Blood-brain barrier-restricted translocation of Toxoplasma gondii from cortical capillaries
Abstract
The cellular barriers of the central nervous system proficiently protect the brain parenchyma from infectious insults. Yet, the single-celled parasite Toxoplasma gondii commonly causes latent cerebral infection in humans and other vertebrates. Here, we addressed the role of the cerebral vasculature in the passage of T. gondii to the brain parenchyma. Shortly after inoculation in mice, parasites mainly localized to cortical capillaries, in preference over post-capillary venules, cortical arterioles or meningeal and choroidal vessels. Early invasion to the parenchyma (days 1-5) occurred in absence of a measurable increase in blood-brain barrier (BBB) permeability, perivascular leukocyte cuffs or hemorrhage. However, sparse focalized permeability elevations were detected adjacently to replicative parasite foci. Further, T. gondii triggered inflammatory responses in cortical microvessels and endothelium. Pro- and anti-inflammatory treatments of mice with LPS and hydrocortisone, respectively, impacted BBB permeability and parasite loads in the brain parenchyma. Finally, pharmacological inhibition or Cre/loxP conditional knockout of endothelial focal adhesion kinase (FAK), a BBB intercellular junction regulator, facilitated parasite translocation to the brain parenchyma. The data reveal that the initial passage of T. gondii to the central nervous system occurs principally across cortical capillaries. The integrity of the microvascular BBB restricts parasite transit, which conversely is exacerbated by the inflammatory response.
Editor's evaluation
There is significant interest in how pathogens like Toxoplasma infect the brain. The present study carefully details early steps in this process by inoculating mice intravenously and monitoring their distribution within brain tissues over the subsequent days. The analysis presented will be a valuable reference for further investigation of this process. The authors perform several perturbations that involve the permeability of the blood-brain barrier as a key determinant of parasite entry into the brain parenchyma. Taken together the study highlights the critical role of the blood-brain barrier in restricting access of Toxoplasma to the brain.
https://doi.org/10.7554/eLife.69182.sa0Introduction
The vertebrate central nervous system (CNS) is protected by restrictive cellular barriers that maintain homeostasis and regulate passage of molecules and cells to the brain parenchyma (Abbott et al., 2006). Three main cellular barrier systems protect neurons from blood-borne external insults, such as infection: the blood-brain barrier (BBB), the blood-cerebrospinal fluid barriers and the meningeal barriers (Coureuil et al., 2017). Of these, the BBB exerts the greatest immediate impact on the cerebral microenvironment.
The BBB is anatomically localized to the cerebral microvasculature, which is constituted by capillaries with a luminal diameter (Ø) of <10 μm, arterioles and venules (~10–100 μm Ø) (Wilhelm et al., 2016; Gould et al., 2017). The microvascular lumen is covered by highly specialized endothelial cells characterized by low permeability, low pinocytic activity and high transcellular electrical resistance (TCER) (Stamatovic et al., 2008). Basal lamina, astrocyte ‘end-feet’ and pericytes also contribute to restrict permeability (Daneman and Prat, 2015; Armulik et al., 2010). Intercellular tight junction (TJ) proteins seal the spaces between adjacent endothelial cells and separate the apical from the basolateral side. This restricts the paracellular flux of hydrophilic molecules and regulates the migration of cells across the endothelial barrier (Alon and van Buul, 2017). Focal adhesion kinase (FAK), also named protein tyrosine kinase 2 (PTK2), regulates signaling pathways involved in cell-cell adhesion and focal adhesion complexes in endothelial cells (Lee et al., 2010; Siu et al., 2009). The turnover of FAK has been shown to regulate barrier function, and dysregulation of FAK impacts the integrity of cellular barriers (Ivey et al., 2009) by increasing paracellular permeability, which can imply disruption of the barrier function (Ma et al., 2013).
Inflammation can cause impairment of the blood-CNS barrier functions (Abbott et al., 2006). Immune activity by resident cells and infiltrating leukocytes are crucial to eradicate pathogens that succeed in translocating across the restrictive CNS barriers (Coureuil et al., 2017), but this response can also alter neuronal function (Dando et al., 2014). Therefore, striking a balance between controlling infection and limiting excessive inflammation is crucial (Klein and Hunter, 2017).
The obligate intracellular parasite Toxoplasma gondii infects a broad range of warm-blooded vertebrates, with an estimated 1/3 of the global human population being chronically infected (Pappas et al., 2009). From the point of entry in the intestinal tract, T. gondii rapidly achieves systemic dissemination and establishes latent infection in the CNS (Schlüter and Barragan, 2019). While chronic infection is generally considered asymptomatic, reactivated or acute infection can lead to life-threatening encephalitis in immune-compromised individuals and to neurological disorders in neonates (Montoya and Liesenfeld, 2004). T. gondii tachyzoites use gliding motility to actively invade cells where they replicate (Dobrowolski and Sibley, 1996). Gliding motility also facilitates transmigration of tachyzoites across the endothelium in vitro (Ross et al., 2019; Barragan et al., 2005) and provides an effective mechanism of propulsion in the microenvironment inside tissues (Barragan and Sibley, 2002). In their journey to form chronic cysts, the tachyzoites cross the cellular brain barriers to establish latent infection in the CNS (Feustel et al., 2012).
In recent years, work in the field has focused on parasite dissemination pathways and mechanisms of passage to the brain (Konradt et al., 2016; Drewry et al., 2019; Kanatani et al., 2017; Bhandage et al., 2020; Schneider et al., 2019; Sangaré et al., 2019). Yet, the roles played by the blood-CNS barriers have remained unresolved. Here, we address the implication of the BBB in the early passage of T. gondii tachyzoites to the CNS. Specifically, we assess the loci of passage of T. gondii across the cerebral cellular barriers and the impacts of BBB integrity, dysregulation and inflammation on the access of tachyzoites to the parenchyma. We identify a role for the TJ regulator FAK in the passage of T. gondii to the brain parenchyma.
Results
T. gondii tachyzoites localize to parenchymal capillaries in the cerebral microcirculation
T. gondii reaches the peripheral blood circulation shortly after infection (Derouin and Garin, 1991) and localization within the cerebral vasculature precedes its penetration to the brain parenchyma in experimental infections (Konradt et al., 2016). To study the distribution of T. gondii in the brain vasculature, we inoculated mice in the tail vein with GFP-expressing T. gondii tachyzoites and a fluorescent intraluminal vascular tracer (Evans blue, EB). Interestingly, immuno-histochemical analyses of brain tissue revealed that T. gondii tachyzoite GFP+ signal preferentially localized to microvessels with an intraluminal diameter less than 10 μm ( < 10 μm Ø; 91.32% ± 5.97) (Figure 1a and b). Furthermore, T. gondii tachyzoite signal preferentially localized to microvessels with low relative expression of the endothelial basement membrane marker α5 laminin (91.33% ± 8.08) (Figure 1c and d, Figure 1—figure supplement 1) and with high expression of P-glycoprotein relative to α5 laminin expression (67.60% ± 8.83) (Figure 1e and f). The accumulation of T. gondii tachyzoites in microvasculature with <10 μm Ø and low relative α5 laminin/P-glycoprotein expression is consistent with preferential localization to parenchymal capillaries. T. gondii also localized to post-capillary venules ( > 10 μm Ø, low relative α5 laminin/P glycoprotein ratio) at a lower relative frequency compared with capillaries, while localization to penetrating arterioles, pre-capillary arterioles and penetrating venules was absent or scarce (Figure 1f and g).

Localization of T. gondii tachyzoites in the cortical vasculature.
C57BL/6 mice were challenged i.v. with 3–10 × 106 T. gondii GFP-expressing tachyzoites (RH) and brains were extracted 72 hr post-inoculation. (a) Representative confocal micrograph of cortical section shows intraluminal vascular staining (EB) and nuclear staining (DAPI). Arrowheads indicate localization of tachyzoites. Scale bar, 20 μm. (b) Graphs show the relative frequency (%) of blood vessels (EB+) with associated T. gondii tachyzoites (GFP+) related to the luminal diameter (µm). Data is from three tissue sections per mouse from 6 mice (m1-6) ranging between 14 and 25 GFP+ vessels per mouse. (c) Immunofluorescence staining of cortical section for α5 laminin. Arrowhead and inset show T. gondii (GFP+) in vicinity of a vessel with relatively low α5 laminin signal. Scale bars, 50 μm, inset 10 μm. (d) Quantification of the relative fluorescence intensity (arbitrary units, a.u.) of α5 laminin signal in GFP- and GFP+ vasculature, related to the blood vessel diameter (µm). Data is from a total of 284 vessels in three sections per mouse (n = 3 mice). ANCOVA, F (1, 281) = 36.931, p < 0.0001. (e) Representative immunofluorescence micrograph of cortical section stained for α5 laminin and P-glycoprotein (P-gly). Arrowhead and inset show T. gondii (GFP+) in the vicinity of a vessel. Scale bars, 50 μm, inset 10 μm. (f) Quantification of the relative fluorescence intensity (a.u.) ratio α5 laminin / P-glycoprotein, related to the blood vessel diameter (µm). Data is from a total of 275 vessels in three sections per mouse (n = 3 mice). ANCOVA, F (1, 272) = 80.255, p< 0.0001. (g) Schematic representation of the cortical microvasculature illustrates the preferential localization of T. gondii to capillaries and, to a lesser extent, post-capillary venules (PCV) in the brain parenchyma. Triangles indicate the relative expression of the vascular markers α5 laminin and P-glycoprotein in arterioles, capillaries, and PCV.
Distribution of parasite loads in brain parenchyma, choroid plexus (CP), meninges, and peripheral organs
Because the vasculature of peripheral organs and of the blood-CNS barriers exhibit very different restrictiveness to passage of cells (Stamatovic et al., 2008), we assessed the parasite loads at organ level and sub-organ level in brain tissue. At 24–72 hr post-inoculation i.v., the relative total parasite loads were significantly lower in the brain compared with lung and liver for two different mice strains (Figure 2a, b and c), as previously reported in different experimental approaches using oral and i.p. routes (Kanatani et al., 2017; Zenner et al., 1998; Mordue et al., 2001). Moreover, the restrictiveness of the different blood-CNS barriers is heterogeneous, especially in the meninges and CP (Wilhelm et al., 2016). To identify putative entry sites to the CNS, we classified the parasite foci, as defined under Methods, on the basis of (i) anatomical localization and (ii) in situ localization in relation to the adjacent vasculature (Figure 2d and e, Figure 2—figure supplement 1). Higher total numbers of parasite foci localized to parenchymal vessels compared with meningeal vessels and CP (Figure 2f). However, when the number of parasite foci was normalized to the relative tissue area, a significantly higher relative frequency was observed in the CP, but not in meningeal vessels (Figure 2g). The data corroborates that the vast majority of parasite foci localized to parenchymal tissue and its vasculature (Figure 1). However, the CP tissue contained a higher relative foci density compared with the parenchymal tissue and its vasculature. Altogether, this indicates that, while the vast majority of parasites localize to the cortical capillary bed, both the choroidal and meningeal blood-CNS barriers can serve as a point of entry for T. gondii to the CNS.

Parasite loads in peripheral organs and localization to vasculature in brain tissue.
(a, b, d-g) C57BL/6 mice or (c) BALB/c mice were challenged i.v. with 3–10 × 106 T. gondii GFP-expressing tachyzoites (RH). (a) Representative epifluorescence micrographs of brain, lung and liver sections, respectively, at indicated time-points post-inoculation. Arrowheads indicate localization of GFP-expressing T. gondii tachyzoites at early time-points. Brain sections show intraluminal vascular tracer (EB) injected prior to organ extraction. Scale bars, 50 μm. (b, c) Parasite loads in brain, lung and liver tissue, respectively, at indicated time-points of C57BL/6 mice (b) or BALB/c mice (c) were quantified by plaquing assays. Data show mean ± SEM (n = 3 mice per time-point) *p < 0.05, Kruskal-Wallis test, followed by Dunn’s post-hoc test. (d, e) Representative immunofluorescence micrographs of brain sections show intraluminal vascular staining (EB) and localization of GFP-expressing T. gondii tachyzoites in (d) meningeal vessels and (e) CP 72 hr post-inoculation. Arrows indicate parasite localization. Asterisks indicate sub-meningeal penetrating cortical vessel and characteristic morphology of CP (Figure 2—figure supplement 1), respectively. Scale bars, 50 μm. (f, g) Box-and-whisker dot plots show for (f) total numbers of parasite foci, defined as presence of replicating GFP+ T. gondii, in CP, meninges and parenchyma, and (g) total parasite foci numbers related to tissue area (mm2), respectively, 72 hr post-inoculation. Medians with 25th to 75th percentile of datasets are shown. Whiskers mark 5th and 95th percentile. Each dot represents mean value per brain section in three consecutive brain sections per mouse from separate experiments (n = 6 mice). **p < 0.01; ****p < 0.0001; ns, non-significant, Kruskal-Wallis test, Dunn’s post-hoc test.
