1. Cell Biology
  2. Genetics and Genomics
Download icon

An actin-related protein that is most highly expressed in Drosophila testes is critical for embryonic development

  1. Courtney M Schroeder  Is a corresponding author
  2. Sarah A Tomlin
  3. Isabel Mejia Natividad
  4. John R Valenzuela
  5. Janet M Young
  6. Harmit S Malik
  1. Division of Basic Sciences, Fred Hutchinson Cancer Research Center, United States
  2. Howard Hughes Medical Institute, Fred Hutchinson Cancer Research Center, United States
Research Article
  • Cited 0
  • Views 736
  • Annotations
Cite this article as: eLife 2021;10:e71279 doi: 10.7554/eLife.71279

Abstract

Most actin-related proteins (Arps) are highly conserved and carry out well-defined cellular functions in eukaryotes. However, many lineages like Drosophila and mammals encode divergent non-canonical Arps whose roles remain unknown. To elucidate the function of non-canonical Arps, we focus on Arp53D, which is highly expressed in testes and retained throughout Drosophila evolution. We show that Arp53D localizes to fusomes and actin cones, two germline-specific actin structures critical for sperm maturation, via a unique N-terminal tail. Surprisingly, we find that male fertility is not impaired upon Arp53D loss, yet population cage experiments reveal that Arp53D is required for optimal fitness in Drosophila melanogaster. To reconcile these findings, we focus on Arp53D function in ovaries and embryos where it is only weakly expressed. We find that under heat stress Arp53D-knockout (KO) females lay embryos with reduced nuclear integrity and lower viability; these defects are further exacerbated in Arp53D-KO embryos. Thus, despite its relatively recent evolution and primarily testis-specific expression, non-canonical Arp53D is required for optimal embryonic development in Drosophila.

Introduction

Actin is an ancient, highly conserved protein that performs many cytoplasmic and nuclear functions vital for eukaryotes, including division, motility, cargo transport, DNA repair, and gene expression (Dominguez and Holmes, 2011; Schrank et al., 2018; Wei et al., 2020). Its origin predates eukaryotes (Goodson and Hawse, 2002; Muller et al., 2005); both bacteria and archaea encode actin-like proteins (van den Ent et al., 2001; Izoré et al., 2016). Actin forms many protein-protein interactions, including with other actin monomers, to perform its various functions (Dominguez and Holmes, 2011). Because of its interactions and functional importance, actin evolves under stringent evolutionary constraints (Goodson and Hawse, 2002; Muller et al., 2005). For example, despite being separated by 800 million years of evolution, actin proteins from Drosophila melanogaster and Homo sapiens are 98% identical. In addition to actin, most eukaryotes encode an expanded repertoire of actin-related proteins (Arps) because of ancient gene duplications (Goodson and Hawse, 2002; Muller et al., 2005). These Arps have specialized for a wide range of functions, including regulation of actin (Arps 2/3) (Mullins et al., 1998), chromatin remodeling (Arps 4–8) (Harata et al., 2000; Blessing et al., 2004; Klages-Mundt et al., 2018), and microtubule-based transport (Arps 1 and 10) (Muhua et al., 1994; Lee et al., 2001). Although all Arps maintain a conserved actin fold, they have specialized for their novel roles via distinct structural insertions (Liu et al., 2013; Chen and Shen, 2007). These ‘canonical’ Arps significantly diverged from each other early in eukaryote evolution, but now evolve under stringent evolutionary constraints, like actin.

Many eukaryotic genomes also encode evolutionarily young, rapidly evolving ‘non-canonical’ Arps. Unlike cytoplasmic actin and canonical Arps, which are ubiquitously expressed, non-canonical Arps appear to be exclusively expressed in the male germline (Machesky and May, 2001). The first described ‘non-canonical’ Arp was D. melanogaster Arp53D (named for its cytogenetic location), which was shown to be most highly expressed in the testis (Fyrberg et al., 1994). Its presence only in D. melanogaster and its unusual expression pattern led to Arp53D being mostly ignored in studies of cytoskeletal proteins. However, phylogenomic surveys reveal that ‘non-canonical’ Arps are not as rare as previously believed. Recently, we described a 14-million-year-old Drosophila clade that independently acquired four non-canonical Arp genes that are all expressed primarily in the male germline (Schroeder et al., 2020). Mammals also encode at least seven non-canonical Arps that are predominantly expressed in the testis (Heid et al., 2002; Tanaka et al., 2003; Hara et al., 2008; Boëda et al., 2011; Fu et al., 2012), at least some of which localize to actin structures in sperm development (Hara et al., 2008; Boëda et al., 2011). Thus, accumulating evidence suggests that non-canonical Arps play fundamentally distinct cytoskeletal functions from canonical Arps, which might explain both their tissue specificity as well as their unusual evolution.

To gain insight into the functions of non-canonical Arps, we performed evolutionary, genetic, and cytological analyses of Arp53D in D. melanogaster. We showed that Arp53D is conserved over 65 million years of Drosophila evolution, suggesting that it performs a critical function. Unlike actin or canonical Arps, we found that Arp53D has evolved under positive selection. Our cytological analyses reveal that Arp53D specifically localizes to the fusome and actin cones, two specialized actin structures found in the male germline. We show that Arp53D's unique 40 amino acid N-terminal extension (relative to actin) is necessary and sufficient to recruit it to germline actin structures. Its abundant expression in testes, together with its specialized localization, led us to hypothesize that Arp53D loss would lower male fertility. Contrary to this prediction, we found that Arp53D knockouts (KO) exhibit increased male fertility. The detrimental effect of Arp53D presence on male fertility is at odds with its long-term retention in Drosophila. Indeed, population cage experiments confirm that wildtype Arp53D has a net fitness benefit in populations relative to Arp53D KOs, despite the increased fertility of KO males. Seeking to explain this paradox, we investigated whether Arp53D also has functions outside the male germline. Despite its low expression in females and early embryos, we find that loss of Arp53D in the female lowers embryonic viability under heat stress. Our study finds that a non-canonical ‘testis-expressed’ Arp is evolutionarily retained throughout Drosophila for critical roles outside the male germline.

Results

Arp53D encodes a rapidly evolving non-canonical Arp that has been retained for over 65 million years

Arp53D was first identified as a male-specific Arp gene on chromosome 2 of D. melanogaster (Fyrberg et al., 1994). It was subsequently shown to be phylogenetically more closely related to actin than to any of the canonical Arps (Goodson and Hawse, 2002). A subsequent study proposed that Arp53D arose from retroduplication of Act88F, which encodes a Drosophila muscle actin (Bai et al., 2007). However, Arp53D is almost equally similar to Act88F (59.76%) as Act5C (59.2%), which encodes a cytoplasmic actin, at the nucleotide level. Arp53D was not found in any other non-insect genomes in a broad survey of eukaryotes, raising the possibility that it only exists in a few Drosophila species. To date its evolutionary origin, we investigated Arp53D presence in sequenced genomes from Drosophila and closely related Diptera (Drosophila 12 Genomes Consortium et al., 2007; Chen et al., 2014; Zhou and Bachtrog, 2012; Renschler et al., 2019; Kurek et al., 1998). Using phylogeny and shared synteny, we found clear orthologs in species as divergent as Drosophila lebanonensis (also known as Scaptodrosophila lebanonensis) but not in more divergent Dipteran species such as Ceratitis capitata, Glossina morsitans, or Aedes aegypti (Figure 1A, Figure 1—figure supplement 1A, Table 1). Thus, we found that the Arp53D gene arose approximately 65 million years ago at the origin of Drosophila (Drosophila 12 Genomes Consortium et al., 2007). Its retention for 65 million years implies that Arp53D performs an important function in Drosophila; deleterious or non-functional genes are quickly pseudogenized and lost within a few million years in Drosophila genomes (Lynch and Conery, 2000).

Figure 1 with 1 supplement see all
Arp53D encodes a rapidly evolving non-canonical Arp with male-enriched expression.

(A) A species tree of selected Diptera, including 18 Drosophila species, Scaptodrosophila lebanonensis, Ceratitis capitata, Glossina morsitans, and Aedes aegypti, which either encode or lack Arp53D orthologs (filled and empty boxes, respectively). Based on this, we estimate Arp53D is at least 65 million years old. (B) Arp53D domains include an extended N-terminus, which is predicted to be unstructured, as well as a canonical actin domain. The protein identities are displayed for the different domains of actin (Act5C) and Arp53D from D. melanogaster and S. lebanonensis. Arp53D’s sequence has diverged from actin and has higher between-species divergence than actin. (C) Expression levels from RNA-seq (in RPKM) are displayed for tissues at different developmental stages (wandering L3 larvae, white prepupae, pupae, and adults) (modENCODE Consortium et al., 2009; Thurmond et al., 2019), with blue indicating highest expression. Unlike actin and canonical Arps like Arp2, Arp53D expression is highly skewed towards males in adult flies.

Table 1
Arp53D orthologs used in phylogenetic analysis.
SpeciesNCBI Accession or Flybase
(Thurmond et al., 2019) gene name
D. melanogasterFBgn0011743
D. simulansXM_016168248.1
D. sechelliaXM_032716929.1
D. erectaFBgn0112814
D. yakubaFBgn0229606
D. eugracilisXM_017223499.1
D. takahashiiXM_017160173.1
D. ficusphilaXM_017189170.1
D. ananassaeXM_001960587.3_modified*
S. lebanonensisXM_030513294.1
D. busckiiXM_017981926.1
D. mojavensisXM_002006572.3
D. virilisFBgn0208134
D. grimshawiXM_001995276.2_modified*
D. willistoniFBgn0217915
D. pseudoobscuraFBgn0078861
D. persimilisXM_002026570.2
D. mirandaXM_033397705.1
  1. *Some NCBI gene models were incomplete and were corrected using the BLAT tool (Kent, 2002) in UCSC’s genome browser (http://genome.ucsc.edu).

To gain insight into its function, we compared the domain architectures of D. melanogaster Arp53D to cytoplasmic actin Act5C. Like canonical Arps, Arp53D includes an actin fold domain, which consists of four subdomains and a central ATP-binding pocket. However, in contrast to actin, Arp53D has an extended 40-amino acid N-terminal domain that is predicted to be mostly unstructured (Figure 1B, Figure 1—figure supplement 1B). All Arp53D orthologs encode this extended N-terminal domain, which is also the most rapidly evolving segment of Arp53D in sequence and length. For example, N-terminal domains from D. melanogaster and S. lebanonensis Arp53D proteins are only 42% identical, whereas the actin fold domain is 70% identical (Figure 1B). In contrast to Arp53D, actin homologs are 100% identical over a comparable period of evolutionary divergence. We found no homology between the N-terminal region of Arp53D to any coding or non-coding sequence in any Drosophila (or other) genome. The ancient evolutionary origin of Arp53D does not allow us to determine whether Arp53D’s unique N-terminus was acquired from the intergenic DNA sequence upon retroduplication or via subsequent insertions after retroduplication.

Since actin evolves under extremely strong selective constraint, the higher between-species divergence of Arp53D could simply reflect more relaxed selective constraints. Alternatively, it could reflect a faster than expected divergence of Arp53D due to diversifying selection. To distinguish between these possibilities, we took advantage of publicly available sequences of hundreds of D. melanogaster strains (Lack et al., 2015; Lack et al., 2016) (http://www.popfly.org, Hervas et al., 2017) to carry out McDonald–Kreitman (MK) tests for positive selection (McDonald and Kreitman, 1991). The MK test compares the ratio of non-synonymous (amino acid replacing, PN) to synonymous (Ps) polymorphisms within a species (D. melanogaster) to fixed differences between species (DN and DS, D. melanogaster-D. simulans); we exclude low-frequency polymorphisms since they have not been as strongly subject to selective scrutiny (Fay et al., 2001; Bierne and Eyre-Walker, 2004). If selective constraints are not significantly different within species versus between species, we expect DN:DS to be approximately equal to PN:Ps. If DN:DS is greater than PN:Ps, then we deduce that the gene has evolved under positive selection. Cytoplasmic actin genes have no non-synonymous changes (fixed or polymorphic); thus, they are not rapidly evolving and were not analyzed. We analyzed canonical Arps found in most eukaryotes using the MK test and found no evidence of positive selection (Figure 1—figure supplement 1C).

In contrast, Arp53D has evolved under positive selection during D. melanogaster-D. simulans divergence (p=0.04, Figure 1—figure supplement 1C), as DN:DS (23:29) is much higher than PN:Ps (1:9). When examining the MK results in detail, we noticed that far fewer D. melanogaster strain sequences had passed our quality control tests for Arp53D than for canonical Arps. Upon further investigation, we identified a common 15 bp (five amino acid) deletion polymorphism in Arp53D. This deletion polymorphism could have interesting functional consequences, but also confounded our MK tests as it initially caused many strains to drop out of our analysis because their sequence contained unknown bases in this region. Redoing the MK test for Arp53D including all strains yielded an even more significant positive selection result (p=0.001, Figure 1—figure supplement 1C). The MK results indicate that at least some of the non-synonymous fixed differences between D. melanogaster and D. simulans Arp53D are adaptive substitutions, and these changes are distributed throughout the whole gene, including several in Arp53D’s unique N-terminus (Figure 1—figure supplement 1D). These findings imply that the higher rate of Arp53D protein evolution is not simply a result of relaxed selective constraints; some of these changes have likely been evolutionarily advantageous.

These MK results revealed that Arp53D evolved under positive selection in recent evolutionary time (since D. melanogaster and D. simulans divergence) but do not pinpoint which residue changes were functionally important. We wondered whether positive selection acted recurrently upon a subset of Arp53D residues over a longer period of Drosophila evolution. We therefore carried out maximum likelihood analyses using the PAML suite’s CODEML algorithm. We found no evidence for recurrent positive selection on any Arp53D codons (Figure 1—figure supplement 1E). This suggests that the signature of positive selection does not recur in the same subset of residues. Overall, our evolutionary analyses find that Arp53D is an evolutionarily young, non-canonical Arp that is subject to long-term retention and atypical selective constraints, consistent with it performing a distinct function from canonical Arps.

Arp53D localizes to specific actin structures late in sperm development

Arp53D was first shown to be expressed in D. melanogaster testes (Fyrberg et al., 1994). We took advantage of transcriptomic profiling of various adult tissues in D. melanogaster and nine other Drosophila species to investigate tissue-specific expression of Arp53D. Confirming previous analyses, we found that all Drosophila species show significantly male-biased expression of Arp53D and almost undetectable expression in adult females (Figure 1—figure supplement 1F, Table 2Benner et al., 2019; Luo et al., 2020; Ma et al., 2018; Mahadevaraju et al., 2021; Nozawa et al., 2016; Rogers et al., 2014; Yang et al., 2018). In all these cases, Arp53D RNA expression is much higher in the testis than the remaining male carcass (Figure 1—figure supplement 1F, Table 2). More extensive transcriptome profiling of various tissues in D. melanogaster, obtained from the ModENCODE project (modENCODE Consortium et al., 2009), revealed that Arp53D RNA is modestly expressed in other tissues, including fat bodies and imaginal discs at earlier developmental stages (Figure 1C). This extremely sex- and tissue-biased expression of Arp53D is unusual, as cytoplasmic actin or canonical Arps are ubiquitously expressed in all tissues (Figure 1C).

