Acquisition of cellular properties during alveolar formation requires differential activity and distribution of mitochondria

Version of Record

Accepted for publication after peer review and revision.

Download
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Version of Record published: June 9, 2022 (This version)
Accepted Manuscript published: April 6, 2022 (Go to version)
Accepted: April 5, 2022
Preprint posted: April 11, 2021 (Go to version)
Received: March 20, 2021

1. Related to
Mitochondria: Powering the formation of alveoli

Qianjiang Hu, Melanie Königshoff

Insight Jun 9, 2022
Further reading

Abstract
Editor's evaluation
eLife digest
Introduction
Results
Discussion
Materials and methods
Appendix 1
Data availability
References
Decision letter
Author response
Article and author information
Metrics

Abstract

Alveolar formation requires coordinated movement and interaction between alveolar epithelial cells, mesenchymal myofibroblasts, and endothelial cells/pericytes to produce secondary septa. These processes rely on the acquisition of distinct cellular properties to enable ligand secretion for cell-cell signaling and initiate morphogenesis through cellular contraction, cell migration, and cell shape change. In this study, we showed that mitochondrial activity and distribution play a key role in bestowing cellular functions on both alveolar epithelial cells and mesenchymal myofibroblasts for generating secondary septa to form alveoli in mice. These results suggest that mitochondrial function is tightly regulated to empower cellular machineries in a spatially specific manner. Indeed, such regulation via mitochondria is required for secretion of ligands, such as platelet-derived growth factor, from alveolar epithelial cells to influence myofibroblast proliferation and contraction/migration. Moreover, mitochondrial function enables myofibroblast contraction/migration during alveolar formation. Together, these findings yield novel mechanistic insights into how mitochondria regulate pivotal steps of alveologenesis. They highlight selective utilization of energy in cells and diverse energy demands in different cellular processes during development. Our work serves as a paradigm for studying how mitochondria control tissue patterning.

Editor's evaluation

This paper will be of interest to the large class of scientists interested in lung development and disease. It explores the under-investigated role of mitochondrial activity and subcellular distribution for alveolar formation, by using a variety of transgenic mouse models to delete two specific mitochondrial proteins. The data support a role for mitochondria distribution and function in postnatal lung development in the mice.

https://doi.org/10.7554/eLife.68598.sa0

eLife digest

The lungs display an intricate, tree-shaped structure which enables the complex gas exchanges required for life. The end of each tiny ‘branch’ hosts delicate air sacs, or alveoli, which are further divided by internal walls called septa. In mammals, this final structure is acquired during the last stage of lung development. Then, many different types of cells in the immature alveoli multiply and reach the right location to start constructing additional septa.

While the structural changes underlining alveoli maturation are well-studied, the energy requirements for that process remain poorly understood. In particular, the exact role of the mitochondria, the cellular compartments that power most life processes, is still unclear.

Zhang et al. therefore set out to map, in detail, the role of mitochondria in alveolar development. Microscope imaging revealed how mitochondria were unevenly distributed within the lung cells of newborn mice. Mitochondria accumulated around the machinery that controls protein secretion in the epithelial cells that line the air sacs, and around the contractile apparatus in the underlying cells (the ‘myofibroblasts’).

Genetically altering the mice to reduce mitochondrial activity or perturb mitochondrial location in these two cell types produced defective alveoli with fewer septa, but it had no effect on lung development before alveoli formation. This suggests that the formation of alveoli requires more energy than other steps of lung development. Disrupting mitochondrial activity or location also compromised how epithelial cells produced chemical signals necessary for the contraction or migration of the myofibroblasts.

Together, these results highlight the importance of tightly regulating mitochondrial activity and location during lung patterning. In the future, this insight could lay the groundwork to determine how energy requirements in various tissues shape other biological processes in health and disease.

Introduction

Production of alveoli during development and following lung injury is essential for lung function (Burri, 2006; Chao et al., 2016; Whitsett and Weaver, 2015; Pan et al., 2019; Rippa et al., 2021). Defective alveologenesis underlies bronchopulmonary dysplasia (BPD) (Silva et al., 2015), and ongoing destruction of alveoli is characteristic of chronic obstructive lung disease (COPD) (Patel et al., 2019). COPD is a major cause of morbidity and mortality globally (Barnes et al., 2015; Rodríguez-Castillo et al., 2018). During alveolar formation, alveolar epithelial cells (type I [AT1] and type II [AT2] cells), myofibroblasts, and endothelial cells/pericytes undergo coordinated morphogenetic movement to generate secondary septa within saccules. As a result, secondary septa are comprised of a layer of alveolar epithelial cells that ensheathes a core of myofibroblasts and endothelial cells/pericytes. Secondary septa formation (or secondary septation) is the most important step during alveolar formation. Platelet-derived growth factor (PDGF) produced by alveolar epithelial cells is a key player in controlling myofibroblast proliferation and contraction/migration during alveologenesis (Boström et al., 1996; Lindahl et al., 1997). In response to PDGF signaling, the traditional model posits that myofibroblasts proliferate and migrate to the prospective site of secondary septation and secrete elastin. Myofibroblasts and endothelial cells/pericytes are subsequently incorporated with alveolar epithelial cells to form secondary septa. All of these principal components play a key role in driving secondary septa formation (Chao et al., 2016). Generation of alveoli increases the surface area and efficiency of gas exchange, enabling high activity in terrestrial environments. Despite the progress that has been made, our mechanistic understanding of alveologenesis remains incomplete.

Mitochondrial activity is essential for every biological process, and mitochondria provide a major source of ATP production through oxidative phosphorylation (OXPHOS) (Labbé et al., 2014; Chan, 2020). Unexpectedly, we have limited mechanistic insight into how mitochondria control cellular processes in vivo. In particular, little is known about whether certain cellular processes have a higher energy demand during alveolar formation. Many genetic and molecular tools have been developed in mice to study mitochondrial function. They offer a unique opportunity to address the central question of how mitochondria control alveologenesis at the molecular level.

Mitochondria exhibit dynamic distribution within individual cells. This process is mediated by the cytoskeletal elements that include microtubules, F-actin and intermediate filaments. For instance, Rhot1 (ras homolog family member 1), which is also called Miro1 (Mitochondrial Rho GTPase 1), encodes an atypical Ras GTPase and plays an essential role in mitochondrial transport (Devine et al., 2016). RHOT1 associates with the Milton adaptor (TRAK1/2) and motor proteins (kinesin and dynein), and tethers the adaptor/motor complex to mitochondria. This machinery facilitates transport of mitochondria via microtubules within mammalian cells. Whether regulated mitochondrial distribution is essential for lung cell function during alveologenesis is unknown.

In this study, we have demonstrated a central role of mitochondrial activity and distribution in conferring cellular properties to alveolar epithelial cells and myofibroblasts during alveolar formation. In particular, PDGF ligand secretion from alveolar epithelial cells and motility of myofibroblasts depend on regulated activity and distribution of mitochondria. Moreover, loss of mitochondrial function does not have a uniform effect on cellular processes, indicating diverse energy demands in vivo. We also reveal regulation of mitochondrial function by mTOR complex 1 (mTORC1) (Laplante and Sabatini, 2012; Land et al., 2014) during alveolar formation and establish a connection between mitochondria and COPD/emphysema. Taken together, these findings provide new insight into how different cell types channel unique energy demands for cellular machinery into distinct cellular properties during alveolar formation.

Results

Mitochondria display dynamic subcellular distribution in alveolar epithelial cells and mesenchymal myofibroblasts during alveolar formation

To uncover the functional role of mitochondria during alveologenesis, we first examined the distribution of mitochondria in murine lung cells involved in alveolar formation. We used antibodies against mitochondrial components to visualize the distribution of mitochondria in lung epithelial cells and myofibroblasts. For instance, we performed immunostaining on lung sections derived from Sox9^Cre/+; ROSA26^mTmG/+ mice with anti-mitochondrial pyruvate carrier 1 (MPC1) and anti-mitochondrially encoded cytochrome c oxidase I (MTCO1) (Varuzhanyan et al., 2019). In particular, anti-MPC1 serves as a general marker for mitochondria. Lung epithelial cells were labeled by GFP produced from the ROSA26^mTmG reporter (Muzumdar et al., 2007) due to selective Cre expression in SOX9⁺ epithelial cells (Akiyama et al., 2005). We found that mitochondria were widely distributed in alveolar epithelial cells (distinguished by T1α and SPC for AT1 and AT2 cells, respectively) and myofibroblasts (marked by PDGF receptor A [PDGFRA] and smooth muscle actin [SMA]) (Sun et al., 2000; Gouveia et al., 2017; Figure 1A). This is consistent with an essential role of mitochondrial activity in proper functioning of lung cells. In addition, we observed an uneven subcellular distribution of mitochondria (Figure 1A and B). For instance, mitochondria were concentrated in areas adjacent to the trans-Golgi network (TGN38⁺) in alveolar epithelial cells (especially AT1 cells) where proteins were sorted to reach their destinations through vesicles and in areas that surrounded SMA in myofibroblasts (Figure 1A and B). This finding suggests that localized mitochondrial distribution is required for cellular function in mammalian lungs.

Figure 1

Download asset Open asset

Mitochondria display subcellular concentration in alveolar epithelial cells and mesenchymal myofibroblasts of mouse lungs.

(A) Immunostaining of lung sections collected from *Sox9^Cre/+; ROSA26^mTmG/+* mice at 18.5 *days post coitus* (*dpc*) and different postnatal (P) stages as indicated. The GFP signal identified alveolar epithelial cells (alveolar type I [AT1] and alveolar type II [AT2] cells) while myofibroblasts were characterized by smooth muscle actin (SMA) expression. Moreover, mitochondria were labeled by MPC1; the trans-Golgi network was visualized by TGN38. Enhanced MPC1 signal was distributed nonuniformly in both alveolar epithelial cells and myofibroblasts. (B) Transmission electron micrographs of lungs collected from wild-type mice at P3. Prominent features in a given lung cell type include lamellar bodies in AT2 cells, elongated cell membrane in AT1 cells, and actin bundles and collagen fibers in myofibroblasts. RBC, red blood cell.

Compromised mitochondrial activity in the postnatal murine lung leads to defective alveologenesis

We first tested if mitochondrial activity is required for alveologenesis by inactivating Tfam (transcription factor A, mitochondria), which encodes a master regulator of mitochondrial transcription (Bouda et al., 2019), in the mouse lung after birth. We produced CAGG^CreER/+; ROSA26^mTmG/+ (control), and Tfam^f/f; CAGG^CreER/+; ROSA26^mTmG/+ mice. Tamoxifen was administered to neonatal mice to activate CreER and lungs were collected at postnatal (P) day 10 (Figure 2A). CreER expression under the CAGG promoter/enhancer (Hayashi and McMahon, 2002) was ubiquitous in lung cells, including NKX2.1⁺ epithelial cells and PDGFRA⁺ fibroblasts/myofibroblasts, and converted a floxed allele of Tfam (Tfam^f) (Hamanaka et al., 2013) into a null allele (Figure 2B). We noticed that multiple regions in the lungs of mutant mice displayed alveolar defects concomitant with an increased mean linear intercept (MLI), a measure of air space size (Campbell and Tomkeieff, 1952; Escolar et al., 1994; Figure 2C and D). Alveolar defects were associated with disorganized SMA (Figure 2E). We anticipated that Tfam removal led to shutdown of mitochondrial transcription and reduction of mitochondrial activity. Indeed, the relative ratio of mitochondrial DNA (mtDNA) (Venegas and Halberg, 2012), 16S rRNA, and mitochondrially encoded NADH dehydrogenase 1 (mtND1), to nuclear DNA (nDNA), hexokinase 2 (Hk2), was reduced in Tfam-deficient lungs compared to controls (Figure 2F). Loss of Tfam was accompanied by diminished immunoreactivity of MTCO1, the expression of which is controlled by Tfam (Figure 2G). Together, these results indicate that mitochondrial activity is required for alveolar formation.

Figure 2

Download asset Open asset

Global inactivation of *Tfam* in postnatal mice results in alveolar defects.

(A) Schematic diagram of the time course of postnatal (P) administration of tamoxifen and harvest of mouse lungs. (B) Immunostaining of lungs collected from *CAGG^CreER/+; ROSA26^mTmG/+* (control) and *Tfam^f/f; CAGG^CreER/+; ROSA26^mTmG/+* mice at P10 that had received tamoxifen at P0. The GFP signal represents sites of induced CreER activity. Nuclear NKX2.1 staining marked all lung epithelial cells while PDGFRA immunoreactivity labeled mesenchymal fibroblasts/myofibroblasts. (C) Hematoxylin and eosin-stained lung sections of control and *Tfam^f/f; CAGG^CreER/+; ROSA26^mTmG/+* mice at P10. Histological analysis revealed the presence of enlarged saccules and retarded development of secondary septa in the mutant lungs. (D) Measurement of the mean linear intercept (MLI) in control and *Tfam^f/f; CAGG^CreER/+; ROSA26^mTmG/+* lungs at P10 (n = 4 for each group). The MLI was increased in *Tfam*-deficient lungs. (E) Immunostaining of lung sections collected from control and *Tfam^f/f; CAGG^CreER/+; ROSA26^mTmG/+* mice at P10. Smooth muscle actin (SMA) expression was characteristic of myofibroblasts and phalloidin stained the actin filaments. (F) Quantification of the relative ratio of mitochondrial DNA (mtDNA), 16S rRNA, and mitochondrially encoded NADH dehydrogenase 1 (mtND1), to nDNA (nuclear DNA), hexokinase (Hk2), in lysates derived from control and *Tfam^f/f; CAGG^CreER/+; ROSA26^mTmG/+* lungs (n = 4 for each group). (G) Immunostaining of lung sections collected from control and *Tfam^f/f; CAGG^CreER/+; ROSA26^mTmG/+* mice at P10. MPC1 antibodies marked mitochondria; MTCO1 antibodies detected cytochrome c oxidase, the expression of which was controlled by *Tfam*. All values are mean ± SEM. *p<0.05; **p<0.01 (unpaired Student’s t-test).

Figure 2—source data 1 Mean linear intercept and relative mitochondrial DNA (mtDNA)/nuclear DNA (nDNA) ratio.: https://cdn.elifesciences.org/articles/68598/elife-68598-fig2-data1-v2.xlsx
Download elife-68598-fig2-data1-v2.xlsx

Selective reduction of mitochondrial activity in the lung epithelium disrupts alveologenesis

To investigate the function of mitochondrial activity in distinct compartments, we selectively reduce mitochondrial activity in either the lung epithelium or mesenchyme. We produced control and Tfam^f/f; Sox9^Cre/+ mice to establish a platform for mechanistic studies on mitochondrial activity in lung epithelial cells during alveolar formation. The Sox9^Cre mouse line (Akiyama et al., 2005) is highly efficient in removing sequences flanked by loxP sites in the distal lung epithelium. Sox9-Cre is active at or later than 11.5 days post coitus (dpc) and converted Tfam^f into a null allele and compromised mitochondrial activity (Figure 3—figure supplement 1A). Tfam^f/f; Sox9^Cre/+ mice were born at the expected Mendelian frequency and could not be distinguished from their wild-type littermates by their outer appearance at birth. Moreover, histological analysis revealed no difference between control and mutant lungs prior to P5, confirming that branching morphogenesis and saccule formation were unaffected by inactivating Tfam in SOX9⁺ cells (Figure 3—figure supplement 2A). In addition, differentiation of alveolar type I and type II cells proceeded normally in Tfam^f/f; Sox9^Cre/+ lungs (Figure 3—figure supplement 2B). These results highlight a difference in dependence on mitochondrial activity in distinct cellular processes during development. To uncover the cellular processes that are highly dependent on mitochondrial activity, we investigated alveolar formation in control and Tfam^f/f; Sox9^Cre/+ lungs.

After P5, Tfam^f/f; Sox9^Cre/+ mice could be discerned by their slightly reduced body size in comparison with the littermate controls. Histological analysis of Tfam^f/f; Sox9^Cre/+ lungs at various postnatal stages revealed defects in secondary septa formation with an increased MLI (Figure 3A and B) and reduced primary septal thickness (Figure 3C). In this setting, primary septal thickness (P2–P7) appears to be an earlier and more sensitive indicator than MLI in detecting defects in secondary septation. No apparent difference in cell death was noted between control and Tfam^f/f; Sox9^Cre/+ lungs (Figure 3—figure supplement 3A), suggesting that mitochondria-mediated apoptosis was not activated. Moreover, lysates from Tfam^f/f; Sox9^Cre/+ lungs displayed a reduction in mtDNA/nDNA ratio (Figure 3D), mitochondrial complex I activity (Figure 3E) and ATP production (Figure 3F). By contrast, loss of epithelial Tfam did not affect the major regulators of mitochondrial fusion and fission such as OPA1 processing and DRP1 phosphorylation (Chan, 2020; Figure 3—figure supplement 4). Together, these findings are consistent with reduced mitochondrial activity in Tfam^f/f; Sox9^Cre/+ lungs and reveal a critical role of mitochondrial activity in lung epithelial cells during alveologenesis. We noted that removal of Tfam in T cells by Foxp3-Cre (Rubtsov et al., 2008) or Cd4-Cre (Lee et al., 2001) and in macrophages by activated Cx3cr1-CreER (Yona et al., 2013) did not exhibit alveolar defects (Figure 3—figure supplement 5; Fu et al., 2019; Gao et al., 2022). Histological analysis revealed no difference between control and Tfam^f/f; Foxp3^Cre/+ and Tfam^f/f; Cd4^Cre/+ lungs, and between control and Tfam^f/f; Cx3cr1^CreER/+ lungs that had received tamoxifen (Figure 3—figure supplement 5). This suggests that structural components of the secondary septa are more susceptible to reduced mitochondrial function.

Figure 3 with 5 supplements see all

Download asset Open asset

Elimination of *Tfam* or *Rhot1* in the epithelium of mouse lungs disrupts alveolar formation.

