikely to work given that the driver is only expressed in ~5% of root cells (estimate based on Schmidt et al., 2014. The iRoCS Toolbox--3D analysis of the plant root apical meristem at cellular resolution. Plant J 77, 806-14.).

3. The interaction cytoSUS assay is not sufficient to prove the direct interaction between TPL and Med21 Mediator subunit and should be confirmed by additional biochemical experiments with purified proteins or plant crude extracts (for example, by CoIP). In general, TPL interaction with Mediator complex should be analyzed.

As described above, we have extensively addressed the protein-protein interaction question through the inclusion of several independent methods in both yeast (Co-IP, yeast two hybrid), and plants (BiFC, Co-IP). These methods all support the conclusion that TPL and MED21 interact in yeast and in plants. As also described above, we added ChIP and Anchor Away experiments to probe the role of other components of the Mediator complex.

4. A direct analysis of Mediator composition, especially with regards to the publication by Ito and colleagues (2016, PNAS) demonstrating the role of Mediator CDK8 kinase module in auxin-responsive repression with TPL-CDK8 module interaction and dissociation of this module for active transcription, is necessary. More generally, the role of this Mediator module in repression mechanisms should be taken into account.

We agree with the reviewer that the role of the MED13 component of the CDK8 kinase module in TPL-based repression is of great interest. We took two complimentary approaches to probe this relationship. First, we used an Anchor Away experiment in yeast to deplete CDK8 from the nucleus in real time. We found that, in contrast to the marked relief of repression we observed with depletion of core Mediator components, the removal of CDK8 had only a minimal effect. Second, we crossed the dominant effect TPLN188-IAA14 fusion plant lines into the gct-5 background (a MED13 loss of function), and carefully compared the ability of med13 loss of function to influence repression of lateral root development. The choice of med13 allele for these experiments is critical, as other mutations that are in the latter portion of the gene body have a dominant effect in reverting the loss of lateral root phenotype in the solitary root mutant (see Author response image 1). Because the phenotype is dominant (i.e. in gct-2), these alleles are likely reflecting anti-morphic behavior. For this reason, we used the gct-5 allele, which is the most 5’ of all of the available mutations and the most likely to be an amorph.

Author response image 1

5. The recruitment of transcriptional machinery including Mediator to promoter and regulatory regions of auxin-responsive genes should be analyzed by ChIP. RNA polymerase II recruitment and state should be directly tested in native system.

We have now included ChIP-qPCR on the yeast circuit to answer this question.

6. Physiological consequences of the changes in TPL domains and TPL-Med21 interaction should be studied.

We agree with the reviewer that understanding the physiological role of the TPL-MED21 interaction is critical (versus other modes of repression through MED13, HDACs, etc). We have included several new experiments that address this concern (Figure 6). The first experiment was to introduce the Helix 8 quadruple point mutant (that abrogates MED21 binding) into the same driver line used for the lateral root suppression assay. The transgenic lines carrying the UAS-TPLN188-Helix8Quad construct produce lateral roots, demonstrating that the Helix 8 residues (and thus TPLMED21 interaction) are required for full repression of target genes. To complement this experiment, we introduced UAS-MED21 with and without N-terminal deletions (Δ3, Δ5, Δ7) into the same driver line. We hypothesized that N-terminal deletions when expressed over the wild-type allele might have a dominant effect on lateral root development. Indeed, we observed an increase in lateral root density compared to wild type. These two reciprocal experiments help to pinpoint the importance of the TPLMED21 interaction in a specific auxin-regulated plant process: lateral root development.

7. The results are difficult to follow. First of all, the AtARC(Sc) system should be described at the beginning of the results indicating exactly which construction was used from the previous paper of the authors (Pierre-Jerome 2014 PNAS) and emphasizing the possibility to measure reporter fluorescence to evaluate reporter repression and also the response of the system to auxin (induction in the presence of auxin). The results should be profoundly rewritten for clarity and the figure organization should be readjusted.

For example, why the first figure cited in the results is Figure 1C?

Why some but not all constructions are summarized on Figure 1B with corresponding repression index and auxin induction level? The main figure summarizing all truncations tested would help.