Table 2
RNA-seq databases analyzed.
SpeciesFemaleMaleMale carcassTestis
D. melanogasterSRR3123319
Luo et al., 2020
SRR3123321
Luo et al., 2020
SRR2021000
Rogers et al., 2014
SRR11341471
D. simulansSRR9025064SRR9025061SRR330567SRR9025060
D. yakubaSRR166821SRR6161781
Ma et al., 2018
SRR1693754
Rogers et al., 2014
SRR934057
D. ananassaeSRR7243228, SRR5639307
Yang et al., 2018; Benner et al., 2019; Mahadevaraju et al., 2021
SRR6161785
Ma et al., 2018
SRR2021005
Rogers et al., 2014
SRR2021004
Rogers et al., 2014
D. pseudoobscuraDRR055272
Nozawa et al., 2016
DRR055274
Nozawa et al., 2016
DRR055274
Nozawa et al., 2016
DRR055270
Nozawa et al., 2016
D. willistoniSRR5639517, SRR7243438
Yang et al., 2018; Benner et al., 2019; Mahadevaraju et al., 2021
SRR6161775
Ma et al., 2018
-SRR7243415, SRR5639494
Yang et al., 2018; Benner et al., 2019; Mahadevaraju et al., 2021
D. virilisSRR7243394, SRR5639473
Yang et al., 2018; Benner et al., 2019; Mahadevaraju et al., 2021
SRR6161774
Ma et al., 2018
SRR5278991SRR5278986
D. mojavensisSRR7243269, SRR5639348
Yang et al., 2018; Benner et al., 2019; Mahadevaraju et al., 2021
SRR6161773
Ma et al., 2018
-SRR5639328, SRR7243249
Yang et al., 2018; Benner et al., 2019; Mahadevaraju et al., 2021
D. grimshawiSRR7253580, SRR3355287
Yang et al., 2018
SRR7253581
Yang et al., 2018
-SRR3355234, SRR7253527
Yang et al., 2018
S. lebanonensisSRR9691967,
SRR9691970
-SRR9691966SRR9691965

We investigated Arp53D localization in D. melanogaster testes, where it is most abundantly expressed. Drosophila testes contain numerous cell types, including somatic cells and germ cells at many stages of development (i.e., mitotic cells, meiotic cells, and mature sperm) (Fabian and Brill, 2012). Germ cells undergo incomplete cytokinesis during their four mitotic divisions and subsequent meiosis, resulting in a cyst of 64 sperm cells, which share the same cytoplasm and membrane until full maturation (Fabian and Brill, 2012Figure 2A). Multiple cysts at different stages of spermatogenesis are visible in the testis, allowing simultaneous visualization of all developmental stages.

Figure 2 with 1 supplement see all
Arp53D localizes to specific actin structures late in sperm development.

(A) A schematic shows spermatogenesis progression from the apical end to the basal end of the testis; green indicates stages where GFP fluorescence is visible in transgenic flies (B). Labels for the meiotic and elongating stages refer to panels (CF). (B) To localize Arp53D in the testis, a transgene encoding Arp53D with an N-terminal superfolder GFP (sfGFP) tag was inserted on the third chromosome. The transgenic fly line was then crossed into the Arp53D-KO background so that transgene and knockout (KO) alleles are both homozygous; thus, all Arp53D molecules are fluorescently tagged. (C–E) Cysts from transgenic fly testes are from meiotic (C), post-meiotic (D), or elongating stages (E) of spermatogenesis. The fusome-localizing protein α-spectrin (magenta), DNA (blue), and Arp53D (green, anti-GFP) were probed. The merge of α-spectrin and Arp53D appears as white, indicating that Arp53D co-localizes with α-spectrin and thus appears at the fusome. Arrows correspond to the enlarged insets. (F) Cysts from transgenic fly testes (B) were fixed and probed for filamentous actin, indicating Arp53D co-localizes with actin only at the fusome and not throughout the cyst. All scale bars are 10 µm.

We generated a transgenic fly line with superfolder GFP-tagged Arp53D (sfGFP-Arp53D; Pédelacq et al., 2006) under the control of its endogenous promoter (Figure 2B). We tagged Arp53D at the N-terminus because C-terminal tags disrupt polymerization of canonical actin (Brault et al., 1999). This transgene was introduced and assayed in an Arp53D-knockout background (described in detail later) such that only two copies of sfGFP-Arp53D are present, ensuring that every Arp53D molecule is fluorescently tagged. We found that sfGFP-Arp53D is undetectable during mitosis but is present within the meiotic and post-meiotic spermatocyte cysts (Figure 2, Figure 2—figure supplement 1A, B) where it localizes specifically to two germline-specific actin structures: the fusome during meiosis and spermatid elongation (Figure 2) and actin cones during sperm individualization (Figure 3).

Figure 3 with 1 supplement see all
Arp53D localizes to the leading edge of actin cones during sperm individualization.

(A) A schematic depicts the different stages of sperm individualization. Once actin cones are fully assembled at mature sperm nuclei, the cones translocate along the axoneme (a microtubule structure), pushing excess cytoplasm (the ‘cystic bulge’) to the end of the cyst. The cystic bulge undergoes autophagy and becomes known as the ‘waste bag.’ (B–D) Testes expressing sfGFP-Arp53D (Figure 2B) were dissected and fixed. Axonemal microtubules (gray, anti-tubulin), DNA (blue, DAPI), actin (magenta, phalloidin), and sfGFP-Arp53D (green, anti-GFP) were visualized. Each row shows a cyst at a different stage of individualization, which is depicted with a schematic to the right. Arp53D colocalizes with actin during cone polymerization and then coalesces at the leading edge of the cone, once the actin cone is fully constructed. Arp53D remains at the leading edge throughout translocation. (E) SfGFP-Arp53D-expressing testes (Figure 2B) were imaged live and probed for filamentous actin (SiR-actin probe; Lukinavičius et al., 2014) and DNA. The arrow indicates the actin cone shown in panel (F). (F) A mature sperm nucleus and its corresponding actin cone is shown in cross-section with Arp53D localizing only at the leading edge. On the right is a schematic that delineates the types of actin networks found in the cone (Noguchi et al., 2008) (not drawn to scale). The green filaments indicate Arp53D localization. All scale bars are 10 µm.

The fusome is a membranous organelle that forms at all incomplete cytokinetic furrows following mitosis and meiosis. It is actin-coated and forms a large network that connects all developing spermatids, mediating cytoplasm exchange within the cyst (de Cuevas and Spradling, 1998; Lin et al., 1994Figure 2A, Figure 2—figure supplement 1C). To ascertain sfGFP-Arp53D localization to the fusome, we fixed sfGFP-Arp53D-expressing testes and probed for the fusome-specific α-spectrin protein (de Cuevas et al., 1996). We found that sfGFP-Arp53D co-localizes with α-spectrin, confirming Arp53D localization to the fusome (Figure 2C–E). Arp53D localizes weakly to the fusome during meiosis (Figure 2C) but becomes progressively stronger post-meiosis (Figure 2D, E). Arp53D remains associated with the fusome even as it moves to one end of an elongating cyst. We conclude that Arp53D is targeted to the fusome specifically during meiosis with increased recruitment to the fusome during spermatid elongation. Arp53D’s localization specifically to the fusome contrasts with that of actin, which is found both at the fusome and throughout the cyst (Figure 2F, Figure 2—figure supplement 1C).

During late stages of spermatogenesis, spermatids must separate and obtain their own individual membranes. In this process, known as individualization, each sperm head acquires a hollow cone of actin filaments when nuclear condensation is complete. All 64 cones in a cyst synchronously translocate along the axonemes of the sperm tails to push out excess cytoplasm (‘cystic bulge’) and encase each sperm in its own membrane (Noguchi and Miller, 2003; Fabrizio et al., 1998Figure 3A). All 64 actin cones then undergo degradation along with the excess cytoplasmic components in a structure known as the ‘waste bag’ (Noguchi and Miller, 2003; Fabrizio et al., 1998Figure 3A). When actin cones begin to polymerize (indicated by a gradual accumulation of filamentous actin), we find that sfGFP-Arp53D is enriched along the axoneme and slightly overlaps the base of sperm nuclei (Figure 3B). The puncta observed along the axoneme are usually observed with immunofluorescence but not live imaging, suggesting that this axonemal staining may be non-specific. Yet the GFP puncta at actin cones are consistently found with both fixed samples and live imaging, suggesting that it is not an immunofluorescence artifact. At this stage, sfGFP-Arp53D localization is very similar to actin at the base of the sperm head. However, when actin cones are fully formed, sfGFP-Arp53D is visible as a highly concentrated structure at the front of the actin cone, distinct from actin (Figure 3C, E). Subsequently, sfGFP-Arp53D remains associated with actin cones as they translocate down the microtubule-based axoneme (Figure 3D). Thus, sfGFP-Arp53D localizes to the leading edge of the actin cone (Figure 3E, F), which is composed of branched actin networks and is the site of active cytoplasm extrusion. In contrast, the rear of the actin cone is composed of parallel actin bundles (Noguchi et al., 2008Figure 3F). Previous studies have shown that an actin-binding molecular motor—myosin VI—also localizes to the leading edge of actin cones (Rogat and Miller, 2002). Indeed, we find that a testis-specific myosin VI subunit (Frank et al., 2006) localizes proximally to Arp53D at the leading edge, though its distribution on the cone extends beyond where Arp53D is most concentrated (Figure 3—figure supplement 1A). Proteomic studies (Wasbrough et al., 2010) and our cytological analyses (Figure 3—figure supplement 1B) do not detect Arp53D in mature sperm. We therefore conclude that Arp53D protein must be degraded in the waste bag along with the rest of the actin cone apparatus.

Our cytological analyses reveal that Arp53D specifically localizes to two germline-specific actin structures in a dynamic manner. It first localizes to the fusome during meiosis (Figure 2). Once spermatid elongation is complete, Arp53D moves to actin cones as they are being constructed (Figure 3) and remains associated with actin cones until it is ultimately destroyed along with the rest of the actin cones following the completion of sperm individualization. Notably, for most of spermatogenesis, Arp53D localization is distinct from actin, which localizes more broadly. Thus, Arp53D appears to carry out specialized roles at unique cytoskeletal machineries during spermatogenesis.

Arp53D’s unique N-terminal extension is necessary and sufficient for recruitment to germline cytoskeletal structures

We investigated whether Arp53D’s unique 40-residue N-terminal domain mediates its specialized localization to the fusome and actin cones (Figure 1B). We generated a sfGFP-△N-term D. melanogaster transgenic line encoding sfGFP-Arp53D with 35 amino acids of the N-terminal domain deleted (Figure 4A). The sfGFP-△N-term transgene was driven by the endogenous Arp53D promoter from the same insertion site in the fly genome as our full-length sfGFP-Arp53D transgene (Figure 2B). We dissected testes from the transgenic flies and performed immunoblotting analyses, which showed that the smaller deletion protein is expressed at comparable levels to sfGFP-Arp53D (Figure 4—figure supplement 1B). Moreover, like full-length sfGFP-Arp53D transgenic flies, sfGFP-△N-term transgenic flies also express GFP in meiosis (Figure 4—figure supplement 1A). However, unlike the full-length Arp53D fusion, localization of sfGFP-△N-term remained diffuse; we did not detect concentrated GFP signal at the fusome or actin cones (Figure 4B, C, Figure 4—figure supplement 1C). The sfGFP-△N-term protein may be less stable than full-length Arp53D, yet we believe the actin-like domain is most likely as stable as canonical actin. Based on the cytology, we conclude that the N-terminus is necessary for Arp53D’s localization to these specialized germline actin structures. Since sfGFP-△N-term-Arp53D was not detected at any actin structure in the testis, we further conclude that Arp53D’s actin fold domain is too divergent to co-polymerize with actin in vivo, at least within our detection limits.

Figure 4 with 1 supplement see all
N-terminal domain of Arp53D is necessary and sufficient for localization.

(A) Two additional transgenic fly lines were generated with the transgene on the third chromosome in the wildtype background. In the ‘△N-term’ transgene, 35 aa of the N-terminus of Arp53D were removed and the remaining actin fold was N-terminally tagged with sfGFP. In the ‘Nt-Actin’ transgene, the actin domain of Arp53D was replaced with canonical actin (Act5C). Both transgenes are under the control of Arp53D’s endogenous promoter. (B) Cysts from transgenic fly testes were fixed and probed with anti-GFP (green), anti-α-spectrin (magenta), and Hoechst (blue). Cysts shown are in meiotic or post-meiotic stages and indicate that Arp53D without the N-terminus can no longer localize to the fusome (α-spectrin staining), yet the Nt-Actin chimera is sufficient for localization. Arrows correspond to the enlarged insets, and all scale bars are 10 µm. (C) Cysts undergoing individualization were imaged live, and filamentous actin (SiR-actin probe; Lukinavičius et al., 2014) and DNA were labeled. Only Nt-Actin can localize to the leading edge of actin cones. (D) Testes from the Nt-Actin transgenic fly line were dissected and imaged live. Similar to full-length sfGFP-Arp53D, sfGFP-Nt-Actin localizes to the fusome of elongating spermatids, motile actin cones (no longer co-localizing with mature sperm nuclei), and the waste bag. All scale bars are 10 µm.

We next tested whether the N-terminus is sufficient to confer Arp53D’s localization to canonical actin. We generated an sfGFP-Nt-actin D. melanogaster transgenic line, encoding sfGFP-Arp53D N-terminal domain fused to canonical actin (Act5C) (Figure 4A). Like all previous transgenic constructs, we placed this chimeric protein under the control of Arp53D’s endogenous promoter and used the same genomic insertion location (Figure 4A). We found that this chimeric protein is expressed and localizes similarly to full-length sfGFP-Arp53D throughout spermatogenesis (Figure 4B–D), maintaining its association with the fusome during spermatid elongation and motile actin cones throughout individualization just like full-length Arp53D (Figure 4D). Furthermore, despite encoding an identical actin fold domain, this chimeric protein does not co-colocalize with actin throughout the developing cysts. Based on these findings, we conclude that the most prominent structural diversification of Arp53D—its N-terminal extension—is necessary and sufficient for recruitment of actin to the unique cytoskeletal machinery of the male germline.

However, Arp53D’s N-terminal domain cannot confer this specialized localization onto other globular proteins. When we tested the localization of Arp53D’s N-terminal domain fused to sfGFP alone, without an actin fold (‘Nt-sfGFP’, Figure 4—figure supplement 1D), we could only detect diffuse GFP expression and no concentrated signal at the fusome or actin cones (Figure 4—figure supplement 1D). We verified the construct was indeed expressed in the testis by conducting immunoblot analysis (Figure 4—figure supplement 1E). This implies that specialized localization to fusomes and actin cones requires both the Arp53D N-terminal domain as well as sequences or the tertiary structure of the actin fold domain.

Loss of Arp53D does not impair male fertility

Based on its strict retention in Drosophila and its cytological localization to germline-specific actin structures in D. melanogaster testes, we predicted that Arp53D must play important roles in male fertility. To test this hypothesis, we created a KO of Arp53D using CRISPR/Cas9, introducing an early stop codon and a DsRed transgene under the control of an eye-specific promoter (Figure 5—figure supplement 1A). The DsRed transgene allowed us to track the KO allele by fluorescence microscopy. Based on the intensity of eye fluorescence, we could also distinguish heterozygous from homozygous KO flies, which are viable. We backcrossed the KO founder line to a wildtype strain (Oregon-R) for eight generations in order to isogenize the KO background with Oregon-R as much as possible (Figure 5—figure supplement 1B). Using sequencing, we confirmed the presence of DsRed in the Arp53D locus (Figure 5—figure supplement 1C). We also verified the lack of mutations or expression changes in SOD2, an essential gene located upstream of Arp53D (Figure 5—figure supplement 1D). Finally, we confirmed absence of Arp53D expression in the KO flies as well as absence of Wolbachia, a bacterium that can infect wildtype strains of Drosophila and confound fertility assays (Serbus et al., 2008Figure 5—figure supplement 1E, F).

We reasoned that loss of Arp53D would manifest in a fertility reduction of Arp53D-KO males. To evaluate male fertility, we mated WT females to either homozygous Arp53D-KO males or isogenic WT males for 9 days and subsequently counted all progeny that survived to adulthood (all crosses are written as female × male, Figure 5A). This measure of male ‘fertility’ encapsulates number of sperm produced, their fertilization success, and successful development of sired embryos to adulthood. We were surprised to find that the KO males had significantly higher fertility than WT males at 25°C (1.3-fold increase in average progeny count, Figure 5A, p=0.001), which was even more pronounced at 29°C (2.4-fold increase, Figure 5A, p<0.0001). This increase in fertility is dose-dependent; heterozygous Arp53D-KO males have slightly lower fertility than KO males (Figure 5—figure supplement 2A). Thus, presence of only one intact copy of Arp53D is sufficient to reduce male fertility at 29°C (p=0.03, Figure 5—figure supplement 2A), while two copies are significantly worse (p<0.0001, Figure 5A, Figure 5—figure supplement 2A), suggesting that the phenotype’s magnitude is dependent on Arp53D expression levels.