(A) Hematoxylin and eosin-stained lung sections of control and *Tfam^f/f; Sox9^Cre/+* mice at different postnatal (P) stages as indicated. Histological analysis revealed the presence of enlarged saccules and failure in secondary septation in the mutant lungs. (B) Measurement of the mean linear intercept (MLI) in control and *Tfam^f/f; Sox9^Cre/+* lungs at P3–P10 (n = 3 for each group). The MLI was increased in *Tfam*-deficient lungs. (C) Measurement of the primary septal thickness in control and *Tfam^f/f; Sox9^Cre/+* lungs at P3–P7 (n = 3 for each group). (D) Quantification of the relative ratio of mitochondrial DNA (mtDNA), 16S rRNA, and mitochondrially encoded NADH dehydrogenase 1 (mtND1), to nuclear DNA (nDNA), hexokinase 2 (Hk2), in lysates derived from control and *Tfam^f/f; Sox9^Cre/+* lungs at P5 (n = 5 for each group). (E) Quantification of the relative enzymatic activity of mitochondrial complex I and complex IV in control and *Tfam^f/f; Sox9^Cre/+* lungs at P5 (n = 5 for each group). (F) Measurement of relative ATP production in control and *Tfam^f/f; Sox9^Cre/+* lungs at P5 (n = 5 for each group). (G) Hematoxylin and eosin-stained lung sections of control and *Rhot1^f/f; Sox9^Cre/+* mice at different postnatal stages as indicated. Histological analysis detected enlarged saccules and lack of secondary septa in the mutant lungs. (H) Measurement of the MLI in control and *Rhot1^f/f; Sox9^Cre/+* lungs at P3–P10 (n = 3 for each group). The MLI was increased in *Rhot1*-deficient lungs. (I) Measurement of the primary septal thickness in control and *Rhot1^f/f; Sox9^Cre/+* lungs at P5–P7 (n = 3 for each group). (J) Quantification of the relative ratio of mtDNA, 16S rRNA, and mtND1, to nDNA, Hk2, in lysates derived from control and *Rhot1^f/f; Sox9^Cre/+* lungs at P5 (n = 5 for each group). (K) Quantification of the relative enzymatic activity of mitochondrial complex I and complex IV in control and *Rhot1^f/f; Sox9^Cre/+* lungs at P5 (n = 5 for each group). (L) Measurement of relative ATP production in control and *Rhot1^f/f; Sox9^Cre/+* lungs at P5 (n = 5 for each group). All values are mean ± SEM. **p<0.01; ***p<0.001; ns, not significant (unpaired Student’s t-test).

Figure 3—source data 1 Mean linear intercept, primary septal thickness, relative mitochondrial DNA (mtDNA)/nuclear DNA (nDNA) ratio, relative enzymatic activity, and relative ATP production.: https://cdn.elifesciences.org/articles/68598/elife-68598-fig3-data1-v2.xlsx
Download elife-68598-fig3-data1-v2.xlsx

Disruption of mitochondrial distribution in the lung epithelium disturbs alveologenesis

As described above, mitochondria display dynamic distribution in lung cells, raising the possibility that proper subcellular distribution of mitochondria is vital for cellular function during alveolar formation. To test this hypothesis, we generated control and Rhot1^f/f; Sox9^Cre/+ mice. Sox9^Cre converted a floxed allele of Rhot1 (Rhot1^f) (Nguyen et al., 2014) to a null allele in SOX9⁺ alveolar epithelial cells. Loss of Rhot1 is expected to perturb normal subcellular distribution of mitochondria. Rhot1^f/f; Sox9^Cre/+ mice were born at the expected Mendelian frequency and cannot be distinguished from their wild-type littermates by their outer appearance or activity at birth. Similarly, no difference between control and mutant lungs prior to P5 was detected by histological analysis (Figure 3—figure supplement 2C and D). After P5, Rhot1^f/f; Sox9^Cre/+ mice displayed defects in secondary septation (Figure 3G) with an increased MLI (Figure 3H) and reduced primary septal thickness (Figure 3I). Loss of epithelial Rhot1 did not induce cell death (Figure 3—figure supplement 3B). The alveolar phenotypes could first appear anywhere between P5 and P12 (Figure 3G–I). As expected, mitochondrial activity was unperturbed by disrupting epithelial Rhot1. No changes in mtDNA/nDNA ratio, mitochondrial complex I activity, or ATP production were observed in lysates from Rhot1^f/f; Sox9^Cre/+ lungs (Figure 3J–L). These results support the notion that localized mitochondrial distribution plays a functional role in alveolar formation. We noticed that the alveolar defects in Rhot1^f/f; Sox9^Cre/+ lungs were less severe than those in Tfam^f/f; Sox9^Cre/+ lungs. This is likely due to the fact that only the distribution and not the activity of mitochondria was perturbed in Rhot1^f/f; Sox9^Cre/+ lungs.

PDGF signal reception is perturbed and the number of mesenchymal myofibroblasts is reduced in the absence of proper mitochondrial activity or distribution in the lung epithelium

We examined various lung cell types in Tfam^f/f; Sox9^Cre/+ lungs to explore the molecular basis of their alveolar phenotypes. Interestingly, the number of fibroblasts/myofibroblasts marked by PDGFRA was reduced in the absence of epithelial Tfam (Figure 4A and D). Likewise, we found that the number of fibroblasts/myofibroblasts was reduced in Rhot1^f/f; Sox9^Cre/+ lungs where epithelial Rhot1 was lost (Figure 4G and I). A diminished population of fibroblasts/myofibroblasts in Tfam^f/f; Sox9^Cre/+ and Rhot1^f/f; Sox9^Cre/+ lungs prompted us to investigate whether PDGF signaling was disrupted.

Figure 4 with 1 supplement see all

Download asset Open asset

Loss of epithelial *Tfam* or *Rhot1* compromises PDGF release.

(A) Immunostaining of lungs collected from control and *Tfam^f/f; Sox9^Cre/+* mice at postnatal (P) day 5 or 10, some of which were injected with EdU as indicated. (B) Immunostaining of lungs collected from control and *Tfam^f/f; Sox9^Cre/+* mice at P5. (C) LacZ staining (blue) of lung sections collected from *Sox9^Cre/+; Pdgfa^ex4COIN/+* (control) and *Tfam^f/f; Sox9^Cre/+; Pdgfa^ex4COIN/+* mice. The slides were counterstained with eosin (red). No difference in the intensity of LacZ staining in the lung was noted between these two mouse lines. (D) Quantification of fibroblast/myofibroblast proliferation in control and *Tfam^f/f; Sox9^Cre/+* lungs at P5, P7, and P10 (n = 3 for each group). The rate of fibroblast/myofibroblast proliferation was calculated as the ratio of the number of EdU⁺ fibroblasts/myofibroblasts (EdU⁺ PDGFRA⁺) to the number of fibroblasts/myofibroblasts (PDGFRA⁺). The percentage of proliferating fibroblasts/myofibroblasts was reduced in *Tfam^f/f; Sox9^Cre/+* compared to controls at P7 and P10. (E) qPCR analysis of gene expression in control and *Tfam^f/f; Sox9^Cre/+* lungs at P5 (n = 3 for each group). While no difference in expression levels was noted for *Pdgfa* and *Pdgfra* between control and *Tfam^f/f; Sox9^Cre/+* lungs, the expression levels of *Acta2* (smooth muscle actin [SMA]) and *Eln* (elastin) were significantly reduced in the absence of *Tfam*. (F) Western blot analysis of cell lysates and supernatants from control and *Tfam*-deficient cells (n = 4 for each group) lentivirally transduced with PDGFA-expressing constructs. The amount of PDGFA released into the media was reduced in *Tfam*-deficient cells compared to controls. α-Tubulin served as a loading control. (G) Immunostaining of lungs collected from control and *Rhot1^f/f; Sox9^Cre/+* mice at P5, P7, or P10, some of which were injected with EdU as indicated. (H) Immunostaining of lungs collected from control and *Rhot1^f/f; Sox9^Cre/+* mice at P5. (I) Quantification of fibroblast/myofibroblast proliferation in control and *Rhot1^f/f; Sox9^Cre/+* lungs at P7 and P10 (n = 3 for each group). The percentage of proliferating fibroblasts/myofibroblasts was reduced in *Rhot1^f/f; Sox9^Cre/+* compared to controls at P7 and P10. (J) qPCR analysis of gene expression in control and *Rhot1^f/f; Sox9^Cre/+* lungs at P5 (n = 3 for each group). The expression levels of *Pdgfa* and *Pdgfra* were unaltered between control and *Rhot1^f/f; Sox9^Cre/+* lungs; the expression levels of *Acta2* and *Eln* were significantly reduced in the absence of *Rhot1*. (K) Western blot analysis of cell lysates and supernatants from control and *Rhot1*-deficient cells (n = 4 for each group) lentivirally transduced with PDGFA-expressing constructs. The amount of PDGFA released into the media was reduced in *Rhot1*-deficient cells compared to controls. α-Tubulin served as a loading control. All values are mean ± SEM. *p<0.05; ns, not significant (unpaired Student’s t-test).

Figure 4—source data 1 EdU quantification, relative transcript levels, and quantification of PDGFA secretion.: https://cdn.elifesciences.org/articles/68598/elife-68598-fig4-data1-v2.xlsx
Download elife-68598-fig4-data1-v2.xlsx

Phosphorylation of PDGFRA (p-PDGFRA), indicative of PDGF signaling, was reduced in Tfam^f/f; Sox9^Cre/+ or Rhot1^f/f; Sox9^Cre/+ lungs (Figure 4A and G). This observation suggests that PDGF signal reception by fibroblasts/myofibroblasts was impaired in Tfam^f/f; Sox9^Cre/+ or Rhot1^f/f; Sox9^Cre/+ lungs. Defective PDGF signal reception in fibroblasts/myofibroblasts could be due to lack of PDGF production, trafficking, or release.

We found that production of the PDGF ligand (PDGFA) in alveolar epithelial cells was unaffected in Tfam^f/f; Sox9^Cre/+ or Rhot1^f/f; Sox9^Cre/+ lungs by qPCR analysis (Figure 4E and J). To substantiate this model, we utilized a PDGF reporter mouse line (Pdgfa^ex4COIN) (Andrae et al., 2014) that faithfully recapitulates the spatial and temporal expression of Pdgfa. Of note, no reliable PDGF antibody is available to detect PDGF in lungs or other tissues (Gouveia et al., 2017; Andrae et al., 2014). We generated Pdgfa^ex4COIN/+; Sox9^Cre/+ (control) and Tfam^f/f; Pdgfa^ex4COIN/+; Sox9^Cre/+ mice. Cre recombinase activated β-galactosidase (lacZ) expression in Pdgfa-expressing cells from the Pdgfa^ex4COIN allele. We found that LacZ expression in Pdgfa-expressing cells (i.e., alveolar epithelial cells) displayed a similar pattern and intensity between control and Tfam-deficient lungs (Figure 4C, Figure 4—figure supplement 1A). Together, these results pointed to disrupted PDGF trafficking or release. This defect would subsequently disturb signal reception in mesenchymal fibroblasts/myofibroblasts of Tfam^f/f; Sox9^Cre/+ and Rhot1^f/f; Sox9^Cre/+ lungs.

PDGF secretion from lung cells is diminished without proper mitochondrial activity or distribution

Our model posits that secretion of PDGF ligand from Tfam- and Rhot1-deficient alveolar epithelial cells is compromised. To test this idea, we derived Tfam- and Rhot1-deficient cells from Tfam^f/f; Pdgfra^Cre/+ and Rhot1^f/f; Pdgfra^Cre/+ lungs (see below), respectively. We transduced control and Tfam- and Rhot1-deficient cells with lentiviruses that produced epitope-tagged PDGF (Figure 4—figure supplement 1B). Using this assay, we determined the amount of PDGF released from control and Tfam- and Rhot1-deficient cells (Figure 4F and K). PDGF levels in the conditioned media derived from Tfam- or Rhot1-deficient cells were reduced compared to controls (Figure 4F and K). These findings support a model in which loss of mitochondrial activity or distribution results in a failure of vesicular transport and PDGF release from alveolar epithelial cells. We surmise that these defects are in part due to an incapacitated actomyosin cytoskeleton caused by reduced mitochondrial function.

Selective reduction of mitochondrial activity or distribution in fibroblasts/myofibroblasts compromises alveologenesis

We then investigated the functional requirement of mitochondria in the lung mesenchyme. To this end, we produced control and Tfam^f/f; Pdgfra^Cre/+ (Roesch et al., 2008) mice for Tfam inactivation in lung fibroblasts/myofibroblasts. It was reported that ~95% of lineaged cells (PDGFRA⁺) are myofibroblasts (Li et al., 2018). Nevertheless, we have adopted PDGFRA⁺ fibroblasts/myofibroblasts throughout this study for accuracy. Cre expression in PDGFRA⁺ fibroblasts/myofibroblasts eliminated Tfam and reduced mitochondrial activity. Indeed, the expression of MTCO1, a transcriptional target of Tfam, was decreased in lung fibroblasts/myofibroblasts derived from Tfam^f/f; Pdgfra^Cre/+ mice (Figure 3—figure supplement 1B). Prior to P3, Tfam^f/f; Pdgfra^Cre/+ mice could not be distinguished from their wild-type littermates by appearance, activity, and morphological and immunohistochemical analysis (Figure 5—figure supplement 1A and B). This suggests that loss of Tfam in the lung mesenchyme did not affect branching morphogenesis or saccule formation (Metzger et al., 2008). This permitted us to assess the contribution of mesenchymal mitochondria to alveolar formation. Histological analysis of Tfam^f/f; Pdgfra^Cre/+ lungs at various postnatal stages prior to P5 revealed defective secondary septa formation with an increased MLI (Figure 5A and B) and reduced primary septal thickness (Figure 5C). Loss of mesenchymal Tfam did not induce cell death (Figure 5—figure supplement 2A). Moreover, lysates from Tfam^f/f; Pdgfra^Cre/+ lungs displayed a reduction in mtDNA/nDNA ratio (Figure 5D), mitochondrial complex I/IV activity (Figure 5E), and ATP production (Figure 5F). All of them are consistent with reduced mitochondrial activity in Tfam^f/f; Pdgfra^Cre/+ lungs. Most Tfam^f/f; Pdgfra^Cre/+ mice died before P30.

Figure 5 with 3 supplements see all

Download asset Open asset

Elimination of *Tfam* or *Rhot1* in mouse lung fibroblasts/myofibroblasts impairs alveolar formation.

(A) Hematoxylin and eosin-stained lung sections of control and *Tfam^f/f; Pdgfra^Cre/+* mice at different postnatal (P) stages as indicated. Histological analysis revealed the presence of enlarged saccules and defective development of secondary septa in the mutant lungs. (B) Measurement of the mean linear intercept (MLI) in control and *Tfam^f/f; Pdgfra^Cre/+* lungs at P0–P5 (n = 3 for each group). The MLI was increased in *Tfam*-deficient lungs. (C) Measurement of the primary septal thickness in control and *Tfam^f/f; Pdgfra^Cre/+* lungs at P2–P3 (n = 3 for each group). (D) Quantification of the relative ratio of mitochondrial DNA (mtDNA), 16S rRNA, and mitochondrially encoded NADH dehydrogenase 1 (mtND1), to nuclear DNA (nDNA), hexokinase 2 (Hk2), in lysates derived from control and *Tfam^f/f; Pdgfra^Cre/+* lungs at P5 (n = 5 for each group). (E) Quantification of the relative enzymatic activity of mitochondrial complex I and complex IV in control and *Tfam^f/f; Pdgfra^Cre/+* lungs at P5 (n = 5 for each group). (F) Measurement of relative ATP production in control and *Tfam^f/f; Pdgfra^Cre/+* lungs at P5 (n = 5 for each group). (G) Hematoxylin and eosin-stained lung sections of control and *Rhot1^f/f; Pdgfra^Cre/+* mice at different postnatal stages as indicated. Histological analysis detected enlarged saccules and lack of secondary septa in the mutant lungs. (H) Measurement of the MLI in control and *Rhot1^f/f; Pdgfra^Cre/+* lungs at P3–P10 (n = 3 for each group). The MLI was increased in *Rhot1*-deficient lungs. (I) Measurement of the primary septal thickness in control and *Rhot1^f/f; Pdgfra^Cre/+* lungs at P5–P7 (n = 3 for each group). (J) Quantification of the relative ratio of mtDNA, 16S rRNA, and mtND1, to nDNA, Hk2, in lysates derived from control and *Rhot1^f/f; Pdgfra^Cre/+* lungs at P5 (n = 5 for each group). (K) Quantification of the relative enzymatic activity of mitochondrial complex I and complex IV in control and *Rhot1^f/f; Pdgfra^Cre/+* lungs at P5 (n = 5 for each group). (L) Measurement of relative ATP production in control and *Rhot1^f/f; Pdgfra^Cre/+* lungs at P5 (n = 5 for each group). All values are mean ± SEM. *p<0.05; **p<0.01; ns, not significant (unpaired Student’s t-test).

Figure 5—source data 1 Mean linear intercept, primary septal thickness, relative mitochondrial DNA (mtDNA)/nuclear DNA (nDNA) ratio, relative enzymatic activity, and relative ATP production.: https://cdn.elifesciences.org/articles/68598/elife-68598-fig5-data1-v2.xlsx
Download elife-68598-fig5-data1-v2.xlsx

We also generated control and Tfam^f/f; Twist2 (Dermo1)^Cre/+ mice, in which Tfam was eliminated by mesenchymal Twist2-Cre (Yu et al., 2003). Tfam^f/f; Twist2^Cre/+ mice exhibited alveolar defects (Figure 5—figure supplement 3A and B) similar to those in Tfam^f/f; Pdgfra^Cre/+ mice, further supporting a central role of mitochondrial activity in the lung mesenchyme during alveologenesis.

Of note, we bred Lrpprc^f/f; Pdgfra^Cre/+ mice as an alternative means to disrupt mitochondrial activity. Lrpprc (Leucine-rich PPR motif-containing) (Ruzzenente et al., 2012) is required for mitochondrial translation. Similarly, Pdgfra^Cre converted a floxed allele of Lrpprc (Lrpprc^f) into a null allele. Lrpprc affects different aspects of mitochondrial activity and serves the purpose of confirming our findings using Tfam. We found that Lrpprc^f/f; Pdgfra^Cre/+ mice developed alveolar defects (Figure 5—figure supplement 3C and D), albeit the phenotypes were less severe than those in Tfam^f/f; Pdgfra^Cre/+ mice. This was likely due to the presence of residual proteins after removal of Lrpprc. Together, these studies establish a crucial role of mitochondrial activity in fibroblasts/myofibroblasts for alveologenesis.

We went on to determine whether proper subcellular distribution of mitochondria in fibroblasts/myofibroblasts is necessary for their function during alveolar formation. We generated control and Rhot1^f/f; Pdgfra^Cre/+ mice (Figure 5—figure supplement 1C and D). In this case, the subcellular distribution of mitochondria is expected to be perturbed in mesenchymal fibroblasts/myofibroblasts as indicated by loss of proper MTCO1 distribution in fibroblasts/myofibroblasts derived from lungs of Rhot1^f/f; Pdgfra^Cre/+ mice (Figure 3—figure supplement 1C). Rhot1^f/f; Pdgfra^Cre/+ mice exhibited alveolar defects (Figure 5G–I, Figure 5—figure supplement 2B), milder than those in Tfam^f/f; Pdgfra^Cre/+ lungs. Mitochondrial activity was unperturbed by disrupting mesenchymal Rhot1 (Figure 5J–L).