In general, Figure 1 is a complex mix between different panels and constructions.

We thank the reviewer for this observation, and we have revised the manuscript to focus only on Helix 8 and its interaction with MED21 to allow us to simplify the story. We have also worked to simplify the language and readability of the manuscript overall. Figure 1 is now streamlined accordingly. We have also included more schematics throughout to help guide the reader.

8. The authors did not provide any direct evidence to claim that "these results indicate that the CRA domain (H3-H8) requires contact with MED21 to drive repression" (p. 12, l. 284). No direct evidence was provided that TPL interaction with Med21 is involved in repression. Med21 is not the only interacting partner of TPL. Moreover, amino acid substitutions in TPL-N188 used in cytoSUS assay that reduced TPL-Med21 interaction also reduced TPL-IAA3 interaction.

We have included two experiments that focus on this interaction in planta. First, we performed UAS-TPL-IAA14 experiments with the TPL Helix 8 quad mutations which break TPL’s interaction with MED21. This was sufficient to break the repression of IAA14 controlled genes, and resulted in more lateral root production. Second, we created UAS-MED21 lines with either the wild-type N-terminus, or Nterminal deletions that break TPL-MED21 interaction. These lines show increases in lateral root production, and reciprocally demonstrate that the TPL-MED21 interaction is required for the repression of lateral root development.

9. The protein level of Med21 in wt is lower compared to Med21∆3 and ∆5 (Figure 3B) that should be explained/commented to indicate how this could influence the interpretation of the results.

We understand the concern over the protein level in these assays; however, if anything it is more striking that the protein level of the Med21∆3 and ∆5 are slightly higher and yet still do not interact with TPLN188. This demonstrates that the proteins in this assay are: (a) expressed and stable, and (b) that protein stability is not responsible for the loss of protein interaction.

10. The part of the manuscript on Med21 Anchor Away constructions in AtARC(Sc) system seems very methodological. The combined system is extremely artificial and heterological with three synthetic constructions (AA yeast Med21, inducible yeast Med21, auxin-responsive system with plant components ARF, IAA, TPL-N, plant promoter and endogenous, yeast degradation and transcriptional machinery). There are too many modifications and treatments (rapamycin, auxin, b-estradiol). This is the problem especially since Med21 is a part of the Mediator complex. What happens with Mediator in these conditions? The results are difficult to interpret. The complicated experimental procedure is not clear. The result description is unclear with mistakes (for example, Figure 5E cited on p. 14, l. 371 instead of Figure 4). Why no differences occur between mock and +Rapa for ∆5-MED21-FRB in blue on Figure 4 D? In general, the potential conclusions from this part are not clear.

Alternative strategies, for example point Med21 mutations directly tested in plants should be considered.

It was clear that our original submission was challenging to follow and included a number of methods that might not be familiar to all of our readers. We have worked hard to improve readability and accessibility throughout, including adding explanations for why we believed certain approaches were the best choice for answering particular questions. There are a few areas of specific concern here that need clarification. First, the Anchor away system has been extensively utilized in yeast to characterize and understand the mechanism of Mediator’s function at promoters (i.e. PMID:28699889, PMID:24746699). In our case, the only novel component is the Auxin Response Circuit. Therefore, we do not agree that because the circuit is complicated it is not relevant to transcription. We would argue that the dynamic nature of transcription greatly complicates the interpretation of phenotypes of stable point mutations in Mediator components. We strongly believe that our approaches and findings in yeast add unique and highly relevant insights into this complicated process, as well as providing guidance for follow-up work in plants.

11. The part of the results on TPL multimerization and potential conclusions are unclear. It is not well integrated into the manuscript. The authors indicate a caveat in the use of heterological systems that further illustrates the limitations of their use and difficult interpretation of the results. The authors also indicate that "there are important differences between the synthetic and native systems" (p. 19, l. 474). This is the problem for result interpretation. It is not clear why the authors then used another conditional expression system in another plant (tobacco)? (p. 19) Why they use this additional model instead of A. thaliana and native gene expression? Finally, they decided to use transgenic Arabidopsis lines and obtained a negative result suggesting that multimer formation is not required for repression.