Figure 5 with 2 supplements see all
Loss of Arp53D does not impair male fertility.

(A) Male fertility assays at 25°C and 29°C were conducted using wildtype (WT) females mated to either WT males or knockout (KO) males (all crosses are reported as female × male). All crosses were conducted in the D. melanogaster Oregon-R strain background, into which Arp53D-KO alleles were isogenized. Embryos were laid for 9 days and adult progeny were counted. KO males appeared more fertile than WT even when stressed at high temperature. For all graphs, the lines indicate the mean and standard deviation. Progeny genotypes are distinguished by color, and a t-test was used to determine all p-values that are reported. (B) For male competition assays, 10 WT females were mated to 2 WT males and 2 KO males at 25°C. Progeny of KO and WT males were identified with the presence or lack of DsRed fluorescence, respectively, and progeny genotypes are displayed as a percentage of the total population. More progeny were fathered by the KO males than the WT males. To test statistical significance, the number of progeny of each genotype was summed across the replicates and compared using a chi-squared test versus the expected 50:50 proportion (dotted line) if the competing males had equal fitness. (C) Testes from WT and Arp53D-KO virgin males that were aged 3 days at 29°C were dissected, fixed, and probed for actin. Cones and waste bags, which exhibit degrading actin cones, are noted. No gross differences were visible in the actin cones from Arp53D-KO testes. Scale bars are 80 µm. (D) The number of cysts with actin cones in each testis was quantified. More individualizing cysts were found in testes from KO compared to WT males, suggesting accelerated sperm development. (E) To test for rescue of Arp53D-KO phenotypes, WT Arp53D and 0.5 kbp of the upstream intergenic region (including its endogenous promoter) was inserted into the attP site of the Arp53D-KO alleles previously generated (see Figure 5—figure supplement 1A). The WT transgene was tracked with sfGFP under the control of an eye-specific promoter, while the KO allele was tracked with DsRed. (F) Rescue transgene-bearing male KO flies were crossed to WT Oregon-R females. Embryos were laid for 9 days, and the progeny count was compared to that from male KO flies without the transgene. The average progeny was slightly reduced but not to statistically significant levels.

To validate our surprising findings of increased fertility in Arp53D-KO males, we conducted RNAi knockdown of Arp53D using topi-Gal4 (Raychaudhuri et al., 2012) to induce expression of the RNAi hairpin specifically targeted against the Arp53D coding region (Figure 5—figure supplement 2B–D). Consistent with our genetic KO findings, we found that even a partial knockdown of Arp53D expression resulted in significantly increased fertility at 29°C (p=0.04, Figure 5—figure supplement 2C, D). Together, these data reveal that lack of Arp53D can increase male fertility.

We hypothesized that although Arp53D presence intrinsically decreases male fertility, it might confer a competitive advantage in the presence of other males. To test this possibility, we mated WT females to both WT males and Arp53D-KO males in the same vials (Figure 5B). If WT and Arp53D-KO males had equal probabilities of successful fertilization, then 50% of adult progeny would be fathered by WT or Arp53D-KO males (Figure 5B). However, we found that Arp53D-KO males sired nearly 70% of the progeny in the presence of WT males, implying that they had a significant fertility advantage even in a competitive situation (p<0.0001, Figure 5B, Supplementary file 1). Our experiments show that Arp53D presence can be significantly deleterious to male fertility, both in isolation as well as in competition.

One possible consequence of Arp53D loss in KO males could be gross disruption of the germline actin structures to which it localizes. Contrary to this expectation, we found no gross defects in overall organization or actin intensity of actin cones (Figure 5C) or the fusome in Arp53D-KO males (Figure 5—figure supplement 2E). We assessed whether Arp53D-KO flies have increased fertility because they produce more sperm than WT flies by staining for DNA in the seminal vesicle, where mature sperm are deposited (Figure 5—figure supplement 2F). We did not find a significant difference between Arp53D-KO and WT males in seminal vesicle size, suggesting that they produced roughly equal amounts of sperm (Figure 5—figure supplement 2G). However, when we observed sperm development and compared the number of actin cones in WT versus KO testes, we found that the Arp53D-KO males had significantly more cysts with actin cones per testis than WT males (Figure 5D), suggesting that sperm production is accelerated upon loss of Arp53D.

We next sought to determine if the Arp53D-KO’s increase in male fertility is specific to the Arp53D locus, rather than being due to any off-target CRISPR mutations. When generating the KO flies, we inserted an attP site, which serves as a ‘landing site’ for transgenes into the Arp53D locus (Figure 5—figure supplement 1A). We took advantage of this attP site to reinsert tagless WT Arp53D under the control of its endogenous promoter into the Arp53D-KO fly line that was isogenized in the Oregon-R background (Figure 5E, Figure 5—figure supplement 2H). We found that male fertility only showed a slight decrease upon presence of the Arp53D rescue transgene (not statistically significant, Figure 5F). We attribute the lack of a significant fertility rescue to the lower expression of the rescue transgene compared to endogenous Arp53D in the Oregon-R background (Figure 5—figure supplement 2I). This apparent dependence on high expression is consistent with our previous observation that heterozygous males have fertility that is closer to KO males than to WT males (Figure 5—figure supplement 2A). The alternative possibility is that the male fertility effect is independent of Arp53D. However, this scenario would require a distinct gain-of-function mutation for male fertility in a gene that is closely linked to the Arp53D-KO to have survived repeated backcrossing. Although we cannot formally rule out this latter possibility due to lack of a robust effect of the Arp53D rescue transgene on male fertility, we find it very unlikely. In either case, we can unambiguously conclude that loss of Arp53D does not impair male fertility, despite testes being the primary tissue of Arp53D expression. Our findings thus still leave unanswered the question of why Arp53D was largely retained over 65 million years of Drosophila evolution.

Loss of Arp53D results in an overall fitness disadvantage

We found that Arp53D loss does not reduce male fertility, yet Arp53D has been retained throughout most of Drosophila evolution, suggesting that its presence must have positive consequences. We, therefore, tested whether Arp53D loss confers any fitness disadvantage in laboratory populations. For this, we competed KO and WT alleles of Arp53D over multiple generations at room temperature using a population cage experiment. This experimental design is more powerful than single-generation mating experiments as it tests for more subtle fitness differences at all lifecycle stages in males and females. In this assay, we used Arp53D-KO flies that were isogenized in a w1118 genetic background (six backcrosses). We used w1118 because it lacks eye pigmentation, making detection of DsRed fluorescence more efficient. Since w1118 flies were used as the competing ‘WT’ flies, KO and WT strains are isogenic except for the absence of Arp53D and presence of eye-expressed DsRed in the KO allele at the Arp53D locus.

We began the experiment with three replicate populations consisting of 50 KO females, 25 KO males, and 25 WT (w1118) males using an excess of KO flies (75%) to put the Arp53D-KO allele at a starting advantage (Figure 6A). At each generation, we randomly selected 50 females and 50 males to act as founders for the next generation (without scoring the fluorescent eye marker for the Arp53D-KO allele) and quantified the remaining progeny for the presence of the Arp53D-KO allele (Figure 6B). If there were no advantages associated with the WT Arp53D genotype, then homozygous WT flies (lacking DsRed) should dramatically decrease within 20 generations. In contrast to this expectation, we found a robust and consistent increase in frequency of the homozygous WT genotype across all three replicate populations despite stochastic effects due to genetic drift given the small effective population sizes. The frequency of the homozygous WT genotype reached an average proportion of 67% among the three replicate populations in just 20 generations (Figure 6B). This rise in frequency suggests a strong fitness disadvantage for the KO genotype. To infer the selective coefficients associated with this increased fitness, we modeled three different scenarios that varied the relative fitness of heterozygote genotypes (i.e., equal to homozygous WT, equal to homozygous KO, or intermediate between HOM and WT; see Materials and methods). Based on these models, we find that the rapid, consistent rise of the WT allele in just 20 generations is most consistent with the first scenario, in which the frequency of the heterozygotes is the same as homozygous WT genotypes (Figure 6—figure supplement 1). Moreover, we infer the WT allele of Arp53D confers between a 30–40% selective advantage over the KO allele per generation (Figure 6—figure supplement 1). Thus, although Arp53D appears dispensable for male fertility, it must play important roles beyond the male germline in D. melanogaster.

Figure 6 with 1 supplement see all
Loss of Arp53D results in an overall fitness disadvantage.

(A) Arp53D-KOs were isogenized in the w1118 background. A population cage experiment was initiated by mixing 50 Arp53D-KO females with 25 Arp53D-KO males, and 25 wildtype (WT) (w1118) males in each of three replicate bottles. All subsequent generations were passaged by randomly selecting 50 male and 50 female progeny from the previous generation and placing them in a new bottle at room temperature. (B) All progeny at selected generations were assessed for the presence of DsRed-fluorescent eyes, the marker for the Arp53D-KO allele. The graph displays the percent of each generation’s total population that were homozygous for the WT allele (entirely lacking DsRed fluorescence); replicates are distinguished by icons with different shapes and color. The red dot indicates the expected percentage of homozygous WT progeny over time if no fitness advantage is associated with WT Arp53D (according to Hardy–Weinberg equilibrium). In contrast to this expectation, homozygous WT Arp53D flies overtook the majority of the population in all three replicate populations, demonstrating Arp53D confers a strong fitness advantage to D. melanogaster. WT: wildtype.

Lack of Arp53D reduces female fertility under heat stress

Given that Arp53D presence is unnecessary or even disadvantageous for male fertility, we considered whether other life history traits require Arp53D, which might help explain its long-term evolutionary retention. Although Arp53D is most abundantly expressed in adult testes, there is also weak expression in other tissues and developmental stages (Figure 1C). Moreover, although published transcriptomic data suggests that Arp53D is undetectable in adult females (modENCODE Consortium et al., 2009Figure 1C), bulk RNA-seq analyses can miss transcripts that are expressed at low levels. We, therefore, carried out sensitive RT-PCR analyses (high number of amplification cycles), which revealed that Arp53D is indeed expressed in adult females, albeit at much lower levels than in males (Figure 7—figure supplement 1A); expression is highest in ovaries and undetectable in somatic tissues (Figure 7—figure supplement 1B). However, Arp53D expression in the ovary is much lower than in the testis (Figure 7—figure supplement 1B), which agrees with previous RNA-seq data that indicates very low to undetectable levels of Arp53D expression in the ovary (Jevitt et al., 2020; Slaidina et al., 2020). Consistent with this low expression, our cytological examination of ovaries in female flies expressing sfGFP-Arp53D did not reveal GFP expression above background levels (Figure 7—figure supplement 1C).

To investigate whether this weak expression in ovaries has important biological consequences, we crossed Arp53D-KO females to either WT males or Arp53D-KO males, and compared the number of adult progeny produced relative to WT × WT crosses (Figure 7A). At room temperature (25°C), we did not observe any significant differences between these three crosses (Figure 7A). However, at 29°C, KO × WT crosses produced significantly fewer adult progeny than WT × WT crosses (1.7-fold decrease in average progeny count, p=0.0007, Figure 7A). Arp53D-KO females therefore have a fertility disadvantage at higher temperatures, suggesting a maternal effect.

Figure 7 with 1 supplement see all
Maternal contribution of Arp53D is required for optimal fitness.

(A) Female fertility assays at 25°C and 29°C were conducted with knockout (KO) females mated to either wildtype (WT) males or KO males. Matings took place for 9 days, and all resulting adult progeny were counted. KO females have fewer progeny at high temperature, especially when a KO male is present. A t-test was used to determine all p-values. (B) To test for a maternal effect, Arp53D-KO females were crossed to heterozygous (HET) males, whereas HET females were crossed to KO males in reciprocal crosses, which yield progeny with the same genotypes. The total adult progeny counts for each cross are shown. Crosses between KO females and HET males exhibit a considerably lower progeny count compared to the reciprocal cross between HET females and KO males (<0.0001), suggesting that the KO females exhibit a maternal effect. (C) KO males were crossed to either KO females or KO females encoding the homozygous Arp53D rescue transgene (‘Rescue’), which was identified via GFP-positive eyes (see schematic). In addition, rescue transgene-bearing male KO flies were crossed to KO females. Matings took place for 6 days, and all resulting adult progeny were counted. KO females expressing a rescue transgene had more progeny than KO females, indicating a rescue of the fertility phenotype. However, KO rescue males did not exhibit an increase in progeny count when crossed to KO females, suggesting that Arp53D is predominantly playing a maternal role.

To further test for a maternal effect, we conducted two additional crosses—HET × KO and KO × HET—at 29°C (Figure 7B). In both crosses, the progeny genotypes produced are the same (heterozygous and homozygous KOs), whereas the parental genotypes are swapped. If there were no maternal effect, or if paternal and maternal contributions of Arp53D were identical, we would expect both crosses to yield the same number of progeny. In contrast to this expectation, we found that the KO female cross produced far fewer total progeny than the HET female cross (p<0.0001, Figure 7B). This confirms that Arp53D KOs exhibit a maternal effect, indicating that Arp53D surprisingly plays a significant role despite its weak expression in the female.

We next tested whether this reduction in fertility under heat stress could be solely attributed to loss of Arp53D. For this, we again used the KO ‘rescue’ fly line with untagged WT Arp53D reinserted into the Arp53D-KO locus (Figure 5E, Figure 7C). We found that KO females expressing the Arp53D rescue transgene in one or two copies had robustly increased fertility compared to KO females without the transgene (Figure 7C, Figure 7—figure supplement 1D) despite low expression of the rescue transgene (Figure 5—figure supplement 2I). These findings confirm that Arp53D’s contribution to fitness is largely driven by its maternal effect. Moreover, they confirm our predictions from the population-genetic modeling that heterozygous Arp53D can at least partially restore fitness.

Lack of zygotic Arp53D can lead to lower fitness, which is nearly masked by maternal contributions

A strong maternal effect explains most but not all of the defects seen in crosses involving Arp53D-KO flies. The number of adult progeny produced at 29°C in KO × KO crosses is further reduced 3.5-fold relative to KO × WT crosses (p<0.0001, Figure 7A). This reduction is especially surprising since KO males have increased fertility over WT males at this temperature (Figure 5A). These findings suggest that the complete loss of Arp53D resulting from a KO × KO cross must lead to an additional zygotic disadvantage since KO × WT crosses produce heterozygous zygotes (Figure 7A).

To further confirm this zygotic effect, we quantified the ratio of KO versus HET progeny produced in the previous HET × KO and KO × HET crosses (Figure 7B). If there were no contribution of zygotic genotype to survival, we would expect a 1:1 mix of KO and HET genotypes among surviving offspring (Figure 7B, schematic). In contrast, we find that KO progeny only made up <30% of total progeny in the KO × HET cross (p<0.0001, Figure 8A, Supplementary file 1). Thus, KO zygotes are at a survival disadvantage relative to HET zygotes. In the reciprocal cross with HET mothers, KO progeny were also recovered at lower than 50% frequency (p=0.005, Figure 8A, Supplementary file 1, note that total progeny counts are 10-fold higher for this cross). Although this zygotic effect is subtler with HET mothers rather than KO mothers, it is highly consistent across replicates and significant (p=0.005, Supplementary file 1). Thus, loss of Arp53D in the zygote reduces survival, yet this zygotic effect can be almost entirely masked in the presence of maternal contributions of Arp53D.

Figure 8 with 1 supplement see all
A zygotic fitness effect of Arp53D is masked by maternal contributions.