T. gondii tachyzoites invade the brain parenchyma in the vicinity of capillaries
To analyze the progress of infection in situ around the parenchymal vasculature, the localization of foci with replicating T. gondii (GFP+) was related to the vascular marker EB and categorized as intravascular, perivascular or parenchymal localization (Figure 3a). Quantifiable numbers of replicating parasites were detected at 48 hr post-inoculation in the vasculature and an elevation in numbers was observed 72 hr post-inoculation with detection of parasites perivascularly and in the parenchyma (Figure 3b), in line with the elevation of total parasite loads in the brain (Figure 2b and c). A detailed analysis of the localization of T. gondii tachyzoites in relation to the vasculature (Figure 3c and d, Videos 1–8) revealed the distribution of parasite distances around parenchymal capillaries and indicated parenchymal localization (Figure 3e, Figure 3—figure supplement 1a). For randomly located parasite vacuoles, analyzes of distances to vasculature and of vascular diameter revealed a preferential vicinity to one capillary, related to the average distances to surrounding vasculature (Figure 3f, Figure 3—figure supplement 2). Localization of vacuoles containing replicating tachyzoites distantly from the blood tracer and vascular markers, and in the vicinity astrocyte and microglia markers, confirmed penetration to the parenchyma (Figure 3g, Figure 3—figure supplement 1b).

Distribution of parasite loads and invasion of the brain parenchyma by T. gondii tachyzoites.
(a–b) C57BL/6 mice were challenged i.v. with 1–3 × 106 T. gondii GFP-expressing tachyzoites (RH). (a) Representative confocal micrographs of parasite foci with replicating T. gondii (GFP+) categorized by association to the vasculature (EB): intravascular, perivascular and parenchymal localization, as indicated in Methods. DAPI indicates nuclear staining. Arrowheads indicate parasites located in the parenchyma. Scale bars, 20 µm. (b) Mean numbers of parasite foci (GFP+) detected per brain section at indicated time points post-inoculation. Data is from three sections per mouse from 3 mice per time point (n = 3 mice). (c–k) CD1 mice were challenged i.v. with 1–4 × 106 T. gondii GFP-expressing tachyzoites (ME49) and sacrificed at 4 days post-infection. (c, d) Representative micrographs show the distribution of T. gondii tachyzoites (GFP+) around the vascular lumen (EB+) in challenged mice. For each micrograph, the corresponding 3D plot analysis shows individual GFP+ tachyzoite vacuoles as indicated in Methods. Color scales indicate Euclidian distances (μm) of tachyzoites to the nearest vascular lumen. Scale bars, 20 μm. (e) Distribution of Euclidian distances of T. gondii (GFP+) tachyzoites to the nearest capillary. Eight representative foci of challenged mice (day 4) are shown. In graph, each data point represents one tachyzoite (GFP+) and mean + SEM are indicated for each focus. Dashed lines indicate luminal center (0) and 10 μm distance to the nearest vascular lumen, respectively. (f) Distribution of Euclidian distances of randomly located T. gondii (GFP+) vacuoles to vasculature (EB+) in single fields of view (FOV). Filled circles indicate the distance to the nearest located blood vessel for intravascular, perivascular and parenchymal vacuoles, respectively. Unfilled circles indicate distances to vasculature in the same FOVs (Figure 3—figure supplement 2). Dashed lines indicate luminal center (0) and 10 μm distance to the nearest vascular lumen, respectively. Solid lines indicate mean diameter and mean distance, respectively, of vessels to randomly located vacuoles. Chi square test X2(29, N = 166) = 64.96, p < 0.001. (g) Immunofluorescence staining of brain sections depict the parenchymal localization of T. gondii (GFP+) related to the BBB basement membrane marker β1 laminin, the astrocytic marker GFAP and the TJ marker occludin (Ocln) and, the microglia markers Iba1, respectively. DAPI indicates nuclear staining. Scale bars, 25 µm. (h) Relative distribution (%) of the localization of T. gondii tachyzoites assessed by two-photon microscopy in whole brains (day 3). n = 8 independent foci. (i) Distance of individual T. gondii tachyzoites to the nearest blood vessel (EB+). n = 10 independent foci. (j, k) Diameter of the nearest blood vessel (j) and distance to the nearest vascular branching (k) for intravascular and extravascular T. gondii tachyzoites, respectively. n = 69 tachyzoites. **p < 0.01; Student’s t-test. (i–k) Medians with 25th to 75th percentile of datasets are shown. Whiskers mark 5th and 95th percentile. (l, m) Relative frequency (%) of parasite foci related to localization at indicated time points post-inoculation. CD1 Mice were inoculated with (l) high-dose or (m) low-dose T. gondii tachyzoites (ME49). For each condition, the mean + SEM from 3 to 10 sections per mouse from three independent experiments is shown (n = 3–6 mice). *p < 0.05; ***p < 0.001; ****p < 0.0001; ns, non-significant, one-way ANOVA, F (2, 10) = 79.19, followed by Tukey’s multiple comparisons test.
Intravascular replication of T. gondii in brain microvasculature.
Movie shows 3D projections of vacuoles with replicating T. gondii (GFP+, green) and association to the vasculature (EB+, red) as detailed in Methods.
Perivascular replication of T. gondii.
Movie shows 3D projections of parasite foci with replicating T. gondii (GFP+) in close proximity to the vasculature (EB+, red) as detailed in Figure 3. Nuclei (blue) were stained with DAPI.
Parenchymal localization of T. gondii.
Movie shows 3D projections T. gondii tachyzoites (GFP+) and spatial relation to the vasculature (EB+, red).
Intravascular, perivascular, and parenchymal localization of T. gondii.
Movie shows 3D projections of parasite foci with replicating T. gondii (GFP+) within a microvessel (EB+, red), in close proximity outside vasculature and distant location.
Penetration to the parenchymal tissue by T. gondii.
Movies show 3D projections of representative parasite foci with replicating T. gondii (GFP+) within the brain parenchyma (cell nuclei, DAPI/ blue) and association to the vasculature (EB+, red).
Penetration to the parenchymal tissue by T. gondii.
Movies show 3D projections of representative parasite foci with replicating T. gondii (GFP+) within the brain parenchyma (cell nuclei, DAPI/ blue) and association to the vasculature (EB+, red).
Penetration to the parenchymal tissue by T. gondii.
Movies show 3D projections of representative parasite foci with replicating T. gondii (GFP+) within the brain parenchyma (cell nuclei, DAPI/ blue) and association to the vasculature (EB+, red).
Penetration to the parenchymal tissue by T. gondii.
Movies show 3D projections of representative parasite foci with replicating T. gondii (GFP+) within the brain parenchyma (cell nuclei, DAPI/ blue) and association to the vasculature (EB+, red).
Because the mouse genetic background and the parasite lineage impact the cerebral pathology and the immune responses (Schlüter and Barragan, 2019), we assessed two additional mouse strains (CD1, BALB/c) and one additional parasite strain (ME49). A similar distribution of T. gondii was found around the parenchymal vasculature by days 3–4 post-inoculation in the different mouse strains (Figure 3—figure supplement 1c-f).
Next, to confirm the distribution of parasites in live brain tissue, freshly extracted whole brains from challenged mice were analyzed ex vivo by two-photon microscopy (Videos 9 and 10). Similar to fixed brain sections, the intravascular parasite localization predominated at 72 hr, with relatively lower numbers of tachyzoites in the perivascular space and parenchyma (Figure 3h). Furthermore, extravascular (perivascular and parenchymal) parasites localized to the vicinity of a blood vessel (Figure 3i) and both intravascular and extravascular parasites localized within or in the vicinity, respectively, of vessels with <10 μm Ø (Figure 3j) and in the vicinity of vascular branching points (Figure 3k). Finally, the localization of T. gondii was monitored beyond 72 h. Importantly, while intravascular and perivascular parasite localization predominated days 1–4 post-inoculation (Figure 3l), parenchymal localization clearly predominated by day 10 (Figure 3m, Figure 3—figure supplement 1g). Of note, at all time-points, focal leakage of the EB blood tracer to the parenchyma was not observed, indicating absence of hemorrhage. Altogether, the data show that breaching of the BBB by T. gondii predominantly occurs at the level of parenchymal capillaries.
Two-photon microscopy analyses of brain tissue ex vivo.
Brains were extracted from T. gondii-challenged mice and immediately subjected to microcopy as indicated under Materials and methods. Movies show 3D projections of representative parasite foci with replicating T. gondii (GFP+) and spatial relation to the vasculature (EB+, red).
Two-photon microscopy analyses of brain tissue ex vivo.
Brains were extracted from T. gondii-challenged mice and immediately subjected to microcopy as indicated under Materials and methods. Movies show 3D projections of representative parasite foci with replicating T. gondii (GFP+) and spatial relation to the vasculature (EB+, red).
Kinetics of leukocyte infiltration at parenchymal sites of T. gondii replication
Because parasite penetration to the parenchymal tissue may imply inflammatory responses, we assessed the presence of leukocytes at loci of T. gondii replication in the cerebral and pulmonary parenchyma. In the lung, a prominent leukocyte (CD45+) infiltration was rapidly observed in the vicinity of parasite foci by days 4–5 (Figure 4a). In contrast, the vast majority of parasite foci in the brain parenchyma stained negative for CD45 by days 4–5 post-inoculation, irrespective of parasite dose (Figure 4a and b). However, an abundant infiltration of CD45+ cells around parasite foci was evidenced by day 10 (Figure 4b, Figure 4—figure supplement 1a). Analyses by flow cytometry (Figure 4—figure supplement 1b, c) confirmed elevated CD45+ CD11b+/- cell frequencies in lung by days 4–5 (Figure 4c, d and f) and modest elevations of CD45+ cells in the brain day 5 (Figure 4c, d and e). An elevation in CD45hi CD11b+/- cell frequencies in the brain by day 10 (Figure 4d and e) corroborated immunohistochemical findings. Additionally, a significant portion of T. gondii tachyzoites also co-localized with intravascular CD45+ cells (Figure 4—figure supplement 2a, b) and a portion of parasite-associated microglia (CD45low CD11b+) and CD45+ cells were retrieved from the brain tissue (Figure 4—figure supplement 2c-j). Altogether, the data indicate that initial parasite penetration to the parenchyma by day 4–5 occurs in absence of perivascular cuffing or a significant leukocyte infiltration, which is accentuated in the brain parenchyma by day10.

Kinetics of leukocyte infiltration in the brain parenchyma.
CD1 mice were inoculated with high-dose (hd, 1 × 106 i.v.) or low-dose (ld, 5 × 104 i.p.) of T. gondii GFP-expressing tachyzoites (ME49) (a, b) Representative immunofluorescence micrographs of brain and lung cryosections from mice challenged with T. gondii (GFP+) at (a) high-dose or (b) low-dose, assessed after days 4, 5, or 10 post-inoculation. Sections were stained for CD45 and occludin (Ocln). Scale bars, 50 µm. (c, d) Flow cytometry analyses of brain and lung tissue homogenates labeled with anti-CD45 and anti-CD11b antibodies, with gating on CD45+ cells. Representative bivariate plots (brain) show subpopulations of leukocytes discriminated according to the expression of CD11b and CD45: microglia (CD11b+ CD45low), myeloid leukocytes (CD11b+ CD45hi) and non-myeloid leukocytes (CD11b- CD45hi). Plots from lung tissue show CD11b- and CD11b+ subpopulations of CD45+ cells. (e, f) Quantitative analyses of CD45+ immune cell subpopulations in the (e) brain and (f) lung. The relative mean frequency of the leukocyte subpopulations is indicated (n = 3–5 mice per condition). *p < 0.05; **p< 0.01; Student’s t-test.