We have extensively edited the relevant sections of the manuscript to increase clarity of our logic and conclusions.

12. The last part on minimal repression domains in synthetic circuits is not within the general scope of the manuscript. It is not clear why this part was included. One of the possibilities would be to focus the manuscript on synthetic biology purposes and to choose an appropriate journal.

We thank the reviewer for this constructive suggestion, and have removed the discussion of synthetic circuitry in plants from the manuscript

13. Many sentences in discussion are not supported by the results. For example, the authors should not say that their result "suggests a fundamental conservation in at least one corepressor mechanism across species" (p. 22, l. 596). No mechanistic insights were provided and conservation from yeast to plants was not directly addressed. No recruitment experiments were done for TLP, Mediator and RNA polymerase II.

We have now addressed this concern via both ChIP and Anchor away experiments in yeast, as described above.

No direct experiments were done to demonstrate that TPL-Med21 interaction is directly involved in repression and to propose a molecular mechanism or to integrate their data into previously proposed model for Cdk8 module-containing Mediator.

We have now directly tested this in experiments in plants, see previous comment above

Mediator complex composition and its implication was not directly addressed.

We have now included this via both ChIP and Anchor away experiments in yeast, as described above.

More appropriate references should be cited for the main roles of Mediator complex.

We have carefully reviewed the references cited, and would welcome any specific suggestions for further improvement.

No evidence for stabilization of Mediator complex by TPL were provided.

We have addressed this by ChIP which makes it is clear that the Mediator core complex is co-bound with TPLN188 at promoters in yeast.

It is completely incorrect to say that in plants and yeast there is "more primitive form of pausing".

This sentence has been removed from the newest version of the manuscript.

Reviewer #3:

In this manuscript, authors seek to resolve conflicting models for corepressor function using the elegant synthetic auxin response system. Auxin signaling is governed by a de-repression paradigm and is ideally suited to interrogate co-repressor function – in this case, the TOPLESS (TPL) co-repressor. Several contradicting models have been put forward for the mechanism of TPL-mediated gene repression, ranging from a requirement for protein oligomerization for activity, interaction with distinct partners, and even which regions of the protein are required for repressive activity. Leydon et al., use the yeast-based synthetic auxin response system to interrogate these models using a single reporter locus, allowing for straight-forward examination of TPL function.

Strengths of this study include the use of a simplified model to study a complex problem and the broad implications for study results (ie, findings likely hold true across organisms).

We thank the reviewer for their positive comments.

There were a few pieces of data that I found confusing, which I have outlined below. Clarifying these points would strengthen the manuscript.

1. In Figure 1E, it appears that IAA3 alone can repress the reporter to some degree, or at least the maximal reporter activity cannot be achieved with IAA3 present. However, a lack of increased reporter expression with auxin treatment suggests that IAA3 degradation is insufficient to allow for maximal reporter expression (for example, what is seen for the H1-H7 line). I find this to be a curious result; can the authors expand on this?

We agree that this result gets at a very interesting observation, namely that in circuits where the reporter gene is repressed, it is often activated to a higher level than in control lines where there is no repression (constitutive activation). In our experiments in yeast, IAA3 does not provide any repressive function unless it is fused to TPL, and the increase in activation above this level is due to the switch from repressed to activated state.

2. In many cases, experiments to differentiate between variant effects on TPLN activity versus TPLN protein stability are lacking. This data would be helpful for interpreting some of the results. Note: this is included for some assays/variants, but not others.

This is something that concerned us as well, and we have tried to address it wherever possible. Our hands are tied with respect to the addition of epitope tags in the case of certain experiments. While an epitope tag can be added to the N188 full length protein at the N terminus, the number and length of tags does diminish repression activity. When we use further truncations, the presence of an epitope tag can drastically affect repression. We have tried to include protein levels whenever the inclusion of a tag does not itself change repression strength.

3. It seems that the images presented for the split ubiquitin assays are stitched together from multiple images. This should be made clear in both the figure legend. In addition, it should be clear whether these were performed as a single experiment or images put together from distinct experiments. If from distinct experiments, I suggest that these be repeated as a single experiment.