(A) To assess Arp53D’s zygotic requirements for fitness, we quantified progeny produced from the reciprocal crosses in Figure 7B as a percentage of the total population. Homozygous knockout (KO) progeny were reliably distinguished from heterozygous (HET) progeny by intensity of DsRed fluorescence. Progeny fractions obtained were compared to 50:50 Mendelian expectation using a chi-squared test, and p-values are reported. KO progeny comprise a significantly lower proportion than the expected 50% of the population. (B) To determine if KO progeny are only at a disadvantage when the mother lacks Arp53D, HET females were crossed to HET males, and progeny genotypes were quantified and compared to Mendelian expectations of 25:50:25. KO progeny were present at nearly 25% of the population, indicating that KO progeny have no significant fitness disadvantage when the mother has one copy of Arp53D (p-values from a chi-squared test indicate deviation from Mendelian expectation and are not significant). (C) A model for Arp53D’s role in fitness (as assessed by adult progeny counts) under heat stress. For optimal fitness, Arp53D must be contributed maternally or via zygotic transcription of the paternal Arp53D wildtype (WT) allele. Maternal contribution is most critical, while zygotic transcription alone only leads to partial rescue.

We further tested the dependence of Arp53D’s zygotic effect on maternal Arp53D by conducting a separate cross between HET males and HET females (Figure 8B). In this scenario, all progeny receive the same Arp53D contribution from their HET mothers. If there is a zygotic effect that is independent of the maternal genotype, we expect that KO progeny should comprise less than a quarter of the total progeny (Figure 8B). However, we find that the fraction of KO progeny is almost exactly 25%, comparable to the proportion of WT progeny (Figure 8B, Supplementary file 1). Thus, Arp53D-dependent zygotic effects are nearly masked in the presence of maternal Arp53D contributions. Overall, our genetic experiments allow us to conclude that maternal contributions of Arp53D are primarily responsible for its contribution to Drosophila fitness. Lack of maternal contribution can only be partially rescued by zygotic expression from the paternal Arp53D allele (Figures 7A and 8C). Loss of both maternal and zygotic Arp53D leads to the most significant fitness costs (Figures 7A and 8C).

We investigated early embryonic expression of Arp53D to explain its zygotic effect. Publicly available in situ data revealed weak signal for Arp53D first in stages 1–3 of embryogenesis (Figure 8—figure supplement 1Jambor et al., 2015), which precedes zygotic transcription (Tadros and Lipshitz, 2009) and is therefore likely the result of maternal contribution. Arp53D RNA is much more evident during embryonic stages 10–17, after zygotic transcription has initiated (Figure 8—figure supplement 1Jambor et al., 2015). Single-embryo RNA-seq analyses that use single-nucleotide polymorphisms (SNPs) to distinguish between maternal and zygotic transcripts also reveal zygotic expression of Arp53D (Lott et al., 2011). Based on these data, we conclude that Arp53D is sufficiently expressed in embryos to manifest its zygotic effects.

Loss of Arp53D impairs early embryonic development

To understand why fewer adult progeny are recovered when maternal and/or zygotic Arp53D is absent (Figure 7A, B), we compared the number of embryos laid versus the number that actually develop in WT × WT, KO × WT, and KO × KO crosses at 29°C (Figure 9A). We saw no significant differences in the number of eggs laid or the percent of fertilized eggs between these crosses (Figure 9—figure supplement 1A, B). We therefore conclude that maternal and zygotic Arp53D must be required post-fertilization and after embryos have been laid. Indeed, we found that 25% of eggs failed to develop in the KO × WT cross, whereas <20% of eggs failed to develop to larval stages in WT × WT crosses (p=0.04, Figure 9A). An even more dramatic effect was observed in the KO × KO crosses, in which nearly 40% of eggs failed to develop (p=0.02, Figure 9A). Based on these results, we conclude that Arp53D is required for optimal embryonic development.

Figure 9 with 1 supplement see all
Loss of Arp53D impairs early embryonic development.

(A) Knockout (KO) females were crossed to wildtype (WT) or KO males and allowed to lay for 2 hr at 29°C, and all resulting embryos were counted. Hatched embryos were then quantified 24 hr later and are displayed as a percentage of total embryos laid the previous day. KO females lead to reduced embryonic viability relative to WT females (p=0.04, 0.02). (B, C) After a 2 hr lay at 29°C, embryos were collected from WT Oregon-R, Arp53D-KOs, and Arp53D-KOs encoding the rescue Arp53D transgene. Embryos were fixed, stained for DNA, and assessed for abnormal nuclei. In the representative image of WT Oregon-R embryos, only one (arrow) exhibits disorganized and aggregated nuclei. However, Arp53D-KO embryos exhibited more abnormal nuclei than WT, which correlates with their reduced viability. The number of embryos quantified is denoted above each genotype. (D) The embryos in (BC) that were at approximately cycles 13–14 of embryogenesis (Kotadia et al., 2010) were assessed for ‘nuclear fallout,’ which results in visibly large gaps in the embryo’s epithelium and an increase in damaged nuclei in the middle of the embryo. The enlarged images in the third column (‘Arp53D KO enlarged’) correspond to the arrows in the Arp53D KO images in the second column. (E) Gaps were measured in WT and Arp53D-KO embryo epithelia represented in (D). The number of gaps larger than 25 µm2 is significantly higher in KO embryos at 29°C.

To investigate why some KO embryos fail to develop, we allowed WT × WT and KO × KO flies to lay for 2 hr at 29°C. We fixed and stained resulting WT and KO embryos for DNA to stage embryos and identify any gross morphological defects. We found a higher incidence of abnormal nuclei that appeared disorganized and lacked compaction in Arp53D-KO embryos (28% in KO vs. 3% in WT, p<0.0001, Figure 9B, C). Following fertilization, WT Drosophila embryos undergo rapid mitotic divisions. Consequently, mitotic fidelity is often sacrificed, leading to damaged nuclei that are allowed to cycle but are removed from the cell cortex and deposited in the embryo’s yolk at a discrete stage of embryogenesis (Foe and Alberts, 1983; Sullivan et al., 1993). This leads to gaps in an otherwise ordered array of nuclei on the surface of Drosophila embryos. This phenotype has been referred to as ‘nuclear fallout,’ which increases due to mitotic errors preceding and during late cortical nuclear cycles in Drosophila embryogenesis (cycles 11–14) (Sullivan et al., 1993). We found that Arp53D-KO embryos exhibited more gaps larger than 25 µm2 in the cortex than WT embryos at 29°C, suggesting an increase in the occurrence and removal of damaged nuclei (Figure 9D, E). Moreover, Arp53D-KO embryos have more nuclei that are presumed to be damaged in the yolk than WT embryos (Figure 9D). However, in ‘rescued’ KO embryos (bearing the Arp53D rescue transgene, Figure 5E), we find a significant reduction in the frequency of abnormal nuclei (15% in the rescue vs. 28% in KOs, p=0.005, Figure 9—figure supplement 1C) and a slightly lower number of large gaps per embryo (not significant, Figure 9—figure supplement 1D). Cytoskeletal proteins are often important in the organization and migration of nuclei during early embryogenesis (Sullivan et al., 1993). Our cytological analyses of embryos (Figure 9B–E) together with our genetic analyses (Figures 7 and 8) indicate that Arp53D plays a key maternal and zygotic role in embryonic development, despite being primarily testis-enriched in expression.

Discussion

Actin and canonical Arps represent some of the most conserved proteins in eukaryotic genomes. Canonical Arps diversified early in evolution and have been mostly retained for their essential cellular functions since. In contrast to these ancient, conserved Arps, many genomes also encode non-canonical Arps that are often evolutionarily young, rapidly evolving, and predominantly expressed in the male germline. These non-canonical Arps have received much less scientific attention than canonical Arps. In this study, we investigated one of the first-described non-canonical Arps, encoded by Arp53D in D. melanogaster. Although this Arp is not widely conserved even in animal genomes, we show that it has been retained through 65 million years of Drosophila evolution and is important for optimal fitness in D. melanogaster. Moreover, even though Arp53D is predominantly expressed in Drosophila testes, we find that it exerts its critical function during embryogenesis. Non-canonical Arps like Arp53D are found in many animal genomes, including mammals. Our analyses suggest that these non-canonical Arps might encode many important functions that have been previously overlooked.

The evolutionary invention of Arps allows the deployment of the actin fold to perform new functions without compromising actin’s many essential pre-existing functions within a cell. Compared to canonical Arps, the more recent evolutionary divergence of non-canonical Arps provides a better opportunity to dissect how they diverged from actin to acquire and consolidate their varied cellular functions. For example, Arp53D is distinguished from canonical actin by its divergent actin fold domain and a longer 40 amino acid residue N-terminal domain. Although N-terminal tails in actin proteins are typically much shorter—only three amino acid residues in length—they regulate the binding of many regulatory proteins, such as myosin (Sutoh et al., 1991; Hansen et al., 2000). Moreover, post-translational modifications of the N-terminal domains can affect actin localization, polymerization, and interactions with actin-binding proteins (Varland et al., 2019). Our analyses show that the unique N-terminal tail is necessary and sufficient to explain Arp53D’s specialization to germline-specific actin structures during spermatogenesis (Figure 4). We hypothesize that the longer N-terminal tail of Arp53D may allow it the ability to interact specifically with other cytoskeletal proteins, thereby distinguishing it from canonical actin.

Many non-canonical Arps show testes-enriched patterns of expression (Schroeder et al., 2020; Heid et al., 2002; Hara et al., 2008; Fu et al., 2012; Harata et al., 2001). It is not unexpected that novel Arps might specialize for spermatogenesis, which requires several novel cytoskeletal functions and complex actin structures. For example, Drosophila exhibits a unique sperm developmental program that deploys two germline-specific actin structures: the fusome and actin cones. Arp53D localizes to both in a developmental stage-specific manner that is distinct from actin. Actin cones are unique to Drosophila males flies, whereas the fusome is found in both Drosophila females and males, in additional insects (de Cuevas et al., 1997), and in frogs (Kloc et al., 2004). Although these actin structures are absent in many species’ germ cell developmental programs, the actin-based processes of cytoplasm sharing and sperm separation span many phyla (de Cuevas et al., 1997; Geyer et al., 2009). The specialized requirement of these actin processes may have led to the independent origin and retention of many non-canonical Arps throughout animal evolution. Indeed, we find that another non-canonical Arp, which independently arose via gene duplication from canonical Arp2 in the D. pseudoobscura lineage, also specialized to localize to actin cones (Schroeder et al., 2020). Their role in reproduction may have also led to their accelerated rate of evolution due to strong selective pressures from sperm competition and sexual selection (Kleene, 2005; Swanson and Vacquier, 2002; Panhuis et al., 2006).

Against all expectations, however, we find that presence of Arp53D may impair rather than enhance male fertility, both in isolation as well as in competition with WT males. This finding is at odds with Arp53D’s predominant expression in male testes across Drosophila evolution (Figure 1—figure supplement 1F) and its localization to specialized actin structures in spermatogenesis (Figures 2 and 3). Yet, upon loss of Arp53D, we observe no obvious defects in these actin structures and instead observe an acceleration of sperm production (Figure 5C, D). It is possible that Arp53D’s absence in sperm leads to increased expression and recruitment of other Arps, such as Arp2/3, or actin regulatory proteins in testes to these germline-specific actin structures. However, this does not explain why Arp53D is expressed in testes at all, given that it may be costly to male fertility. One possibility is that Arp53D may serve to monitor the quality of sperm produced. Under this model, Arp53D-KO males may produce more sperm, but of an inferior quality, leading to progressively less fit progeny. These impairments could be subtle and require multiple generations to reveal themselves, like in our population cage experiment (Figure 6). Alternatively, Arp53D may confer a fitness benefit to male fertility in untested conditions like the presence of Wolbachia. Since a predominant testis-specific expression pattern is a hallmark of Arp53D and other non-canonical Arps in Drosophila and mammalian species, we favor the possibility of at least a context-specific beneficial role for Arp53D in male fertility.

Despite its weak expression outside the male germline, we show that Arp53D plays an important beneficial role in embryonic development (Figure 9). We find that the fitness defects arising from lack of maternal contribution of Arp53D synergize with absence of zygotic Arp53D expression in the zygote, leading to more severe embryonic inviability (Figure 9A) and reduced number of adult progeny (Figure 7A). Therefore, we conclude that Arp53D is a maternal-zygotic lethal effect gene, in which embryonic lethality is exacerbated when both maternal and zygotic genotypes are Arp53D-KO (Figure 8C). We show that lack of Arp53D leads to gross nuclear abnormalities and increased nuclear fallout during early embryonic development (Figure 9B–E). This may be because Arp53D directly acts upon nuclei during this process. However, we favor the alternative hypothesis that nuclear fallout is an indirect consequence of loss of Arp53D and its regulation of the actin cytoskeleton. Many cytoskeletal proteins are critical in cellularization and nuclear migration during early embryogenesis (Sullivan et al., 1993). These developmental events are also highly sensitive to heat stress. Actin networks are dramatically reorganized in the heat stress response of Drosophila embryos, leading to decreased embryonic viability (Figard et al., 2019). We speculate that Arp53D may regulate embryonic actin networks in the heat stress response, explaining why embryonic defects upon Arp53D loss are strongly exacerbated at high temperature.

Our studies reveal that, contrary to assumptions based on patterns of highest expression, non-canonical Arp53D plays important roles in many aspects of D. melanogaster biology beyond male fertility. Numerous genes exhibit highest expression in the testis and brain, two tissues that are especially transcriptionally promiscuous, even though their most important function may manifest elsewhere. The ‘out-of-testis’ hypothesis predicts that the male germline provides an initial ‘gene nursery’ for evolutionary innovation, with diversification subsequently broadening its expression profile (Assis and Bachtrog, 2013Vinckenbosch et al., 2006; Nyberg and Carthew, 2017). Recent studies of histone variants, which were originally thought to be ‘testis-specific’ in Drosophila and mammals, based on RT-PCR data, demonstrated that their expression and function also extends to females (Kursel et al., 2021; Molaro, 2020). Similarly, Umbrea, which is highly testis-enriched, is required for chromosome segregation more broadly (Ross et al., 2013). Our findings suggest caution against the practice of using gene expression patterns as a surrogate for function. We conclude that even non-canonical ‘testis-specific’ Arps like Arp53D may, in fact, play surprising roles outside the male germline.

Materials and methods

Phylogenetics and positive selection tests

Request a detailed protocol

All sequences (Table 1) were obtained from Flybase (Thurmond et al., 2019) and/or NCBI and aligned using MAFFT (Katoh and Standley, 2013) in Geneious (Kearse et al., 2012) (RRID:SCR_010519). Nucleotide sequences were used for the maximum likelihood tree generated using PhyML and 100 bootstraps. For positive selection tests, unpolarized MK tests (McDonald and Kreitman, 1991) were conducted online (Egea et al., 2008) with 198 D. melanogaster strains (DPGP3) (Lack et al., 2015), obtained from the genome browser Popfly (Hervas et al., 2017), and the D. simulans reference allele (Hu et al., 2013). We manually curated the gene sequence for D. simulans Arp2, which was incorrectly annotated in the automated gene prediction model (Hu et al., 2013), likely due to poor alignment with D. melanogaster Arp2. For all genes, only Zambian strains were used due to having many sequenced strains. Strains whose sequence contained one or more N bases were initially removed; rare polymorphisms (<5% of total sequences) were ignored (Fay et al., 2001). After deducing that a stretch of contiguous N bases represents a polymorphic 15 bp deletion rather than poor sequencing quality, we repeated the MK test using all strain sequences.

To assess site-specific positive selection, we generated codon-based alignments of Arp53D coding sequences in 10 species in the D. melanogaster subgroup using Geneious (Kearse et al., 2012). The alignment and corresponding species tree were used in the CODEML algorithm in the PAML suite (Yang, 2007) (RRID:SCR_014932) to compare the M7, M8a, and M8 NSsites models. The program determines whether the evolution of Arp53D best fits the M8 model, which allows for positive selection, or the M7 or M8a models, which do not allow for positive selection. The difference between the models’ log-likelihoods was assessed for statistical significance using a chi-squared test. We used several starting omegas (0.4, 1.0, and 1.5) and codon frequency models (F3x4 and F61), none of which indicated site-specific positive selection in Arp53D.