Invasion of T. gondii to the brain parenchyma occurs with minimal perturbation of the vascular permeability
Next, we determined if challenge with T. gondii impacted the BBB restrictiveness to the permeability tracer EB, as detailed in Materials and methods (Figure 5—figure supplement 1a, c). High-dose inoculation of T. gondii significantly increased EB signal in the parenchyma, indicating elevated BBB permeability similar to the effects of LPS treatment (Xaio et al., 2001; Figure 5a and b). In contrast, a lower dose of T. gondii non-significantly affected permeability up to 5 days post-inoculation. Yet, at day 10, a significant elevation in permeability was observed (Figure 5c and d). Because early passage (24–72 hr) to the parenchyma (Figure 3) occurred seemingly in absence of measurable generalized elevations in permeability, we closely assessed the vascular permeability in the vicinity of parasite foci. Overall, non-significant differences in permeability were observed when comparing brain sections containing tachyzoites (GFP+) and sections with absence of tachyzoites (GFP-) at days 3 or 10 (Figure 5e and f). However, a subset of GFP+ vessels exhibited elevated EB signal, indicating focal or selective enhanced permeability in these vessels (Figure 5f). Areas with major EB intensity signal, indicative of hemorrhage (Manaenko et al., 2011), were absent throughout the study. We conclude that a generalized enhanced BBB permeability was only observed upon high-dose i.v. inoculation of T. gondii, while lower doses given i.p. generated overall non-significant differences in BBB permeability, with focal permeability elevations in the vicinity of parasite foci.

Impact of T.gondii challenge on the BBB permeability.
(a–b) C57BL/6 mice were inoculated with high-dose (hd, 2–4 × 106 i.v. RH) or (c–d) with low-dose (ld, 5 × 104 i.p. ME49) of T. gondii GFP-expressing tachyzoites or treated with LPS (2 mg/kg, 6 hr). (a) Representative fluorescence micrographs of cortical sections show EB+ signal from unchallenged, T. gondii-challenged (GFP+) mice at day 3 post-inoculation and LPS-treated mice. Arrowhead indicates GFP signal, magnified in inset image. Scale bars, 50 µm, inset, 25 µm. (b) Quantification of the extravascular fluorescence intensity (arbitrary units, a.u.) with the EB tracer as described in Methods. Each dot in the graph represents the accumulated fluorescence intensity signal (EB+) around one blood vessel. Data show mean ± SD from a total of 344 vessels (unchallenged 132, T. gondii 97, LPS 115) from three to four sections per mouse (n = 4–5 mice per condition). (c) Representative fluorescence micrographs of cortical sections show EB+ signal as in (a) from T. gondii-challenged (ld, low-dose, ME49) mice at days 3, 5, and 10 post-inoculation. Arrowhead indicates GFP signal, magnified in inset image. Scale bars, 50 µm, inset image, 25 µm. (d) Quantification of the extravascular fluorescence intensity with the EB tracer as in (b). Data show mean ± SD from a total of 1205 vessels (unchallenged 280, T. gondii day3 214, day5 244, day10 234, LPS 233) from three sections per mouse from three independent experiments (n = 3–8 mice per condition). (e, f) Fluorescence intensity analyses with EB tracer signal in (e) GFP+ and GFP- cortical vessels from mice challenged with T. gondii (hd, day 3) or in (f) microvessels located within 100 µm distance to parasite foci (GFP+) and fields of view without detectable foci (GFP-) from mice challenged with T. gondii (ld, day 10). Data show mean ± SD from (e) 97 vessels (GFP+ 37, GFP- 60) and (f) 234 vessels (GFP+ 96, GFP- 138), respectively (n = 3–4 mice per condition). *p < 0.05; ****p < 0.0001; ns, non-significant. (b, d) Kruskal-Wallis test, Dunn’s post-hoc test, (e, f) Mann-Whitney test.
Inflammatory responses in brain endothelium upon challenge with T. gondii
To address the putative endothelial responses to the presence of T. gondii in capillaries, we assessed the inflammatory responses of primary mouse brain endothelial cell (MBEC) monolayers, of purified brain microvessels and in vivo in mice. First, transcriptional analyses of MBECs challenged with T. gondii demonstrated upregulation of a number of inflammation-associated genes, similar to LPS treatment (Figure 6a). Second, isolated brain microvessels from T. gondii-infected mice (Figure 6b, Figure 6—figure supplement 1a-c), consistently presented upregulated transcriptional expression of the adhesion molecules and inflammation indicators ICAM-1, VCAM-1, E-selectin, and anti-inflammatory TIMP-1 (Figure 6c and d). Finally, an upregulation of ICAM-1 and VCAM-1 expression was confirmed in isolated brains from infected mice (Figure 6e and f).

Inflammatory responses of brain endothelium upon T. gondii challenge.
(a) Graphs show the relative mRNA expression, for indicated target genes, in primary MBECs challenged with T. gondii tachyzoites (RH, MOI4) or LPS (100 ng/ml) for 6 or 12 hr, respectively. Data show mean + SEM normalized to non-stimulated controls (unchallenged) from two independent MBEC purifications with 3–7 replicates/condition. (b) Representative immunofluorescence micrographs show brain microvessels isolated from unchallenged and T. gondii (RH)-challenged C57BL/6 mice stained with antibodies to the vascular BBB markers CD31/PECAM-1, ZO-1, Glut-1, α5/α4 laminins and the astrocytic marker GFAP. DAPI indicates nuclear staining. Arrowhead indicates T. gondii tachyzoites (GFP+) in association with the vasculature. Scale bars, 25 µm. (c, d) Relative mRNA expression, for indicated target genes, in purified brain microvessels of C57BL/6 mice challenged with T. gondii. (c) high-dose (hd, 4x106, RH) and (d) low-dose (ld, 5 × 104, ME49), assessed on days 3 and 5 post-inoculation, respectively. Data show mean + SEM gene expression from 3 to 4 mice per group normalized to non-infected controls (n = 3–4 mice). (e, f). Relative mRNA expression (mean + SEM), for indicated target genes, in brain homogenates from mice challenged as in (c, d) (n = 3–4).*p < 0.05; **p < 0.01; (a) one-way ANOVA followed by Dunnett’s test, (c–f), Unpaired Student’s t-test.
Effects of anti- and pro-inflammatory treatments on vascular permeability and penetration of T. gondii to the brain parenchyma
To address if inflammation was a determinant of T. gondii passage across the BBB, we quantified the invasion of T. gondii to the parenchyma in two situations (i) reduced inflammation by hydrocortisone treatment before and during infection and (ii) increased inflammation upon low-dose LPS treatment before and during infection. First, we confirmed that hydrocortisone treatment efficiently reduced pro-inflammatory IFN-γ and IL-12 responses upon T. gondii challenge (Figure 7—figure supplement 1a-d). Conversely, LPS-treated T. gondii-challenged mice maintained elevated IFN-γ and IL-12 responses with leukocytosis (Figure 7—figure supplement 1a, c, e-k). Next, we assessed the impact of the treatments on parasite loads. At day 6 post-inoculation, higher parasite loads were detected in brain, liver and spleen in hydrocortisone-treated challenged mice (Figure 7a) and in LPS-treated challenged mice (Figure 7b). Importantly, characterizations of parasite foci in brain tissue revealed dramatic differences between the treatments (Figure 7c). First, LPS treatment impacted the distribution of localization of parasite foci (Figure 7d) with elevated numbers of foci in the parenchyma (Figure 7e). Second, the parenchymal foci were significantly larger compared with foci in unchallenged or hydrocortisone-treated mice (Figure 7f). Finally, LPS-treated mice exhibited elevated BBB permeability (Figure 7g). Hydrocortisone treatment yielded minor or non-significant differences in parenchymal foci numbers and size, and BBB permeability (Figure 7e–g). At early time-points (day 3), infected mice untreated or treated with hydrocortisone or LPS exhibited non-significant differences in parasite loads and in the localization of parasites in parenchyma and the perivascular space (Figure 7—figure supplement 2a-e), indicating that the effects of hydrocortisone and LPS appeared posteriorly. We conclude that anti-inflammatory treatment of mice with hydrocortisone elevated total parasite loads with non-significant effects on vascular permeability, numbers and size of T. gondii foci in the brain parenchyma. In contrast, pro-inflammatory treatment with LPS elevated vascular BBB permeability, and increased numbers and size of parenchymal parasitic foci. Jointly, this indicated that both the inflammatory immune response and the restrictiveness of the BBB impacted the parasite loads in the brain parenchyma.

Modulation of parasite loads in the brain by anti-inflammatory and pro-inflammatory treatments.
CD1 mice were inoculated with T. gondii GFP-expressing tachyzoites (ME49, 5 × 104 i.p.). (a, b) Quantification of parasite loads by plaquing assays in brain, liver, and spleen of mice challenged with T. gondii (ld, day 6) and treated with (a) hydrocortisone or (b) LPS, as indicated under Materials and methods. Data show mean ± SEM (n = 5–10 mice per condition) *p < 0.05, **p < 0.01, Mann-Whitney test. (c) Representative micrographs of cortical sections from mice treated as in (a, b) show T. gondii (GFP+) and vascular tracer (EB). Scale bars, 25 µm. (d) Bar graph shows the relative proportion of intravascular, perivascular and parenchymal parasite foci in mice treated as in (a, b). (e) Relative numbers of parasite foci per mm2 tissue related to intravascular, perivascular, and parenchymal localization, respectively, in mice treated as in (a, b). Data show mean + SEM **p < 0.01; ns, non-significant, Kruskal-Wallis test, Dunn’s post-hoc test. (f) Relative numbers of parasite foci per mm2 tissue related to foci size. Foci sizes were determined by counting number of vacuoles (<10, 11–50 or >50 vacuoles/focus) containing replicating tachyzoites (two or more / vacuole). Data show means ± SEM *p < 0.05; **p < 0.01; ns, non-significant, Kruskal-Wallis test, Dunn’s post-hoc test. (g) Quantification of the extravascular fluorescence intensity (arbitrary units, a.u.) with the EB tracer in mice treated as in (a, b). Each dot represents the accumulated fluorescence intensity signal (EB+) around one blood vessel. Data show mean ± SD from a total of 321 vessels (untreated 64, hydrocortisone 111, LPS 146). (d-g) Data are from two independent experiments; untreated condition (n = 5 mice), hydrocortisone (n = 7 mice) and LPS (n = 7 mice).
Treatment with a FAK inhibitor leads to elevated parasite loads in the brain parenchyma
To determine the impact of the BBB integrity on parenchymal parasite loads, mice were treated with a second-generation inhibitor (defactinib, VS) (Kanteti et al., 2018; Gerber et al., 2020) of the intercellular junction regulator FAK. VS treatment led to significantly elevated parasite loads in the brain for both high-dose (hd) and low-dose (ld) T. gondii challenges (Figure 8a, b and c, Figure 8—figure supplement 1a), with an impact on parasite loads in peripheral organs. Detected IFN-γ/IL-12 responses in brain homogenate were in similar range as untreated, with variability between mice (Figure 8—figure supplement 1b, c). Importantly, the number of parasites in the intravascular and perivascular space were significantly increased early during infection (Figure 8d). However, at day eight post-inoculation, VS-treated mice exhibited a significant increase in the number of parasite foci in the intravascular, perivascular and parenchymal space, related to untreated mice (Figure 8e). Moreover, the numbers and sizes of parasite foci were elevated (Figure 8f and g), indicating earlier penetration to the parenchyma upon VS-treatment. Leakage of the vascular tracer EB to the parenchyma was significantly increased in VS-treated mice compared to non-treated mice (Figure 8h and i), indicating increased permeability. Overall, we conclude that pharmacological inhibition of the vascular intercellular TJ regulator FAK increases BBB permeability and significantly elevates parasite loads in the brain parenchyma.

Modulation of parasite loads and BBB permeability by inhibition of FAK.