We discovered that fibroblast/myofibroblast proliferation was reduced in Tfam^f/f; Pdgfra^Cre/+ or Rhot1^f/f; Pdgfra^Cre/+ lungs compared to controls (Figure 6A, B, E and F), suggesting defective PDGF signal reception. This may be related to a failure in PDGFR trafficking when mitochondrial function is impaired. As a result, the pool of PDGFRA⁺ myofibroblasts was decreased with a concomitant reduction in SMA (encoded by Acta2) and/or elastin (Figure 6C and G), contributing to alveolar defects. In summary, these findings suggest that proper activity and distribution of mitochondria in alveolar fibroblasts/myofibroblasts are critical to generating a sufficient number of fibroblasts/myofibroblasts for secondary septation.

Figure 6 with 2 supplements see all

Download asset Open asset

Loss of mesenchymal *Tfam* or *Rhot1* compromises fibroblast/myofibroblast migration.

(A) Immunostaining of lungs collected from control and *Tfam^f/f; Pdgfra^Cre/+* mice at postnatal (P) day 2 and 5, some of which were injected with EdU as indicated. (B) Quantification of fibroblast/myofibroblast proliferation in control and *Tfam^f/f; Pdgfra^Cre/+* lungs at P2, P3, and P5 (n = 3 for each group). The rate of fibroblast/myofibroblast proliferation was calculated as the ratio of the number of EdU⁺ fibroblasts/myofibroblasts (EdU⁺ PDGFRA⁺) to the number of fibroblast/myofibroblasts (PDGFRA⁺). The percentage of proliferating fibroblasts/myofibroblasts was reduced in *Tfam^f/f; Pdgfra^Cre/+* compared to controls at P3 and P5. (C) qPCR analysis of gene expression in control and *Tfam^f/f; Pdgfra^Cre/+* lungs at P3 (n = 3 for each group). The expression levels of *Pdgfra*, *Acta2,* and *Eln* were significantly reduced in *Tfam^f/f; Pdgfra^Cre/+* lungs compared to controls. (D) Wound recovery assays to assess the migratory ability of fibroblasts/myofibroblasts derived from control and *Tfam^f/f; Pdgfra^Cre/+* lungs (n = 3 for each group). Within 36–48 hr, the wound area has been populated by migrating fibroblasts/myofibroblasts derived from control lungs. By contrast, fewer fibroblasts/myofibroblasts from *Tfam^f/f; Pdgfra^Cre/+* lungs reached the wound area within the same time frame. Wound recovery by fibroblasts/myofibroblasts from control and *Tfam^f/f; Pdgfra^Cre/+* lungs was quantified. (E) Immunostaining of lungs collected from control and *Rhot1^f/f; Pdgfra^Cre/+* mice at P5 and P10, some of which were injected with EdU as indicated. (F) Quantification of fibroblasts/myofibroblasts proliferation in control and *Rhot1^f/f; Pdgfra^Cre/+* lungs at P5 and P10 (n = 3 for each group). The percentage of proliferating fibroblasts/myofibroblasts was decreased in *Rhot1^f/f; Pdgfra^Cre/+* compared to controls at P10. (G) qPCR analysis of gene expression in control and *Rhot1^f/f; Pdgfra^Cre/+* lungs at P7 (n = 3 for each group). The expression levels of *Eln* were significantly reduced in *Rhot1^f/f; Pdgfra^Cre/+* lungs in comparison with controls. (H) Wound recovery assays to assess the migratory ability of fibroblasts/myofibroblasts derived from control and *Rhot1^f/f; Pdgfra^Cre/+* lungs (n = 3 for each group). Fewer fibroblasts/myofibroblasts from *Rhot1^f/f; Pdgfra^Cre/+* lungs reached the wound area within the same time frame compared to controls. Wound recovery by fibroblasts/myofibroblasts from control and *Rhot1^f/f; Pdgfra^Cre/+* lungs was quantified. All values are mean ± SEM. *p<0.05; ns, not significant (unpaired Student’s t-test).

Figure 6—source data 1 EdU quantification, relative transcript levels, and quantification of wound recovery.: https://cdn.elifesciences.org/articles/68598/elife-68598-fig6-data1-v2.xlsx
Download elife-68598-fig6-data1-v2.xlsx

Contraction/migration of fibroblasts/myofibroblasts is reduced without proper mitochondrial activity or distribution, which is associated with a disrupted cytoskeleton

We speculate that myofibroblasts deficient in Tfam are defective in their ability to migrate to the prospective site of secondary septation. To test this idea, we isolated fibroblasts/myofibroblasts from control and Tfam^f/f; Pdgfra^Cre/+ lungs. Tfam-deficient fibroblasts/myofibroblasts displayed short tubular and fragmented mitochondria (Figure 6—figure supplement 1A and B). Fibroblasts/myofibroblasts were seeded onto the migration chamber for wound healing assays (Zhang et al., 2020), in which the rate of fibroblasts/myofibroblasts migration into the cell-free area was measured. While control fibroblasts/myofibroblasts occupied the cell-free area after 36–48 hr, only scant Tfam-deficient fibroblasts/myofibroblasts were detected in the cell-free area (Figure 6D). Introduction of TFAM into Tfam-deficient fibroblasts/myofibroblasts rescued their migratory defects (Figure 6—figure supplement 2A, B, and E). This result indicates that mobility of fibroblasts/myofibroblasts was compromised due to loss of mitochondrial activity in these cells. We conjecture that the migration defect was in part due to an incapacitated actomyosin cytoskeleton without mitochondrial activity. Consistent with this idea, organization of the cytoskeleton (labeled by phalloidin) was perturbed in Tfam^f/f; Pdgfra^Cre/+ lungs in comparison with controls (Figure 6A).

Similarly, fibroblasts/myofibroblasts derived from Rhot1^f/f; Pdgfra^Cre/+ lungs displayed a compromised response in wound healing assays compared to controls (Figure 6H, Figure 6—figure supplement 1C and D), which was restored by RHOT1 expression (Figure 6—figure supplement 2C–E). To sum up, these results affirm the role of mitochondrial activity and distribution in regulating fibroblasts/myofibroblasts contraction and/or migration during alveologenesis.

mTOR complex 1 regulates mitochondrial function and alveologenesis

We have discovered an essential role of mitochondria in controlling alveolar formation. To dissect the signaling cascade that regulates mitochondrial function during alveologenesis, we first investigated mTOR complex 1 (mTORC1), a known regulator of mitochondrial activity and biogenesis. We generated control, Rptor^f/f; Sox9^Cre/+ and Rptor^f/f; Pdgfra^Cre/+ mice. Rptor (Raptor, rapamycin-sensitive regulatory associated protein of mTOR) (Sengupta et al., 2010) encodes an essential component of mTORC1, which includes RPTOR, mTOR, and several other proteins. Rptor^f/f; Sox9^Cre/+ and Rptor^f/f; Pdgfra^Cre/+ mice failed to survive to term, precluding the analysis of potential alveolar phenotypes.

To circumvent this problem, we produced control and Rptor^f/f; CAGG^CreER/+ mice and administered tamoxifen postnatally (Figure 7A). Analysis of Rptor^f/f; CAGG^CreER/+ mice at P10 revealed alveolar defects with an increased MLI (Figure 7B and C). Defective secondary septation in Rptor^f/f; CAGG^CreER/+ lungs was associated with reduced SMA (Figure 7D). As expected, the protein levels of phosphorylated ribosomal protein S6 (p-RPS6), a downstream target of mTORC1, were decreased in lysates from Rptor-deficient lungs compared to controls (Figure 7E, Figure 7—figure supplement 1). The relative ratio of mtDNA to nDNA was reduced in Rptor-deficient lungs (Figure 7F). Moreover, immunoreactivity of both MPC1 and MTCO1 was diminished in Rptor^f/f; CAGG^CreER/+ lungs compared to controls (Figure 7G). These findings show that elimination of Rptor in the lung resulted in loss of mitochondria. Impaired mitochondrial function then contributed to alveolar defects. Collectively, our results suggest that mTORC1 controls alveolar formation partly through its effects on mitochondrial function.

Figure 7 with 1 supplement see all

Download asset Open asset

Postnatal inactivation of *Rptor* in mice results in alveolar defects.

(A) Schematic diagram of the time course of postnatal (P) administration of tamoxifen and harvest of mouse lungs. (B) Hematoxylin and eosin-stained lung sections of control and *Rptor^f/f; CAGG^CreER/+* mice at P10. Histological analysis revealed the presence of enlarged saccules and retarded development of secondary septa in the mutant lungs. (C) Measurement of the mean linear intercept (MLI) in control and *Rptor^f/f; CAGG^CreER/+* lungs at P10 (n = 5 for each group). The MLI was increased in *Rptor*-deficient lungs. (D) Immunostaining of lung sections collected from control and *Rptor^f/f; CAGG^CreER/+; ROSA26^mTmG/+* mice at P10. Smooth muscle actin (SMA) expression was characteristic of myofibroblasts and phalloidin stained the actin filaments. (E). Quantification of the protein levels of RPS6 and phosphorylated RPS6 (p-RPS6) in lung lysates derived from control and *Rptor^f/f; CAGG^CreER/+; ROSA26^mTmG/+* lungs (n = 5 for each group). (F) Quantification of the relative ratio of mitochondrial DNA (mtDNA), 16S rRNA, and mitochondrially encoded NADH dehydrogenase 1 (mtND1), to nuclear DNA (nDNA), hexokinase 2 (Hk2), in lysates derived from control and *Rptor^f/f; CAGG^CreER/+; ROSA26^mTmG/+* lungs (n = 5 for each group). (G) Immunostaining of lung sections collected from control and *Rptor^f/f; CAGG^CreER/+; ROSA26^mTmG/+* mice at P10. MPC1 antibodies marked mitochondria; MTCO1 antibodies detected cytochrome c oxidase, the expression of which was controlled by *Tfam*. All values are mean ± SEM. p<0.05; **p<0.01; ***p<0.001 (unpaired Student’s t-test).

Figure 7—source data 1 Mean linear intercept, relative protein levels, and relative mitochondrial DNA (mtDNA)/nuclear DNA (nDNA) ratio.: https://cdn.elifesciences.org/articles/68598/elife-68598-fig7-data1-v2.xlsx
Download elife-68598-fig7-data1-v2.xlsx

Mitochondrial copy number and TFAM protein levels are decreased in lungs from COPD/emphysema patients

To explore whether studies of mitochondrial function in alveolar formation in mice can shed new light on human diseases, we assessed the status of mitochondria in lung tissues of normal subjects and COPD/emphysema patients (Figure 8A, Figure 8—figure supplement 1). We found that the copy number of mitochondria (Venegas and Halberg, 2012) relative to nuclear DNA was significantly reduced in COPD/emphysema patients (Figure 8B). In addition, TFAM protein levels were reduced in lysates from emphysema lungs compared to normal lungs (Figure 8C). These results established a connection between mitochondrial function and pathogenesis of COPD/emphysema. Interestingly, a disorganized cytoskeleton was noted in COPD/emphysema lungs, in which actin bundles seen in normal alveoli were sparse (Figure 8D). We did not detect a difference in the protein levels of either RPS6 or p-RPS6 in lysates from emphysema and normal lungs (Figure 8E, Figure 8—figure supplement 2). However, we observed heterogeneous expression of p-RPS6 in emphysema lungs. Whether regional reduction of p-RPS6 is correlated with disease progression needs future studies.

Figure 8 with 3 supplements see all

Download asset Open asset

Lungs from emphysema patients exhibit a reduction in mitochondrial DNA and TFAM expression.

(A) Hematoxylin and eosin-stained lung sections of normal and emphysema patients. Disruption of alveoli in emphysema patients resulted in enlarged airspace with thin primary septa. (B) qPCR analysis of mitochondrial DNA (mtDNA) to nuclear DNA (nDNA) in lung lysates derived from normal and emphysema patients (n = 22 for each group). mtDNA-encoded tRNA^Leu and 16S rRNA and nDNA-encoded b2M (b2 microglobulin) were used in this study. The relative ratio of mtDNA to nDNA was calculated. (C) Quantification of TFAM protein levels in lung lysates derived from normal and emphysema patients (n = 21 for each group). (D) Immunostaining of lungs collected from control and emphysema patients. Phalloidin detected actin filaments. (E). Quantification of the protein levels of RPS6 and phosphorylated RPS6 (p-RPS6) in lung lysates derived from normal and emphysema patients (n = 21 for each group). (F) Western blot analysis of cell lysates and supernatants from human lung epithelial cells transduced with control constructs, constructs expressing shRNAs against human *TFAM* and constructs expressing mouse TFAM^FLAG (mTFAM^FLAG) as indicated. qPCR analysis revealed efficient knockdown of human *TFAM* transcripts. The amount of PDGFA released into the media was reduced in *TFAM*-knockdown cells compared to controls and was rescued by expression of mTFAM^FLAG (n = 3 for each group). α-Tubulin served as a loading control. (G) Western blot analysis of cell lysates from human lung fibroblasts transduced with control constructs, constructs expressing shRNAs against human *TFAM* and constructs expressing mouse TFAM^FLAG (mTFAM^FLAG) as indicated. qPCR analysis revealed efficient knockdown of human *TFAM* transcripts. Wound recovery assays using control, *TFAM*-knockdown fibroblasts, and *TFAM*-knockdown fibroblasts expressing mTFAM^FLAG were quantified. The migratory defect of fibroblasts was rescued by mTFAM^FLAG expression (n = 3 for each group). α-Tubulin served as a loading control. All values are mean ± SEM. *p<0.05; **p<0.01; ns, not significant (unpaired Student’s t-test).

Figure 8—source data 1 Relative mitochondrial DNA (mtDNA)/nuclear DNA (nDNA) ratio, protein levels, relative transcript levels, quantification of PDGFA secretion, and quantification of wound recovery.: https://cdn.elifesciences.org/articles/68598/elife-68598-fig8-data1-v2.xlsx
Download elife-68598-fig8-data1-v2.xlsx

To further explore the connection between mitochondrial function and cellular properties, we conducted gain- and loss-of-function studies on TFAM and RHOT1 in both human lung epithelial cells and human lung fibroblasts. TFAM or RHOT1 knockdown in human lung epithelial cells impaired PDGF secretion from epithelial cells (Figure 8F, Figure 8—figure supplement 3A). This defect was rescued by introduction of mouse TFAM or RHOT1 (Figure 8F, Figure 8—figure supplement 3A). In addition, TFAM or RHOT1 knockdown in human lung fibroblasts compromised cell migration of fibroblasts (Figure 8G, Figure 8—figure supplement 3B). Likewise, migration defects were restored upon expression of mouse TFAM or RHOT1 (Figure 8G, Figure 8—figure supplement 3B). Results from the experiments using human lung cells affirmed the observations obtained in mouse cells and mouse lungs. Taken together, these findings using human lungs and cells complement our mouse work and lay the foundation for further investigation into the disease mechanisms of COPD/emphysema.

Discussion

Our studies have provided new insight into how mitochondrial function controls alveolar formation. We discovered a major role of mitochondria in conferring requisite cellular properties to both alveolar epithelial cells and myofibroblasts during alveologenesis. These findings define the molecular basis of the functional requirement of mitochondria in distinct compartments and reveal the energy demand in a given process. They also add a new layer of complexity to the interactions between the major players of secondary septa. Moreover, our work establishes the foundation for investigating the interplay between mitochondria and signaling pathways in endowing cellular properties in alveologenesis during development and following injury. We expect that this framework will be applicable to other developmental systems (Figure 9).

Figure 9

Download asset Open asset

A model of regulating alveolar formation through mitochondrial activity and distribution.

The main players during alveolar formation are shown in the schematic diagram. Mitochondria display dynamic subcellular distribution in alveolar epithelial cells and mesenchymal fibroblasts/myofibroblasts. *Tfam* controls mitochondrial activity while *Rhot1* regulates mitochondrial distribution. Mitochondrial activity and distribution in alveolar epithelial cells (type I [AT1] and type II [AT2]) contribute to secretion of the PDGF-A ligand. Reception of PDGF-A by mesenchymal fibroblasts/myofibroblasts is critical to fibroblast/myofibroblast proliferation and migration, a key step in secondary septation. Similarly, mitochondrial activity and distribution in fibroblasts/myofibroblasts are also required for fibroblast/myofibroblast contraction and migration, likely through powering the cytoskeleton. The mTORC1 pathway plays a central role in controlling mitochondrial function during alveolar formation. Specification of alveolar epithelial cells and fibroblasts/myofibroblasts was unaffected in mutant mouse lungs in which mitochondrial activity and distribution were perturbed. We propose that essential cellular processes have differential requirements of mitochondrial activity and distribution. Investigating how mitochondria control signaling pathways and cellular processes in vivo provide a new way to functionally define signaling pathways and cellular processes. We surmise that the regulatory circuitry mediated by mitochondria activity and distribution is also deployed during alveolar repair following lung injury and could contribute to the pathogenesis of chronic obstructive lung disease (COPD)/emphysema.

A reduction in mitochondrial function either globally or in distinct compartments in the lung results in alveolar defects. We found that not all cellular processes are perturbed to the same extent when mitochondrial activity or distribution is perturbed. For instance, while alveolar development is disrupted, saccule formation and cell-type specification are unaffected. These observations highlight the differential requirement of mitochondrial function in a given cellular process. Events that necessitate a higher demand for energy will be the first to exhibit phenotypes once mitochondrial function is compromised. It implies that the severity of phenotypes resulting from a reduction in mitochondrial function could be used to characterize the energy demand for a particular cellular process in development. This information cannot be obtained from cell-based studies. It is unclear why alveolar formation has a higher energy demand than saccule formation. Perhaps, construction of a more complex structure such as the alveolus requires additional energy consumption.

A limitation of our approach lies in the broad expression of Cre lines in multiple cell types over an extended developmental time. We propose that distinct cellular processes exhibit differential dependence on mitochondrial activity. While there is no evidence that a new epithelial cell type emerges from saccular to alveolar stages, the transcriptome of any cell type changes as development proceeds. The simplest model is that the same cell types with an altered transcriptome (dubbed cell subtypes) display different sensitivity to mitochondrial perturbation (and energy expenditure) as lung development proceeds from saccular to alveolar stages. This is based on the assumption that the subcellular events (e.g., ligand secretion and cellular contraction) that drive a cellular process (e.g., sacculation and secondary septation) are the main consumer of energy for a given cell subtype. However, it is also possible that the subcellular events that execute a given cellular process may not be the main consumer of energy. In this scenario, one would conclude that the phenotypic defects of a given cellular process due to compromised mitochondrial activity are indicative of the sensitivity of the subcellular events to mitochondrial activity. Finally, we cannot rule out the possibility that functions mediated by mitochondria other than energy production play an important role in a given cellular process (Schumacker et al., 2014). However, lack of apoptosis in the mutant lungs in our study suggests that mitochondria-controlled cell death does not contribute to the lung phenotypes.

Our work has focused on PDGF ligand secretion. Alveolar epithelial cells, especially AT1 cells, are the reservoirs for multiple ligands, including PDGFA, VEGFA, and SHH (Zhang et al., 2020; Vila Ellis et al., 2020; Bellusci et al., 1997). While other pathways have not been interrogated, different pathways may exhibit a varying degree of dependence on mitochondrial function. Similarly, this could provide a new way to functionally categorize signaling pathways on the basis of their energy demand in vivo. Such insight will provide a new blueprint of how cells dispense their energy source in tissues.