Sequencing and RT-PCR

Request a detailed protocol

To obtain genomic DNA from flies for subsequent PCRs and Sanger sequencing, one or two flies were ground in 10 mM Tris-HCl pH8, 1 mM EDTA, 25 mM NaCl, and 200 µg/mL Proteinase K. The fly lysate was incubated at 37°C for 30 min, followed by 95°C for 3 min to inactivate Proteinase K. Following centrifugation, the supernatant was used for analysis. PCRs were conducted with Phusion according to the manufacturer’s instructions (NEB).

To assess Arp53D RNA expression, whole flies (10 minimum) were ground in TRIzol (Invitrogen). Following centrifugation, the supernatant was chloroform-extracted and the resulting soluble phase was isopropanol-extracted to precipitate RNA. RNA was then centrifuged, washed with 75% ethanol, dried, and resuspended in RNAse-free water. Samples were treated with DNaseI (Zymo Research) or TURBO DNase (Thermo Fisher) according to the manufacturer’s instructions. DNase-treated samples were then further purified and concentrated using an RNA-cleanup kit (Zymo Research), and cDNA was obtained using SuperScript III first-strand synthesis (Invitrogen). All primers used are listed in Table 3. To detect low amounts of Arp53D cDNA from female tissue, a touchdown PCR protocol (Korbie and Mattick, 2008) was conducted. The starting annealing temperature was 70°C, which was decreased 0.5°C every cycle for 13 cycles, followed by 17 cycles at 64°C.

Table 3
Primers used in this study.
PurposePrimer 1’s sequencePrimer 2’s sequence
Sequencing Arp53-KO locusACCTTCCCGAATCAAAATCGATTCACGTACACCTTGGAGCC
Sequencing WT Arp53D locusAGATACTCCCCGTGCTGTCTGCAAATCCATTGGATCCGCC
Testing presence of Wolbachia (Schneider et al., 2014)TTCGCCAATCTGCAGATTAAAGTTTTAAACGCTTGACAA
Sequencing SOD2CTTCAGATCATCGCTGGGCTTGAAGAATGTTCTGTGCCCGT
RT-PCR of SOD2TGGAGCTGCATCACCAGAAGTCTTGTTGGGCGAGAGGTTC
RT-PCR of Arp53D (Fig. S4E)ACCTTCCCGAATCAAAATCGAGCGGCGTGGTGTGAATTAC
RT-PCR of Arp53D (Supp. Fig. S7B)CAAAATCGATATAACAAATAAAC
GGGCACAGAACATTCTTCAC
GATACTTTAGGGTTAGTATT
CCCCTTTTTCGGGC

Immunoblot analysis

Request a detailed protocol

Approximately 30 testes from the transgenic line w-; sfGFP-△N-term-Arp53D and the line w-; Arp53D KO; sfGFP-Arp53D (full length) were dissected separately in PBS and centrifuged. After the supernatant was removed, the pellets of testes were flash frozen. Once thawed for immunoblot analysis, 20 µL of 4X NuPAGE LDS sample buffer (Thermo Fisher) was added to each pellet, which was resuspended and boiled for 5 min at 100°C. Protein samples were loaded on a mini-protean TGX stain-free protein gel (BioRad), run with Tris/Glycine/SDS buffer and transferred to a PVDF trans-blot turbo membrane (BioRad). After blocking with 5% milk in Tris-buffered saline (TBS) and 0.1% Tween-20 (TBST), the membrane was probed with anti-GFP and anti-tubulin in TBST for 1 hr at room temperature, followed by three 10 min washes with TBS. The membrane was then incubated for 45 min at room temperature with IR dye 680 anti-chicken (LI-COR) and/or IR dye 800 anti-rabbit 800 nm (LI-COR) in TBST (see Table 4 for dilutions). After three final washes with TBS, the membrane was scanned with 680 nm and 800 nm.

Table 4
Imaging reagents.
Antibody or chemicalCompanyPurposeDilution
Anti-GFP (chicken)Abcam (13970), RRID:AB_300798Western blot1:2000
Immunofluorescence1:500
Anti-tubulin (rabbit)Abcam (6046), RRID:AB_2210370Western blot1:500
Immunofluorescence1:200
Anti-α-spectrinDevelopmental Studies Hybridoma Bank (AB_528473), RRID:AB_528473Immunofluorescence1:50
Anti-phospho-Histone H3 (Ser10)Millipore (Upstate Brand), RRID:AB_310177Immunofluorescence1:1000
Anti-calmodulin (rabbit)Gift from Kathleen Beckingham and Leslie VosshallImmunofluorescence1:50
Anti-mouse Cy3 or Cy5InvitrogenImmunofluorescence1:2000
Anti-rabbit Cy3 or Cy5InvitrogenImmunofluorescence1:2000
Anti-chicken 488InvitrogenImmunofluorescence1:2000
Anti-chicken 680LI-COR, RRID:AB_1850018Western blot1:2500
Anti-rabbit 800LI-CORWestern blot1:2500
Phalloidin Cy3Thermo FisherImmunofluorescence1:40
Phalloidin Cy5Thermo FisherImmunofluorescence1:40
SiR-actin (Lukinavičius et al., 2014)Cytoskeleton, IncLive imaging10 µM

Generation of the Arp53D-KO fly line and reinsertion of WT Arp53D for rescue

Request a detailed protocol

CRISPR/Cas9 was used to knockout Arp53D and replace it with DsRed to track the Arp53D-KO allele. Both guide RNAs were cloned into pCFD4 (RRID:Addgene_49411) (Port et al., 2014). Homology arms (1 kb in length) flanking DsRed were cloned into pHD-attP-DsRed (RRID:Addgene_51019) (Gratz et al., 2014). Guide RNAs were chosen based on optimal efficiency score and no predicted off-targets (http://www.flyrnai.org/crispr2/). The guide RNAs (TCCTGGAAACATGAGCAGCG and TTGGACGGGTGGTTCCGTCT) targeted internally to Arp53D, leading to an early stop-codon and removal of the actin fold domain. The CRISPR/Cas9 targets were chosen because they were least invasive to the nearby essential gene SOD2 and predicted to not alter SOD2’s transcriptional regulatory elements. The two plasmids for CRISPR/Cas9 were midi-prepped (Takara Bio) and co-injected by BestGene, Inc in stock 55821 from the Bloomington Drosophila Stock Center (RRID:BDSC_55821). BestGene, Inc isolated transformants, crossed out the gene encoding for Cas9, and balanced the modified second chromosome with CyO. The Arp53D-KO fly line was backcrossed to the same Oregon-R fly line used in fertility assays for eight generations, sequence-verified, and confirmed for lack of Arp53D expression and absence of Wolbachia (Figure 5—figure supplement 1B–F). The Arp53D-KO line was also separately backcrossed to the w1118 fly line for six generations and sequence verified; this white-eyed line was subsequently used for cytological analyses and population cage experiments. For isogenization, females heterozygous for the Arp53D-KO allele were collected in each generation for a subsequent backcross since meiotic recombination only occurs in females, allowing for further mixing of genetic backgrounds. Heterozygous virgin flies were then crossed to obtain a homozygous Arp53D-KO fly strain, which was consistently maintained at room temperature and used for fertility assays.

To test for rescue of the Arp53D-KO phenotypes, we used site-directed transgenesis and inserted WT Arp53D (PCR-amplified from the Oregon-R D. melanogaster strain) into the attP site of the Arp53D-KO flies that were isogenized in the Oregon-R background. The construct used for transgenesis included the longer WT Arp53D allele (containing the polymorphic 5-codon segment) and its upstream intergenic region (~400 bp), which includes Arp53D’s endogenous promoter. The transgene was cloned into an attB vector that encoded sfGFP under the control of an eye-specific promoter, which allowed us to track the presence of the transgene (Table 5). The construct was midi-prepped and injected by Rainbow Transgenic Flies, Inc Transformants were selected by identifying GFP fluorescence in the eye and were crossed to maintain as homozygous stocks.

Table 5
D. melanogaster transgenics constructed.
Genetic modificationChromosomal locationIntegrated plasmid backboneFly strain injected
CRISPR/Cas9 Arp53D knockoutChr 2, 53D8, 2R:12661915.12662963pHD-attP-DsRed (RRID:Addgene_51019)*RRID:BDSC_55821
sfGFP-Arp53DChr 3, 89E11, 3R:17052863p[acman] (Venken et al., 2006)RRID:BDSC_9744
sfGFP-△N-term -Arp53DChr 3, 89E11, 3R:17052863attB-DsRed†RRID:BDSC_9744
Nterm Arp53D-sfGFPChr 3, 89E11, 3R:17052863attB-DsRed†RRID:BDSC_9744
sfGFP-Nterm Arp53D-Act5CChr 3, 89E11, 3R:17052863attB-DsRed†RRID:BDSC_9744
WT Arp53D (tagless)chr2R:16,774,308–16,774,426attB-sfGFP‡Arp53D KOs isogenized in the Oregon-R background
  1. *pDsRed-attP is from Melissa Harrison and Kate O'Connor-Giles and Jill Wildonger (Addgene plasmid # 51019; http://n2t.net/addgene:51019; RRID:Addgene_51019).

    Vector encoding an attB site and 3xP3-DsRed flanked by loxP sites.

  2. Vector encoding an attB site and 3xP3-sfGFP.

Fly culturing and generation of fly transgenics

Request a detailed protocol

All flies were cultured at 25°C on yeast-cornmeal-molasses-malt extract medium. D. melanogaster Arp53D was N-terminally tagged with sfGFP followed with a 6-aa intervening linker (GGSGGS). This transgene as well as all Arp53D variants (△Nterm-Arp53D, Nterm Arp53D-Actin, and Nterm Arp53D-sfGFP) included Arp53D’s upstream intergenic region (~400 bp) for expression under Arp53D’s endogenous promoter. All transgenes were cloned into vectors encoding an attB site and DsRed under the control of an eye-specific promoter (3XP3). Constructs were midi-prepped (Takara Bio) and injected by BestGene, Inc into BDSC 9744 (Table 5). To construct the △N-term Arp53D fly transgenic, amino acids 1–35 of Arp53D were removed. For the Nterm Arp53D-Actin fly line, amino acids 1–35 of Arp53D followed by the GGSGGS linker were added N-terminally to D. melanogaster Act5C. For Nterm Arp53D-sfGFP, Arp53D’s N-terminus (aa 1–35) followed by a 6-aa linker (GGSGGS) was added N-terminally to sfGFP, replacing Arp53D’s actin fold domain (aa 36–411); this construct did not have an N-terminal sfGFP tag. PCR products encoding the tags, linkers, and Arp53D or actin domains were PCR-stitched together and inserted into the vector backbone (Table 5) with Gibson technology (Gibson et al., 2009) (NEB). Transformants were selected by the eye marker, crossed to w1118, and were stably maintained as homozygous stocks. Modified sites were verified by PCR and subsequent Sanger sequencing.

Immunofluorescence and live imaging

Request a detailed protocol

For live and fixed imaging, testes at room temperature were dissected from 0- to 2-day-old males in PBS using a dissecting scope. Live imaging was also conducted to confirm lack of fixation artifacts in immunofluorescence. For live imaging of individual cysts at all stages of spermatogenesis, dissected testes were transferred to a drop of PBS containing Hoechst 33342 (Invitrogen) and SiR-actin, a fluorescent molecule that binds filamentous actin (Lukinavičius et al., 2014) (10 µM; Cytoskeleton, Inc) on a slide and pulled apart, evenly distributing visibly elongated cysts. Cysts were stained for 5 min at room temperature, and then a coverslip was placed on top for imaging.

For fixation of individual cysts, cysts were separated (as done for live imaging) in PBS. After a coverslip was placed on the slide, it was submerged in liquid nitrogen. Tissue was fixed with either paraformaldehyde (PFA) or methanol. For PFA fixation, the coverslip was removed from flash-frozen slides and the slides were placed in 100% ethanol for 10 min. Then fixation with 4% PFA in PBS took place for 7 min at room temperature. Tissue was then permeabilized twice for 15 min each with PBS and 0.3% Triton X-100% and 0.3% sodium deoxycholate. Alternative fixation with methanol took place at −20°C for 5 min, followed by incubation in acetone −20°C for 5 min. After both fixation protocols, slides were washed once with PBST for 10 min and then blocked with 3% BSA in PBST for 30 min. Primary antibody incubations took place overnight at 4°C, followed by three 15 min washes in PBS at room temperature. Slides were incubated with secondary antibody for 1 hr, followed by four 15 min washes with PBS. Slides were then either washed once with Hoechst 33342 (Invitrogen) or DNA-stained with mounting media containing DAPI (Thermo Fisher). Following the addition of mounting media, a coverslip was placed and sealed with nail polish. Table 4 includes antibody dilutions that were used.

To conduct immunofluorescence with whole fixed testes, dissected testes were immediately fixed with 2% PFA in periodate-lysine-paraformaldehyde (PLP) buffer for 1 hr at room temperature, and then permeabilized with PBS with 0.5% Triton X-100 for 30 min. Testes were blocked for 30 min with 3% BSA in PBS plus 0.1% Triton X-100 (PBST). Incubation with primary antibodies took place overnight at 4°C. Testes were then washed several times, followed by secondary antibody incubation for 2 hr at room temperature. After washing three times with PBST, testes were mounted onto slides with VECTASHIELD antifade mounting media with DAPI (Thermo Fisher).

For imaging testes and seminal vesicles under heat stress, virgin males were aged at 29°C for 3 days. Whole testes and the seminal vesicle were then dissected and fixed in 4% PFA in PBS for 25 min. After washing with PBST three times for 15 min, tissue was incubated with 2 µM SiR-actin (Lukinavičius et al., 2014) for 3 hr at room temperature (for detection of actin cones). Tissue was then washed with PBS three times for 10 min each, followed by a 5–10 min incubation with Hoechst 33342 (Invitrogen). Testes and seminal vesicles were mounted on slides with VECTASHIELD antifade mounting media.

Embryos were imaged as done previously (Mavrakis, 2016). Virgin females and males were collected, and after 5 days of aging at room temperature, crosses were setup at 29°C in cages. Embryos were collected and dechorinated with 50% bleach for 30 s. Embryos were then washed several times with embryo wash buffer (0.7% NaCl, 0.05% Triton X-100) and then fixed in 4% PFA with heptane (1:1 ratio) for 25 min. The PFA (bottom layer) was removed and an equal volume of methanol was added to remove the vitelline envelope. The embryos were vortexed vigorously for 30 s, and after removing the supernatant, they were washed several times with 100% methanol and stored at −20°C. To probe for DNA, embryos were first rehydrated in PBST and blocked with 10% BSA in PBS for 10 min. Following a 10 min incubation with Hoechst 33342 (Invitrogen), embryos were mounted on slides with VECTASHIELD antifade mounting media. All live and fixed samples were imaged using a confocal microscope (Leica TCS SP5 II) and LASAF software (Leica).

Fertility assays

Request a detailed protocol

Oregon-R flies were used as WT flies because Arp53D KOs were isogenized in the Oregon-R genetic background. Female and male virgins were collected for all assays. Females were 1–5 days old, and males were 1–2 days old. Crosses were setup with females in excess (female:male ratios of 5:2 or 10:3, unless noted otherwise), and matings took place for a week at 25°C or 29°C with vials flipped every 2–3 days. Light/dark cycles were maintained consistently. For heat-stress experiments, virgins were maintained at 25°C until crosses were setup and then transferred to 29°C. All adult progeny were quantified on the last possible day before emergence of progeny from the next generation. With day 1 being the time at which crosses were setup, day 15 or 16 was the last day the first generation could be counted at 25°C; day 12 or 13 was the last day for 29°C experiments. For quantification of fluorescence (the Arp53D-KO allele) in the Oregon-R background, DsRed fluorescence was visualized in the ocelli because pigmentation obscured fluorescence in the eye. Heterozygous flies were generated by crossing KO females to Oregon-R flies at room temperature. Homozygous DsRed flies were denoted by strikingly fluorescent ocelli and dim fluorescence of the body, whereas the ocelli of heterozygous flies were dim and required close observation to differentiate from WT flies. All fertility assays were conducted at least twice. Parental flies that died in all crosses were tallied and did not differ significantly among genotypes.