All experiments within a figure panel are from the same experiment, but were cropped together to conserve space. We have added white lines to indicate this on the panels, and have included text within the figure legend to explain this.

4. I don't understand why N188 repression is not relieved by auxin treatment, when both the H1 and H3-H8 truncations are relieved. Maybe this is explained in the text, but if so, I missed this.

We have included a description of our previous experiments from prior publications that discuss the relevant results that lead to our understanding of why the N188 repressed circuit is not relievable by auxin addition. This is on page 4, lines 78-85.

5. I also don't understand why H3-H8-QuadAAA is more auxin responsive than H3-H8.

We agree that this is an interesting and somewhat surprising result. One way to explain this pattern is that the loss of interaction with Med21 weakens the repression state, as evidenced by higher reporter expression in the absence of auxin. Adding auxin sensitizes the system by decreasing the level of the TPL-fusion, thereby revealing the decrease in stability of this complex and allowing activation at a lower level of auxin. In the context of the entire TPLN188 with the QuadA mutations, we would argue that the second repression domain (H1) and the intact interaction with Med10 are sufficient to maintain a stable repression state, even when the level of TPL is decreased with auxin addition.

6. I am confused by the data presented in Figure 4D. The text on lines 354-354 suggest that auxin sensitivity of the system is being examined, but it is not apparent that auxin treatment is involved in either the figure or the legend.

We thank the reviewer for this correction, which is remedied in the current version of the manuscript.

[Editors’ note: what follows is the authors’ response to the second round of review.]

Essential Revisions:

1. As previously requested, the authors included ChIP experiments to directly show the presence of pre-initiation complex components at the repressed promoter.

a) Nevertheless, it is not clear how the ChIP experiments were quantified, what is enrichment over background, this is not explained in the text.

We quantified our ChIP experiments using a method applied extensively for such assays in yeast (i.e., in the recent eLife paper PMID: 30681409). It is described here: https://www.thermofisher.com/us/en/home/life-science/epigenetics-noncoding-rnaresearch/chromatin-remodeling/chromatin-immunoprecipitation-chip/chip-analysis.html Briefly, the δ CT (dCT) between input and IP is calculated for each sample for both the control locus (Either ACT1 3’ gene body, or a new control primer from a well-characterized gene-free region on Sc chromosome V, PMID: 22156212) and the target locus (i.e., the ARF binding site of the ARC). The δ δ CT (ddCT) is then identified for the (Ct IP) – (Ct control locus) to create the non-specific adjustment. Then the fold enrichment is calculated (2DDCt).

To improve clarity, we have edited the methods section description, and changed the labelling of the y-axis on ChIP graphs in Figure 4 to “Fold enrichment over background (ACT1 Gene body)” or “Fold enrichment over background (Chr.V gene free region)”. We have also included a supplementary ChIP-qPCR figure to assist in guiding the reader (Figure 4 —figure supplement 2).

b) In addition, it is essential to include ChIP controls at an actively transcribed promoter, this is an especially important positive control for RA polymerase II that was not detected at the repressed promoters.

We appreciate this suggestion, and have now tested the enrichment of our proteins of interest at the promoter of the essential plasma membrane ATPase gene PMA1 (PMID: 3005867). ChIP assays in yeast grown under similar conditions as we are using for our analysis have previously detected enrichment of transcriptional machinery at the PMA1 locus, and it is frequently used as a housekeeping gene (PMID: 16461706). We tested our ChIP samples at the PMA1 promoter using validated qPCR primer sets, and detected a significant enrichment of Mediator and GTFs, consistent with previous reports (PMID: 28699889). Thus, we are confident that our ChIP conditions and anti-FRB antibodies are able to capture transcriptionally active loci. The data is shown in Figure 4D. Please see Point D below for experiments examining Pol-II.

c) Furthermore, Med21 Mediator subunit and TPLN188 were analyzed on chromosome-integrated AtARC locus (Figure 4C) while other ChIP experiments for Mediator subunits, some GTFs and Pol II were done with SPARC plasmid.