Secretion of the PDGF ligand from alveolar epithelial cells is impaired due to mitochondrial dysfunction in either activity or distribution. We surmise that the actomyosin cytoskeleton likely underlies this defect. However, it is also possible that the energy produced by mitochondria is required in many key steps of vesicular transport and membrane fusion. Additional insight would come from a careful assessment of the dependence of each process on mitochondrial function. Similarly, failure to power the actomyosin cytoskeleton in myofibroblasts due to disruption of mitochondrial activity or distribution could cause the contraction and/or migratory defect. ATP produced by mitochondria is known for the assembly of the actomyosin cytoskeleton. By contrast, how regulation of mitochondrial distribution is superimposed upon the formation of the actomyosin cytoskeleton is less understood at the molecular level. This scenario is further complicated by the observation that F-actin and intermediate filaments also play a key role in mitochondrial dynamics and functions (Shah et al., 2021). Technical advances that enable live imaging (Looney and Bhattacharya, 2014) of mitochondria (Gökerküçük et al., 2020) and the cytoskeleton would provide new tools to address this important issue.

We have uncovered the role of mitochondria in alveolar epithelial cells and fibroblasts/myofibroblasts during alveolar formation. Whether the function of endothelial cells/pericytes or other cell types not yet tested also relies on mitochondrial activity and/or distribution in this process is unknown (Ding et al., 2011; Swonger et al., 2016). This would require future studies using an approach similar to that employed in this work. Again, the dependence of cell types, cellular processes, and signaling pathways on mitochondrial function can only be revealed through studies in vivo.

We envision that a complex regulatory network must be in place to regulate mitochondrial number and distribution in distinct cellular processes. Our work shows that mTOR complex 1 is a key player in controlling mitochondrial function during alveolar formation. This is consistent with the role of mTORC1 in regulating mitochondrial function in cell-based assays. Identifying additional components in the signaling network would reveal the key hubs in the signaling network that control mitochondrial function during alveologenesis.

Mitochondrial copy number and TFAM expression levels are reduced in the lungs of COPD/emphysema patients. Moreover, knockdown of TFAM or RHOT1 in human lung epithelial cells or fibroblasts impairs their cellular properties, including PDGF secretion and myofibroblast migration. We speculate that changes in cellular properties due to disturbed mitochondrial activity and distribution contribute to the pathogenesis of COPD/emphysema (Ryter et al., 2018; Caldeira et al., 2021; Hara et al., 2018; Cloonan and Choi, 2016). Disturbance of mitochondrial function and cellular properties could be related to inflammatory responses in COPD/emphysema. To further test this idea would rely on the analysis of lungs at different stages of disease progression with a focus on identifying cellular changes that are directly related to mitochondrial dysfunction. It also necessitates new approaches that enable a mechanistic correlation between mitochondrial function and disease pathogenesis and progression. For instance, analysis of the transcriptome and proteome of various lung cell types at single-cell levels could reveal alterations in a subset of cells that herald the process of emphysematous changes. Such analysis could also uncover changes in the signaling network that connects mitochondria to cellular processes.

Taken together, our work has yielded new molecular insight into the old question of energy utilization in vivo. In particular, energy production by mitochondria is channeled in a spatially specific manner to power cellular machinery and drive cellular processes in distinct cell types. Diverse cell types and cellular processes have a unique energy demand, which is likely executed by a signaling network. These investigations form the basis of additional studies to explore this new concept in alveolar formation and repair and in other physiological and pathological processes in vivo.

Materials and methods

Animal husbandry

Request a detailed protocol

Mouse strains used in this study are listed in the Key resources table. All mouse experiments described in this study were performed according to the protocol approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California, San Francisco (UCSF).

Tamoxifen administration

Request a detailed protocol

Tamoxifen was prepared by dissolving in corn oil to a concentration of 50 mg/ml (Zhang et al., 2020). For postnatal (P) injection, the tamoxifen stock was diluted 1/10 in corn oil to make a final concentration of 5 mg/ml. 50 μl of tamoxifen was delivered through oral gavage or direct injection into the stomach of neonatal mice.

Measurement of MLI

Request a detailed protocol

Measurement of MLI was performed as previously reported (Zhang et al., 2020). Briefly, 15 fields without visible blood vessels or airways from three different histological sections per animal were captured at ×20 magnification using a Nikon Eclipse E1000 microscope. A grid with horizontal and vertical lines (10 each) was superimposed on the images using ImageJ. The MLI (Lm) was calculated as Lm = L/N, where L is the total length of horizontal plus vertical lines, and N is the total number of the intercepts.

Measurement of alveolar wall thickness

Request a detailed protocol

To measure the thickness of the primary septal wall (Osterreicher et al., 1999), 15 representative fields from histological sections of lungs at the indicated age were imaged at ×100 magnification using a Nikon Eclipse E1000 microscope. Three vertical lines were drawn on each image such that they can cross the primary septal wall. The thickness of the primary septal wall was evaluated by ImageJ as the vertical distance of the line that traversed the primary septal wall.

Whole-lung imaging, histology, and immunohistochemistry

Request a detailed protocol

To image the whole lungs that carried GFP or RFP, dissected mouse lungs at the indicated stages were placed under a Nikon Eclipse E1000 microscope equipped with a SPOT 2.3 CCD camera.

Mouse lungs at indicated time points were collected and fixed with 4% paraformaldehyde (PFA) in PBS on ice for 1 hr. The tissues were embedded in paraffin wax or OCT and sectioned at 7 μm. For histological analysis of lung sections, hematoxylin and eosin (H&E) staining was performed as previously described (Zhang et al., 2020; Lin et al., 2017). Images were taken using a SPOT 2.3 CCD camera connected to a Nikon Eclipse E1000 microscope.

To detect PDGFA in lung cells, lungs from Sox9^Cre/+; Pdgfa^ex4COIN/+ (control) and Tfam^f/f; Sox9^Cre/+; Pdgfa^ex4COIN/+ mice at P3 were dissected and fixed in 4% PFA on ice for 1 hr. Lungs were washed in 0.02% NP40 in PBS for 2 hr, then placed in X-gal staining solution (5 mM K₃Fe(CN)₆, 5 mM K₄Fe(CN)₆, 2 mM MgCl₂, 0.01% sodium deoxycholate, 0.02% NP-40, 1 mg/ml X-gal) for 72 hr at 37°C. The stained lungs were paraffin embedded and sectioned. Images were taken using a SPOT 2.3 CCD camera connected to a Nikon Eclipse E1000 microscope.

Immunofluorescence was performed as previously described (Lin et al., 2017). Antibodies used in this study are listed in the Key resources table. The primary antibodies used for wax sections were: chicken anti-GFP (1:200, Abcam, Cat# ab13970), rabbit anti-NKX2.1 (1:100, Epitomics, Cat# 2044-1), goat anti-CC10 (1:200, Santa Cruz Biotechnology, Cat# sc-9773), mouse anti-acetylated tubulin (1:200, Sigma-Aldrich, Cat# T6793), rabbit anti-prosurfactant protein C (proSP-C) (1:200, MilliporeSigma, Cat# AB3786), hamster anti-T1α (1:200, Developmental Studies Hybridoma Bank, Cat# 8.1.1), and mouse anti-HOPX (1:100, Santa Cruz Biotechnology, Cat# sc-398703). The primary antibodies used for frozen sections were rabbit anti-MPC1 (1:100, Millipore/Sigma, Cat# HPA045119), rat anti-E-cadherin (1:200, Invitrogen, Cat# 13-1900), mouse anti-MTCO1 (1:100, Abcam, Cat# ab14705), chicken anti-GFP (1:300, Abcam, Cat# ab13970), mouse anti-ACTA2 (1:200, Thermo Scientific Lab Vision, Cat# MS-113-P0), rat anti-PECAM-1 (CD31) (1:150, Santa Cruz Biotechnology, Cat# sc-18916), rabbit anti-PDGFRA (1:150, Cell Signaling Technology, Cat# 3164), rabbit anti-phospho-PDGFRA (Tyr754) (1:100, Cell Signaling Technology, Cat# 2992), mouse anti-S6 ribosomal protein (1:100, Cell Signaling Technology, Cat# 2317), and rabbit anti-phospho-S6 ribosomal protein (Ser235/236) (1:100, Cell Signaling Technology, Cat# 4856). Secondary antibodies and conjugates used were donkey anti-rabbit Alexa Fluor 488 or 594 (1:1000, Life Technologies), donkey anti-chicken Alexa Fluor 488 or 647 (1:1000, Life Technologies), donkey anti-mouse Alexa Fluor 488 or 594 (1:1000, Life Technologies), and donkey anti-rat Alexa Fluor 594 (1:1000, Life Technologies). The biotinylated secondary antibodies used were goat anti-hamster (1:1000, Jackson ImmunoResearch Laboratories), donkey anti-rabbit (1:1000, Jackson ImmunoResearch Laboratories), donkey anti-rat (1:1000, Jackson ImmunoResearch Laboratories), and horse anti-mouse (1:1000, Jackson ImmunoResearch Laboratories). The signal was detected using streptavidin-conjugated Alexa Fluor 488, 594, or 647 (1:1000, Life Technologies) or HRP-conjugated streptavidin (1:1000, PerkinElmer) coupled with fluorogenic substrate Alexa Fluor 594 tyramide for 30 s (1:200, TSA kit; PerkinElmer). F-actin was stained with rhodamine-conjugated phalloidin (1:200, Sigma) in PBS for 2 hr. Since the filamentous actin is sensitive to methanol, ethanol, and high temperature, we only used OCT-embedded frozen sections for F-actin staining.

Confocal images were captured on a Leica SPE laser-scanning confocal microscope. Adjustment of red/green/blue/gray histograms and channel merges were performed using LAS AF Lite (Leica Microsystems).

Fibroblast/myofibroblast proliferation assays

Request a detailed protocol

The rate of cell proliferation was determined through EdU incorporation as previously described (Zhang et al., 2020). Mouse pups at the indicated time points were intraperitoneally injected with EdU/PBS solution for 1 hr before dissection. The Click-iT EdU Alexa Fluor 488 Imaging Kit (Life Technologies) was used to quantify EdU incorporation. The sections were co-stained with antibody against PDGFRA. Cell proliferation rate was calculated as the ratio of (EdU⁺ PDGFRA⁺ cells)/(PDGFRA⁺ cells).

Fibroblast/myofibroblast migration assay in vitro

Request a detailed protocol

The migratory capacity of lung fibroblasts/myofibroblasts was assessed by the Culture-Insert 2 Well system (ibidi) (Zhang et al., 2020). Briefly, at P3, dissected lungs from control, Tfam^f/f; Pdgfra^Cre/+ and Rhot1^f/f; Pdgfra^Cre/+ mice were minced into small pieces and digested in solution (1.2 U/ml dispase, 0.5 mg/ml collagenase B, and 50 U/ml DNase I), rocking at 37°C for 2 hr to release single cells. After adding an equal volume of culture medium (DMEM with 10% fetal bovine serum (FBS), 2× penicillin/streptomycin, and 1× L-glutamine), the samples were filtered through 40 μm cell strainers and centrifuged at 600 × g for 10 min. The dissociated cells were resuspended in 200 μl of culture medium and plated into wells (100 μl per well). The lung fibroblasts/myofibroblasts were allowed to attach to the fibronectin-coated plates for 2–3 hr. Fresh culture medium was added, and the attached fibroblasts/myofibroblasts were cultured 2 or 3 days to reach 100% confluence. The confluent fibroblasts/myofibroblasts were switched to starvation medium (DMEM with 0.5% FBS and 1× penicillin/streptomycin) for 16 hr before removal of the insert. Fibroblasts/myofibroblasts migration was assessed 36–48 hr afterward.

Lentiviral production and transduction

Request a detailed protocol

Lentiviruses were produced in HEK293T cells maintained in DMEM containing 10% FBS, 1× penicillin/streptomycin, and 1× L-glutamine (Zhang et al., 2020). HEK293T cells were plated and transfected when they reached 70% confluence on the following day. 2 μg of pMD2.G, 2 μg of psPAX2, 4 μg of PDGFA-3xFLAG (in the modified pSECC lentiviral vector), and 50 μl of polyethylenimine (PEI) (1 μg/μl) were mixed in 1000 μl OPTI-MEM and added to a 10 cm dish. Incubation medium was replaced 1 day after transfection. 48 hr post-transfection, the viral supernatant was collected, filtered through 0.45 μm PVDF filter, then added to primary lung cells together with 8 μg/ml polybrene. 12 hr post-transduction, the medium was replaced with fresh culture medium.

shRNA-mediated gene silencing

Request a detailed protocol

shRNAs against the 3'UTR of human TFAM and RHOT1 were designed by pSicOligomaker (Reynolds et al., 2004). Paired oligonucleotides were annealed and inserted into the pLentiLox3.7 lentiviral vector. The packaging vectors used were either the pLP1/pLP2/pLP/VSV-G or pMD2.G/psPAX2 combinations. Primers used for shRNAs were shTFAM-1 forward,

5′-TGGTGCTGAGGAGTGTTAAATTCAAGAGATTTAACACTCCTCAGCACCTTTTTTC-3′; reverse, 5′ TCGAGAAAAAAGGTGCTGAGGAGTGTTAAATCTCTTGAATTTAACACTCCTCAGCACCA-3′, shTFAM-2 forward, 5′-TGACTTCTGCCAGCATAATATTCAAGAGATATTATGCTGGCAGAAGTCTTTTTTC-3′; reverse, 5′-TCGAGAAAAAAGACTTCTGCCAGCATAATATCTCTTGAATATTATGCTGGCAGAAGTCA-3′, shTFAM-3 forward, 5′-TGTACTCTTGTTTCCTTATATTCAAGAGATATAAGGAAACAAGAGTACTTTTTTC-3′; reverse, 5′-TCGAGAAAAAAGTACTCTTGTTTCCTTATATCTCTTGAATATAAGGAAACAAGAGTACA-3′, shRHOT1-1 forward, 5′-TGAAACAGCGATGATATAAATTCAAGAGATTTATATCATCGCTGTTTCTTTTTTC-3′; reverse, 5′-TCGAGAAAAAAGAAACAGCGATGATATAAATCTCTTGAATTTATATCATCGCTGTTTCA-3′, shRHOT1-2 forward, 5′-TGTACATTCTGAATGCTTTATTCAAGAGATAAAGCATTCAGAATGTACTTTTTTC-3′; reverse, 5′-TCGAGAAAAAAGTACATTCTGAATGCTTTATCTCTTGAATAAAGCATTCAGAATGTACA-3′, shRHOT1-3 forward, 5′-TGAAATGATGTTTCTAGACATTCAAGAGATGTCTAGAAACATCATTTCTTTTTTC-3′; reverse, 5′-TCGAGAAAAAAGAAATGATGTTTCTAGACATCTCTTGAATGTCTAGAAACATCATTTCA-3′.

PDGFA secretion assay

Request a detailed protocol

PDGFA secretion assay was performed as previously described (Zhang et al., 2020). In brief, PDGFA-3xFLAG was stably expressed in control and Tfam- and Rhot1-deficient primary lung cells (derived from the lungs of control, Tfam^f/f; Pdgfra^Cre/+ and Rhot1^f/f; Pdgfra^Cre/+ mice, respectively) that were plated onto 10 cm dishes. The culture media were replaced with OPTI-MEM supplemented with insulin, transferrin, and selenium (ITS) once the cells reached 100% confluence. 24 hr post-incubation, the supernatants were mixed with 1× protein inhibitor cocktail, filtered through 0.45 μm filters, and centrifuged at high speed (>12,000 rpm) for 15 min at 4°C. The filtrates were then concentrated in protein concentration columns (Millipore CENTRICON YM-10 Centrifugal Filter Unit 2 ml 10 kDa) through centrifugation at 2000 × g for 1 hr at 4°C. Concentrated supernatants were mixed with immunoprecipitation (IP) buffer (50 mM Tris pH 7.4, 2 mM EDTA, 150 mM NaCl, 0.5% Triton X-100, 1× protein inhibitor cocktail) in a total volume of 500 μl. Meanwhile, cells seeded on the plate were harvested and lysed in IP buffer. Immunoprecipitation was performed using FLAG-M2 beads following the standard procedure. Western blotting was performed to detect PDGFA in the supernatants and lysates derived from control, Tfam -deficient, and Rhot1-deficient primary lung cells.

qPCR analysis

Request a detailed protocol

qPCR was performed as previously described (Zhang et al., 2020). Briefly, the right cranial lobe was dissected from the mouse lungs of the indicated genotypes and time points, and homogenized in 1 ml TRIzol (Life Technologies). The homogenates were added to 200 μl chloroform, and then centrifuged for 15 min at 12,000 rpm. The upper aqueous layer was collected and mixed with an equal volume of 70% ethanol. RNAs were extracted with the RNeasy Mini Kit (QIAGEN) following the manufacturer’s instructions. The extracted RNAs were reverse-transcribed with the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). Quantitative PCR (qPCR) was performed on the Applied Biosystems QuantStudio 5 Real-Time PCR System. Primers used for qPCR were mouse Pdgfa forward,

5′-CTGGCTCGAAGTCAGATCCACA-3′; reverse, 5′-GACTTGTCTCCAAGGCATCCTC-3′, mouse Pdgfra forward, 5′-TGCAGTTGCCTTACGACTCCAGAT-3′; reverse, 5′-AGCCACCTTCATTACAGGTTGGGA-3′, mouse Acta2 forward, 5′-ATGCAGAAGGAGATCACAGC-3′; reverse, 5′-GAAGGTAGACAGCGAAGCC-3′, mouse Eln forward, 5′-GCCAAAGCTGCCAAATACG-3′; reverse, 5′-CTCCAGCTCCAACACCATAG-3′, mouse Gapdh forward, 5′-AGGTTGTCTCCTGCGACTTCA-3′; reverse, 5′-CCAGGAAATGAGACAAAGTT-3′.