To examine the development of embryos, female and male virgins were collected as for the fertility assays. Fly crosses were setup with females in fourfold excess and allowed to lay at 29°C for 2 hr. The eggs laid were counted and then returned to 29°C. After 24 hr, unhatched eggs were quantified. To compare the proportion of laid eggs that are fertilized, eggs were collected after 2 hr of laying at 29°C and washed in embryo wash buffer (EB, 0.7% NaCl, 0.05% Triton X-100), followed by dechorination with 50% bleach for 30 s. The dechorinated eggs were then washed several times with EB and once with water. They were mounted on an adhesive solution resulting from double-sided tape soaked in n-heptane. Eggs were then covered with Halocarbon oil 700 (Sigma-Aldrich) to prevent dehydration and imaged with brightfield microscopy (Leica microscope model DMIL LED) to assess cellularization, the first stage of embryogenesis and sign of successful fertilization.

For knockdown of Arp53D, RNAi line 108369 (VDRC, RRID:SCR_013805) was used and sequence-verified (as done in Green et al., 2014) for integration at the chromosomal 30B site and not the 40D site, which has a non-specific phenotype (Green et al., 2014). The line was crossed to topi-Gal4 flies (generously given by the labs of Lynn Cooley and Christian Lehner) for knockdown in late spermatogenesis.

Population cage experiment and fitness modeling

Request a detailed protocol

The isogenized Arp53D-KO line in the w1118 background was used due to ease of DsRed detection in the eye (as opposed to the ocelli in the Oregon-R Arp53D-KO background). Virgin females and males were collected from the w1118 fly line and the Arp53D-KO fly line isogenized in the w1118 background. Crosses with 50 Arp53D-KO females, 25 Arp53D-KO males, and 25 w1118 males were setup in bottles with three replicates. Crosses were passaged every 2 weeks at room temperature. At each passage, 50 females and 50 males were randomly collected without fluorescence detection and without selection based on virgin status. These 100 flies were placed in a fresh bottle, and the remaining progeny were frozen for subsequent detection of DsRed fluorescence. After 1 week of laying before the next generation hatched, the 100 flies were removed and frozen to include in the previous generation’s quantification.

In order to gain insight into the fitness differences between Arp53D-KO and WT flies, we modeled the population cage experiment (Figure 6—figure supplement 1) in silico, simulating experimental evolution using a large number of different fitness parameters (https://github.com/jayoung/Arp53D_popCage; Young, 2021; copy archived at swh:1:rev:52ff682daab06ba677f43a49de6f5bd8a0c54a62). Our modeling assumes a freely mating population of infinite size. We defined fitness coefficients for each genotype (FWT, Fhet, FKO) relative to WT homozygous flies (FWT = 1). We explored fitness coefficients for KO homozygous flies (FKO) that ranged between 0.4 and 1 in increments of 0.001. We explored three possibilities for heterozygote fitness, where fitness matched either WT (Fhet = FWT), or KO homozygotes (Fhet = FKO), or was exactly intermediate in fitness between WT and KO homozygotes (Fhet = (FWT + FKO)/2). We seeded all models using the same genotype combinations as the actual experiment (100% KO homozygous females, and a 50:50 mix of WT homozygous and KO homozygous males). At each generation, we calculated the fraction of randomly selected mating pairs that represented each possible genotype combination (Pmat x pat). For each combination of mating pair genotypes, we used Mendelian segregation to determine the fraction of offspring genotypes (OWT, Ohet, OKO). To obtain the overall fraction of progeny genotypes from all parental genotype combinations, we summed the product of those frequencies (P×O) for all mating pair combinations. After obtaining initial progeny genotype frequencies in each generation, we applied fitness coefficients, multiplying the genotype frequencies by FWT, Fhet, FKO, and re-normalizing genotype frequencies to sum to 1. This strategy oversimplifies the true biology as it applies fitness coefficients only to individual genotypes at each generation, regardless of parental genotypes that we know have strong effects. We iterated these steps over 35 generations and recorded genotype frequencies at each generation. In order to determine which model best fit the data, we calculated the mean absolute error (MAE) for each model (by subtracting the modeled value at the corresponding generation from each real datapoint, taking the absolute value, and then calculating the mean) and selected the model that minimized MAE.

Data availability

All data are displayed in the main and supplementary figures. Source data files are provided for Figure 5B and Figure 8A-B. The code developed to model the population cage experiment is available on GitHub (https://github.com/jayoung/Arp53D_popCage/releases/tag/v1.0.0).

The following previously published data sets were used
    1. Luo S
    2. Zhang H
    3. Duan Y
    4. Yao X
    5. Clark AG
    6. Lu J
    (2020) NCBI BioProject
    ID PRJNA309630. Co-evolution of transposable elements and piRNAs in Drosophila melanogaster.
    1. Rogers RL
    2. Shao L
    3. Sanjak JS
    4. Andolfatto P
    5. Thornton KR
    (2014) NCBI BioProject
    ID PRJNA257287. D. melanogaster reference RNA-seq virgin male carcass.
    1. Rogers RL
    2. Shao L
    3. Sanjak JS
    4. Andolfatto P
    5. Thornton KR
    (2014) NCBI BioProject
    ID PRJNA196536. D. yakuba reference RNA-seq virgin male carcass, paired end reads.
    1. Rogers RL
    2. Shao L
    3. Sanjak JS
    4. Andolfatto P
    5. Thornton KR
    (2014) NCBI BioProject
    ID PRJNA257286. Drosophila ananassae Transcriptome or Gene expression.
    1. Ma S
    2. Avanesov AS
    3. Porter E
    4. Lee BC
    5. Mariotti M
    6. Zemskaya N
    7. Guigo R
    8. Moskalev AA
    9. Gladyshev VN
    (2018) NCBI BioProject
    ID PRJNA414017. Comparative Transcriptomics across 14 Drosophila Species Reveals Signatures of Longevity.
    1. Nozawa M
    2. Onizuka K
    3. Fujimi M
    4. Ikeo K
    5. Gojobori T
    6. National Institute of Genetics
    (2016) NCBI BioProject
    ID PRJDB4576. mRNA-seq of Drosophila miranda, D. pseudoobscura, and D. obscura.
    1. Yang H
    2. Jaime M
    3. Mahadevaraju S
    4. Polihronakis M
    5. Oliver B
    (2017) NCBI Gene Expression Omnibus
    ID GSE99574. RNA-seq of sexed adult tissues/body parts from eight Drosophila species.
    1. Yang H
    2. Jaime M
    3. Kanegawa K
    4. Kaneshiro K
    5. Oliver B
    (2016) NCBI Gene Expression Omnibus
    ID GSE80124. Expression profiling Hawaiian Drosophila species, tissues, and sexes.
    1. University of California, Davis
    (2020) NCBI BioProject
    ID PRJNA613134. Adult Drosophila melanogaster testis RNA sequencing.
    1. University of Rochester
    (2019) NCBI BioProject
    ID PRJNA541548. Transcriptome sequencing of Drosophila simulans clade.
    1. Oliver B
    (2011) NCBI Gene Expression Omnibus
    ID GSE31302. RNA-Seq of Gonads and Carcasses in D. simulans and D. pseudoobscura.
    1. University Of California, Davis
    (2013) NCBI BioProject
    ID PRJNA210329. The population genetics of De novo genes in Drosophila.
    1. Cornell University
    (2017) NCBI BioProject
    ID PRJNA376405. D. americana, D. lummei, D. novamexicana, and D. virilis: genomes and male transcriptome sequencing and assembly.
    1. Hervas S
    2. Sanz E
    3. Casillas S
    4. Pool JE
    5. Barbadilla A
    (2017) PopFly
    ID PopFly. PopFly: the Drosophila population genomics browser.

References

    1. de Cuevas M
    2. Lee JK
    3. Spradling AC
    (1996)
    alpha-spectrin is required for germline cell division and differentiation in the Drosophila ovary
    Development 122:3959–3968.
    1. de Cuevas M
    2. Spradling AC
    (1998)
    Morphogenesis of the Drosophila fusome and its implications for oocyte specification
    Development 125:2781–2789.
    1. Drosophila 12 Genomes Consortium
    2. Clark AG
    3. Eisen MB
    4. Smith DR
    5. Bergman CM
    6. Oliver B
    7. Markow TA
    8. Kaufman TC
    9. Kellis M
    10. Gelbart W
    11. Iyer VN
    12. Pollard DA
    13. Sackton TB
    14. Larracuente AM
    15. Singh ND
    16. Abad JP
    17. Abt DN
    18. Adryan B
    19. Aguade M
    20. Akashi H
    21. Anderson WW
    22. Aquadro CF
    23. Ardell DH
    24. Arguello R
    25. Artieri CG
    26. Barbash DA
    27. Barker D
    28. Barsanti P
    29. Batterham P
    30. Batzoglou S
    31. Begun D
    32. Bhutkar A
    33. Blanco E
    34. Bosak SA
    35. Bradley RK
    36. Brand AD
    37. Brent MR
    38. Brooks AN
    39. Brown RH
    40. Butlin RK
    41. Caggese C
    42. Calvi BR
    43. Bernardo de Carvalho A
    44. Caspi A
    45. Castrezana S
    46. Celniker SE
    47. Chang JL
    48. Chapple C
    49. Chatterji S
    50. Chinwalla A
    51. Civetta A
    52. Clifton SW
    53. Comeron JM
    54. Costello JC
    55. Coyne JA
    56. Daub J
    57. David RG
    58. Delcher AL
    59. Delehaunty K
    60. Do CB
    61. Ebling H
    62. Edwards K
    63. Eickbush T
    64. Evans JD
    65. Filipski A
    66. Findeiss S
    67. Freyhult E
    68. Fulton L
    69. Fulton R
    70. Garcia AC
    71. Gardiner A
    72. Garfield DA
    73. Garvin BE
    74. Gibson G
    75. Gilbert D
    76. Gnerre S
    77. Godfrey J
    78. Good R
    79. Gotea V
    80. Gravely B
    81. Greenberg AJ
    82. Griffiths-Jones S
    83. Gross S
    84. Guigo R
    85. Gustafson EA
    86. Haerty W
    87. Hahn MW
    88. Halligan DL
    89. Halpern AL
    90. Halter GM
    91. Han MV
    92. Heger A
    93. Hillier L
    94. Hinrichs AS
    95. Holmes I
    96. Hoskins RA
    97. Hubisz MJ
    98. Hultmark D
    99. Huntley MA
    100. Jaffe DB
    101. Jagadeeshan S
    102. Jeck WR
    103. Johnson J
    104. Jones CD
    105. Jordan WC
    106. Karpen GH
    107. Kataoka E
    108. Keightley PD
    109. Kheradpour P
    110. Kirkness EF
    111. Koerich LB
    112. Kristiansen K
    113. Kudrna D
    114. Kulathinal RJ
    115. Kumar S
    116. Kwok R
    117. Lander E
    118. Langley CH
    119. Lapoint R
    120. Lazzaro BP
    121. Lee SJ
    122. Levesque L
    123. Li R
    124. Lin CF
    125. Lin MF
    126. Lindblad-Toh K
    127. Llopart A
    128. Long M
    129. Low L
    130. Lozovsky E
    131. Lu J
    132. Luo M
    133. Machado CA
    134. Makalowski W
    135. Marzo M
    136. Matsuda M
    137. Matzkin L
    138. McAllister B
    139. McBride CS
    140. McKernan B
    141. McKernan K
    142. Mendez-Lago M
    143. Minx P
    144. Mollenhauer MU
    145. Montooth K
    146. Mount SM
    147. Mu X
    148. Myers E
    149. Negre B
    150. Newfeld S
    151. Nielsen R
    152. Noor MA
    153. O'Grady P
    154. Pachter L
    155. Papaceit M
    156. Parisi MJ
    157. Parisi M
    158. Parts L
    159. Pedersen JS
    160. Pesole G
    161. Phillippy AM
    162. Ponting CP
    163. Pop M
    164. Porcelli D
    165. Powell JR
    166. Prohaska S
    167. Pruitt K
    168. Puig M
    169. Quesneville H
    170. Ram KR
    171. Rand D
    172. Rasmussen MD
    173. Reed LK
    174. Reenan R
    175. Reily A
    176. Remington KA
    177. Rieger TT
    178. Ritchie MG
    179. Robin C
    180. Rogers YH
    181. Rohde C
    182. Rozas J
    183. Rubenfield MJ
    184. Ruiz A
    185. Russo S
    186. Salzberg SL
    187. Sanchez-Gracia A
    188. Saranga DJ
    189. Sato H
    190. Schaeffer SW
    191. Schatz MC
    192. Schlenke T
    193. Schwartz R
    194. Segarra C
    195. Singh RS
    196. Sirot L
    197. Sirota M
    198. Sisneros NB
    199. Smith CD
    200. Smith TF
    201. Spieth J
    202. Stage DE
    203. Stark A
    204. Stephan W
    205. Strausberg RL
    206. Strempel S
    207. Sturgill D
    208. Sutton G
    209. Sutton GG
    210. Tao W
    211. Teichmann S
    212. Tobari YN
    213. Tomimura Y
    214. Tsolas JM
    215. Valente VL
    216. Venter E
    217. Venter JC
    218. Vicario S
    219. Vieira FG
    220. Vilella AJ
    221. Villasante A
    222. Walenz B
    223. Wang J
    224. Wasserman M
    225. Watts T
    226. Wilson D
    227. Wilson RK
    228. Wing RA
    229. Wolfner MF
    230. Wong A
    231. Wong GK
    232. Wu CI
    233. Wu G
    234. Yamamoto D
    235. Yang HP
    236. Yang SP
    237. Yorke JA
    238. Yoshida K
    239. Zdobnov E
    240. Zhang P
    241. Zhang Y
    242. Zimin AV
    243. Baldwin J
    244. Abdouelleil A
    245. Abdulkadir J
    246. Abebe A
    247. Abera B
    248. Abreu J
    249. Acer SC
    250. Aftuck L
    251. Alexander A
    252. An P
    253. Anderson E
    254. Anderson S
    255. Arachi H
    256. Azer M
    257. Bachantsang P
    258. Barry A
    259. Bayul T
    260. Berlin A
    261. Bessette D
    262. Bloom T
    263. Blye J
    264. Boguslavskiy L
    265. Bonnet C
    266. Boukhgalter B
    267. Bourzgui I
    268. Brown A
    269. Cahill P
    270. Channer S
    271. Cheshatsang Y
    272. Chuda L
    273. Citroen M
    274. Collymore A
    275. Cooke P
    276. Costello M
    277. D'Aco K
    278. Daza R
    279. De Haan G
    280. DeGray S
    281. DeMaso C
    282. Dhargay N
    283. Dooley K
    284. Dooley E
    285. Doricent M
    286. Dorje P
    287. Dorjee K
    288. Dupes A
    289. Elong R
    290. Falk J
    291. Farina A
    292. Faro S
    293. Ferguson D
    294. Fisher S
    295. Foley CD
    296. Franke A
    297. Friedrich D
    298. Gadbois L
    299. Gearin G
    300. Gearin CR
    301. Giannoukos G
    302. Goode T
    303. Graham J
    304. Grandbois E
    305. Grewal S
    306. Gyaltsen K
    307. Hafez N
    308. Hagos B
    309. Hall J
    310. Henson C
    311. Hollinger A
    312. Honan T
    313. Huard MD
    314. Hughes L
    315. Hurhula B
    316. Husby ME
    317. Kamat A
    318. Kanga B
    319. Kashin S
    320. Khazanovich D
    321. Kisner P
    322. Lance K
    323. Lara M
    324. Lee W
    325. Lennon N
    326. Letendre F
    327. LeVine R
    328. Lipovsky A
    329. Liu X
    330. Liu J
    331. Liu S
    332. Lokyitsang T
    333. Lokyitsang Y
    334. Lubonja R
    335. Lui A
    336. MacDonald P
    337. Magnisalis V
    338. Maru K
    339. Matthews C
    340. McCusker W
    341. McDonough S
    342. Mehta T
    343. Meldrim J
    344. Meneus L
    345. Mihai O
    346. Mihalev A
    347. Mihova T
    348. Mittelman R
    349. Mlenga V
    350. Montmayeur A
    351. Mulrain L
    352. Navidi A
    353. Naylor J
    354. Negash T
    355. Nguyen T
    356. Nguyen N
    357. Nicol R
    358. Norbu C
    359. Norbu N
    360. Novod N
    361. O'Neill B
    362. Osman S
    363. Markiewicz E
    364. Oyono OL
    365. Patti C
    366. Phunkhang P
    367. Pierre F
    368. Priest M
    369. Raghuraman S
    370. Rege F
    371. Reyes R
    372. Rise C
    373. Rogov P
    374. Ross K
    375. Ryan E
    376. Settipalli S
    377. Shea T
    378. Sherpa N
    379. Shi L
    380. Shih D
    381. Sparrow T
    382. Spaulding J
    383. Stalker J
    384. Stange-Thomann N
    385. Stavropoulos S
    386. Stone C
    387. Strader C
    388. Tesfaye S
    389. Thomson T
    390. Thoulutsang Y
    391. Thoulutsang D
    392. Topham K
    393. Topping I
    394. Tsamla T
    395. Vassiliev H
    396. Vo A
    397. Wangchuk T
    398. Wangdi T
    399. Weiand M
    400. Wilkinson J
    401. Wilson A
    402. Yadav S
    403. Young G
    404. Yu Q
    405. Zembek L
    406. Zhong D
    407. Zimmer A
    408. Zwirko Z
    409. Jaffe DB
    410. Alvarez P
    411. Brockman W
    412. Butler J
    413. Chin C
    414. Gnerre S
    415. Grabherr M
    416. Kleber M
    417. Mauceli E
    418. MacCallum I
    (2007) Evolution of genes and genomes on the Drosophila phylogeny
    Nature 450:203–218.
    https://doi.org/10.1038/nature06341
    1. Fay JC
    2. Wyckoff GJ
    3. Wu CI
    (2001)
    Positive and negative selection on the human genome
    Genetics 158:1227–1234.
    1. Lin H
    2. Yue L
    3. Spradling AC
    (1994)
    The Drosophila fusome, a germline-specific organelle, contains membrane skeletal proteins and functions in cyst formation
    Development 120:947–956.
    1. Machesky LM
    2. May RC
    (2001) Arps: actin-related proteins
    Results and problems in cell differentiation 32:213–229.
    https://doi.org/10.1007/978-3-540-46560-7_15
    1. Panhuis TM
    2. Clark NL
    3. Swanson WJ
    (2006) Rapid evolution of reproductive proteins in abalone and Drosophila
    Philosophical transactions of the Royal Society of London. Series B, Biological sciences 361:261–268.
    https://doi.org/10.1098/rstb.2005.1793
    1. Sullivan W
    2. Fogarty P
    3. Theurkauf W
    (1993)
    Mutations affecting the cytoskeletal organization of syncytial Drosophila embryos
    Development 118:1245–1254.