CD1 mice were inoculated with high-dose (hd, 3 × 106 i.v., RH) or low-dose (ld, 5 × 104 i.p. ME49) of T. gondii GFP-expressing tachyzoites. (a, b) Quantification of parasite loads by plaquing assays in brain, liver and spleen of mice treated with VS-inhibitor and challenged with T. gondii at (a) high-dose or (b) low dose, assessed at days 3 or 8 post-inoculation, respectively. Data show mean + SEM from three independent experiments (n = 4–10 mice per group). (c)Representative micrographs of cortical sections from mice treated as in (a, b) show T. gondii (GFP+) and vascular tracer (EB). Scale bars, 25 µm. (d, e) Bar graph shows the relative proportion of intravascular, perivascular and parenchymal parasite foci in mice treated with VS-inhibitor and challenged with T. gondii at (d) high-dose or (e) low-dose, assessed at day three or eight post-inoculation, respectively. Data are from four independent experiments (n = 6–10 mice per group). (f, g) Relative numbers of parasite foci per mm2 tissue related to foci size, in mice treated as in (a, b), respectively. Foci sizes were determined by counting number of vacuoles ( < 10, 11–50 or >50 vacuoles/focus) containing replicating tachyzoites. Data show mean + SEM from four independent experiments (n = 6–10 mice per group). (h, i) Quantification of the extravascular fluorescence intensity (arbitrary units, a.u.) with the EB tracer in mice treated as in (a, b). Each dot represents the accumulated fluorescence intensity signal (EB+) around one blood vessel. Data show mean ± SD from a total of (h) 517 vessels (untreated 217, VS-treated 300) and (i) 374 vessels (untreated 153, VS-treated 221) from two independent experiments (n = 6–7 mice per condition). *p< 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, non-significant, (a,d,f) Unpaired Student’s t-test, (b,e,g,h,i), Mann-Whitney test.
Conditional deletion of endothelial FAK in mice impacts the passage of T. gondii to the brain parenchyma
The impact of pharmacological FAK antagonism on parenchymal parasite loads motivated a deletion of endothelial FAK-encoding Ptk2 in mice. To generate endothelial cell-specific deletion of Ptk2 (ECPTK2 cKO), Ptk2flox/flox mice were crossed with Cdh5cre+/- mice harboring a tamoxifen-inducible Cre recombinase under the regulation of vascular endothelial cadherin promoter. To confirm FAK deletion in genotyped mice (Figure 9—figure supplement 1a), fractions enriched in brain endothelial cells (MBECs) were isolated (Ross et al., 2019). Western blotting showed a significant reduction in total FAK protein expression in MBEC-enriched preparations from ECPTK2 cKO mice (Figure 9a), with undetectable changes of FAK expression in bone-marrow-derived cells (BMDCs) (Figure 9—figure supplement 1b, c). Tamoxifen-induced FAK deletion non-significantly impacted total parasite loads in brain tissue and in peripheral organs (Figure 9b), and BBB impermeability to EB was maintained (Figure 9c), consistent with the reported absence of detectable systemic derangement of vascular permeability (Lee et al., 2010; Weis et al., 2008). Importantly, a detailed analysis of parasite foci in the brain parenchyma (Figure 9d) detected elevated numbers (Figure 9e) and size (Figure 9f) of parasite foci in ECPTK2 cKO mice, related to ECPTK2 WT mice. Tamoxifen-treated cre control mice exhibited non-significant differences in peripheral parasite loads and parenchymal parasite foci numbers (Figure 9—figure supplement 1d-f). The data is consistent with a BBB dysregulative, but non-disruptive, effect of FAK deletion on MBECs (Ross et al., 2019). We conclude that endothelial FAK deletion impacts the passage of T. gondii to the brain parenchyma and yields elevated numbers of parasite foci.

Characterizations of parasite foci in the brain parenchyma of ECPTK2 cKO mice challenged with wildtype (RH) and uracil-auxotroph T. gondii (CPS).
(a) Western blot analysis of total FAK protein expression in endothelial cells derived from Cdh5cre+/- C57BL/6 mice that were Ptk2wt/wt, Ptk2flox/wt, or Ptk2flox/flox. Graph shows FAK expression normalized to GAPDH expression. ADU, arbitrary densitometry unit. n = 3 biological replicates from independent blots. (b) Quantification of parasite loads by plaquing assays in brain, liver and spleen of ECPTK2 WT (Ptk2flox/floxCdh5cre-/-) and ECPTK2 cKO (Ptk2flox/floxCdh5cre+/-) C57BL/6 mice, respectively, challenged with T. gondii (ME49, 2,5–5 × 104), assessed at day 6 post-inoculation. Data show mean + SEM from three independent experiments (n = 14–15 mice per group). (c) Quantification of the extravascular fluorescence intensity (arbitrary units, a.u.) with the EB tracer in mice treated as in (b). Data show mean ± SEM from a total of 86–100 vessels from two independent experiments (n = 4 mice per condition). (d) Representative micrographs of cortical sections from mice treated as in (b) show T. gondii (GFP+) and vascular tracer (EB). Scale bars, 25 µm. (e) Bar graph shows the relative proportion of intravascular, perivascular and parenchymal parasite foci in ECPTK2 WT and ECPTK2 cKO mice challenged with T. gondii as in (b) assessed at day 6 post-inoculation, respectively. Data are from three independent experiments (n = 11–14 mice per group). (f) Relative numbers of parasite foci per mm2 tissue related to foci size, in mice treated as in (b), respectively. Foci sizes were determined by counting number of vacuoles ( < 10, 11–50 or >50 vacuoles/focus) containing replicating tachyzoites. Data show mean ± SEM from three independent experiments (n = 11–14 mice per group). (g) Transmigration frequencies of freshly egressed T. gondii tachyzoites (RH, CPS) across bEnd.3 or Caco2 polarized monolayers, in presence or absence of uracil, are shown as percentage (%) of tachyzoites added in the upper well and assessed by plaquing assays as described under Methods. Data show mean ± SEM from four independent experiments performed in duplicate. (h) Transmigration frequencies of freshly egressed CPS tachyzoites grown in absence of uracil for 24, 48, and 72 hr, respectively. Data show mean ± SEM from three independent experiments performed in duplicate (i) Gliding motility analyses of freshly egressed RH and CPS tachyzoites, in presence or absence of uracil. Compiled data show individual trail lengths (n = 45–50) and mean + SEM from three independent experiments. (j) Transmigration frequencies of T. gondii tachyzoites (RH, CPS) as in (g) in presence or absence of FAK inhibitor (VS-6063). Data show mean ± SEM from 3 (bEnd.3) and 4 (Caco2) independent experiments performed in duplicate. (k) Relative parasite frequency in the brain after co-infection in CD1 mice. Each mouse was co-inoculated i.v. with 5 × 107 (50 M), 1 × 107 (10 M) or 1.5 × 106 (1.5 M) freshly egressed RH and an equal number of freshly egressed CPS tachyzoites, respectively. Consecutive coronal brain sections were assessed for T. gondii after 24, 48, or 72 hr, respectively, as detailed in (Figure 9—figure supplement 3a-d). Data show mean ± SEM from 3 to 4 mice per experiment and condition. (l, m) Parasite loads in the brains of CD1 mice treated with FAK inhibitor (l) or ECPTK2 cKO mice (m), respectively, challenged with freshly egressed CPS tachyzoites (2 × 108, i.v.). Parasite loads were assessed as in (k). Data show mean + SEM from 2 experiments and 5 mice per condition. (n) Representative micrographs from brain sections of C57BL/6 mice challenged with CPS (2 × 108, i.v.) and stained for endothelial marker GLUT1, the basal lamina markerβ1 laminin and anti-T. gondii antibodies followed by secondary antibody Alexa 488/405/594, respectively. Left: micrograph and inset depict intravascular CPS tachyzoites. Right: micrograph illustrates extravascular localization of CPS. Inset represents magnification of area of interest. Arrows indicate T. gondii tachyzoites. Scale bars, 25 µm (Figure 9—figure supplement 3e). *p< 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns, non-significant (a, g–j) one-way ANOVA followed by Sidaks post-hoc test, (b, c, e, f, l, m), Mann-Whitney test.
-
Figure 9—source data 1
Western blots corresponding to Figure 9a.
- https://cdn.elifesciences.org/articles/69182/elife-69182-fig9-data1-v3.zip
Finally, we sought to determine the impact of FAK on the passage of a non-replicating uracil-auxotroph T. gondii mutant (CPS) (Fox and Bzik, 2002), shown to infect brain endothelium in mice (Konradt et al., 2016). First, we determined the invasive phenotype of the CPS mutant across polarized cellular monolayers with moderate-to-high (bEnd.3) and high (Caco2) transcellular electrical resistance (TCER), in presence and absence of uracil. Interestingly, freshly egressed CPS tachyzoites transmigrated across the polarized monolayers, with a non-significant reduction of transmigration frequencies in absence of uracil throughout the assay (16–18 h) and with relative lower transmigration frequencies across monolayers with high TCER (Figure 9g). The TCER values and the permeability to a low-molecular-weight tracer were monitored throughout the assay (Figure 9—figure supplement 2a, b, c), in accordance with (Ross et al., 2019). In sharp contrast, upon uracil deprivation ≥24 hr, freshly egressed CPS tachyzoites dramatically reduced their transmigration frequencies (Figure 9h). Similarly, gliding motility analyses confirmed a significant reduction of gliding trail lengths by freshly egressed CPS tachyzoites, which was accentuated in absence of uracil (Figure 9i). In vitro, CPS tachyzoites invaded the polarized cell monolayers over time in absence of replication (Figure 9—figure supplement 2d), with intracellular parasite localization as described (Fox and Bzik, 2002). Importantly, in presence of FAK inhibitor, the relative transmigration frequencies of freshly egressed CPS tachyzoites increased significantly, proportionally similar to RH (~2–3 fold) (Figure 9j). In vivo, co-challenge of mice with CPS and RH at highest doses tolerated by mice 24, 48, or 72 hr, respectively, showed dramatically low parasite loads for CPS in brain and other organs, compared with RH (Figure 9k, Figure 9—figure supplement 3a). Partly contrasting with in vitro data, non-significant differences in parasite loads were detected upon pharmacological FAK inhibition or upon challenge of ECPTK2 cKO mice with CPS (Figure 9l and m). For CPS-challenged mice, staining with endothelial cell and basal lamina markers confirmed scarce invasion events of single CPS tachyzoites, encompassing both intravascular localization and extravascular localization in the parenchyma (Figure 9n, Figure 9—figure supplement 3e, Video 11). The low total numbers of CPS parasites retrieved in brain precluded direct comparisons with RH for translocation events or relative quantifications of passage across the BBB versus invasion of endothelial cells for this mutant line. We conclude that non-replicating CPS tachyzoites transmigrate across polarized monolayers in a TCER-related fashion in vitro and that FAK inhibition elevates transmigration frequency. Upon uracil deprivation, the CPS line rapidly exhibits reduced gliding motility and transmigration frequency across polarized monolayers, compared with the parental strain RH. In vivo, low numbers of CPS parasites are retrieved in tissues hours after inoculation, indicating generally reduced invasion events and a rapid elimination of this parasite mutant in vivo.
Localization of tachyzoites (CPS) in brain tissue.
Movie shows 3D projections of brain section from C57BL/6 mice challenged with freshly egressed CPS tachyzoites (2 × 108, i.v.) and stained for endothelial marker GLUT1 (green) and anti-T. gondii followed by secondary antibody Alexa 594 (red).
Discussion
Passage across the cellular blood-CNS barriers is a prerequisite for the establishment of latent cerebral toxoplasmosis in humans and rodents. Here, we studied the crucial interaction of T. gondii with the brain vasculature in mice.
Our study establishes that the principal point of entry of T. gondii from the blood circulation into the brain parenchyma is at the level of cortical capillaries, similarly in three separate mouse strains and for prototypic T. gondii type I and type II strains. The data evidence preferential localization of parasites to capillaries with low α5 laminin/P-glycoprotein expression ratio, a relative less frequent localization to post-capillary venules, and scarce or absence of localization to penetrating arterioles, pre-capillary arterioles and penetrating venules.