Analysis of mtDNA/nDNA ratio

Request a detailed protocol

Lung samples from mice and human patients were lysed in lysis buffer (100 mM Tris pH 7.5, 5 mM EDTA, 0.4% SDS, 200 mM NaCl, 50 μg/ml proteinase K), and incubated in a 55°C chamber overnight. The tissues were digested with 100 μg/ml RNase A at 37°C for 30 min to degrade the RNAs. An equal volume of phenol/chloroform was added to the lysed samples, which were centrifuged at 12,000 rpm for 10 min. Lung DNAs were concentrated by ethanol precipitation. For mouse lungs, the mitochondrial 16S rRNA or ND1 gene and the nuclear Hk2 gene were used to calculate the relative ratio of mitochondrial (mt) to nuclear (n) DNA copy number. For human lungs, the mitochondrial tRNA^Leu(UUR) or 16S rRNA gene and the nuclear β2-microglobulin (β2M) gene were employed to determine the relative ratio of mtDNA to nDNA. qPCR was performed on the Applied Biosystems QuantStudio 5 Real-Time PCR System. The primer pairs used for the indicated genes were: mouse 16S rRNA forward, 5′-CCGCAAGGGAAAGATGAAAGAC-3′; reverse, 5′-TCGTTTGGTTTCGGGGTTTC-3′, mouse mt-ND1 forward, 5′-CTAGCAGAAACAAACCGGGC-3′; reverse, 5′-CCGGCTGCGTATTCTACGTT-3′, mouse Hk2 forward, 5′-GCCAGCCTCTCCTGATTTTAGTGT-3′; reverse, 5′-GGGAACACAAAAGACCTCTTCTGG-3′, human tRNA^Leu(UUR) forward, 5′-CACCCAAGAACAGGGTTTGT-3′; reverse, 5′-TGGCCATGGGTATGTTGTTA-3′, human 16S rRNA forward, 5′-GCCTTCCCCCGTAAATGATA-3′; reverse, 5′-TTATGCGATTACCGGGCTCT-3′, human β-2-microglobulin (β2M) forward, 5′-TGCTGTCTCCATGTTTGATGTATCT-3′; reverse, 5′-TCTCTGCTCCCCACCTCTAAGT-3′.

Enzymatic activities of the mitochondrial electron transport chain (ETC) complex

Request a detailed protocol

Measurement of the enzymatic activity of mitochondrial ETC complex was performed as previously described (Masand et al., 2018). In brief, frozen lung tissues from control, Tfam^f/f; Pdgfra^Cre/+, Tfam^f/f; Sox9^Cre/+, Rhot1^f/f; Pdgfra^Cre/+ and Rhot1^f/f; Sox9^Cre/+ mice at P5 were homogenized in homogenization buffer (120 mM KCl, 20 mM HEPES, 1 mM EGTA, pH 7.4) using a Dounce homogenizer. The Pierce BCA Protein Assay Kit was used to determine protein concentrations before spectrophotometric kinetic assays. Complex I (NADH:ubiquinone oxidoreductase) activity was determined by measuring the oxidation of NADH at 340 nm in a reaction mixture (50 mM potassium phosphate [pH 7.5], 1.7 mM potassium ferricyanide, 0.2 mM NADH, and homogenate of interest). Potassium ferricyanide was used as the electron acceptor for Complex I. Complex IV (cytochrome c oxidase) activity was determined by measuring the oxidation of cytochrome c at 550 nm in a reaction solution (50 mM potassium phosphate [pH 7.0], 100 μM reduced cytochrome c, and homogenate of interest).

Mitochondrial network

Request a detailed protocol

Fibroblasts were derived from control, Tfam^f/f; Pdgfra^Cre/+ and Rhot1^f/f; Pdgfra^Cre/+ lungs and transduced with lentiviral constructs expressing Mito-7-mEmerald to label mitochondria. After 48 hr, cells were fixed and co-stained with MTCO1. Tubular mitochondria are the dominant form in control fibroblasts, while short tubular and fragmented mitochondria could be found in Tfam-deficient fibroblasts. Fragmented mitochondria are characterized as dot-like structures; the morphology of short tubular mitochondria is intermediate between tubular and fragmented mitochondria.

Human lung tissues

Request a detailed protocol

Human lung samples were processed as previously described (Zhang et al., 2020). Briefly, lung tissues were obtained from severe emphysema (Global Initiative for Chronic Obstructive Lung Disease Criteria, stages III or IV) at the time of lung transplantation. The donor control lung samples were indicated physiologically and pathologically normal (Ware et al., 2002). Written informed consent was obtained from all subjects, and the study was approved by the University of California, San Francisco Institutional Review Board (IRB approval # 13-10738).

Human lung cells

Request a detailed protocol

The human lung epithelial cell line (1310 cell line) was derived from human alveolar type II cells. Cells were immortalized by lentiviral transduction with hTERT and CDK4 to create a stable cell line (Ramirez et al., 2004).

Human airway fibroblasts were derived from donor lungs not utilized for lung transplantation. It was approved by the Committee on Human Research at the University of California, San Francisco, in full accordance with the Declaration of Helsinki principles. Airway fibroblasts were cultured from the lung parenchyma by the explant technique and used passages 1–4, as previously described (Araya et al., 2007). The identity of the cell lines has been confirmed by STR profiling, and no mycoplasma contamination was found.

Western blotting analysis

Request a detailed protocol

Human lung tissues from normal subjects and emphysema patients and mouse lung samples were homogenized in RIPA buffer with 1× Protease Inhibitor Cocktail and 1× PMSF. The lysates were centrifuged at full speed for 15 min at 4°C and analyzed by Western blotting as previously described (Lin et al., 2017). The primary antibodies used were rabbit anti-TFAM (1: 2000, Proteintech, Cat# 22586-1-AP), mouse anti-S6 ribosomal protein (1:2000, Cell Signaling Technology, Cat# 2317), rabbit anti-phospho-S6 ribosomal protein (Ser235/236) (1:2000, Cell Signaling Technology, Cat# 4856), mouse anti-OPA1 (clone 18) (1:2000, BD Transduction Laboratories, Cat# 612606), mouse anti-DLP1 (1:2000, BD Transduction Laboratories, Cat# 611113), rabbit anti-phospho-DRP1 (Ser616) (1:1000, Cell Signaling Technology, Cat# 3455S), and mouse anti-alpha-tubulin (1:3000, Developmental Studies Hybridoma Bank, Cat# 12G10).

Statistical analysis

Request a detailed protocol

All the statistical comparisons between different groups are shown as mean value ± SEM. The p-values were calculated by two-tailed Student’s t-tests, and statistical significance was evaluated as *p<0.05; **p<0.01; ***p<<0.001. More than or equal to three biological repeats were performed, and the detailed biological replicates (n numbers) are indicated in the figure legends.

Appendix 1

Appendix 1—key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Antibody	Anti-ACTA2 (mouse monoclonal)	Thermo Scientific Lab Vision	Cat# MS-113-P0; RRID:AB_64001	IF (1:200)
Antibody	Anti-CC10 (goat polyclonal)	Santa Cruz Biotechnology	Cat# sc-9773; RRID:AB_2183391	IF (1:200)
Antibody	Anti-DLP1 (mouse monoclonal)	BD Biosciences	Cat# 611113; RRID:AB_398424	WB (1:2000)
Antibody	Anti-phospho-DRP1 (Ser616) (rabbit polyclonal)	Cell Signaling Technology	Cat# 3455; RRID:AB_2085352	WB (1:1000)
Antibody	Anti-E-cadherin (rat monoclonal)	Invitrogen	Cat# 13-1900; RRID:AB_2533005	IF (1:200)
Antibody	Anti-GFP (chicken polyclonal)	Abcam	Cat# ab13970; RRID:AB_300798	IF (1:200)
Antibody	Anti-mouse HOPX (mouse monoclonal)	Santa Cruz Biotechnology	Cat# sc-398703; RRID:AB_2687966	IF (1:100)
Antibody	Anti-MPC1 (BRP44L) (rabbit polyclonal)	MilliporeSigma	Cat# HPA045119; RRID:AB_10960421	IF (1:100)
Antibody	Anti-MTCO1 [1D6] (mouse monoclonal)	Abcam	Cat# ab14705; RRID:AB_2084810	IF (1:100)
Antibody	Anti-NKX2.1 (rabbit monoclonal)	Epitomics	Cat# 2044-1; RRID:AB_1267367	IF (1:100)
Antibody	Anti-OPA1, clone 18 (mouse monoclonal)	BD Biosciences	Cat# 612606; RRID:AB_399888	WB (1:2000)
Antibody	Anti-PDGF receptor alpha (rabbit polyclonal)	Cell Signaling Technology	Cat# 3164; RRID:AB_2162351	IF (1:150)
Antibody	Anti-phospho-PDGF receptor α (Tyr754) (23B2) (rabbit monoclonal)	Cell Signaling Technology	Cat# 2992; RRID:AB_390728	IF (1:100)
Antibody	Anti-PECAM-1 (MEC 13.3) (rat monoclonal)	Santa Cruz Biotechnology	Cat# sc-18916; RRID:AB_627028	IF (1:150)
Antibody	Anti-prosurfactant protein C (proSP-C) (rabbit polyclonal)	MilliporeSigma	Cat# AB3786; RRID:AB_91588	IF (1:200)
Antibody	Anti-S6 ribosomal protein (54D2) (mouse monoclonal)	Cell Signaling Technology	Cat# 2317; RRID:AB_2238583	IF (1:100); WB (1:2000)
Antibody	Anti-phospho-S6 ribosomal protein (Ser235/236)(2F9) (rabbit monoclonal)	Cell Signaling Technology	Cat# 4856; RRID:AB_2181037	IF (1:100); WB (1:2000)
Antibody	Anti-T1α (hamster monoclonal)	Developmental Studies Hybridoma Bank	Cat# 8.1.1; RRID:AB_531893	IF (1:200)
Antibody	Anti-TFAM (rabbit polyclonal)	Proteintech	Cat# 22586-1-AP; RRID:AB_11182588	WB (1:2000)
Antibody	Anti-Rat TGN38 (sheep polyclonal)	Bio-Rad Laboratories	Cat# AHP499G; RRID:AB_2203272	IF (1:100)
Antibody	Anti-acetylated α-tubulin, clone 6-11B-1 (mouse monoclonal)	MilliporeSigma	Cat# T6793; RRID:AB_477585	IF (1:200)
Antibody	Anti-alpha-tubulin (mouse monoclonal)	Developmental Studies Hybridoma Bank	Cat# 12G10; RRID:AB_1157911	WB (1:3000)
Chemical compound, drug	ANTI-FLAG M2 Affinity Gel	Sigma-Aldrich	Cat# A2220; RRID:AB_10063035
Chemical compound, drug	Biotin-XX Phalloidin	Molecular Probes	Cat# B7474
Chemical compound, drug	DMEM	Mediatech	Cat# 10-013-CV
Chemical compound, drug	Fetal bovine serum (FBS)	Gibco	Cat# 10437-028
Chemical compound, drug	Fibronectin	Corning	Cat# 354008
Chemical compound, drug	Glutaraldehyde, 8% aqueous solution, EM grade	Electron Microscopy Sciences	Cat# 16000
Chemical compound, drug	Insulin, transferrin, and selenium (ITS)	Gibco	Cat# 51300-044
Chemical compound, drug	Paraformaldehyde, 16% solution, EM grade	Electron Microscopy Sciences	Cat# 15700
Chemical compound, drug	Paraformaldehyde	Sigma-Aldrich	Cat# P6148
Chemical compound, drug	Polyethylenimine (PEI)	Polysciences, Inc	Cat# 23966-2
Chemical compound, drug	Penicillin/streptomycin	Gibco	Cat# 15070-063
Chemical compound, drug	Protease Inhibitor Cocktail	Biotool	Cat# B14001
Chemical compound, drug	Rhodamine-conjugated phalloidin	Molecular Probes	Cat# R415
Chemical compound, drug	Tamoxifen	Toronto Research Chemicals	Cat# T006000
Chemical compound, drug	TRIzol Reagent	Ambion	Cat# 15596018
Cell line (Homo sapiens)	Human lung epithelial cells (1310 cell line)	John D. Minna (Ramirez et al., 2004)
Cell line (H. sapiens)	Human lung airway fibroblasts	Stephen L. Nishimura (Araya et al., 2007)
Commercial assay or kit	Click-iT EdUAlexa Fluor 488 Imaging Kit	Thermo Fisher	Cat# C10337
Commercial assay or kit	Centriprep Ultracel YM-10 Centrifugal Filter Devices	MilliporeSigma	Cat# 4305
Commercial assay or kit	Maxima First Strand cDNA Synthesis Kit	Thermo Scientific	Cat# K1641
Commercial assay or kit	RNeasy Mini Kit	QIAGEN	Cat# 74104
Commercial assay or kit	TSA Plus Cyanine 3 (Cy3) Fluorescein detection kit	PerkinElmer	Cat# NEL753001KT
Commercial assay or kit	Two-well culture insert	Ibidi	Cat# 80209
Genetic reagent (Mus musculus)	CAGG^Cre-ER^TM [B6.Cg-Tg(CAG-cre/Esr1*)5Amc/J]	The Jackson Laboratory	Stock# 004682; RRID:IMSR_JAX:004682
Genetic reagent (M. musculus)	Cd4^Cre [B6.Tg(Cd4-cre)1Cwi]	The Jackson Laboratory	Stock# 022071; RRID:MGI:3691126
Genetic reagent (M. musculus)	Cx3cr1^CreER [B6.129P2(C)-Cx3cr1^{tm4(tm2.1(cre/ERT2)Jung}/J]	The Jackson Laboratory	Stock# 020940; RRID:IMSR_JAX:020940
Genetic reagent (M. musculus)	Dermo1^Cre [Twist2^{tm1.1(cre)Dor}/J]	David Ornitz (Yu et al., 2003)
Genetic reagent (M. musculus)	Foxp3^Cre [Foxp3^{tm4(YFP/icre)Ayr}/J]	The Jackson Laboratory	Stock# 016959; RRID:IMSR_JAX:016959
Genetic reagent (M. musculus)	Lrpprc^f [Lrpprc^tm1.1Lrsn/J]	Nils-Göran Larsson (Ruzzenente et al., 2012)
Genetic reagent (M. musculus)	Miro1^f [B6(Cg)-Rhot1^tm2.1Jmsu/J]	The Jackson Laboratory	Stock# 031126; RRID:IMSR_JAX:031126
Genetic reagent (M. musculus)	Pdgfa^ex4COIN [Pdgfa^ex4COIN]	ChristerBetsholtz (Andrae et al., 2014)
Genetic reagent (M. musculus)	Pdgfra^Cre [C57BL/6-Tg(Pdgfra-cre)1Clc/J]	The Jackson Laboratory	Stock# 013148; RRID:IMSR_JAX:013148
Genetic reagent (M. musculus)	Rptor^f [B6.Cg-Rptor^tm1.1Dmsa/J]	The Jackson Laboratory	Stock# 013188; RRID:IMSR_JAX:013188
Genetic reagent (M. musculus)	ROSA26^mTmG [Gt(ROSA)26Sor^tm4(ACTB-tdTomato,-EGFP)^Luo/J]	The Jackson Laboratory	Stock# 007576; RRID:IMSR_JAX:007576
Genetic reagent (M. musculus)	Sox9^Cre [Sox9^tm3(Cre)Crm]	Benoit de Crombrugghe (Akiyama et al., 2005)
Genetic reagent (M. musculus)	Tfam^f [B6.Cg-Tfam^tm1.1Ncdl/J]	The Jackson Laboratory	Stock# 026123; RRID:IMSR_JAX:026123
Biological sample (H. sapiens)	Human Emphysema/COPD patient tissue (deidentified)	Paul Wolters
Recombinant DNA reagent	Lentiviral vector backbone for Pdgfa cloning, modified from pSECC	This paper		Refer to the ‘Lentivirus production and transduction’
Recombinant DNA reagent	pSECC	Sánchez-Rivera et al., 2014	AddgenePlasmid# 60820
Recombinant DNA reagent	pMD2.G	A gift from Didier Trono	AddgenePlasmid# 12259
Recombinant DNA reagent	psPAX2	A gift from Didier Trono	AddgenePlasmid# 12260
Software, algorithm	Prism	GraphPad	https://www.graphpad.com/
Software, algorithm	ImageJ	National Institutes of Health (NIH) (https://imagej.nih.gov/ij/)	RRID:SCR_003070

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. This study does not generate source data files that need to be deposited.

References

1. Akiyama H
2. Kim JE
3. Nakashima K
4. Balmes G
5. Iwai N
6. Deng JM
7. Zhang Z
8. Martin JF
9. Behringer RR
10. Nakamura T
11. de Crombrugghe B
(2005) Osteo-chondroprogenitor cells are derived from Sox9 expressing precursors
PNAS 102:14665–14670.
https://doi.org/10.1073/pnas.0504750102
- PubMed
- Google Scholar
1. Andrae J
2. Gouveia L
3. He L
4. Betsholtz C
(2014) Characterization of platelet-derived growth factor-A expression in mouse tissues using A lacZ knock-in approach
PLOS ONE 9:e105477.
https://doi.org/10.1371/journal.pone.0105477
- PubMed
- Google Scholar
1. Araya J
2. Cambier S
3. Markovics JA
4. Wolters P
5. Jablons D
6. Hill A
7. Finkbeiner W
8. Jones K
9. Broaddus VC
10. Sheppard D
11. Barzcak A
12. Xiao Y
13. Erle DJ
14. Nishimura SL
(2007) Squamous metaplasia amplifies pathologic epithelial-mesenchymal interactions in COPD patients
The Journal of Clinical Investigation 117:3551–3562.
https://doi.org/10.1172/JCI32526
- PubMed
- Google Scholar
(2015) Chronic obstructive pulmonary disease
Nature Reviews. Disease Primers 1:15076.
https://doi.org/10.1038/nrdp.2015.76
- PubMed
- Google Scholar
1. Bellusci S
2. Furuta Y
3. Rush MG
4. Henderson R
5. Winnier G
6. Hogan BL
(1997) Involvement of Sonic hedgehog (Shh) in mouse embryonic lung growth and morphogenesis
Development (Cambridge, England) 124:53–63.
https://doi.org/10.1242/dev.124.1.53
- PubMed
- Google Scholar
1. Boström H
2. Willetts K
3. Pekny M
4. Levéen P
5. Lindahl P
6. Hedstrand H
7. Pekna M
8. Hellström M
9. Gebre-Medhin S
10. Schalling M
11. Nilsson M
12. Kurland S
13. Törnell J
14. Heath JK
15. Betsholtz C
(1996) PDGF-A signaling is A critical event in lung alveolar myofibroblast development and alveogenesis
Cell 85:863–873.
https://doi.org/10.1016/s0092-8674(00)81270-2
- PubMed
- Google Scholar
(2019) Mechanisms of mammalian mitochondrial transcription
Protein Science 28:1594–1605.
https://doi.org/10.1002/pro.3688
- PubMed
- Google Scholar
1. Burri PH
(2006) Structural Aspects of Postnatal Lung Development – Alveolar Formation and Growth
Neonatology 89:313–322.
https://doi.org/10.1159/000092868
- PubMed
- Google Scholar
1. Caldeira DAF
2. Weiss DJ
3. Rocco PRM
4. Silva PL
5. Cruz FF
(2021) Mitochondria in Focus: From Function to Therapeutic Strategies in Chronic Lung Diseases
Frontiers in Immunology 12:782074.
https://doi.org/10.3389/fimmu.2021.782074
- PubMed
- Google Scholar
1. Campbell H
2. Tomkeieff SI
(1952)
Calculation of the internal surface of a lung