It is absolutely true that genes on plasmids and those integrated into the genome may behave differently. It is for this exact reason that we carefully validated our results in multiple independent assays (transient and stable transformations, integrated loci and plasmids) in multiple species. We created the SPARC because shared prototrophy genes make it impossible to combine the Anchor Away strains with the integrated ARC as originally constructed. To be scrupulously careful in drawing our main conclusion, we created the integrated strain with TPLN188-HA and MED21-FRB in a non-Anchor Away genetic background to confirm that we saw similar enrichment patterns whether we performed ChIP on MED21-FRB at an integrated locus or on the SPARC plasmid. Because we see that (i) the SPARC behaves similarly to the ARC with respect to repression, and (ii) that we could ChIP MED21-FRB at both the integrated ARC and the plasmid SPARC, we feel comfortable using the SPARC for ChIP assays on other components of the transcriptional machinery.

Given that even this level of caution still left the reviewer with some concerns, we performed additional experimental validations of both the integrated locus and the SPARC plasmid. These results now appear in Figure 4 —figure supplement 2. We find a general similarity in ChIP results between the two reporter locations (SPARC or ARC), and that the ChIP trends track the expression level of the reporter (YFP). Please find the specific description of the experiments in the sections below.

d) Chromosomal ACT1 gene body is completely inappropriate as a background for Pol II ChIP, since this region is enriched for Pol II. Appropriate control regions, regulatory, core promoter and transcribed regions, as well as experiments with untagged control strains should be added.

We have repeated this analysis for the RNA Polymerase II ChIP samples using an alternative primer set. The Chr.V non-genic control primer is the well-characterized gene-free region on Sc chromosome V, utilized in PMID: 22156212. We saw a similar profile for Pol-II at the repressed gene loci at the SPARC reporter promoter and the endogenously Tup1-repressed SUC1 promoter as compared to the clear enrichment at the promoter of PMA1. This indicates that the anti-FRB ChIP was successful, and that the Pol-II is not enriched at the repressed promoters. These data now appear as part of Figure 4D.

e) Percentage of IP over input values should be presented for untagged control strains and for several regions (negative control, regulatory, core promoter and transcribed regions).

We appreciate the reviewer’s suggestion, and have several responses. First, we added an explanation of how ‘Fold enrichment over the background is calculated’ (point A – above, and in the Methods section). We have also shown this graphically by comparing the percent input calculation to the Fold enrichment over background.

This normalization to control allows us to plot ChIPs from different antibodies/IPs onto the same graph. We show this in Figure 4C as it will allow better comparisons to be made with the new Figure 4D, and Figure 4L and the new supplemental ChIP figure (Figure 4 —figure supplement 2).

We have also performed ChIPs with the control strains that do not have any FRB tag present. These data demonstrate that there is no enrichment of the SPARC promoter or relevant control loci (see far left lanes labelled ‘No Tag’ in Figure 4D).

The second part of this question is addressed in our response to point G below, as it is thematically linked.

f) Sequences and positions of qPCR primers should be indicated.

All sequences are included in the provided oligo sequences supplementary file and are labelled with their use as “ChIP-qPCR”. We have updated this list to include all new primer sets. We have also created a map of the ARC promoter, the sequence of which is identical in both the integrated ARC and the SPARC plasmid. This is included in Figure 4 —figure supplement 2.

g) Mediator is mainly enriched on regulatory (UAS) regions, GTFs are bound on core promoters and Pol II signal in yeast is mostly on transcribed regions. Well-identified UAS enriched by Mediator should be added as positive controls and for comparison.

Two pieces of information are important to consider in addressing this issue. The first is that our sonication conditions generate DNA libraries that are centered at ~500 base pairs in size. The second is that the promoter we are analyzing here is very short (363bp, as shown in response to Point G), and indeed this is a similar size to many other genes in the yeast genome. Therefore, the UAS and core promoter cannot be easily untangled without a finer resolution technique such as ChIP-seq, using an alternative fragmentation technique. We tested the resolution of our assays using a series of primers along the gene body, and confirmed that our ‘peaks’ are quite broad (see Figure 2—figure supplement 2). A primer set ~500 base pairs downstream of the ‘UAS’-site still shows a residual enrichment of both TPL and MED21. We will refer to the region we are assaying as the Promoter as opposed to an UAS due to the resolution of our chromatin preparation protocol. Our control gene (the ACT1 gene body, >700 base pairs downstream of the start codon) is appropriate to test this level of resolution for most cases except for Pol-II, as discussed above. As a note, this figure again highlights why it is critical to normalize the data to a control region. It is only with this step that allows us to plot the data in a single graph, which we think makes for optimal readability and straightforward comparisons.

h) The growth conditions should be clearly indicated to specify that they correspond to repressed state.