We report that the BBB integrity is paramount to restrict T. gondii infection of the brain parenchyma. First, from day one post-inoculation, the accumulation of T. gondii tachyzoites in the brain was dramatically inferior to that observed in lung and liver, indicating a relative lower permissiveness of the brain vasculature to adhesion or invasive events by T. gondii. Second, the initial vascular localization with replicating parasites within brain endothelium (Konradt et al., 2016), was rapidly accompanied by appearance of vacuoles with replicating parasites in the perivascular spaces and in the cerebral parenchyma. Third, perturbations of BBB permeability by pro-inflammatory, anti-inflammatory stimuli or high doses of T. gondii resulted in elevated parasite loads in the CNS. Finally, pharmacological inhibition or induced gene ablation of the endothelial BBB intercellular junction regulator FAK facilitated parasite passage to the brain parenchyma.
In natural oral infections, relatively low numbers of T. gondii cysts ultimately form in the CNS indicating that passage across the BBB is a relatively rare event, compared with the initial parasite loads in the parenchyma of other peripheral organs, for example, lungs, liver, spleen, or in musculature. We validated an experimental approach that allowed controlled assessment of T. gondii localization in the CNS after intraperitoneal or intravenous inoculation and that yielded parasite load distributions comparable with oral and other intraperitoneal infection models (Konradt et al., 2016; Kanatani et al., 2017; Zenner et al., 1998; Mordue et al., 2001). While the approaches utilized in this and other studies permit reproducible quantifications, they may also entail limitations. An impact on the relative localization of parasites or kinetics of passage cannot be excluded. However, similar BBB localization and invasion patterns were observed for both inoculation routes, irrespective of mouse strain, parasite strain or dose. Importantly, for the vast majority of parasite foci, the clear vicinity to one capillary indicated the putative translocation site to the brain parenchyma. Further, the observation of perivascular parasite vacuoles beneath the vascular endothelium is interesting and the identification of the hosting cells remains to be investigated.
Our data show that T. gondii tachyzoites very early (1–3 dpi) interact primarily with the endothelium of cortical capillaries, confirming and extending the earlier reported replication of parasites in brain endothelium at later timepoints (7–9 dpi) (Konradt et al., 2016). This localization contrasts with findings in cerebral malaria, where parasitized erythrocytes preferentially bind to post-capillary venules and larger venules with components of inflammatory leukocytes (Haldar et al., 2007; Nacer et al., 2014). The capillary bed offers the largest hemodynamic resistance to the cortical blood supply and has lower flow speeds (Gould et al., 2017). Hypothetically, this together with the restricted diameter of capillaries may facilitate the adhesion, invasion and crossing of T. gondii tachyzoites. In vitro, ICAM-1 and integrins are implicated in adhesion and transmigration of T. gondii tachyzoites (Barragan et al., 2005) and of parasitized leukocytes (Ueno et al., 2014; Ross et al., 2021). Among other inflammatory parameters and cell adhesion molecules (CAMs), here we report elevated expression of ICAM-1 and VCAM-1 in infected brains and, specifically, in purified brain microvessels from challenged mice. Jointly with the finding of elevated TIMP-1 expression in microvessels, and its recently attributed functions in maintenance of FAK-related BBB integrity (Tang et al., 2020) and T. gondii dissemination (Ólafsson et al., 2018; Ólafsson et al., 2019), future investigations need to address the implication of CAMs in endothelial and parenchymal invasion.
We provide evidence that T. gondii can invade the CNS across the choroid plexus (CP) and meningeal vessels, albeit in lower relative numbers compared with total parasite numbers entering across the extensive parenchymal vascular network. However, taking into account the relative smaller endothelial cell surface area and tissue volume of the CP and meningeal vessels related to cortical vasculature, the data indicate that passage is facilitated at the CP. Hypothetically, this may implicate the fenestrated choroidal endothelium, a known locus minoris resistentiae for brain invasion by the causative agent of sleeping sickness Trypanosoma brucei (Schultzberg et al., 1988). Similarly, bacteria and viruses can translocate across meninges and CP (Schwerk et al., 2015) or by disrupting the parenchymal BBB (Doran et al., 2016; Spindler and Hsu, 2012). The data is also in line with the reported localization of T. gondii reactivation foci in grey matter, with few reactivation foci in the CP and the meninges (Dellacasa-Lindberg et al., 2007). Further, human cerebral toxoplasmosis is associated with encephalitis and seldomly associated with meningeal inflammation (Schlüter and Barragan, 2019), while detection of T. gondii in the cerebrospinal fluid is used in clinical practice (Mesquita et al., 2010). Jointly, this indicates that, while parenchymal invasion occurs primarily across cortical capillaries, passage across the CP and meningeal vessels provides T. gondii access to the cerebrospinal fluid circulatory system, which may contribute to parasite dissemination within the CNS.
We report that early passage of T. gondii to the brain parenchyma occurs in absence of measurable BBB leakage, perivascular cuffing or prominent leukocyte infiltration, similarly in different mouse strains and for T. gondii type I and type II strains. In fact, measurable leukocyte infiltration in the vicinity of parasite foci was absent early during infection (< day 5). In contrast, infiltration was abundant by day 10, in line with recent findings (Schneider et al., 2019). Thus, perivascular cuffing or significant leukocyte infiltration does not appear to be a requisite for initial T. gondii passage to the parenchyma (< day 5). However, an inflammatory activation of the BBB endothelium by the infection was evidenced by elevated expression of CAMs but also inflammation-dampening TIMP-1 (Ólafsson et al., 2018; Ólafsson et al., 2019). Pro-inflammatory pre-treatment with LPS yielded elevations of parenchymal parasite loads and significantly larger cerebral parasite foci. This indicates that initial parasite passage was facilitated by LPS-induced increased BBB permeability (Banks et al., 2015), which may implicate regulation via FAK (Guo et al., 2015), and by exacerbated inflammation (Haruwaka et al., 2019). Conversely, anti-inflammatory pre-treatment with hydrocortisone led to elevated total parasite loads in the brain but also in other organs, likely secondary to a hampered immune response. Jointly, though these treatments have pleiotropic effects with a likely impact on parasitemia, the data is indicative that passage of T. gondii across the BBB is not only restricted by the inflammatory response. Along these lines, unnaturally high doses of T. gondii tachyzoites were required to induce BBB leakage similar to LPS. This strongly advocates against a generalized BBB dysfunction early in natural T. gondii infections, but does not exclude the occurrence of focalized dysregulations (Estato et al., 2018). In fact, focalized permeability elevations were detected in the vicinity of parasite foci, albeit in low numbers and without increased relative numbers over time. This is indicative of BBB permeability variations over time following the penetration of parasites to the parenchyma or that the BBB is transiently dysregulated. Thus, future investigations need to determine if an elevated BBB permeability around a given focus is consistently present, albeit transient, or if translocation can also occur in the absence of elevated permeability. Also, taking into consideration the alternative pathways of translocation discussed below, these two possibilities are not necessarily mutually exclusive. Noteworthy, despite the infection of endothelium and expected natural lysis of parasitized cells after replication, we found no evidence of irreversible vascular disruption with petechial hemorrhages, as described in cerebral malaria (Haldar et al., 2007) and meningococcal disease (Coureuil et al., 2014). Yet, this does not rule out that single translocation events of T. gondii or egress of tachyzoites from single endothelial cells transiently destabilize the BBB below the detection threshold for the permeability tracer EB. In in vitro models using polarized primary brain endothelium, extracellular tachyzoites and parasitized dendritic cells rapidly translocated in absence of endothelial cell lysis, with a modest perturbation of the transcellular electrical resistance (TCER) but, importantly, in absence of leakage of a low-molecular weight permeability tracer (Ross et al., 2019; Ross et al., 2021). In sharp contrast, cellular depolarization events or lysis of cells in the monolayers following parasite replication at later time-points led to significant decreases in TCER and dramatic elevations of permeability tracer concentration in vitro (Ross et al., 2019; Ross et al., 2021). Altogether, these findings motivated an exploration of the BBB regulatory mechanisms in vivo.
We demonstrate a role for the BBB junction regulator FAK in the restricted passage of T. gondii to the brain parenchyma. Despite being embryonic lethal (Ilić et al., 1995), unchallenged adult mice with conditional deletion of endothelial FAK normally exhibit wildtype phenotype and apparently normal BBB morphology (Lee et al., 2010; Weis et al., 2008), consistent with the maintained morphology and the absence of leakage of blood tracer observed here. However, upon T. gondii challenge, FAK-deficient mice carried higher numbers of parasite foci and foci of larger size in the parenchyma, indicative of increased permissiveness compared to wildtype. Interestingly, pharmacological treatment with FAK inhibitor had a more pronounced effect on parasite loads with elevated BBB permeability, compared with conditional ablation of endothelial FAK. This difference may be due to a number of factors. First, conditional deletion of endothelial FAK is partially functionally compensated (Weis et al., 2008). Second, although the FAK inhibitor defactinib appears to be well tolerated, immunomodulatory effects may also contribute to the higher parasite loads in peripheral organs, and, thus, elevated numbers of parasites may enter the cerebral circulation (Osipov et al., 2019). Additionally, inhibition of FAK may interfere with parasite dissemination in infected leukocytes (Ólafsson et al., 2019; Cook et al., 2018) and parasite survival in endothelium (Portillo et al., 2017). Regardless, induced ablation of FAK in endothelium, with maintained expression of FAK in bone-marrow-derived cells, yielded higher numbers and size of parasite foci in brain parenchyma, demonstrating endothelium-related effects. Further, we recently reported that altered FAK phosphorylation upon T. gondii infection facilitates parasite passage across highly polarized primary brain endothelial cell monolayers (Ross et al., 2019). Importantly, this transient dysregulation of FAK occurs without disruption of monolayer polarization or increased permeability to low-molecular weight tracer, consistent with in vivo observations here. Thus, FAK inhibition or ablation appears to have a destabilizing, but non-disruptive, effect on the BBB. Jointly, the data show that endothelial FAK-regulated BBB restrictiveness is one of the determinants of T. gondii passage across the BBB.
Alternative routes have been proposed for the translocation of T. gondii across restrictive biological barriers (Lambert and Barragan, 2010), including the BBB (Schlüter and Barragan, 2019), and it is likely that more than one mechanism mediates entry into the CNS, including growth across endothelium, direct penetration and trafficking of leukocytes (Matta et al., 2021). The paracellular entry route (Ross et al., 2019; Barragan et al., 2005; Barragan and Sibley, 2002; Furtado et al., 2012; Weight et al., 2015) implies passing cellular TJs, and the transcellular route (Konradt et al., 2016; Lambert and Barragan, 2010; Dubey, 1997) implies apical parasite invasion and basolateral exit from the cells after replication. Additionally, leukocytes traffic into the brain parenchyma during toxoplasmosis (John et al., 2011) and parasitized hypermigratory leukocytes may aid in direct translocation (Bhandage et al., 2020; Courret et al., 2006; Lachenmaier et al., 2011) or by depositing parasites on the endothelium (Lambert and Barragan, 2010; Baba et al., 2017). Although the relative importance of the alternative pathways of passage is not specifically addressed here, the data are relevant for these alternatives or combinations of pathways because focal invasion events with an impact on TJ and BBB barrier integrity are likely to occur, for example, upon egress of tachyzoites from endothelium (Konradt et al., 2016). In these settings, we demonstrate that a non-replicating T. gondii line (CPS) transmigrates across polarized endothelium and epithelium in vitro, with elevated transmigration frequencies upon FAK inhibition. Thus, despite the reduced gliding motility and transmigration abilities of this mutant, the data provide additional evidence that FAK impacts the endothelial process of tachyzoite transmigration, in absence of monolayer disruption and independently of parasite replication in vitro. In mice, surprisingly few CPS parasites were detected in the brain and other peripheral organs shortly after inoculation, consistent with the absence of symptomatology in mice despite the inoculation of doses that are imminently lethal with wildtype ( > 108) and with scarce localization of single CPS tachyzoites intravascularly, and extravascularly in the brain parenchyma. Partly contrasting with in vitro results, elevated total numbers of CPS parasites were not detected in the brain upon FAK inhibition or ablation in vivo. Given the high TCER of the BBB, this may be related to the expected overall reduced invasive and transmigration abilities of this mutant, in combination with a sensitivity limitation of the assay due to scarce total invasion events. Importantly, the low numbers of intravascular CPS parasites compared with wildtype (RH) precluded direct comparisons with wildtype for numbers of translocation events in vivo. Together, the reduced gliding and TCER-related transmigration abilities of this auxotroph mutant upon uracil deprivation indicate that metabolic stress (Blondy et al., 2020) negatively impacts invasion events in vitro and in vivo and, that this mutant is rapidly neutralized in vivo, possibly as a consequence of its generally reduced invasion capability.