Nature 170:116–117.
- PubMed
- Google Scholar
1. Chan DC
(2020) Mitochondrial Dynamics and Its Involvement in Disease
Annual Review of Pathology 15:235–259.
https://doi.org/10.1146/annurev-pathmechdis-012419-032711
- PubMed
- Google Scholar
(2016) Alveologenesis: key cellular players and fibroblast growth factor 10 signaling
Molecular and Cellular Pediatrics 3:e7.
https://doi.org/10.1186/s40348-016-0045-7
- PubMed
- Google Scholar
1. Cloonan SM
2. Choi AMK
(2016) Mitochondria in lung disease
The Journal of Clinical Investigation 126:809–820.
https://doi.org/10.1172/JCI81113
- PubMed
- Google Scholar
(2016) Miro sculpts mitochondrial dynamics in neuronal health and disease
Neurobiology of Disease 90:27–34.
https://doi.org/10.1016/j.nbd.2015.12.008
- PubMed
- Google Scholar
1. Ding B-S
2. Nolan DJ
3. Guo P
4. Babazadeh AO
5. Cao Z
6. Rosenwaks Z
7. Crystal RG
8. Simons M
9. Sato TN
10. Worgall S
11. Shido K
12. Rabbany SY
13. Rafii S
(2011) Endothelial-derived angiocrine signals induce and sustain regenerative lung alveolarization
Cell 147:539–553.
https://doi.org/10.1016/j.cell.2011.10.003
- PubMed
- Google Scholar
(1994) Changes occurring with increasing age in the rat lung: morphometrical study
The Anatomical Record 239:287–296.
https://doi.org/10.1002/ar.1092390307
- PubMed
- Google Scholar
1. Fu Z
2. Ye J
3. Dean JW
4. Bostick JW
5. Weinberg SE
6. Xiong L
7. Oliff KN
8. Chen ZE
9. Avram D
10. Chandel NS
11. Zhou L
(2019) Requirement of Mitochondrial Transcription Factor A in Tissue-Resident Regulatory T Cell Maintenance and Function
Cell Reports 28:159–171.
https://doi.org/10.1016/j.celrep.2019.06.024
- PubMed
- Google Scholar
1. Gao X
2. Zhu B
3. Wu Y
4. Li C
5. Zhou X
6. Tang J
7. Sun J
(2022) TFAM-Dependent Mitochondrial Metabolism Is Required for Alveolar Macrophage Maintenance and Homeostasis
Journal of Immunology (Baltimore, Md 208:1456–1466.
https://doi.org/10.4049/jimmunol.2100741
- PubMed
- Google Scholar
(2020) Imaging Mitochondrial Functions: from Fluorescent Dyes to Genetically-Encoded Sensors
Genes 11:E125.
https://doi.org/10.3390/genes11020125
- PubMed
- Google Scholar
(2017) Expression analysis of platelet-derived growth factor receptor alpha and its ligands in the developing mouse lung
Physiological Reports 5:e13092.
https://doi.org/10.14814/phy2.13092
- PubMed
- Google Scholar
1. Hamanaka RB
2. Glasauer A
3. Hoover P
4. Yang S
5. Blatt H
6. Mullen AR
7. Getsios S
8. Gottardi CJ
9. DeBerardinis RJ
10. Lavker RM
11. Chandel NS
(2013) Mitochondrial reactive oxygen species promote epidermal differentiation and hair follicle development
Science Signaling 6:ra8.
https://doi.org/10.1126/scisignal.2003638
- PubMed
- Google Scholar
1. Hara H
2. Kuwano K
3. Araya J
(2018) Mitochondrial Quality Control in COPD and IPF
Cells 7:E86.
https://doi.org/10.3390/cells7080086
- PubMed
- Google Scholar
1. Hayashi S
2. McMahon AP
(2002) Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse
Developmental Biology 244:305–318.
https://doi.org/10.1006/dbio.2002.0597
- PubMed
- Google Scholar
(2014) Determinants and functions of mitochondrial behavior
Annual Review of Cell and Developmental Biology 30:357–391.
https://doi.org/10.1146/annurev-cellbio-101011-155756
- PubMed
- Google Scholar
(2014) mTOR signalling, embryogenesis and the control of lung development
Seminars in Cell & Developmental Biology 36:68–78.
https://doi.org/10.1016/j.semcdb.2014.09.023
- PubMed
- Google Scholar
1. Laplante M
2. Sabatini DM
(2012) mTOR signaling in growth control and disease
Cell 149:274–293.
https://doi.org/10.1016/j.cell.2012.03.017
- PubMed
- Google Scholar
1. Lee PP
2. Fitzpatrick DR
3. Beard C
4. Jessup HK
5. Lehar S
6. Makar KW
7. Pérez-Melgosa M
8. Sweetser MT
9. Schlissel MS
10. Nguyen S
11. Cherry SR
12. Tsai JH
13. Tucker SM
14. Weaver WM
15. Kelso A
16. Jaenisch R
17. Wilson CB
(2001) A critical role for Dnmt1 and DNA methylation in T cell development, function, and survival
Immunity 15:763–774.
https://doi.org/10.1016/s1074-7613(01)00227-8
- PubMed
- Google Scholar
1. Li R
2. Bernau K
3. Sandbo N
4. Gu J
5. Preissl S
6. Sun X
(2018) Pdgfra marks a cellular lineage with distinct contributions to myofibroblasts in lung maturation and injury response
eLife 7:e36865.
https://doi.org/10.7554/eLife.36865
- PubMed
- Google Scholar
1. Lin C
2. Yao E
3. Zhang K
4. Jiang X
5. Croll S
6. Thompson-Peer K
7. Chuang P-T
(2017) YAP is essential for mechanical force production and epithelial cell proliferation during lung branching morphogenesis
eLife 6:e21130.
https://doi.org/10.7554/eLife.21130
- PubMed
- Google Scholar
(1997) Alveogenesis failure in PDGF-A-deficient mice is coupled to lack of distal spreading of alveolar smooth muscle cell progenitors during lung development
Development (Cambridge, England) 124:3943–3953.
https://doi.org/10.1242/dev.124.20.3943
- PubMed
- Google Scholar
1. Looney MR
2. Bhattacharya J
(2014) Live imaging of the lung
Annual Review of Physiology 76:431–445.
https://doi.org/10.1146/annurev-physiol-021113-170331
- PubMed
- Google Scholar
1. Masand R
2. Paulo E
3. Wu D
4. Wang Y
5. Swaney DL
6. Jimenez-Morales D
7. Krogan NJ
8. Wang B
(2018) Proteome Imbalance of Mitochondrial Electron Transport Chain in Brown Adipocytes Leads to Metabolic Benefits
Cell Metabolism 27:616–629.
https://doi.org/10.1016/j.cmet.2018.01.018
- PubMed
- Google Scholar
(2008) The branching programme of mouse lung development
Nature 453:745–750.
https://doi.org/10.1038/nature07005
- PubMed
- Google Scholar
1. Muzumdar MD
2. Tasic B
3. Miyamichi K
4. Li L
5. Luo L
(2007) A global double-fluorescent Cre reporter mouse
Genesis (New York, N.Y 45:593–605.
https://doi.org/10.1002/dvg.20335
- PubMed
- Google Scholar
1. Nguyen TT
2. Oh SS
3. Weaver D
4. Lewandowska A
5. Maxfield D
6. Schuler MH
7. Smith NK
8. Macfarlane J
9. Saunders G
10. Palmer CA
11. Debattisti V
12. Koshiba T
13. Pulst S
14. Feldman EL
15. Hajnóczky G
16. Shaw JM
(2014) Loss of Miro1-directed mitochondrial movement results in a novel murine model for neuron disease
PNAS 111:E3631–E3640.
https://doi.org/10.1073/pnas.1402449111
- PubMed
- Google Scholar
(1999) Radiation pneumonitis: the model of interstitial edema
Experimental and Toxicologic Pathology 51:491–493.
https://doi.org/10.1016/S0940-2993(99)80122-5
- PubMed
- Google Scholar
(2019) Comprehensive anatomic ontologies for lung development: A comparison of alveolar formation and maturation within mouse and human lung
Journal of Biomedical Semantics 10:e209.
https://doi.org/10.1186/s13326-019-0209-1
- PubMed
- Google Scholar
1. Patel AR
2. Patel AR
3. Singh S
4. Singh S
5. Khawaja I
(2019) Global Initiative for Chronic Obstructive Lung Disease: The Changes Made
Cureus 11:e4985.
https://doi.org/10.7759/cureus.4985
- PubMed
- Google Scholar
1. Ramirez RD
2. Sheridan S
3. Girard L
4. Sato M
5. Kim Y
6. Pollack J
7. Peyton M
8. Zou Y
9. Kurie JM
10. Dimaio JM
11. Milchgrub S
12. Smith AL
13. Souza RF
14. Gilbey L
15. Zhang X
16. Gandia K
17. Vaughan MB
18. Wright WE
19. Gazdar AF
20. Shay JW
21. Minna JD
(2004) Immortalization of human bronchial epithelial cells in the absence of viral oncoproteins
Cancer Research 64:9027–9034.
https://doi.org/10.1158/0008-5472.CAN-04-3703
- PubMed
- Google Scholar
1. Reynolds A
2. Leake D
3. Boese Q
4. Scaringe S
5. Marshall WS
6. Khvorova A
(2004) Rational siRNA design for RNA interference
Nature Biotechnology 22:326–330.
https://doi.org/10.1038/nbt936
- PubMed
- Google Scholar
(2021) Alveologenesis: What Governs Secondary Septa Formation
International Journal of Molecular Sciences 22:12107.
https://doi.org/10.3390/ijms222212107
- PubMed
- Google Scholar
(2018) Understanding alveolarization to induce lung regeneration
Respiratory Research 19:148.
https://doi.org/10.1186/s12931-018-0837-5
- PubMed
- Google Scholar
1. Roesch K
2. Jadhav AP
3. Trimarchi JM
4. Stadler MB
5. Roska B
6. Sun BB
7. Cepko CL
(2008) The transcriptome of retinal Müller glial cells
The Journal of Comparative Neurology 509:225–238.
https://doi.org/10.1002/cne.21730
- PubMed
- Google Scholar
1. Rubtsov YP
2. Rasmussen JP
3. Chi EY
4. Fontenot J
5. Castelli L
6. Ye X
7. Treuting P
8. Siewe L
9. Roers A
10. Henderson WR Jr
11. Muller W
12. Rudensky AY
(2008) Regulatory T cell-derived interleukin-10 limits inflammation at environmental interfaces
Immunity 28:546–558.
https://doi.org/10.1016/j.immuni.2008.02.017
- PubMed
- Google Scholar
1. Ruzzenente B
2. Metodiev MD
3. Wredenberg A
4. Bratic A
5. Park CB
6. Cámara Y
7. Milenkovic D
8. Zickermann V
9. Wibom R
10. Hultenby K
11. Erdjument-Bromage H
12. Tempst P
13. Brandt U
14. Stewart JB
15. Gustafsson CM
16. Larsson N-G
(2012) LRPPRC is necessary for polyadenylation and coordination of translation of mitochondrial mRNAs
The EMBO Journal 31:443–456.
https://doi.org/10.1038/emboj.2011.392
- PubMed
- Google Scholar
1. Ryter SW
2. Rosas IO
3. Owen CA
4. Martinez FJ
5. Choi ME
6. Lee CG
7. Elias JA
8. Choi AMK
(2018) Mitochondrial Dysfunction as a Pathogenic Mediator of Chronic Obstructive Pulmonary Disease and Idiopathic Pulmonary Fibrosis
Annals of the American Thoracic Society 15:S266–S272.
https://doi.org/10.1513/AnnalsATS.201808-585MG
- PubMed
- Google Scholar
1. Sánchez-Rivera FJ
2. Papagiannakopoulos T
3. Romero R
4. Tammela T
5. Bauer MR
6. Bhutkar A
7. Joshi NS
8. Subbaraj L
9. Bronson RT
10. Xue W
11. Jacks T
(2014) Rapid modelling of cooperating genetic events in cancer through somatic genome editing
Nature 516:428–431.
https://doi.org/10.1038/nature13906
- PubMed
- Google Scholar
(2014) Mitochondria in lung biology and pathology: more than just a powerhouse
American Journal of Physiology. Lung Cellular and Molecular Physiology 306:L962–L974.
https://doi.org/10.1152/ajplung.00073.2014
- PubMed
- Google Scholar
(2010) mTORC1 controls fasting-induced ketogenesis and its modulation by ageing
Nature 468:1100–1104.
https://doi.org/10.1038/nature09584
- PubMed
- Google Scholar
(2021) Mitochondrial dynamics, positioning and function mediated by cytoskeletal interactions
Cellular and Molecular Life Sciences 78:3969–3986.
https://doi.org/10.1007/s00018-021-03762-5
- PubMed
- Google Scholar
(2015) Recent advances in the mechanisms of lung alveolarization and the pathogenesis of bronchopulmonary dysplasia
American Journal of Physiology. Lung Cellular and Molecular Physiology 309:L1239–L1272.
https://doi.org/10.1152/ajplung.00268.2015
- PubMed
- Google Scholar
1. Sun T
2. Jayatilake D
3. Afink GB
4. Ataliotis P
5. Nistér M
6. Richardson WD
7. Smith HK
(2000) A human YAC transgene rescues craniofacial and neural tube development in PDGFRalpha knockout mice and uncovers A role for PDGFRalpha in prenatal lung growth
Development (Cambridge, England) 127:4519–4529.
https://doi.org/10.1242/dev.127.21.4519
- PubMed
- Google Scholar
(2016) Genetic tools for identifying and manipulating fibroblasts in the mouse
Differentiation; Research in Biological Diversity 92:66–83.
https://doi.org/10.1016/j.diff.2016.05.009
- PubMed
- Google Scholar
(2019) Mitochondrial fusion is required for spermatogonial differentiation and meiosis
eLife 8:e51601.
https://doi.org/10.7554/eLife.51601
- PubMed
- Google Scholar
1. Venegas V
2. Halberg MC
(2012) Measurement of mitochondrial DNA copy number
Methods in Molecular Biology (Clifton, N.J.) 837:327–335.
https://doi.org/10.1007/978-1-61779-504-6_22
- PubMed
- Google Scholar
1. Vila Ellis L
2. Cain MP
3. Hutchison V
4. Flodby P
5. Crandall ED
6. Borok Z
7. Zhou B
8. Ostrin EJ
9. Wythe JD
10. Chen J
(2020) Epithelial Vegfa Specifies a Distinct Endothelial Population in the Mouse Lung
Developmental Cell 52:617–630.
https://doi.org/10.1016/j.devcel.2020.01.009
- PubMed
- Google Scholar
1. Ware LB
2. Wang Y
3. Fang X
4. Warnock M
5. Sakuma T
6. Hall TS
7. Matthay M
(2002) Assessment of lungs rejected for transplantation and implications for donor selection
Lancet (London, England) 360:619–620.
https://doi.org/10.1016/s0140-6736(02)09774-x
- PubMed
- Google Scholar
1. Whitsett JA
2. Weaver TE
(2015) Alveolar Development and Disease
American Journal of Respiratory Cell and Molecular Biology 53:1–7.
https://doi.org/10.1165/rcmb.2015-0128PS
- PubMed
- Google Scholar
1. Yona S
2. Kim K-W
3. Wolf Y
4. Mildner A
5. Varol D
6. Breker M
7. Strauss-Ayali D
8. Viukov S
9. Guilliams M
10. Misharin A
11. Hume DA
12. Perlman H
13. Malissen B
14. Zelzer E
15. Jung S
(2013) Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis
Immunity 38:79–91.
https://doi.org/10.1016/j.immuni.2012.12.001
- PubMed
- Google Scholar
1. Yu K
2. Xu J
3. Liu Z
4. Sosic D
5. Shao J
6. Olson EN
7. Towler DA
8. Ornitz DM
(2003) Conditional inactivation of FGF receptor 2 reveals an essential role for FGF signaling in the regulation of osteoblast function and bone growth
Development (Cambridge, England) 130:3063–3074.
https://doi.org/10.1242/dev.00491
- PubMed
- Google Scholar
1. Zhang K
2. Yao E
3. Lin C
4. Chou Y-T
5. Wong J
6. Li J
7. Wolters PJ
8. Chuang P-T
(2020) A mammalian Wnt5a-Ror2-Vangl2 axis controls the cytoskeleton and confers cellular properties required for alveologenesis
eLife 9:e53688.
https://doi.org/10.7554/eLife.53688
- PubMed
- Google Scholar

Decision letter

Melanie Königshoff

Reviewing Editor; University of Pittsburgh, United States
Edward E Morrisey

Senior Editor; University of Pennsylvania, United States
David N Cornfield

Reviewer; Stanford University School of Medicine, United States

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Acquisition of cellular properties during alveolar formation requires differential activity and distribution of mitochondria" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen Edward Morrisey as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: David N Cornfield (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

This manuscript explores the under-investigated role of mitochondrial activity and subcellular distribution for alveolar formation by using a variety of transgenic mouse models to delete two specific mitochondrial proteins. While largely descriptive, the data support a role for mitochondria distribution and function postnatal lung development in the mice. However, the experimental design and analysis as well as conclusions drawn within the manuscript raises several concerns, which are outlined below. The following points need to be addressed:

1) It remains unclear whether the effects of deleting the two mitochondrial molecules of interest may represent a general phenomenon as opposed to a specific effect in lung alveolarization. Please provide evidence of cell specific effect as well as evidence that the cells remain healthy in the face of the genetic manipulations. In detail, additional data/experiments to further characterize potential cell-specific effects/impairments upon genetic modulation including apoptosis/ viability and expression of cell-specific functional marker/transcriptional activity are required to significantly improve the manuscript. Further in vivo experiments using a non-structural (immune) cell driver could be helpful to understand whether this is a generalizable phenomenon or not.

2) Similarly, cell-specific effects can be further explored using vitro studies that need to be strengthened by gain- and loss-of-function experiments (potentially in human primary cells).

3) Additional parameters of lung histology, including radial alveolar count and septal thickness are required to evaluate the lung structure and function.

4) Currently insufficient data showing mitochondrial dysfunction upon knockdown, additional experiments to show that mitochondria are dysfunctional are needed.

5) Human disease link is currently vague and further clarification is needed on how these reported mitochondrial changes are unique to COPD/emphysema in comparison to other chronic lung diseases,

Reviewer #1 (Recommendations for the authors):

It would significantly enhance the manuscript if the mechanisms suggested based on the in vivo mouse data would have been expanded on, in particular with respect to a potential human disease. For example, using primary fibroblasts and performing additional gain and loss of function studies on Miro1 and Tfam and investigation of the cellular (mitochondrial) signaling as well as functional consequence, would be helpful.

With respect to COPD/emphysema, further clarification is needed on how these reported mitochondrial changes are unique to COPD/emphysema in comparison to other chronic lung diseases, for which mitochondrial dysfunction has been reported. Given the reported relevance for postnatal development, diseases such as bronchopulmonary dysplasia are important to discuss.