We have put headers on the figures to make sure that the growth conditions and repression state are clear. We have also added language to the figure legends to further guide the reader.

i) The ChIP occupancy was analyzed only in transcriptionally repressed state and no results were provided for transition to the active state. This should be analyzed in detail.

We understand the reviewer’s concerns about what the normal enrichment of Mediator / GTFs / Pol-II is at an ARC promoter in the absence of TPL repressor, or in other words what happens at the active ARC promoter. If we understand the reviewer’s comments, we think that one of our statements (“auxin-induced TPL removal changes the composition of Mediator complex”) led to this concern. While we intended to indicate that the concentration of Mediator complex that is actively recruiting Pol-II at the promoter is increasing, we were not clear. We have changed the text to clarify this (Pg.28 lines 656-660). The sentence now reads: “As suggested by Ito and colleagues (Ito et al., 2016) and supported by our synthetic system, auxin-induced removal of TPL is sufficient to induce changes in the activity of the Mediator complex”.

We agree that it is critical to evaluate the change in Mediator abundance at the ARC promoter when it is active. We would first indicate that the original Figure 4L did indeed test this question specifically. We observed a greater enrichment of MED21 at unrepressed promoters. However, to provide additional information, we have added the analysis of the PMA1 promoter into this figure panel as well as the control, highlighting the lines where there is no repression (No TPL – dark grey). We detect a high abundance of Med21 at the active SPARC promoter, as compared to the repressed promoter. The well-documented PMA1 promoter has an enrichment of MED21, and is unaffected by the presence of the SPARC. The Δ5Med21 does not fully rescue the association of Med21 to the promoter, however this is roughly similar to the change in the transcriptional output of the SPARC when helix 8 is absent ~1.6x (see transcriptional output in Figure 4J). The Δ5Med21 protein is integrating into Mediator complexes (White bars), however it appears slightly less enriched at the PMA1 promoter compared to wild-type Med21, supporting the phenotypic analysis that the Δ5Med21 mutant has slower transcription promoting activity (Figure 4 —figure supplement 3A).

To more directly answer the concern over changes in Mediator composition between repressed and active SPARC promoters, we performed ChIP-qPCR in SPARC lines that have no TPL (active). To do this we had to purchase more anti-FRB, which was from a separate lot number from the prior experiments leading to less effective pull-downs. While we observed a lower total enrichment of FRB tagged proteins at all loci compared to the previous experiments (see Figure 4—figure supplement 2D), the trends are entirely consistent. The enrichment of Mediator components MED18 and MED14 at the SPARC promoter is increased under active conditions, whereas CDK8 is absent. Both TBP1 and Pol-II show high levels of enrichment at the active SPARC promoter. The positive control promoter of PMA1 shows a similar enrichment profile. This indicates that the abundance, and not the composition of the Mediator complex, is altered at the SPARC promoter, with the most striking difference being the recruitment of Pol-II. We have edited our language to make this distinction explicit.

2. The co-immunoprecipitation experiments in plant extracts lack a negative control to conclude on the specificity of CoIP signal. For Figure 6B, a control IP without HA tag or antibody should be added to evaluate non-specific binding of YFP-tagged TPL to beads. A condition Med21-YFP-HA "-" YFP-TPL "-" could not serve as a negative control, since no detection with anti-GFP is possible. Using actin depletion as a specificity control is not sufficient and not an accepted control. For CoIP in Figure 6 —figure supplement 1A, a negative control is not appropriate. A control IP is needed to evaluate non-specific binding of YFP-tagged proteins to beads. Furthermore, it would be important to perform co-immunoprecipitation of the Tpl quad AAAA mutant with Med21 to confirm loss of interaction and of Tpl with the N-terminal deletions of Med21.