Decision letter

  1. Utpal Banerjee
    Senior and Reviewing Editor; University of California, Los Angeles, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

Acceptance summary:

This manuscript was reviewed through the Review commons process by three well -respected reviewers in the field. The reviews were largely positive with several detailed suggestions made for improvement. The authors took these suggestions to heart and provided a well-documented and honest summary of each result. What makes this paper particularly suited for a journal like eLife is its universal acclaim of novelty and high significance. The result that a protein highly expressed in the testis has been selected over evolution, not so much because it contributes to sperm function, but because of expression elsewhere, is, to say the least, extremely surprising but has impressed the reviewers. To me, the fact that this protein is an Arp, with binding function to actin makes this finding even more unusual and interesting. The work will generate discussions amongst evolutionary biologists for sure.

https://doi.org/10.7554/eLife.71279.sa1

Author response

We would like to thank the three reviewers for their time and thoughtful comments on the manuscript. We found their constructive feedback extremely helpful and are grateful for the peer review process in clarifying and strengthening our study. In response to their comments and suggestions, we have extensively revised the Discussion section of our manuscript. We have also added four new experiments in our revision. We summarize them here briefly and describe them in more detail in our revised manuscript and in the point-by-point rebuttal.

– Introduction of Arp53D rescue transgene in place of the Arp53D-KO allele: Although this rescue transgene is not expressed as strongly as the endogenous gene, we find it nonetheless robustly rescues the embryonic viability phenotype, but does not significantly lower male fertility.

– Extensive population-genetic modeling of our population cage experiments: These analyses revealed that we had grossly underestimated the selective coefficients associated with wildtype Arp53D alleles in our previous submission. Instead of a 2-3% effect, we now demonstrate that wildtype alleles have a 30-40% selective advantage over the KO allele.

– Cytological analysis of the basis of male fertility increases in Arp53D-KO flies: We show that although a static readout of total sperm (via seminal vesicle size) is unchanged, there is an increased number of individualizing cysts in Arp53D-KO flies, suggesting that sperm production is accelerated.

– Cytological analysis of the basis of embryonic inviability in Arp53D-KO embryos: We show that there is an increased number of disorganized nuclei and a higher propensity of ‘nuclear fallout’ in Arp53D-KO embryos at 29ºC, suggesting that Arp53D plays a key role in helping facilitate early divisions in Drosophila embryos under heat stress.

Some of these additional experiments were carried out by a new colleague, Isabel Mejia Natividad, who is now added as an author in the revision.

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Reviewer summary:

In this manuscript, the authors characterize the orphan actin related protein Arp53D, which is conserved in all Drosophila species with available full genome sequences but not in other dipterans. Sequence analysis of Arp53D in ~200 D. melanogaster populations and in D. simulans suggests that this gene is experiencing positive selection in melanogaster, implying that it contributes positively to fitness in some way. The authors corroborate this observation using a population study, which reveals that the allele frequency of an Arp53D knockout is strongly and reproducibly reduced within 15-20 generations. Because publicly available RNA-seq data show this gene to have highest expression in the D. melanogaster testis, the authors begin by observing protein localization there. Consistent with its close homology to actin, Arp53D localizes to two actin-enriched structures in male germ cells, fusomes and actin cones of the individualization complex, as revealed by a GFP-tagged transgene. Deleting Arp53D's unique N-terminal region prevents this localization, and attaching the N-terminal region to canonical actin drives concentrated localization to these structures, indicating that the N-terminal region is necessary and sufficient for Arp53D's specific localization in the male germline. However, knocking out the gene does not perturb gross fusome or individualization complex structure, and, surprisingly, leads to increased male fertility. Consistently, knockout males apparently have an advantage in a sperm competition assay. Even more surprisingly, given the gene's low expression in females and early embryos, knockout leads to reduced embryonic survival, with both maternal and zygotic contributions to the effect. Altogether, the data show that despite Arp53D's strong expression and specific localization in the testis, it actually is detrimental there; nevertheless, it confers a survival advantage in embryos, with both maternal and zygotic effects, despite minimal maternal expression.

We thank the reviewer for a clear summary of our findings.

Major comments:

1. Locus specificity of the male fertility and embryonic viability phenotypes must be substantiated before the manuscript is ready for publication. The authors should be able to use their stock carrying the Arp53D knockout with the tagged Arp53D transgene to demonstrate rescue of the major knockout phenotypes.

We thank the reviewer for raising this important point, which was also raised by other reviewers. We have now added experiments to confirm the locus specificity of the phenotypes in the Oregon-R Arp53D-KO strain background used for all genetic experiments. To create the Arp53D-KO strain, we had previously knocked in DsRed with an attp site, which allows for site-directed transgenesis, followed by repeated backcrossing with Oregon-R flies. In our revision, we took advantage of this attP site to integrate an untagged wild-type (WT) Arp53D gene and its upstream endogenous promoter into this genetic location. Our approach is now outlined in the new Figure 5E. This rescue allele robustly rescued the reduction in progeny count seen with the female knockout (new Figure 7C) confirming that the embryonic viability phenotype is a direct result of Arp53D-KO and not a linked mutation. However, male fertility was only slightly decreased in this transgene rescue without statistical significance (Figure 5F). We attribute this slight decrease in male fertility to dosage of Arp53D expression. Indeed, we find that the ‘rescue’ Arp53D transgene is expressed less than WT Arp53D in Oregon-R (Supplemental Figure S5I), which appears sufficient to rescue embryonic viability but not lower male fertility. These rescue experiments confirm our surprising findings that Arp53D’s evolutionary retention is predominantly due to its role in embryonic development.

2. The manuscript would be enhanced greatly by highlighting in the discussion how the key finding, that despite Arp53D's strong expression in the testis its positive selection appears to be driven by a somatic function in the embryo, deviates from expectations under the hypothesis that the testis is often a permissive site for gene evolution (see e.g., Kondo et al. 2017, Assis and Bachtrog 2013, Zhao et al. 2014, Kaessmann 2010). It also is worth mentioning that this story provides a cautionary lesson against the practice of using gene expression patterns as proxies for function. Replacing the current conclusion sentences with some discussion along these lines would emphasize the strong impact of the results (see point 13 below).

We thank the reviewer for giving us the opportunity to clarify these important points. We were indeed surprised by the pertinent phenotype being unrelated to the predominant site of expression of this gene. We have added to the discussion to caution against the practice of using gene expression patterns as proxies for function.

Minor comments:

1. The title is vague and does not highlight the key finding of the paper well. I suggest emphasizing Arp53D's unexpected negative effect on male fertility or positive effect in the embryo, despite its striking male specific expression.

We agree with this suggestion and have changed the title to “An actin-related protein that is most highly expressed in Drosophila testes is critical for embryonic development.”

2. The Abstract should be edited at lines 35-37, with bracketed words removed: "Drosophila and mammals also encode divergent non-canonical Arps [in their male germline] whose roles remain unknown. Here, we show that Arp53D, a rapidly-evolving Drosophila Arp, localizes to fusomes and actin cones, two [male] germline-specific actin structures critical for sperm maturation, via its non-canonical N-terminal tail." The gene is encoded in all cells, and fusomes are found also in the female germline.

We thank the reviewer for these suggestions, which we have gratefully accepted.

3. Results line 111: How were Arp53D orthologs distinguished from other Arp paralogs? What criteria were used? Please add more detail to the Methods section, as Arps are notoriously difficult to distinguish by sequence alone (see Muller et al. 2005).

Arp53D orthologs were distinguished from other Arp paralogs by phylogeny and shared synteny. We have now clarified this in our revision.

4. Results line 135, remove bracketed word: "The MK test compares the ratio of [fixed] non-synonymous (amino acid replacing, PN) to synonymous (Ps) polymorphisms within a species…"

We thank the reviewer for pointing out this error, which we have corrected.

5. Results lines 156-159: The conclusion that inter-species substitutions are concentrated at the N-terminus of Arp53D is not justified. The cartoon in Figure S1E shows only four out of more than 20 in the unstructured N-terminal region.

We agree with this comment and have edited this section accordingly.

6. Results lines 160-162: Please provide more explanation of this analysis and its meaning.

We have added an explanation as follows:

“These McDonald-Kreitman results revealed that Arp53D evolved under positive selection in recent evolutionary time (since D. melanogaster and D. simulans divergence) but do not pinpoint which residue changes were functionally important. […] This suggests that the signature of positive selection does not recur in the same subset of residues.”

7. Results lines 173-175: Please clarify in the text and/or legend where the RNA-seq data came from. Are they publicly available ModENCODE data pulled from Flybase?

Thank you for pointing out this inadvertent omission. The tissue-specific RNA-seq data for D. melanogaster was ModENCODE data obtained from Flybase, which is now explicitly acknowledged in the revision along with citations to the RNA-seq data from non-melanogaster species.

8. Results lines 209-212, revise text: "During late stages of spermatogenesis, spermatids must separate and obtain their own individual membranes. This process is carried out by the individualization complex containing 64 'actin cones', each of which is a cone of actin filaments, which forms around each sperm head when nuclear condensation is complete. Cones translocate along the axonemes of the sperm tails to push out excess cytoplasm ("cystic bulge") while encasing each sperm in its own membrane."

Thank you for pointing out the lack of clarity. We have rewritten this to ensure clarity.

9. Results line 220: Remove the word "punctate," as this word indicates the presence of puncta, which are not seen in Figure 3C and 3D. SfGFP-Arp53D puncta do seem to appear in Figure 3B, along the axonemes caudal to the actin cones, but this is not described in the text.

We have clarified this point in our revision. We agree with the reviewer’s suggestion to remove the word “punctate”. To clarify, we did observe small puncta along the axonemes; however, this is not always seen with live imaging. We now describe these observations more clearly in our revision.

10. Results line 224: Describing the leading edge of the actin cones as "the site of active actin polymerization" is misleading, because actin polymerization happens in the rear bundles as well (see Noguchi et al. 2008). Also, the phrase "membrane extrusion" should be changed to "cytoplasm extrusion."

We thank the reviewer for raising this point. We have edited this line in the revision to describe the actin cone’s leading edge as “the site of active cytoplasm extrusion.”

11. Results line 227: According to the images presented in Figure S2D, Arp53D localizes adjacent to Androcam rather than colocalizing.

We thank the reviewer for this close observation, and we agree that the image suggests they are adjacent. However, previous literature shows that Androcam extends to the very tip of actin cones similar to what we see with Arp53D (citation included in revision). In our images, Androcam’s apparent lack of direct overlap with Arp53D may be due to steric competition between the antibodies probing for Androcam and Arp53D, or the much weaker staining of Androcam, making Arp53D appear more prominent at the leading edge. We have replaced the insets with a focus on cones exhibiting slightly better staining of Androcam, and we have re-worded the text to state the proteins are proximal, rather than definitively co-localizing. We have also noted in the revision that Androcam staining extends beyond where Arp53D is concentrated.

12. Results line 234, remove bracketed words: "It first localizes to the fusome [as it forms] during meiosis…"

We agree with and have made this edit suggestion.

13. Discussion: The last two lines are abstruse- please replace them (see above).

We agree with and have made this edit and suggestions made by the reviewer in Major comment #2.

14. Methods lines 651-654: Please provide more details on how the cloning was accomplished.

We apologize for the brief description in our earlier submission. In our revision, we have now included a more detailed description of the cloning details and strategy.

15. Figure S3B: The doublet on the blot is described in the figure legend as degradation, but it could be the result of processing or post-translational modifications.

We agree. We now note this suggested possibility in the revision.

16. Figure S3D: Can these data be incorporated into main Figure 4? They emphasize the striking redistribution of canonical actin away from its normal localization by the Arp53D N-terminal region.

We thank the reviewer for this suggestion, which we have gratefully accepted, incorporating these images into a revised Figure 4.

17. Figure S3E: Please include a blot for Nt-GFP to show protein expression at the expected size, as the fluorescent signal is weak. Also, this panel is mislabeled in the figure legend.

We are grateful to the reviewer for noting our mislabeling, which we have now corrected. To verify the expression of Nt-GFP, we conducted an immunoblot analysis with testis lysate, which showed the expression of Nt-GFP at the expected size and at comparable levels to that of GFP-tagged full-length Arp53D expressed in testes (now included in Supplemental Figure S3E).

18. Figure 5D and Figure 6E,H: When experimental data are compared to expected values, use a Chi squared test rather than ANOVA to determine significance.

We appreciate this comment. We have now corrected and used the appropriate test for these panels (now Figure 5B and Figure 8A-B) and related experiments. We also include the raw data used for the chi-squared tests in Supplementary File 1.

19. Figure S5E-F: Please include number of eggs counted for each experiment.

As requested, we now report the number of eggs counted for each panel in the figure legend in our revision (now Supplementary Figure S8B-C).