Reviewer #2 (Recommendations for the authors):

This manuscript provides a novel insight that mitochondria bring impact on alveolar formation. However, there are following questions and concerns to be addressed:

1. The current conclusion on defective alveologenesis as a consequence of mitochondrial dysfunction is questionable due to insufficient data showing mitochondrial dysfunction. Confirmation studies on mitochondrial function (eg. Oroboros assay, ATP assay) are required. Furthermore, mitochondrial network analysis is essential for confirming the alteration of mitochondrial activity and dynamic distribution.

2. Since mouse line of Tfam^f/f; Pdgfa^ex4COIN/+; Sox9^Cre/+ cannot properly indicates Pdgfa expression, please use both mouse line of Pdgfa^ex4COIN/+; Sox9^Cre/+ and mouse line of Tfam^f/f; Sox9^Cre/+ as control groups or measure the PDGF expression via other techniques.

3. It is interesting that COPD/emphysema patients show decreased mitochondrial copy number and TFAM protein levels. However, it would be better if authors further analyze these alterations upon cell types. Moreover, please discuss how mitochondrial alterations and disrupted secondary septa formation link to COPD/emphysema pathogenesis.

4. Lentiviral transduction efficiency is critical for the data quality of PDGF levels. Please provide it.

5. Please provide Western blotting images used for quantification in Figure 7E, Figure 8C and Figure 8E.

Reviewer #3 (Recommendations for the authors):

Overall, there is a great deal of merit to the study. Demonstration that the effects are cell specific, and not the result of a generalized phenomena would be helpful. To this end, demonstration that the cell with altered mitochondria are otherwise robust would benefit the manuscript. In addition, demonstration that some cellular constituent of the alveolar still carries out its biological role in the face of compromised mitochondrial function or number, and that alveolarization is unperturbed would be important. In the current form, it is difficult to distinguish a cell-specific effect. Given these limitations, a more focused Discussion, clearly addressing these limitations would be helpful.

Further, the histologic analysis of the lung should be more comprehensive and include radial alveolar counts as well as septal thickness. Mean linear intercept addresses the size of the alveolus, but not number, even though these parameters often track one another. More well curated markers of different cell types to highlight the specificity of the drivers used would be helpful.

1. In the Results section, Figure 1, Sox9 was used as a specific marker for lung epithelial cells. Is it specific? If so, which of the epithelial are Sox9 expressors, alveolar type 1, type 2, both?

2. In the same section, the authors comment that myofibroblasts are marked by PDGFRA, PDGF receptor and smooth muscle actin. What is the distinction between each of the first two markers?

3. Relative to the mitochondria, cells require energy to function, so the need to mitochondria is anticipated. Are the authors suggesting a cell-specific effect? Further, is the inhomogeneous distribution of mitochondria within the cells of interest in contrast with homogeneous distribution in cells less dependent upon the mitochondria?

4. What were the alveolar defects aside an increase in mean linear intercept? For example, was septal thickness affected? Alternatively, was radial alveolar count affected?

5. On page7, the authors state "Moreover, histological analysis revealed no difference between control and mutant lungs prior to P5…" there certainly appears to be histologic differences in terms of septal thickness. Given the differences in histologic appearance it seems that lung histology, perhaps mesenchymal histology, was affected by inactivating Tfam in SOX9⁺ cells

6. While Miro1^f/f; Sox9Cre/+ mice had alterations in the distribution of mitochondria, were absolute numbers of mitochondria decreased as well? Again, lung histology does appear different at P5, even though not in terms of mean linear intercept. Overall, the manuscript would benefit from additional parameters of lung histology, including radial alveolar count and septal thickness.

7. Relative to the mesenchymal studies using the Pdgfra driver, which cell or cellular constituents in the mesenchyme are being affected? The mesenchyme includes multiple, distinct cell types including transcriptomically distinct fibroblasts, myofibroblasts, and airway smooth muscle cells.

8. In the myofibroblast migration assays, was there a rescue component to the experiment? Alternatively, was loss of migratory capacity interrogated other than through decreases in mitochondrial number, function? IN general, the in vitro studies could be strengthened by gain- and loss-of-function components.

9. Relative to the lung histology, it is important to standardize tissue acquisition, especially inflation of the lung. Detail surrounding how this was done would be helpful.

10. In Figure 8, the results are normalized to the controls. If the absolute data are presented, as opposed to % of control, are the differences significant?

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Acquisition of cellular properties during alveolar formation requires differential activity and distribution of mitochondria" for further consideration by eLife. Your revised article has been evaluated by Edward Morrisey (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below. Specifically, the concerns related to cell specificity has not been addressed and the fact that no direct evidence is provided to show that modulation of mitochondrial function in other cells will not affect on lung structure/alveolarization. This is a critical point. Additional concerns about the clarity and interpretation will further need to be addressed.

Reviewer #2 (Recommendations for the authors):

The authors have answered most of the questions raised in the previous reviews and revised the manuscript.

Reviewer #3 (Recommendations for the authors):

The rebuttal response addresses components of the concerns of the reviewers. However, the most fundamental concern remains unaddressed. Specifically, is there a cell intrinsic to lung structure wherein mitochondrial function is diminished that has no effect on secondary septation. In the reply, the authors point out that the saccular stage might be unaffected (Figure 3), but not evidence that alveolarization is preserved despite genetic deletion. It seems that the lines of evidence presented are each indirect. The concern about cell specificity was the central concern expressed by 2 of 3 reviewers. It seems that such data is critical in order to defend the claims of cell specificity.

The addition of data demonstrating mitochondrial dysfunction is helpful

The additional lung histology is helpful. Do the differences in septal thicknesses merit comment?

Why is the observation that saccular formation is unperturbed while alveolarization is compromised a reflection of differential energy requirements as opposed to involvement of different cells at specific stages of lung development?

The authors comment about BPD in the abstract. Might the cell specific compromise in mitochondrial function have implications for BPD?

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Acquisition of cellular properties during alveolar formation requires differential activity and distribution of mitochondria" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Edward Morrisey as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

The manuscript is much improved by including the additional data. Reviewer 3 raises important concerns that we ask you to address in the manuscript text throughout as well as by specifically revising your conclusions and clearly stating the limitations regarding epithelial cell-specificity for the effects observed. No additional experiments are required. This paper will be of interest to the large class of scientists interested in lung development and disease. It explores the under-investigated role of mitochondrial activity and subcellular distribution for alveolar formation, by using a variety of transgenic mouse models to delete two specific mitochondrial proteins. While largely descriptive, the data support a role for mitochondria distribution and function in postnatal lung development in the mice.

Reviewer #3 (Recommendations for the authors):

The present revision includes a number of well performed and carefully considered experiments. The authors have responded to the concerns raised in each of the prior reviews. However, the primary concern persists. Specifically, the authors argue that in Sox9 expressing epithelial cells mitochondrial distribution and activity have specific effects on secondary septation of the lung. Doubtless, the manuscript includes a rich set of experiments. The authors definitively demonstrate that compromising mitochondrial activity and distribution in Sox9 expressing epithelial cells decreases secondary septation. However, it does not seem to this Reviewer that the authors can make the claims of specificity outlined in the manuscript. To make such a claim, it would be important, as stated in the prior reviews, by more than one Reviewer, to demonstrate that loss of mitochondrial activity and altered distribution in another cell type in the lung has no effect on alveolarization. The demonstration that loss of mitochondrial activity non-structural immune cells is helpful, these T-cells compromise a very small percentage of the overall immune population and remain naive through ~ P21. Moreover, there are no reports of a lung phenotype in mice wherein T-cells are deleted; if deleting cells has no effect on alveolarization, then certainly decreasing mitochondrial activity would have no effect. A non-structural immune cell, such as macrophages would be far more meaningful proof of concept.

Relative to claims of specificity regarding use of a Pdgra promoter to effect myofibroblasts problematic. As the authors point out, fibroblasts, adventitial fibroblasts, and adventitial fibroblasts (transcriptionally distinct subpopulations) all express Pdgfra and thus the knockout is certainly effecting cells other than the myofibroblasts.

What is the basis for the contention that septal thickness is a more sensitive indicator of secondary septation? Thinning of the septae is a component of lung maturation, but not specifically secondary septation.

Transcriptomically distinct cell subtypes emerge during the transition from saccular to alveolar stages. This has been shown in multiple papers. Thus, it remains unclear just why the authors insist that the absence of effects during the saccular stage proves differential energy requirements in the same cells as opposed to involvement of alternative cells.

Though not appreciated by the authors, radial alveolar count is distinct from mean linear intercept and represents a more direct method to secondary septae, the outcome measure of primary concern in the present manuscript.

In Figure 6, line 940, how do the authors know the cells were myofibroblasts?

Finally, in Figure 8, it appears that panels b,c, and e are normalized so that the controls = 1. Are findings still significant if the absolute values are compared?

https://doi.org/10.7554/eLife.68598.sa1

Author response

Essential revisions:

This manuscript explores the under-investigated role of mitochondrial activity and subcellular distribution for alveolar formation by using a variety of transgenic mouse models to delete two specific mitochondrial proteins. While largely descriptive, the data support a role for mitochondria distribution and function postnatal lung development in the mice. However, the experimental design and analysis as well as conclusions drawn within the manuscript raises several concerns, which are outlined below. The following points need to be addressed:

1) It remains unclear whether the effects of deleting the two mitochondrial molecules of interest may represent a general phenomenon as opposed to a specific effect in lung alveolarization. Please provide evidence of cell specific effect as well as evidence that the cells remain healthy in the face of the genetic manipulations. In detail, additional data/experiments to further characterize potential cell-specific effects/impairments upon genetic modulation including apoptosis/ viability and expression of cell-specific functional marker/transcriptional activity are required to significantly improve the manuscript. Further in vivo experiments using a non-structural (immune) cell driver could be helpful to understand whether this is a generalizable phenomenon or not.

Multiple pieces of data in the original submission suggest that a reduction in mitochondrial function does not exert a uniform effect on various cell types or tissues. While ATP production by mitochondria is essential for proper functioning of all cell types and tissues, our results suggest that their requirement of ATP levels varies, depending on the cell type and the developmental stage. Employment of appropriate mouse Cre lines is critical to reducing mitochondrial function in the targeted cell types and stages.

1) Removal of murine Tfam by Sox9-Cre in the lung epithelium or Miro1 (Rhot1) by Pdgfra-Cre in the lung mesenchyme did not affect the number and distribution of club cells, ciliated cells, alveolar type I cells and type II cells (Figure 3—figure supplement 2 and Figure 5—figure supplement 1).

2) Loss of Tfam or Miro1 in the lung epithelium or mesenchyme did not perturb saccule formation (Figure 3A, 3G, 5A, 5G).

3) Myofibroblast proliferation was unaltered for a certain period of time following Tfam or Miro1 removal in the lung epithelium or mesenchyme (Figure 4D, 6B, 6F).

4) The expression of Pdgfa (mainly in alveolar epithelial cells) and PDGFRA (in alveolar fibroblasts/myofibroblasts) was largely unchanged in the absence of epithelial Tfam or Miro1 or mesenchymal Miro1 (Figure 4E, 4J, 6G).

5) The rate of apoptosis was similar between control and Tfam- or Miro1-deficient lungs (Figure 3—figure supplement 3 and Figure 5—figure supplement 2).

Moreover, we have produced Tfam^f/f; Foxp3^Cre/+ mice in which Tfam was inactivated by Foxp3-Cre in T cells. These mice did not exhibit alveolar defects (Figure 3—figure supplement 5), further supporting differential requirement of ATP levels. This is also consistent with data in the published literature, where immune defects but not alveolar defects in Tfam^f/f; Foxp3^Cre/+ mice were noted.

2) Similarly, cell-specific effects can be further explored using vitro studies that need to be strengthened by gain- and loss-of-function experiments (potentially in human primary cells).

As suggested by the reviewers, we have conducted gain- and loss-of-function studies on TFAM and MIRO1 in both human lung epithelial cells and human lung fibroblasts. Assays were focused on PDGF secretion from epithelial cells and cell migration of fibroblasts. Results from the experiments using human lung cells (Figure 8F, 8G, Figure 8—figure supplement 3) affirmed the findings obtained in mouse cells and mouse lungs.

3) Additional parameters of lung histology, including radial alveolar count and septal thickness are required to evaluate the lung structure and function.

We have measured both the radial alveolar account and septal thickness as suggested by the reviewers. Since the methodology of measuring radial alveolar count is similar to that of mean linear intercept, the result of radial alveolar count parallels that of mean linear intercept as expected. The septal thickness was reduced in Tfam- and Miro1-deficient lungs as shown in Figure 3C, 3I and Figure 5C, 5I in the revised manuscript.

4) Currently insufficient data showing mitochondrial dysfunction upon knockdown, additional experiments to show that mitochondria are dysfunctional are needed.

In the revision, we have provided additional data on mitochondrial dysfunction in the mutant lungs. They include assays that determine changes in the regulators of mitochondrial fusion and fission (Figure 3—figure supplement 4), mitochondrial network (Figure 6—figure supplement 1), enzymatic activities of mitochondrial complexes 1 and 4 (Figure 3E, 3K, 5E, 5K), and ATP production (Figure 3F, 3L, 5F, 5L).

5) Human disease link is currently vague and further clarification is needed on how these reported mitochondrial changes are unique to COPD/emphysema in comparison to other chronic lung diseases,

While mitochondrial dysfunction is associated with human COPD/emphysema, it is difficult to establish a causal relationship, a general problem in studying human diseases. Nevertheless, we have speculated in the revised manuscript how mitochondrial dysfunction in lung epithelial cells may affect epithelial function and subsequently mesenchymal cell properties. Disturbance in epithelial and mesenchymal cells could contribute to the pathogenesis of COPD/emphysema.

Reviewer #1 (Recommendations for the authors):

It would significantly enhance the manuscript if the mechanisms suggested based on the in vivo mouse data would have been expanded on, in particular with respect to a potential human disease. For example, using primary fibroblasts and performing additional gain and loss of function studies on Miro1 and Tfam and investigation of the cellular (mitochondrial) signaling as well as functional consequence, would be helpful.

As suggested by the reviewer, we have conducted gain- and loss-of-function studies on TFAM and MIRO1 (RHOT1) in both human lung epithelial cells and human lung fibroblasts. Assays were focused on PDGF secretion from epithelial cells and cell migration of fibroblasts. Results from the experiments using human lung cells (Figure 8F, 8G, Figure 8—figure supplement 3) affirmed the findings obtained in mouse cells and mouse lungs.

With respect to COPD/emphysema, further clarification is needed on how these reported mitochondrial changes are unique to COPD/emphysema in comparison to other chronic lung diseases, for which mitochondrial dysfunction has been reported. Given the reported relevance for postnatal development, diseases such as bronchopulmonary dysplasia are important to discuss.

Reviewer #2 (Recommendations for the authors):

This manuscript provides a novel insight that mitochondria bring impact on alveolar formation. However, there are following questions and concerns to be addressed:

1. The current conclusion on defective alveologenesis as a consequence of mitochondrial dysfunction is questionable due to insufficient data showing mitochondrial dysfunction. Confirmation studies on mitochondrial function (eg. Oroboros assay, ATP assay) are required. Furthermore, mitochondrial network analysis is essential for confirming the alteration of mitochondrial activity and dynamic distribution.

As suggested by the reviewer, in the revision, we have provided additional data on mitochondrial dysfunction in control and Tfam- and Miro1 (Rhot1)-deficient lungs using select mouse Cre lines. They include assays that determine the enzymatic activities of mitochondrial complexes 1 and 4 (Figure 3E, 3K, 5E, 5K) and ATP production (Figure 3F, 3L, 5F, 5L) in control and mutant lungs. We have also analyzed the mitochondrial network in control and mutant cells (Figure 6—figure supplement 1.

2. Since mouse line of Tfam^f/f; Pdgfa^ex4COIN/+; Sox9^Cre/+ cannot properly indicates Pdgfa expression, please use both mouse line of Pdgfa^ex4COIN/+; Sox9^Cre/+ and mouse line of Tfam^f/f; Sox9^Cre/+ as control groups or measure the PDGF expression via other techniques.

In Figure 4C, the complete genotype of the control mouse is Sox9^Cre/+; Pdgfa^ex4COIN/+, which has been clarified. We have also included Pdgfa^ex4COIN/+ and Tfam^f/f; Sox9^Cre/+ lungs as controls (Figure 4—figure supplement 1). The transcript levels of Pdgfa is shown in Figure 4E as an alternative means to measure PDGFA expression.

3. It is interesting that COPD/emphysema patients show decreased mitochondrial copy number and TFAM protein levels. However, it would be better if authors further analyze these alterations upon cell types. Moreover, please discuss how mitochondrial alterations and disrupted secondary septa formation link to COPD/emphysema pathogenesis.

We were unable to secure a sufficient number of cell lines derived from COPD/emphysema patients for analysis of alterations in different cell types. As an alternative approach, we employed human lung epithelial cells and lung fibroblasts. Gain- and loss-of-function studies on TFAM and MIRO1 were conducted in human lung epithelial cells and human lung fibroblasts. Assays were focused on PDGF secretion from epithelial cells and cell migration of fibroblasts. Results from the experiments using human lung cells (Figure 8F, 8G, Figure 8—figure supplement 3) affirmed the findings obtained in mouse cells and mouse lungs.

We have added discussions on the relationship between mitochondrial alteration, disrupted secondary septation and COPD/emphysema pathogenesis in the revised manuscript.

4. Lentiviral transduction efficiency is critical for the data quality of PDGF levels. Please provide it.

We have added data on lentiviral transduction efficiency in Figure 4—figure supplement 1. The efficiency of lentiviral transduction was not affected by the loss of Tfam or Miro1.

5. Please provide Western blotting images used for quantification in Figure 7E, Figure 8C and Figure 8E.

We have provided Westerns blotting images in Figure 7—figure supplement 1 and Figure 8—figure supplement 2.

Reviewer #3 (Recommendations for the authors):

Overall, there is a great deal of merit to the study. Demonstration that the effects are cell specific, and not the result of a generalized phenomena would be helpful. To this end, demonstration that the cell with altered mitochondria are otherwise robust would benefit the manuscript. In addition, demonstration that some cellular constituent of the alveolar still carries out its biological role in the face of compromised mitochondrial function or number, and that alveolarization is unperturbed would be important. In the current form, it is difficult to distinguish a cell-specific effect. Given these limitations, a more focused Discussion, clearly addressing these limitations would be helpful.

Further, the histologic analysis of the lung should be more comprehensive and include radial alveolar counts as well as septal thickness. Mean linear intercept addresses the size of the alveolus, but not number, even though these parameters often track one another. More well curated markers of different cell types to highlight the specificity of the drivers used would be helpful.

1. In the Results section, Figure 1, Sox9 was used as a specific marker for lung epithelial cells. Is it specific? If so, which of the epithelial are Sox9 expressors, alveolar type 1, type 2, both?