Jointly, the present study identifies FAK-regulated TJ stability as a determinant of T. gondii translocation across cortical capillaries. We postulate that the infection-related destabilization of the BBB by FAK dephosphorylation (Ross et al., 2019) facilitates active transmigration of parasites across the BBB. The impact of transient and focal BBB dysregulation on the alternative pathways of parasite passage to the parenchyma, together with the roles of the non-endothelial cellular constituents of the neurovascular unit, need to be addressed in future investigations.
In humans and mice, primary infection with T. gondii entails invasion of the CNS with passage of the parasite across the BBB. Natural infections in humans normally present mild or no symptomatology (Montoya and Liesenfeld, 2004). Thus, our data supports the concept that passage of T. gondii to the brain parenchyma is an early and clinically silent process in absence of focal neurological symptoms or cardinal signs of inflammation. As the immune response develops, tachyzoites are neutralized and developmental switch to bradyzoite stages takes place for chronic perseverance in the brain parenchyma.
Materials and methods
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (Mus musculus) | C57BL/6NCrl(B6) | Charles River Laboratories | Strain code 027 | |
Strain, strain background (Mus musculus) | Crl:CD1(ICR)(CD1) | Charles River Laboratories | Strain code 022 | |
Strain, strain background (Mus musculus) | BALB/cAnNCrl(BALB/c) | Charles River Laboratories | Strain code 028 | |
Strain, strain background (Mus musculus) | B6.129P2(FVB)-Ptk2tm1.1Guan/J(Ptk2flox/flox) | Jackson Laboratories (Shen et al., 2005; Daneman and Prat, 2015) | JAX stock # 031956 | |
Strain, strain background (Mus musculus) | C57BL/6-Tg(Cdh5-cre/ERT2)1Rha (Cdh5cre+/-) | Taconic Biosciences | Taconic Model # 13,073 | |
Cell line (T. gondii) | GFP-expressing RH-LDM, type I(RH) | Kim et al., 2001;Barragan and Sibley, 2002; | ||
Cell line (T. gondii) | GFP-expressing ME49/PTG, type II(ME49) | Kim et al., 2001 | ||
Cell line (T. gondii) | mCherry-expressing CPS, type I (CPS) | Fox and Bzik, 2002;Konradt et al., 2016 | ||
Cell line (Homo sapiens) | HFF-1(HFF) | American Type Culture Collection | SCRC-1041 | |
Cell line (Mus musculus) | bEND.3 | American Type Culture Collection | CRL-2299 | |
Cell line (Homo sapiens) | Caco-2 | American Type Culture Collection | HTB-37 | |
Antibody | Anti-P- glycoprotein (Mouse monoclonal) | GeneTex | Cat# GTX23364, RRID:AB_367204 | IF(1:100) |
Antibody | Anti- GFAP (Rat monoclonal) | Thermo Fisher Scientific | Cat# 13–0300, RRID:AB_2532994 | IF(1:200) |
Antibody | Anti-Occludin (Mouse monoclonal) | Thermo Fisher Scientific | Cat# 33–1500, RRID:AB_2533101 | IF(1:100) |
Antibody | Anti- Iba1(Rabbit polyclonal) | FUJIFILM Wako Shibayag | Cat# 019–19741, RRID:AB_839504 | IF(1:100) |
Antibody | Anti-CD45 (Rat monoclonal) | BD Biosciences | Cat# 550539, RRID:AB_2174426 | IF(1:20) |
Antibody | Anti-CD31 (Rat monoclonal) | BD Biosciences | Cat# 553370, RRID:AB_394816 | IF(1:100) |
Antibody | Anti-ZO-1 (Rabbit polyclonal) | Thermo Fisher Scientific | Cat# 40–2200, RRID:AB_2533456 | IF(1:100) |
Antibody | Anti-Glut1(Goat polyclonal) | Santa Cruz Biotechnology | Cat# sc-1605, RRID:AB_2239463 | IF(1:40) |
Antibody | Anti- laminin α4 (Rat polyclonal) | gift from Lydia Sorokin and Krister Kristensson.Masocha et al., 2004. doi:10.1172/JCI22104. | serum 341 | IF(1:500) |
Antibody | Anti- laminin α5 (Rat polyclonal) | gift from Lydia Sorokin and Krister Kristensson. Masocha et al., 2004. doi:10.1172/JCI22104. | supernatant; clone 4G6 | IF(1:20) |
Antibody | Anti- laminin β1 (Rat monoclonal) | gift from Lydia Sorokin and Krister Kristensson. Masocha et al., 2004. doi:10.1172/JCI22104. | 1:1; clone 3A4 | IF(1:100) |
Antibody | Anti-T. gondii (Rabbit polyclonal) | Dellacasa-Lindberg et al., 2011:10.1128/IAI.01042–10 | IF(1:100) | |
Antibody | Anti-Rat IgG (H + L) Alexa Fluor 594 (Chicken polyclonal) | Thermo Fisher Scientific | Cat# A-21471, RRID:AB_2535874 | IF(1:500) |
Antibody | Anti-Mouse IgG (H + L) Alexa Fluor 405 (Goat polyclonal) | Thermo Fisher Scientific | Cat# A-31553, RRID:AB_221604 | IF(1:500) |
Antibody | Anti-Rabbit IgG (H + L) Alexa Fluor 488 (Chicken polyclonal) | Thermo Fisher Scientific | Cat# A-21441, RRID:AB_2535859 | IF(1:1000) |
Antibody | Anti-Rabbit IgG (H + L) Alexa Fluor 594 (Chicken polyclonal) | Thermo Fisher Scientific | Cat# A-21442, RRID:AB_2535860 | IF(1:1000) |
Antibody | Anti-Goat IgG (H + L) Alexa Fluor 488 (Donkey polyclonal) | Jackson ImmunoResearch Labs | Cat# 705-545-147, RRID:AB_2336933 | IF(1:100) |
Antibody | Anti-Rat IgG (H + L) Alexa Fluor 488 (Donkey polyclonal) | Jackson ImmunoResearch Labs | Cat# 712-545-150, RRID:AB_2340683 | IF(1:100) |
Antibody | Anti-mouse CD45 Brilliant Violet 711(Rat monoclonal) | BioLegend | Cat# 103147, RRID:AB_2564383 | FACS (1 ul per test) |
Antibody | Anti-mouse CD11b (M1/70), APC, eBioscience (Rat monoclonal) | Thermo Fisher Scientific | Cat# 17-0112-82, RRID:AB_469343 | FACS (1 ul per test) |
Antibody | Anti- FAK (Rabbit polyclonal) | Cell Signaling Technology | Cat# 3285, RRID:AB_2269034 | WB (1:1000) |
Antibody | Anti-Toxoplasma gondii P30 (Mouse monoclonal) | Thermo Fisher Scientific | Cat# MA1-83499, RRID:AB_935764 | IF(1:50) |
Antibody | Anti-rabbit IgG, HRP-linked (Goat polyclonal) | Cell Signaling Technology | Cat# 7074, RRID:AB_2099233 | WB (1:3000) |
Antibody | Anti-GAPDH (Rabbit polyclonal) | Millipore | Cat# ABS16, RRID:AB_10806772 | WB (1:3000) |
Sequence-based reagent | Gapdh_F | This paper | PCR primers | TGACCTCAA CTACATGGTCTACA |
Sequence-based reagent | Gapdh_R | This paper | PCR primers | CTTCCCATT CTCGGCCTTG |
Sequence-based reagent | Hprt_F | This paper | PCR primers | CCC AGC GTC GTG ATT AGC |
Sequence-based reagent | Hprt_R | This paper | PCR primers | GGA ATA AAC ACT TTT TCC AAA TCC |
Sequence-based reagent | Mmp2_F | This paper | PCR primers | GTT GCT TTT GTA TGC CCT TCG |
Sequence-based reagent | Mmp2_R | This paper | PCR primers | TCA GAC AAC CCG AGT CCT TTG |
Sequence-based reagent | Mmp12_F | This paper | PCR primers | TGT GGA GTG CCC GAT GTA CA |
Sequence-based reagent | Mmp12_R | This paper | PCR primers | AGT GAG GTA CCG CTT CAT CCA T |
Sequence-based reagent | Mmp9_F | This paper | PCR primers | AAA ACC TCC AAC CTC ACG GA |
Sequence-based reagent | Mmp9_R | This paper | PCR primers | GCT TCT CTC CCA TCA TCT GGG |
Sequence-based reagent | Mmp14_F | This paper | PCR primers | TATGGGCCC AACATCTGTGAC |
Sequence-based reagent | Mmp14_R | This paper | PCR primers | AACCATC GCTCCTTG AAGACA |
Sequence-based reagent | Vcam1_F | This paper | PCR primers | GTG ACT CCA TGG CCC TCA CTT |
Sequence-based reagent | Vcam1_R | This paper | PCR primers | CGT CCT CAC CTT CGC GTT TA |
Sequence-based reagent | Icam1_F | This paper | PCR primers | CAA TTT CTC ATG CCG CAC AG |
Sequence-based reagent | Icam1_R | This paper | PCR primers | CTG GAA GAT CGA AAG TCC GG |
Sequence-based reagent | Sele (E-selectin)_F | This paper | PCR primers | CCC TGC CCA CGG TAT CAG |
Sequence-based reagent | Sele (E-selectin)_R | This paper | PCR primers | ACG TGC ATG TCG TGT TCCA |
Sequence-based reagent | Ocln_F | This paper | PCR primers | AGG ACG GAC CCT GAC CAC TA |
Sequence-based reagent | Ocln_R | This paper | PCR primers | GGT GGA TAT TCC CTG ACC CAG |
Sequence-based reagent | Ifng_F | This paper | PCR primers | GCT TTG CAG CTC TTC CTC AT |
Sequence-based reagent | Ifng_R | This paper | PCR primers | CAC ATC TAT GCC ACT TGA GTT AAA ATA GT |
Sequence-based reagent | Ccl2_F | This paper | PCR primers | CATCCACGTGTTGGCTCA |
Sequence-based reagent | Ccl2_R | This paper | PCR primers | GATCATCTTGCTGGTGAATGAGT |
Sequence-based reagent | Il1240_F | This paper | PCR primers | TCCCTCAAGTTCTTTGTTCG |
Sequence-based reagent | Il1240_R | This paper | PCR primers | CGCACCTTTCTGGTTACAC |
Sequence-based reagent | Timp1_F | This paper | PCR primers | GCAACTCGGACCTGGTCATAA |
Sequence-based reagent | Timp1_R | This paper | PCR primers | CGCTGGTATAAGGTGGTCTCG |
Sequence-based reagent | Timp2_F | This paper | PCR primers | CTCGCTGTCCCATGATCCC |
Sequence-based reagent | Timp2_R | This paper | PCR primers | GCCCATTGATGCTCTTCTCTGT |
Sequence-based reagent | B1_F | This paper | PCR primers | GCATTGCCCGTCCAAACT |
Sequence-based reagent | B1_R | This paper | PCR primers | AGACTGTACGGAATGGAGACGAA |
Sequence-based reagent | Ptk2tm1.1_F | The Jackson Laboratory | Stock No: 031956. Protocol 35,084 | GAA CTT GAC AGG GCT GGT CT |
Sequence-based reagent | Ptk2tm1.1_R | The Jackson Laboratory | Stock No: 031956. Protocol 35,084 | CTC CAG TCG TTA TGG GAA ATC T |
Sequence-based reagent | CRE_F | Taconic Biosciences | A.2684.Line: 13,073 Tg(Cdh5-cre/ERT2)1Rha | GCCTGCATTACCGGTCGATGCAACGA |
Sequence-based reagent | CRE_R | Taconic Biosciences | A.2684.Line: 13,073 Tg(Cdh5-cre/ERT2)1Rha | GTGGCAGATGGCGCGGCAACACCATT |
Chemical compound, drug | Lipopolysaccharides from Escherichia coli O111:B4 | Sigma Aldrich | L2630 | |
Chemical compound, drug | Hydrocortisone | Sigma Aldrich | H0888 | |
Chemical compound, drug | Evans Blue | Sigma Aldrich | E2129 | |
Chemical compound, druC | Defactinib (VS-6063) | Selleck Chemical’s | S7654 | |
Chemical compound, drug | (Z)–4-Hydroxytamoxifen | Sigma Aldrich | H7904 | |
Chemical compound, drug | Tamoxifen | Sigma Aldrich | T5648 | |
Commercial assay or kit | RNeasy Mini Kit | QIAGEN | 74,104 | |
Commercial assay or kit | DNeasy Blood & Tissue Kit | QIAGEN | 69,506 | |
Commercial assay or kit | SuperScript IV Reverse Transcriptase (RT) | Thermo Fisher Scientific | 18090050 | |
Commercial assay or kit | Platinum Taq DNA Polymerase | Thermo Fisher Scientific | 10966034 |
Experimental animals
Request a detailed protocolAll utilized mice strains are listed in the Key Resources Table. B6.129P2(FVB)-Ptk2tm1.1Guan/J (Ptk2flox/flox) mice were crossed with C57BL/6-Tg(Cdh5-cre/ERT2)1Rha (Cdh5cre+/-) mice for endothelial cell-specific deletion of FAK-encoding Ptk2. Experimental mice were Ptk2flox/floxCdh5cre+/- (ECPTK2 cKO) and Ptk2flox/floxCdh5cre-/- (ECPTK2 WT) littermates were used as control wild-type mice. Ptk2wt/wtCdh5cre-/- and Ptk2wt/wtCdh5cre+/- mice were also used in control experiments. Mice were injected intraperitoneally (i.p.) with 2 mg tamoxifen (Sigma-Aldrich) for 5 consecutive days to induce recombination. Six- to 12-week-old male or female mice were used for experiments. Animals were housed under specific pathogen-free conditions at the Experimental Core Facility, Stockholm University.