We thank the reviewers for their comments on the specificity of the Co-IP signal. We repeated the Co-IPs using the same protocols with the indicated controls. In these experiments, we see no non-specific binding between the TPL-YFP fusion protein and the beads. The Figure 6 panel B has been replaced (New Figure 6B).

3. It would be appropriate to remove the dimerization/multimerization experiments either completely or at least relegating them to the supplementary data and move the estradiol inducible experiments (Figure 4 Sup. 3) to main figures. This data appears more pertinent to the message of the paper than the ability of Tpl to form tetramers. Also, the colours in Figure 4 Sup. 3 are difficult to distinguish, can this be improved?

We thank the reviewers for this suggestion and have given the question of the ‘message of the paper’ a great deal of thought. While the significance of a result is in the eye of the beholder, we see this study as an investigation into the mechanism and functional unit of repression by TPL. While the data on multimerization is not directly relevant to the first of these objectives, it is of central concern for the second. The prevailing thought has been that multimerization is required for repression, and certainly there is data that higher-order multimers-of-multimers exist and have functional roles (PMID: 28630893). To our knowledge, this is the first time that a study has been able to engineer a variant of the TPL N-terminus capable of testing the ability of a monomer of TPL to repress. Therefore, the ability of a monomer of TPL to repress is a striking and novel finding. Other researchers outside of our lab have expressed their interest in this finding as well, indicating to us that these results are integral to the main message of the manuscript. While we appreciate the reviewer’s enthusiasm for the estradiol experiments. We see these results as being supplementary proof that Med21 and TPL interaction has a functional role in repression that is not caused by an off-target effect due to the method of analysis in yeast. Therefore, while we respect the reviewer’s opinion, and have discussed this extensively among the authors, we have left the distribution of main and supplementary figures unchanged.

https://doi.org/10.7554/eLife.66739.sa2

Article and author information

Author details

  1. Alexander R Leydon

    Department of Biology, University of Washington, Seattle, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3034-1482
  2. Wei Wang

    Department of Pharmacology, Seattle, United States
    Present address
    Key Laboratory of Plant Stress Biology, State Key Laboratory of Cotton Biology, School of Life Science, Jinming Campus, Henan University, Kaifeng, China
    Contribution
    Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
  3. Hardik P Gala

    Department of Biology, University of Washington, Seattle, United States
    Contribution
    Formal analysis, Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
  4. Sabrina Gilmour

    Department of Biology, University of Washington, Seattle, United States
    Contribution
    Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
  5. Samuel Juarez-Solis

    Department of Biology, University of Washington, Seattle, United States
    Contribution
    Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
  6. Mollye L Zahler

    Department of Biology, University of Washington, Seattle, United States
    Contribution
    Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
  7. Joseph E Zemke

    Department of Biology, University of Washington, Seattle, United States
    Contribution
    Investigation, Visualization, Writing - review and editing
    Competing interests
    No competing interests declared
  8. Ning Zheng

    1. Department of Pharmacology, Seattle, United States
    2. Howard Hughes Medical Institute, University of Washington, Seattle, United States
    Contribution
    Resources, Funding acquisition, Writing - review and editing
    Competing interests
    No competing interests declared
  9. Jennifer L Nemhauser

    Department of Biology, University of Washington, Seattle, United States
    Contribution
    Conceptualization, Resources, Supervision, Funding acquisition, Project administration, Writing - review and editing
    For correspondence
    jn7@uw.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-8909-735X

Funding

National Institutes of Health (GM107084)

  • Alexander R Leydon
  • Hardik P Gala
  • Sabrina Gilmour
  • Samuel Juarez-Solis
  • Mollye L Zahler
  • Joseph E Zemke
  • Jennifer L Nemhauser

Howard Hughes Medical Institute

  • Alexander R Leydon
  • Wei Wang
  • Hardik P Gala
  • Sabrina Gilmour
  • Samuel Juarez-Solis
  • Mollye L Zahler
  • Joseph E Zemke
  • Ning Zheng
  • Jennifer L Nemhauser