It is known that Sox9-Cre, Shh-Cre, Nkx2.1-Cre and SPC-Cre can label most lung epithelial cells (but not lung mesenchymal cells) through a reporter such as ROSA26^mTmG. Thus, alveolar type I and type II cells would be labeled by GFP in Sox9^Cre/+; ROSA26^mTmG/+ lungs. This point has been described in our earlier publications (e.g., Zhang et al. eLife, 2020) and those from other groups.

2. In the same section, the authors comment that myofibroblasts are marked by PDGFRA, PDGF receptor and smooth muscle actin. What is the distinction between each of the first two markers?

In alveolar myofibroblasts, smooth muscle actin (SMA or ACTA2) can only be detected by immunostaining from P3 to P12. After P10, SMA expression sharply decreases in alveolar myofibroblasts, but is retained in airway smooth muscle or vascular smooth muscle cells. Unlike SMA, PDGFRA expression persists in alveolar myofibroblasts.

3. Relative to the mitochondria, cells require energy to function, so the need to mitochondria is anticipated. Are the authors suggesting a cell-specific effect? Further, is the inhomogeneous distribution of mitochondria within the cells of interest in contrast with homogeneous distribution in cells less dependent upon the mitochondria?

Tfam removal reduces but does not completely obliterate ATP production. ~30–50% reduction in ATP levels in the whole lungs was observed (Figure 3F, 3L and Figure 5F, 5L). This is expected since all cells require ATP for proper functioning. We anticipate that a partial reduction in ATP levels will preferentially affect cellular processes with a higher energy demand. We showed that loss of epithelial or mesenchymal Tfam resulted in alveolar defects but not branching morphogenesis or saccule formation. This implies that secondary septation requires higher ATP levels compared to other cellular processes. We speculate that ligand secretion from the lung epithelium and myofibroblast contraction and migration have a greater demand for ATP. Consistent with this notion, mitochondria in alveolar epithelial cells accumulate in regions close to the trans Golgi network, while mitochondria in alveolar myofibroblasts concentrate in areas near the smooth muscle actin. Inhomogeneous distribution of mitochondria in a given cell type may be an indicator of higher energy demand for that cell type.

4. What were the alveolar defects aside an increase in mean linear intercept? For example, was septal thickness affected? Alternatively, was radial alveolar count affected?

In Tfam or Miro1 mutant mice using select Cre lines, the proliferation rate of alveolar myofibroblasts was decreased. This would reduce mesenchymal cell number in the primary septa. Thus, the septal thickness could serve to characterize the alveolar defect, in addition to the mean linear intercept. The septal thickness was reduced in Tfam- and Miro1 (Rhot1)-deficient lungs as shown in Figure 3C, 3I and Figure 5C, 5I in the revised manuscript.

Since the methodology of measuring radial alveolar count is similar to that of mean linear intercept, the result of radial alveolar count parallels that of mean linear intercept as expected.

5. On page7, the authors state "Moreover, histological analysis revealed no difference between control and mutant lungs prior to P5…" there certainly appears to be histologic differences in terms of septal thickness. Given the differences in histologic appearance it seems that lung histology, perhaps mesenchymal histology, was affected by inactivating Tfam in SOX9⁺ cells

We stated that there is no apparent difference between control and mutant (Tfam^f/f; Sox9^Cre/+) lungs prior to P5. At P5, lung phenotypes in certain regions of mutant lungs could be discerned as shown in Figure 3A. Since the lung phenotype in the mutants at P5 was relatively mild and non-uniform, MLI, an indicator of the average airspace, was similar between control and mutant lungs. Nevertheless, measurement of septal thickness at P5 did reveal a difference between control and mutant lungs as shown in Figure 3C.

6. While Miro1^f/f; Sox9^Cre/+ mice had alterations in the distribution of mitochondria, were absolute numbers of mitochondria decreased as well? Again, lung histology does appear different at P5, even though not in terms of mean linear intercept. Overall, the manuscript would benefit from additional parameters of lung histology, including radial alveolar count and septal thickness.

We did not observe an alteration in the mtDNA/nDNA ratio in Miro1^f/f; Sox9^Cre/+ lungs. This suggests that the absolute number of mitochondria was unaffected in the absence of epithelial Miro1. This piece of data is shown in Figure 3J of the revised manuscript.

We have measured both the radial alveolar account and septal thickness as suggested by the reviewer. Since the methodology of measuring radial alveolar count is similar to that of mean linear intercept, the result of radial alveolar count parallels that of mean linear intercept as expected. The septal thickness was reduced in Tfam- and Miro1-deficient lungs as shown in Figure 3C, 3I and Figure 5C, 5I in the revised manuscript.

7. Relative to the mesenchymal studies using the Pdgfra driver, which cell or cellular constituents in the mesenchyme are being affected? The mesenchyme includes multiple, distinct cell types including transcriptomically distinct fibroblasts, myofibroblasts, and airway smooth muscle cells.

In Tfam^f/f; Pdgfra^Cre/+ and Miro1^f/f; Pdgfra^Cre/+ lungs, we did not observe an apparent defect in airway smooth muscle cells and vascular smooth muscle cells. No difference in differentiation, migration, structure and marker expression could be discerned between control and mutant lungs. By contrast, alveolar fibroblasts/myofibroblasts were the main cell type affected in the mutant lungs.

8. In the myofibroblast migration assays, was there a rescue component to the experiment? Alternatively, was loss of migratory capacity interrogated other than through decreases in mitochondrial number, function? IN general, the in vitro studies could be strengthened by gain- and loss-of-function components.

We have added rescue data for the myofibroblast migration assay in Figure 6—figure supplement 2.

We have also included gain- and loss-of-function studies on TFAM and MIRO1 in the revised manuscript. These experiments were conducted in human lung epithelial and fibroblast cell lines and presented in Figure 8F, 8G and Figure 8—figure supplement 3.

9. Relative to the lung histology, it is important to standardize tissue acquisition, especially inflation of the lung. Detail surrounding how this was done would be helpful.

In this study, acquisition of all tissues (including the lungs) followed a standardized procedure as detailed in Materials and methods. Of note, we did not inflate the lungs to avoid mechanical distortion of the lung structure.

10. In Figure 8, the results are normalized to the controls. If the absolute data are presented, as opposed to % of control, are the differences significant?

When the absolute data, instead of % of control, were used for statistical analysis, the same p value was obtained.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below. Specifically, the concerns related to cell specificity has not been addressed and the fact that no direct evidence is provided to show that modulation of mitochondrial function in other cells will not affect on lung structure/alveolarization. This is a critical point. Additional concerns about the clarity and interpretation will further need to be addressed.

Reviewer #3 (Recommendations for the authors):

The rebuttal response addresses components of the concerns of the reviewers. However, the most fundamental concern remains unaddressed. Specifically, is there a cell intrinsic to lung structure wherein mitochondrial function is diminished that has no effect on secondary septation. In the reply, the authors point out that the saccular stage might be unaffected (Figure 3), but not evidence that alveolarization is preserved despite genetic deletion. It seems that the lines of evidence presented are each indirect. The concern about cell specificity was the central concern expressed by 2 of 3 reviewers. It seems that such data is critical in order to defend the claims of cell specificity.

In Essential Revisions, Q1 of the first round of review, it was suggested that “Further in vivo experiments using a non-structural (immune) cell driver could be helpful to understand whether this is a generalizable phenomenon or not.” We have conducted this experiment and produced Tfam^f/f; Foxp3^Cre/+ mice in which Tfam was inactivated by Foxp3-Cre in T cells. These mice did not exhibit alveolar defects (Figure 3—figure supplement 5). Since then, we have also generated Tfam^f/f; Cd4^Cre/+ mice to remove Tfam in T cells using Cd4-Cre. These mice also did not display alveolar defects (revised Figure 3—figure supplement 5).

Since mitochondrial function is essential for all cells, we anticipate that reduced mitochondrial function in any structural component of the secondary septa would lead to alveolar defects. We would like to point out that our study provides key insights into how mitochondrial activity and distribution control certain cellular processes in different components of the secondary septa that are critical for secondary septation. As mentioned in the previous response, not all aspects of cellular processes are affected in Tfam-deficient cells. For instance, expression of Pdgfa and PDGFRA, proliferation and apoptosis, and saccule formation (also see below) do not seem to be affected.

In response to the reviewer’s comment, we have revised the text to indicate the susceptibility of structural vs. non-structural components of the secondary septa to reduced mitochondrial function.

The addition of data demonstrating mitochondrial dysfunction is helpful

We appreciate the reviewer’s comment.

The additional lung histology is helpful. Do the differences in septal thicknesses merit comment?

In the first revision, we stated that “…various postnatal stages revealed defects in secondary septa formation with an increased MLI (Figure 3A, 3B) and reduced septal thickness (Figure 3C)“. In response to the reviewer’s comment, we have now added “Septal thickness is more sensitive than MLI in detecting defects in secondary septation”.

Why is the observation that saccular formation is unperturbed while alveolarization is compromised a reflection of differential energy requirements as opposed to involvement of different cells at specific stages of lung development?

The main constituents of both saccules and alveoli are alveolar type I and type II cells and alveolar fibroblasts/myofibroblasts. Alveolar formation occurs within saccules as a continuous developmental process. As such, it appears that the simplest explanation is that the same cells have distinct requirements at different developmental time points.

The authors comment about BPD in the abstract. Might the cell specific compromise in mitochondrial function have implications for BPD?

BPD is often caused by high oxygen levels. Given the central role of mitochondria in oxidative phosphorylation and ATP production, it is possible that cell-specific compromise in mitochondrial function could be related to BPD. We do not have any evidence to show such a connection. This would require future investigations.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Essential revisions:

The manuscript is much improved by including the additional data. Reviewer 3 raises important concerns that we ask you to address in the manuscript text throughout as well as by specifically revising your conclusions and clearly stating the limitations regarding epithelial cell-specificity for the effects observed. No additional experiments are required.

We have modified the conclusions, stated the limitation of our approaches throughout the revised manuscript. In particular, we directly addressed the issue of cell-specificity for the effects observed. We have also added new data in which we showed that removal of Tfam in alveolar macrophages did not lead to alveolar defects. This is similar to the finding that Tfam inactivation in T cells has no apparent effects on alveologenesis.

Reviewer #3 (Recommendations for the authors):

The present revision includes a number of well performed and carefully considered experiments. The authors have responded to the concerns raised in each of the prior reviews. However, the primary concern persists. Specifically, the authors argue that in Sox9 expressing epithelial cells mitochondrial distribution and activity have specific effects on secondary septation of the lung. Doubtless, the manuscript includes a rich set of experiments. The authors definitively demonstrate that compromising mitochondrial activity and distribution in Sox9 expressing epithelial cells decreases secondary septation. However, it does not seem to this Reviewer that the authors can make the claims of specificity outlined in the manuscript. To make such a claim, it would be important, as stated in the prior reviews, by more than one Reviewer, to demonstrate that loss of mitochondrial activity and altered distribution in another cell type in the lung has no effect on alveolarization. The demonstration that loss of mitochondrial activity non-structural immune cells is helpful, these T-cells compromise a very small percentage of the overall immune population and remain naive through ~ P21. Moreover, there are no reports of a lung phenotype in mice wherein T-cells are deleted; if deleting cells has no effect on alveolarization, then certainly decreasing mitochondrial activity would have no effect. A non-structural immune cell, such as macrophages would be far more meaningful proof of concept.

In the previous revision, we showed that mouse lungs with Tfam inactivated in T cells using Foxp3-Cre or CD4-Cre do not show alveolar defects (Figure 3—figure supplement 5). Loss of Tfam by Foxp3-Cre has been previously reported (Fu et al., Cell Rep 2019 PMID 31269437). These animals displayed severe inflammation but no alveolar defects.

Of note, ample evidence suggests that neonatal T cells are not immature or defective versions of adult cells (Rudd Annu Rev Immunol 2020 PMID 31926469). They are well adapted to provide fast-acting immune responses.

The reviewer felt that deletion of Tfam in macrophages would be far more meaningful. This study has been published in which Tfam removal in alveolar macrophages by Cd11c-Cre does not lead to alveolar defects (Gao et al., J Immunol 2022 PMID: 35165165). To further substantiate this finding, we have conditionally inactivated Tfam using Cx3cr1-CreER. We generated Tfam^f/f; Cx3cr1^CreER/+ mice and administered tamoxifen to neonatal mice. These animals also did not display alveolar defects (Figure 3—figure supplement 5). Taken together, while these studies are not exhaustive, they provide strong support to our model in which lung epithelial and mesenchymal cells are more sensitive to perturbation of mitochondrial dysfunction than other cell types during alveologenesis.

We also would like to emphasize that saccule formation is not disrupted in Tfam^f/f; Sox9^Cre/+ lungs. Thus, loss of Tfam or mitochondrial function does not have a universal effect on the developmental processes, which is a main point of our manuscript.

Relative to claims of specificity regarding use of a Pdgra promoter to effect myofibroblasts problematic. As the authors point out, fibroblasts, adventitial fibroblasts, and adventitial fibroblasts (transcriptionally distinct subpopulations) all express Pdgfra and thus the knockout is certainly effecting cells other than the myofibroblasts.

We acknowledged that Pdgfra-Cre labels many subsets of fibroblasts. We have adopted the more precise description of PDGFRA⁺ cells or fibroblasts/myofibroblasts in the revised manuscript. Nevertheless, it is worth mentioning that ~95% of lineaged cells (PDGFRA⁺) in Pdgfra^rtTA; tetO^Cre mice are myofibroblasts (Li et al., ELife 2018 PMID: 30178747).

What is the basis for the contention that septal thickness is a more sensitive indicator of secondary septation? Thinning of the septae is a component of lung maturation, but not specifically secondary septation.

We measured the primary septal thickness and MLI. Thinning of the primary septae appeared earlier than changes in MLI in our analysis. We surmise that thinning of the primary septae is caused by reduced myofibroblast number and contraction/migration, all of which will subsequently lead to defective secondary septation.

Transcriptomically distinct cell subtypes emerge during the transition from saccular to alveolar stages. This has been shown in multiple papers. Thus, it remains unclear just why the authors insist that the absence of effects during the saccular stage proves differential energy requirements in the same cells as opposed to involvement of alternative cells.

While there is no evidence that a new epithelial cell type emerges from saccular to alveolar stages, the transcriptome of any cell type changes as development proceeds. The simplest model is that the same cell types with an altered transcriptome (cell subtypes by the reviewer) display different sensitivity to mitochondrial perturbation (and energy expenditure) as lung development proceeds from saccular to alveolar stages. This is based on the assumption that the subcellular events (e.g., ligand secretion and cellular contraction) that drive a cellular process (e.g., sacculation and secondary septation) are the main consumer of energy for a given cell subtype. However, it is also possible that the subcellular events that execute a given cellular process may not be the main consumer of energy. In this scenario, one would conclude that the phenotypic defects of a given cellular process due to compromised mitochondrial activity are indicative of the sensitivity of the subcellular events to mitochondrial activity. We have clarified these points in the revised manuscript.

Though not appreciated by the authors, radial alveolar count is distinct from mean linear intercept and represents a more direct method to secondary septae, the outcome measure of primary concern in the present manuscript.

A large fraction of the lungs analyzed for alveolar defects in this study were from postnatal day 3 –5. Since no alveoli are formed at this stage, the method of radial alveolar count (RAC) is not applicable. The values of RAC would be zero by definition despite the presence of differences in the primary septal thickness and MLI between control and mutant lungs.

In Figure 6, line 940, how do the authors know the cells were myofibroblasts?

The cells in Figure 6A and 6E expressed SMA and are alveolar myofibroblasts. The cells in Figure D and 6H contained a mixture of fibroblasts and myofibroblasts.

Finally, in Figure 8, it appears that panels b,c, and e are normalized so that the controls = 1. Are findings still significant if the absolute values are compared?

When the absolute values in panel B are compared, the same p value is obtained.

For panels C and E, variabilities in loading and exposure for each scan of Western blotting necessitate normalization before data pooling for statistical analysis. This is a widely accepted practice.

https://doi.org/10.7554/eLife.68598.sa2

Article and author information

Author details

Kuan Zhang

Cardiovascular Research Institute, University of California, San Francisco, United States

Contribution
Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Project administration, Supervision, Validation, Visualization, Writing - original draft, Writing - review and editing

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-9723-1328
Erica Yao

Cardiovascular Research Institute, University of California, San Francisco, United States

Contribution
Conceptualization, Data curation, Formal analysis, Investigation, Validation, Visualization, Writing - original draft, Writing - review and editing

Competing interests
No competing interests declared
Biao Chen

Cardiovascular Research Institute, University of California, San Francisco, United States

Contribution
Data curation, Formal analysis, Validation, Visualization, Writing - review and editing

Competing interests
No competing interests declared
Ethan Chuang

Cardiovascular Research Institute, University of California, San Francisco, United States

Contribution
Data curation, Formal analysis, Validation, Visualization, Writing - review and editing

Competing interests
No competing interests declared
Julia Wong

Cardiovascular Research Institute, University of California, San Francisco, United States

Contribution
Data curation, Formal analysis, Validation, Visualization, Writing - review and editing

Competing interests
No competing interests declared
Robert I Seed

Department of Pathology, University of California, San Francisco, United States

Contribution
Data curation, Validation, Visualization

Competing interests
No competing interests declared
Stephen L Nishimura

Department of Pathology, University of California, San Francisco, United States

Contribution
Data curation, Validation, Visualization

Competing interests
No competing interests declared
Paul J Wolters

Division of Pulmonary, Critical Care, Allergy and Sleep Medicine, Department of Medicine, University of California, San Francisco, United States

Contribution
Data curation, Formal analysis, Validation, Visualization, Writing - review and editing

Competing interests
No competing interests declared
Pao-Tien Chuang

Cardiovascular Research Institute, University of California, San Francisco, United States

Contribution
Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Project administration, Supervision, Validation, Visualization, Writing - original draft, Writing - review and editing

For correspondence
pao-tien.chuang@ucsf.edu

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-8961-8653

Funding

National Heart, Lung, and Blood Institute (R01 HL142876)

Pao-Tien Chuang

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

Some data for this study were acquired at the Nikon Imaging Center at CVRI. This work was supported by R01 HL142876 from the National Institutes of Health to PTC.

Ethics

This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols of the University of California, San Francisco. The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of California, San Francisco (Approval Number: AN187712-01).

Senior Editor

Edward E Morrisey, University of Pennsylvania, United States

Reviewing Editor

Melanie Königshoff, University of Pittsburgh, United States

Reviewer

David N Cornfield, Stanford University School of Medicine, United States

Version history

Received: March 20, 2021
Preprint posted: April 11, 2021 (view preprint)
Accepted: April 5, 2022
Accepted Manuscript published: April 6, 2022 (version 1)
Version of Record published: June 9, 2022 (version 2)

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.