Parasite and cell lines
Request a detailed protocolT. gondii tachyzoites were maintained by serial 2 day passage in human foreskin fibroblast (HFF) monolayers cultured in Dulbecco‘s modified Eagle’s medium (DMEM; Thermofisher scientific) with 10% fetal bovine serum (FBS; Sigma), gentamicin (20 µg/ml; Gibco), glutamine (2 mM; Gibco), and HEPES (0.01 M; Gibco). For the CPS line, uracil (250 µM; Sigma) was added to the culture medium as indicated (Fox and Bzik, 2002). Cultures were periodically tested for mycoplasma and tested negative. Parasite lines and cell lines are listed in the Key Resources Table.
Infections and treatments in mice
Request a detailed protocolMice were inoculated intravenously (i.v.) with high doses (hd, 1–10 × 106) or i.p. with low doses (ld, 2,5–5 × 104) of freshly egressed T. gondii tachyzoites. To evaluate the effect of inflammation on parasite loads, T. gondii-infected CD1 mice were inoculated i.p. with LPS (serotype 011:B4, Sigma) at 0.08 or 0.2 mg/kg/day for seven or 5 days, respectively, starting 1 day before infection or treated subcutaneously with hydrocortisone (Cortisol, Sigma-Aldrich) at 20 or 40 mg/kg/day for 6 days, starting 3 days before T. gondii infection. For assessment of BBB permeability, control mice were injected i.p. with LPS (2 mg/kg) and sacrificed 6 h post-inoculation. T. gondii-infected mice were inoculated i.p. with the FAK inhibitor VS-6063 (defactinib; Selleckchem) at 50 mg/kg twice a day, starting 1 day before T. gondii infection.
Immunohistochemistry
Request a detailed protocolTo visualize the lumen of cerebral blood vessels, mice were injected i.v. with 200 μl of Evans blue solution (EB) containing 3% Evans blue fluorescent dye (Sigma) and 5% BSA dissolved in phosphate-buffered saline (PBS), prior to organ extraction. Extracted organs were fixed in 4% paraformaldehyde 0,1 M phosphate buffer (PFA) for 2 days and preserved in sucrose solution (10% sucrose, 0.01% NaN3 and 0.1 M Sorensen’s phosphate buffer) for 4 days. Tissues were then frozen on dry ice and 14–50 μm cryosections collected onto gelatin-coated slides. For immunostaining, brains were dissected, snap frozen on dry ice and stored in –80 ° C until sectioned in a cryostat. Brain cryosections of 14 μm thickness on coronal plane were fixed in 4% PFA followed by acetone fixation, permeabilization (0.2% Saponin or 0.3% Triton X-100 in PBS), blocking (1% BSA, 1%–10% FBS) and incubation with primary antibodies in IHC buffer (1% BSA, 0.3% Triton X-100, 0.01% NaN3) ON at 4 °C or for 3 hr at RT. All sections were then washed in PBS and incubated with corresponding secondary antibodies diluted in IHC buffer for 1 hr at RT, followed by DAPI staining. Microvessels were purified as describe below and seeded onto glass coverslips pre-coated with 1% gelatin, fixed in 4% PFA for 5 min, rinsed in PBS, incubated ON at 4° C with primary antibodies diluted in IHC buffer, and finally stained with secondary antibodies, followed by DAPI staining. All primary and secondary antibodies used are listed in Key Resources Table.
Microscopy and image analysis
Request a detailed protocolEpifluorescence microscopy was performed by using a 20 X objective (Observer Z1, Zeiss) or 63 X objective (DMi8, Leica Microsystems). Z-stack images were captured by confocal microscopy (LSM 800 Airyscan, Zeiss) and processed with ZenBlue software (Zeiss). Two-photon imaging was performed using a Leica SP8 DIVE microscope equipped with 4Tune non-descanned spectral detectors, a HC PL IRAPO 40 x/1.10 water immersion objective (Leica Microsystems) and a tunable INSIGHT DUAL X3 laser (Spectra-Physics, US). GFP was excited with 924 nm laser pulses, emission was detected at 500–520 nm, Evans blue was excited at 945 nm and detected at 620–750 nm. 3D reconstruction of z-stacks was performed using the 3D Visualization function in the Leica Application Suite X (LAS X, Leica Microsystems). Hyvolution, a Huygens-powered (Scientific Volume Imaging B.V.) deconvolution function integrated in LAS-X was used for deconvolution. To analyze distances between replicating tachyzoites and vasculature, confocal images were processed with 3D view using Imaris9.5 software. The brain microvasculature was defined by using the Surface rendering tool and replicating tachyzoites were identified as minimum 2 μm spots. The distance from each spot to the border of all surfaces was calculated using the ShortestDistanceToSurfaces tool.
Characterizations and quantifications of parasites in the CNS
Request a detailed protocolQuantifications of T. gondii (GFP+) foci were expressed as number of foci/mm2 of tissue or per section on coronal brain sections from parenchyma, choroid plexus and meninges. A parasite focus was defined as a group of vacuoles with replicating T. gondii (GFP+). Unless differently stated, individual vacuoles with replicating T. gondii tachyzoites (two or more tachyzoites per vacuole) were counted. The size of the foci was determined by counting number of vacuoles and categorized as follows <10, 11–50 or >50 vacuoles/focus. Single tachyzoites were also counted in Figures 3e, h–k ,, 9. Detailed localization analyses of T. gondii in relation to the cerebral vasculature were performed in the prefrontal cortex area of the brain parenchyma (bregma +2.96 mm to bregma +1.70 mm), using epifluorescence and confocal microscopy (63 X objective). Parasite (GFP+) signal co-localizing with EB signal was defined as intravascular. Parasite signal localized ≤10 μm and >10 μm from the EB signal of the vascular lumen was defined as perivascular and parenchymal, respectively. The vascular lumen and diameter sizes (μm) were determined by a scale-calibrated measurement (ImageJ software) across the EB signal and α5 laminin signal, respectively, in areas with GFP+ foci. To calculate the α5 laminin/P-glycoprotein fluorescence ratio, the mean α5 laminin fluorescence intensity signal was divided by the mean P-glycoprotein fluorescence intensity signal for each vessel. Plaquing assays were performed as described (Fuks et al., 2012). Briefly, brains, livers, and spleens were extracted and homogenized on 70 μm cell strainers. The numbers of viable parasites per g of tissue were determined by plaque formation on HFF-1 monolayers.
Assessment of BBB permeability
Request a detailed protocolTo assess BBB permeability, mice were injected i.v. with 200 μl of EB solution 15–20 min prior to organ extraction. Brains were dissected and processed for immunohistochemistry as described above. Pixel intensities of EB signal from the vessels and surrounding parenchyma were analyzed by ImageJ software as detailed in Figure 5—figure supplement 1. On average 75 blood vessels per mouse from a minimum of 5 fields of view (magnification 20 x) per brain section were analyzed. All images were acquired using identical microscope settings.
Isolation and treatments of brain microvessels and murine brain endothelial cells (MBECs)
Request a detailed protocolCerebral microvessels from infected and non-infected mice were isolated as described (Ross et al., 2019; Howland et al., 2015). Briefly, brains were minced with a scalpel-blade and homogenized by passing through a 23-gauge needle. The brain homogenate was mixed in an equal volume of 30% dextran solution (MW 70,000; Sigma-Aldrich) and centrifuged at 10,000 g for 15 min at 4° C. After removal of myelin (top layer), the pellet was resuspended in PBS and passed through a 40 µm cell strainer. The cell strainer was then back-flushed with PBS to collect the microvessel fragments. For in vitro culture of MBECs, microvessels from non-infected mice were incubated with 1 mg/ml Collagenase IV (Gibco) and 200 U/ml of DNAse I (Roche) dissolved in HBSS (Ca2+ and Mg2+) for 1.5–2 hr at 37 ° C. Digested microvessels were washed and seeded in 12-well plates pre-coated with 1% gelatin (Gibco) in EBM-2/EGM-2 medium (Lonza) with 4 μg/ml puromycin (Santa Cruz). The purity of MBECs was determined by CD31 expression (70%–80%) and ZO-1 expression as detailed in Ross et al., 2019. MBECs were challenged with freshly egressed T. gondii tachyzoites (RH-LDM, MOI 4) or LPS (100 ng/ml), for six or 12 h, and processed for PCR.
Gliding and transmigration assays
Request a detailed protocolGliding assays were performed as described (Barragan and Sibley, 2002). Briefly, glass slide coverslips were coated with FBS. Recently egressed tachyzoites were added to the coverslips and incubated at 37 ° C for 1 hr before fixation in 3.7% formalin-PBS. Detection of trails and length analyses were performed by using SAG1 mAb (P30) directly conjugated to Alexa 488 fluorochrome, epifluorescence microscopy and ImageJ software. Random trails associated to a tachyzoite were counted and tachyzoites with absence of trail were not counted.
Transmigration assays were performed as described (Ross et al., 2019). Briefly, freshly egressed tachyzoites (2 × 105) were exposed to polarized bEnd.3 and Caco2 monolayers in transwells. Polarization and permeability parameters were determined by measurement of transcellular electrical resistance (TCER) and FITC-dextran (3 kDa), before and after the assay, as detailed in Ross et al., 2019. Following incubation overnight (16–18 hr), transmigrated tachyzoites were quantified by plaquing assays, with uracil added to the medium for the CPS line. Cell lines and reagents are listed in Key Resources Table.
Tissue preparation and flow cytometry
Request a detailed protocolTo prepare single-cell suspensions, brain tissue was incubated with 1 mg/ml collagenase IV (Gibco) and 10 μg/ml DNase I (Roche) for 1 hr at 37 °C. Brain homogenates were then washed with FACS buffer (0.5% FBS, 2 mM EDTA in PBS), centrifuged at 250 g for 10 min and pellets resuspended in Percoll (Easycoll, Biochrom) in PBS at a final concentration of 30%. After centrifugation at 500 g for 30 min, the myelin (top layer) was discarded. Cell pellets were filtered through a 40 μm cell strainer and resuspended in FACS buffer. Spleen and lung cells were isolated by mechanical homogenization on 70 µm cell strainers followed by treatment with red blood cell lysis buffer (0.802% NH4Cl, 0.08%NaHCO3, 0.037% EDTA). Freshly isolated cells from brains, spleens, and lungs were blocked for 30 min in Fc block (BD Biosciences), and incubated with antibodies against CD45 (BV711, BioLegend) and CD11b (APC, eBioscience). Signal from GFP-expressing T. gondii was detected in the filter 525/550 channel. Flow cytometry was performed on LSR Fortessa (BD Biosciences) and data were analyzed with FlowJo software v10.