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We would like to thank Prof. Jef Boeke for kindly providing VEGAS adaptor and regulatory element plasmids; Dr. Jennifer Brophy and Prof. José Dinneny for kindly providing the pUBQ10:GAL4:VP16 plasmid; Dr. Natalia Petrenko and Dr. Kevin Struhl for kindly providing Mediator Anchor Away strains; and Prof. Grant Brown and Prof. Maitreya Dunham for advice on yeast genetics and approaches. We thank members of the Nemhauser group including Amy Lanctot, Romi Ramos, Eric Yang, and Dr. Sarah Guiziou for constructive discussions and comments on this manuscript. We also thank Morgan Hamm for the custom R script used here to analyze Anchor Away plates. Funding: National Institutes of Health (NIH): ARL, HPG, SG, SJS, JEZ, MZ and JLN R01-GM107084. Howard Hughes Medical Institute (HHMI): ARL, SJS, JEZ, MZ, and JLN – Faculty Scholar Award. Ning Zheng is a Howard Hughes Medical Institute Investigator. ARL is supported by the Simons Foundation through the Life Science Research Foundation.

Senior Editor

  1. James L Manley, Columbia University, United States

Reviewing Editor

  1. Irwin Davidson, Institut de Génétique et de Biologie Moléculaire et Cellulaire, France

Reviewers

  1. Irwin Davidson, Institut de Génétique et de Biologie Moléculaire et Cellulaire, France
  2. Lucia Strader, Duke University, United States

Publication history

  1. Received: January 21, 2021
  2. Accepted: May 31, 2021
  3. Accepted Manuscript published: June 2, 2021 (version 1)
  4. Version of Record published: June 14, 2021 (version 2)

Copyright

© 2021, Leydon et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 543
    Page views
  • 125
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cancer Biology
    2. Chromosomes and Gene Expression
    Shou Liu et al.
    Research Article Updated

    ARID1A is one of the most frequently mutated epigenetic regulators in a wide spectrum of cancers. Recent studies have shown that ARID1A deficiency induces global changes in the epigenetic landscape of enhancers and promoters. These broad and complex effects make it challenging to identify the driving mechanisms of ARID1A deficiency in promoting cancer progression. Here, we identified the anti-senescence effect of Arid1a deficiency in the progression of pancreatic intraepithelial neoplasia (PanIN) by profiling the transcriptome of individual PanINs in a mouse model. In a human cell line model, we found that ARID1A deficiency upregulates the expression of aldehyde dehydrogenase 1 family member A1 (ALDH1A1), which plays an essential role in attenuating the senescence induced by oncogenic KRAS through scavenging reactive oxygen species. As a subunit of the SWI/SNF chromatin remodeling complex, our ATAC sequencing data showed that ARID1A deficiency increases the accessibility of the enhancer region of ALDH1A1. This study provides the first evidence that ARID1A deficiency promotes pancreatic tumorigenesis by attenuating KRAS-induced senescence through the upregulation of ALDH1A1 expression.

    1. Cell Biology
    2. Chromosomes and Gene Expression
    Michael Chas Sumner et al.
    Research Article Updated

    Hundreds of genes interact with the yeast nuclear pore complex (NPC), localizing at the nuclear periphery and clustering with co-regulated genes. Dynamic tracking of peripheral genes shows that they cycle on and off the NPC and that interaction with the NPC slows their sub-diffusive movement. Furthermore, NPC-dependent inter-chromosomal clustering leads to coordinated movement of pairs of loci separated by hundreds of nanometers. We developed fractional Brownian motion simulations for chromosomal loci in the nucleoplasm and interacting with NPCs. These simulations predict the rate and nature of random sub-diffusion during repositioning from nucleoplasm to periphery and match measurements from two different experimental models, arguing that recruitment to the nuclear periphery is due to random sub-diffusion and transient capture by NPCs. Finally, the simulations do not lead to inter-chromosomal clustering or coordinated movement, suggesting that interaction with the NPC is necessary, but not sufficient, to cause clustering.