Real-time quantitative PCR
Request a detailed protocolTotal RNA was extracted from brain, liver or spleen homogenates using TRI Reagent (Sigma), chloroform and isopropanol. Microvessels and MBEC RNA was extracted using the RNeasy Mini kit (Qiagen) according to the manufacturer’s protocols. The amount and purity of isolated RNA was determine using a spectrophotometer (NanoDrop 1000, ThermoFisher Scientific) by reading the absorbance at 260 nm and 280 nm. The ratio A260/A280 of RNA from homogenate brain samples was in the range of 1.91–2.06, for microvessels 1.8–2.0 and for MBEC 2.03–2.16. First-strand cDNA was synthesized with Superscript IV Reverse Transcriptase (Invitrogen). Real-time PCR was performed using SYBR green PCR master mix (Kapa Biosystems), forward and reverse primers (200 nM) and cDNA (0.5–1 μg) with a QuantStudio TM 5 Real-Time PCR system (Thermofisher). ΔCt values were calculated with the house-keeping genes HPRT and GAPDH. 2-ΔΔCt values were used to calculate fold-change of expression upon challenge in cells and tissues. All primers were designed using Get-prime or Primer-BLAST software (Key Resources Table).
Western blot
Request a detailed protocolTo quantify protein levels of endothelial FAK in Cdh5cre+/- (Ptk2wt/wt, Ptk2flox/wt or Ptk2flox/flox) mice upon tamoxifen treatment, MBECs were isolated and treated with (Z)–4-Hydroxytamoxifen in vitro (500 nM; Sigma) for 24 hr on day 10. Bone-marrow-derived cells were isolated from mice as described (Bhandage et al., 2020). Livers were extracted and homogenized. MBECs (day 14), BMDCs (day 7) or liver extracts were lysed in RIPA buffer (150 mM NaCl, 50 mM Tris, 0.1% Triton, 0.5% deoxycholic acid, 0.1% SDS) with cOmplete mini protease and phosphatase inhibitors (Roche). Proteins were separated using 8% SDS-PAGE gels, blotted onto a PVDF membrane (Millipore) and blocked (5% BSA, Sigma-Aldrich) followed by incubation with anti-FAK or anti-GAPDH followed by anti-rabbit HRP. Proteins were detected by mean of enhanced chemiluminescence (GE Healthcare) in a BioRad ChemiDoc XRS+. Densitometry analyses was performed using ImageJ (NIH, MD, USA).
Genotyping
Request a detailed protocolMouse genomic DNA was isolated from ear biopsies using DNeasy Blood & Tissue kit (Qiagen). PCR was performed as described by Taconic Biosciences for Cdh5cre+/- mice, and as described by Jackson Laboratory for Ptk2flox/flox mice.
Statistical analyses
Request a detailed protocolStatistical analyses were performed using GraphPad Prism software (v. 8) or TIBCO Statistica software (v. 7). For two-group comparisons, two-tailed Student’s t-test was performed on samples with normal distribution and Mann-Whitney test was used on non-normally distributed data. For multiple comparisons, data with a normal distribution were analyzed by one-way ANOVA, followed by Tukey’s test or Dunnett’s test. ANOVA and ANCOVA- F value and degrees of freedom F (dfn, dfd) are indicated in the figure legends. For multiple comparisons, Kruskal-Wallis test, followed by Dunn’s post-hoc test was performed when data was not normally distributed. For all statistical tests, values of p ≥ 0.05 were defined as non-significant, and p < 0.05 were defined as significant.
Data availability
All data generated or analysed during this study are included in the manuscript and supporting files.
References
-
Astrocyte-endothelial interactions at the blood-brain barrierNature Reviews. Neuroscience 7:41–53.https://doi.org/10.1038/nrn1824
-
Leukocyte Breaching of Endothelial Barriers: The Actin LinkTrends in Immunology 38:606–615.https://doi.org/10.1016/j.it.2017.05.002
-
Transepithelial migration of Toxoplasma gondii is linked to parasite motility and virulenceThe Journal of Experimental Medicine 195:1625–1633.https://doi.org/10.1084/jem.20020258
-
Toxoplasma gondii disrupts β1 integrin signaling and focal adhesion formation during monocyte hypermotilityThe Journal of Biological Chemistry 293:3374–3385.https://doi.org/10.1074/jbc.M117.793281
-
Invasive meningococcal disease: a disease of the endothelial cellsTrends in Molecular Medicine 20:571–578.https://doi.org/10.1016/j.molmed.2014.08.002
-
A journey into the brain: insight into how bacterial pathogens cross blood-brain barriersNature Reviews. Microbiology 15:149–159.https://doi.org/10.1038/nrmicro.2016.178
-
Pathogens penetrating the central nervous system: infection pathways and the cellular and molecular mechanisms of invasionClinical Microbiology Reviews 27:691–726.https://doi.org/10.1128/CMR.00118-13
-
The blood-brain barrierCold Spring Harbor Perspectives in Biology 7:a020412.https://doi.org/10.1101/cshperspect.a020412
-
Migratory activation of primary cortical microglia upon infection with Toxoplasma gondiiInfection and Immunity 79:3046–3052.https://doi.org/10.1128/IAI.01042-10
-
Toxoplasma gondii: blood and tissue kinetics during acute and chronic infections in miceExperimental Parasitology 73:460–468.https://doi.org/10.1016/0014-4894(91)90070-d
-
Host-pathogen interactions in bacterial meningitisActa Neuropathologica 131:185–209.https://doi.org/10.1007/s00401-015-1531-z
-
The Neurotropic Parasite Toxoplasma gondii Induces Sustained Neuroinflammation with Microvascular Dysfunction in Infected MiceThe American Journal of Pathology 188:2674–2687.https://doi.org/10.1016/j.ajpath.2018.07.007
-
Toxoplasma gondii tachyzoites cross retinal endothelium assisted by intercellular adhesion molecule-1 in vitroImmunology and Cell Biology 90:912–915.https://doi.org/10.1038/icb.2012.21
-
The capillary bed offers the largest hemodynamic resistance to the cortical blood supplyJournal of Cerebral Blood Flow and Metabolism 37:52–68.https://doi.org/10.1177/0271678X16671146
-
Optimized expression of green fluorescent protein in Toxoplasma gondii using thermostable green fluorescent protein mutantsMolecular and Biochemical Parasitology 113:309–313.https://doi.org/10.1016/s0166-6851(01)00212-2
-
Intracellular transport of Toxoplasma gondii through the blood-brain barrierJournal of Neuroimmunology 232:119–130.https://doi.org/10.1016/j.jneuroim.2010.10.029
-
Focal adhesion kinase regulates intestinal epithelial barrier function via redistribution of tight junctionBiochimica et Biophysica Acta 1832:151–159.https://doi.org/10.1016/j.bbadis.2012.10.006
-
Cerebral vessel laminins and IFN-gamma define Trypanosoma brucei brucei penetration of the blood-brain barrierThe Journal of Clinical Investigation 114:689–694.https://doi.org/10.1172/JCI22104
-
Toxoplasma gondii infection and its implications within the central nervous systemNature Reviews. Microbiology 19:467–480.https://doi.org/10.1038/s41579-021-00518-7
-
Real-time quantitative PCR in cerebral toxoplasmosis diagnosis of Brazilian human immunodeficiency virus-infected patientsJournal of Medical Microbiology 59:641–647.https://doi.org/10.1099/jmm.0.016261-0
-
Acute toxoplasmosis leads to lethal overproduction of Th1 cytokinesJournal of Immunology 167:4574–4584.https://doi.org/10.4049/jimmunol.167.8.4574
-
Small molecule immunomodulation: the tumor microenvironment and overcoming immune escapeJournal for Immunotherapy of Cancer 7:224.https://doi.org/10.1186/s40425-019-0667-0
-
Toxoplasmosis snapshots: global status of Toxoplasma gondii seroprevalence and implications for pregnancy and congenital toxoplasmosisInternational Journal for Parasitology 39:1385–1394.https://doi.org/10.1016/j.ijpara.2009.04.003
-
Integrin-dependent migratory switches regulate the translocation of Toxoplasma-infected dendritic cells across brain endothelial monolayersCellular and Molecular Life Sciences 78:5197–5212.https://doi.org/10.1007/s00018-021-03858-y
-
Advances and Challenges in Understanding Cerebral ToxoplasmosisFrontiers in Immunology 10:242.https://doi.org/10.3389/fimmu.2019.00242
-
Spread of Trypanosoma brucei to the nervous system: early attack on circumventricular organs and sensory gangliaJournal of Neuroscience Research 21:56–61.https://doi.org/10.1002/jnr.490210109
-
The choroid plexus-a multi-role player during infectious diseases of the CNSFrontiers in Cellular Neuroscience 9:80.https://doi.org/10.3389/fncel.2015.00080
-
Viral disruption of the blood-brain barrierTrends in Microbiology 20:282–290.https://doi.org/10.1016/j.tim.2012.03.009
-
Brain endothelial cell-cell junctions: how to “open” the blood brain barrierCurrent Neuropharmacology 6:179–192.https://doi.org/10.2174/157015908785777210
-
Compensatory role for Pyk2 during angiogenesis in adult mice lacking endothelial cell FAKThe Journal of Cell Biology 181:43–50.https://doi.org/10.1083/jcb.200710038
-
Heterogeneity of the blood-brain barrierTissue Barriers 4:e1143544.https://doi.org/10.1080/21688370.2016.1143544
Article and author information
Author details
Funding
Vetenskapsrådet (2018-02411)
- Antonio Barragan
Olle Engkvist Foundation (193-609)
- Antonio Barragan
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We acknowledge the intravital imaging facility at Stockholm university (IVMSU) and the National Microscopy Infrastructure (NMI), Drs. Lydia Sorokin and Krister Kristensson for providing laminin antibodies and Drs. Christopher Hunter and David Bzik for uracil auxotroph parasites. This work was funded by the Swedish Research Council (Vetenskapsrådet, 2018–02411) and the Olle Engkvist Foundation (193-609).
Ethics
All animal experimentation was approved by the Regional Animal Research Ethical Board, Stockholm, Sweden, (protocol numbers N135/15, 9707-2018 and 14458-2019), following proceedings described in EU legislation (Council Directive 2010/63/EU).
Copyright
© 2021, Olivera et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 2,477
- views
-
- 351
- downloads
-
- 19
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Immunology and Inflammation
Systemic blood coagulation accompanies inflammation during severe infections like sepsis and COVID. We previously established a link between coagulopathy and pyroptosis, a vital defense mechanism against infection. During pyroptosis, the formation of gasdermin-D (GSDMD) pores on the plasma membrane leads to the release of tissue factor (TF)-positive microvesicles (MVs) that are procoagulant. Mice lacking GSDMD release fewer of these procoagulant MVs. However, the specific mechanisms coupling the activation of GSDMD to MV release remain unclear. Plasma membrane rupture (PMR) in pyroptosis was recently reported to be actively mediated by the transmembrane protein Ninjurin-1 (NINJ1). Here, we show that NINJ1 promotes procoagulant MV release during pyroptosis. Haploinsufficiency or glycine inhibition of NINJ1 limited the release of procoagulant MVs and inflammatory cytokines, and partially protected against blood coagulation and lethality triggered by bacterial flagellin. Our findings suggest a crucial role for NINJ1-dependent PMR in inflammasome-induced blood coagulation and inflammation.
-
- Immunology and Inflammation
- Neuroscience
Somatic genetic heterogeneity resulting from post-zygotic DNA mutations is widespread in human tissues and can cause diseases, however, few studies have investigated its role in neurodegenerative processes such as Alzheimer’s disease (AD). Here, we report the selective enrichment of microglia clones carrying pathogenic variants, that are not present in neuronal, glia/stromal cells, or blood, from patients with AD in comparison to age-matched controls. Notably, microglia-specific AD-associated variants preferentially target the MAPK pathway, including recurrent CBL ring-domain mutations. These variants activate ERK and drive a microglia transcriptional program characterized by a strong neuro-inflammatory response, both in vitro and in patients. Although the natural history of AD-associated microglial clones is difficult to establish in humans, microglial expression of a MAPK pathway activating variant was previously shown to cause neurodegeneration in mice, suggesting that AD-associated neuroinflammatory microglial clones may contribute to the neurodegenerative process in patients.