Reviewer #1 (Significance (Required)):

Significance: In addition to highly conserved conventional actins, all eukaryotes possess numerous actin paralogs that together compose a large actin superfamily, which includes many sub-families of actin related proteins (Arps) that also are largely well conserved. Arps carry out a wide array of functions, both in the cytoplasm and the nucleus, investigations of which have focused mostly on well conserved family members and largely have neglected orphan Arps, which are not readily assigned to sub-families. This manuscript investigates a previously uncharacterized orphan Arp that is highly expressed in Drosophila testes. The authors find that despite its striking localization to male germline actin structures, it is detrimental to male fertility in D. melanogaster. The findings suggest that its apparent positive selection is attributable to embryonic functions, implying a developmental tradeoff between germline and somatic development. The findings are surprising in light of a prominent evolutionary model suggesting that high expression of paralogs and/or new genes in the testis permits evolution of new functions there without compromising preexisting somatic functions of the gene family. This novel investigation into a divergent Arp paralog with strong expression in the testis but an apparent detrimental effect there will likely be of great interest to evolutionary biologists.

We are grateful for this positive and complimentary summary by the reviewer. We also note that our study is the first detailed functional dissection of an ‘orphan’ Arp paralog. Our findings suggest that despite being lineage-specific, such Arps encode very important functions.

Reviewer keywords: Drosophila, spermatogenesis, germline actin dynamics

Reviewer #2 (Evidence, reproducibility and clarity (Required)):Summary:Schroeder et al. investigate the role of a rapidly-evolving actin paralog in Drosophila. This gene, Arp53D, is conserved over 65MY in the Drosophila lineage, but is not found outside it. Arp53D's highest expression is in the testis, and the protein is seen to localize with two actin-rich structures, the fusome and the actin cones, though not always exactly with actin. Despite its conservation and localization, Arp53D appears to have a negative effect on male fertility, as its knockout and knockdown males are less fertile than control. However, its activity is needed for optimal fertility because of a maternal effect on survival or development. That effect can be partially rescued by zygotic expression.

We thank the reviewer for accurately summarizing our findings.

Major comments:

Is the study convincing, are the experiments replicated, statistics adequate, is there enough information to reproduce?:

Yes. This is an excellent paper in all respects. It reports a new and interesting finding. The experiments are beautifully done and rigorous. The data are convincing. The question is addressed from several perspectives. The paper is well written, well argued, and gives complete details.

We thank the reviewer for the very positive comments and constructive suggestions for improvements, which we have now incorporated into our revision.

I have some requests for information that seems important for interpretation. I believe these are straightforward and realistic to do.

1. Does the sfGFP-Arp53D rescue the defects of Arp53D knockout? Otherwise, it is not completely certain that its localization reflects where the endogenous protein is, or is needed.

This is a fair point. We chose to tag Arp53D with sfGFP at the N-terminus because actin proteins can only be tagged at the N-terminus in Drosophila; a C-terminal tag disrupts protein polymerization (Brault et al., 1999). However, we believe it is unlikely that this tag alters or dictates localization because actin’s function is not altered with an N-terminal tag. Moreover, we see that actin localizes only to cones and the fusome upon addition of Arp53D’s N-terminus (Figure 4), similar to tagged full-length Arp53D.

We did not attempt to rescue with the sfGFP-Arp53D line because the genetic background is different from the Arp53D-KOs that were used in all our genetic experiments. Since fertility levels can vary strain to strain, it is important to have a WT control that is closest in genetic background, which we lack for the sfGFP-Arp53D line. This transgenic fly line has a mix of the w1118 background and the background of the original injected fly line (see Table 5).

2. Sperm counts would provide an easy way to determine whether the mutant’s problem is in sperm production, mating/transfer, or in function of the sperm themselves.

This is a valuable suggestion. In our revisions, we include additional cytological analyses to assess the basis of male fertility differences. We now report that Arp53D-KO testes have more cysts with actin cones than WT in the Oregon-R background, suggesting accelerated sperm production. However, we do not see significant evidence for increased size of the seminal vesicle.

Interpretation suggestion:

1. Although the “gene nursery” model might imply that Arp53D was selected on for a testis function, I wonder whether it might actually been selected for its beneficial embryo function, and later acquired testis expression. Its testis function might be a tolerated level of competition between it and a different Arp that localizes to fusomes or actin cones. In this latter scenario, if you get rid of all or some of Arp53D from the testis, that might allow the other Arp to do its job unimpeded, thereby improving male fertility.

We are grateful to the reviewer for suggesting this excellent interpretation. We do believe Arp53D has been evolutionarily retained for the beneficial embryo function in the long term. Since Arp53D does not appear to negatively impact male fertility, we also now suggest the possibility that another Arp, such as Arp2/3 or a different actin regulatory protein, may in fact be playing a role that masks a defect in Arp53D’s absence. Together with a recommendation made to further comment on the gene nursery model by Reviewer 1 (major comment #2), we have revised our Discussion extensively to incorporate these suggestions.

Minor comments, easily addressable:

Prior studies are referenced and considered.

Overall text, and figures, are clear and accurate, but there are some wording imprecisions that would be good to correct (by line number):

2: Arp53D is not “(an) actin”. It is an Arp. The rest of the paper, including the running title, refers to it correctly.

We now refer to Arp53D as an Arp rather than an actin in the revised title.

36-37 and 193-194: The authors correctly note later in the paper that fusomes are found in both male and female germlines. But the wording in these lines (e.g. “fusomes and actin cones, two male germline-specific…”) implies that fusomes are only in male germlines. Please reword.

We agree with this comment and have removed the word “male” describing the germline-specific structures to avoid this confusion.

44-45: seems too strong a conclusion. You don’t know what has led to its longterm retention.

We agree with this comment. In our revision, we suggest that embryonic function most likely explains why Arp53D has been evolutionarily retained. In the discussion, we explain there may be additional functions, including in the male germline, that have contributed to retention.

112: did you look for what was in the Arp53D-lacking genomes in that place, by synteny? Can you get info on how Arp53D suddenly appeared there?

Unfortunately, the age of Arp53D and the rapid evolution of Drosophila genomes makes detailed inferences difficult, as we now highlight in our revision:

“A previous study proposed that Arp53D arose from retroduplication of Act88F, which encodes a Drosophila muscle actin24. […] The ancient evolutionary origin of Arp53D does not allow us to determine whether Arp53D’s unique N-terminus was acquired from the intergenic DNA sequence upon retroduplication or via subsequent insertions after retroduplication.”

124: do other genes have regions similar to this N-term extension, or is it Arp-specific as the sentence seems to imply?

As we indicated above, we have found no homology between the N-terminal region of Arp53D to any coding or non-coding sequence in any Drosophila (or other) genome.

239-240: seems too strong. The data don't show that Arp53D carries out specialized roles at cones and fusomes.

We agree and have edited this statement to reflect the possibility of specialized roles at germline structures.

253: do you know that the sfGFP-deletion fusion is as stable as sfGFP-Arp53D? If not, that could also give rise to what you saw.

In our revision, we considered the possibility that the Arp53D actin-like domain without the N-terminus may be less stable. However, we find that this domain is likely as stable as actin and full-length Arp53D based on Western blot analyses.

259: suggest adding: 'within our detection limits' at the end of the sentence.

We have added the suggested clause.

280: I think it is too strong to conclude that the interaction requires an actin fold. When comparing N-term-SfGFP to sfGFP fused to all of Arp53D I think you can only conclude that the localization requires sequences in Arp53D beyond the N-terminus. Not a particular motif.

We agree with this comment. In our revision, we now propose that Arp53D’s localization requires sequences in the actin domain or the tertiary structure of the actin domain.

294: I would find it clearer as:.… changes in SOD2, an essential gene that is located upstream of Apr53D.

We thank the reviewer and have edited the sentence as suggested.

301: in the reverse of my interpretation-suggestion, any lack of phenotype of the KO could reflect some redundancy among Arps.

We agree this may be the case in males (also suggested by Reviewer #1) and have added this possibility in our revision.

413: I did not understand your phrase "the maternal source of Arp53D is unclear". Doesn't the previous RNAseq data detecting it in ovaries, in combination with the maternal effect, suggest that it is expressed egg chambers?

We apologize for this awkward phrasing. We were trying to make the same point as the reviewer that the maternal effect suggests that Arp53D must be expressed in egg chambers or somatically required for some aspect of egg maturation and post-fertilization development, yet we and others find only weak levels of expression. We now include additional RT-PCR analyses of Arp53D in dissected ovaries to confirm that Arp53D is indeed expressed, albeit weakly, in ovaries (Supplementary Figure S7B).

699: suggest rewording to: For heat-stress experiments…

We have changed the wording as suggested.

Reviewer #2 (Significance (Required)):A new and significant finding from several perspectives: the role and localization of a newly-evolved Arp, the evolutionarily-interesting case of a gene that is beneficial in some contexts and not in others. A strong and new addition to the exciting field of gene birth/death.

We thank the reviewer for the favorable evaluation of this work’s significance.

Audience: evolutionary biologists, reproductive biologists, Drosophila geneticists, and cell biologists (among others) will be interested in this paper.

My expertise is in the first three areas just noted.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

Summary:

The manuscript describes the role of atypical actin related protein Arp53D in Drosophila spermatogenesis and reproductive fitness. The gene is highly conserved and expresses at a relatively higher level in the male gonad. Phylogenetic analysis suggested that the gene enveloped relatively late during the specification of Drosophila genus. The authors show that Arp53D knock-out is homozygous viable and mutant males have enhanced fertility. Although the protein localizes at the fusome and investment cone during sperm development, it appeared to be totally redundant for spermatogenesis. Therefore, to understand the reason for its conservation, the authors estimated the maternal and zygotic roles of Arp53D during embryonic development. Arp53D mRNA is enriched in the early stage embryos and the viability of the flies lacking the maternal supply of the protein are susceptible to heat stress at 29C during embryonic development. Thus, the authors conclude that maternal Arp53D is essential to safeguard gastrulation under heat stress, which is the reason for its conservation. The data presentation is top class, experiments are rigorously performed with all appropriate controls, and the reagents are fully characterized. Overall, it is a solid piece of work which raised several intriguing questions.

We thank the reviewer for the positive comments about our work and its impact.

Major Comment:

1) The manuscript lacks focus. It appeared to address two totally disconnected question -a) what is the role of Arp53D in sperm development and b) why it is conserved in Drosophila? It provides and extensive cell biology characterization of Arp53D localization during spermatid development and a rigorous genetic analysis of the fertility and survival phenotype. However, the causal link between these two data sets are rather tenuous. Hence, the first part of the manuscript is disconnected form the second part. The cause of the enhanced fertility of Arp53D-KO males remained unclear. Similarly, the reason behind reduced survival under heat stress and maternal input of Arp53D has not been investigated.

We appreciate the reviewer’s concern. Although it would appear that this seems like a two-part story, in fact it accurately portrays the logical progression in our functional dissection of Arp53D. For example, its high testis-specific expression logically led us to cytological characterization in the testes, while our unexpected finding that genetic ablation leads to increased male fertility eventually led to our discovery of a maternal-zygotic role for this protein in embryonic viability and development. Furthermore, our cytological characterization in the testes also allowed us to identify the importance of Arp53D’s unusual N-terminal tail in functional diversification.

We also agree with the reviewer’s criticism that the nature of enhanced fertility and reduced survival was not fully elucidated in the previous version. We have now added substantial new experiments for both of these. We show that the increased male fertility of Arp53D-KO males may be due to accelerated sperm production (Figure 5C-D), whereas the decreased embryonic survival of Arp53D-KO embryos upon heat stress is correlated with an increase in nuclear abnormalities and a ‘nuclear fallout phenotype,’ in which more damaged nuclei are removed from the Drosophila epithelium in Arp53D-KO than in WT embryos (Figure 9B-E). The molecular dissection of these traits is of high interest to us, but beyond the scope of the present study.

2) Arp53D protein is absent from the ovary and the mRNA is present in early embryo. Its unclear why the author did not look for the presence of Arp53D mRNA in ovary and the protein in the embryo. The RT-PCR data of the whole fly could be misleading.

We agree with these comments. In our revision, we now include RT-PCR analyses on dissected ovaries to show unambiguous expression of Arp53D in ovaries (Supplementary Figure S7B), consistent with published RNA-seq data. Our efforts at characterizing sfGFP-Arp53D in early embryos have been stymied due to high levels of autofluorescence and current lack of information about the developmental stage at which Arp53D protein is expressed.

3) What is the underlying cause of enhanced fertility – increased sperm production of fertilization efficiency? An in depth analysis of the Arp53D-KO phenotype in the testis in terms of the progression of investment cones or the number of intact nuclei bundle at the base of the testis could help to highlight the role of Arp53D in spermatogenesis. Similarly, sperm motility/total sperm estimate in spermatheca may help to suggest whether the mutant sperm has higher fidelity.

We agree and have now performed further cytological analyses of the Arp53D-KO testis. We found that Arp53D KOs do not appear to have significantly more sperm in the seminal vesicle than WT flies, inferred by measuring the size of the seminal vesicle (Supplementary Figure S5F-G). However, KO testes exhibit more cysts that are undergoing individualization than WT testes, suggesting KO sperm production is accelerated (Figure 5C-D) and likely increases male fertility.

4) The role of maternal and zygotic Arp53D in embryonic development needs to be investigated.

For our revision, we have conducted a cytological analysis of the KO embryos to identify an increased degree of nuclear damage. A full mechanistic understanding of these defects will require new tools and will be a substantial undertaking. We hope the reviewer agrees this is beyond the scope of the present study.

5) Transgenic rescue of the phenotypes described in Figure 5 and 6 is essential. How do the author rule out loss of neighboring gene functions in the KO flies? Arp53D coding region is close to the SOD2 5' and an insertion/deletion of this region may disrupt SOD2 expression.

We agree with this comment and have made substantial efforts to demonstrate transgenic rescue; see response to Reviewer 1 major point 1. We note that SOD2 expression is not disrupted upon deletion of the Arp53D locus (see Supplemental Figure S4D). Moreover, SOD2 is not required for embryonic development but only for adult survival (Mukherjee et al., 2011).

Minor comment:

1) The fusome on elongated spermatids morphs into a spectrin cap and promotes membrane extension. Does Arp53D enrichment continue at this stage?

Arp53D enrichment does appear to be stably maintained at spectrin when spermatids are fully elongated.

2) The pictures of intact IC in Arp53D-KO testis would be useful to highlight the role of the protein or the lack of it in sperm-individualization.

We agree. We have imaged actin cones and have found that the KO has significantly more actin cones than WT. We have included this data in Figure 5C-D.

3) The introduction could revised to focus on the competition between male fidelity and embryonic development in the gene evolution.

We appreciate the suggestion. Since we do not have a priori information implicating Arp53D in embryonic development, we expand on this more in the revised Discussion.

4) What is the basis of the term 'rapidly evolving' used in the title. The data suggest that Arp53D is Drosophila clade-specific gene.

Based on another reviewer comment, we have revised the title for the paper, which no longer includes ‘rapidly-evolving.’ This term comes from our implementation of the McDonald-Kreitman test, which indicates that Arp53D is evolving under positive selection in D. melanogaster (Supplementary Figure S1C).

Reviewer #3 (Significance (Required)):

Significance:

One of the strongest part of this manuscript is the attempt to correlate the cell biology of actin polymerization with evolution. One of the most exciting proposition highlighted by this manuscript – Apr53D provides an evolutionary fitness by protecting embryonic development under stress.

We thank the reviewer for this positive evaluation, and we agree the strength of the work lies in the evolutionary perspective of Arp53D and how diversification of actin has led to novel roles in development. We hope that our additional experimental analyses have suitably addressed their criticisms.

Existing knowledge:

No such literature on Arp53D is found in PubMed.

Audience:

The manuscript will be appreciated by the evolutionary biologists for its unusual linkage to Actin related protein, the peculiar adverse effect on male fertility, and supportive role in embryonic development.

We thank the reviewer for this positive summary.

Reviewer Competence:

This reviewer has first-hand expertise on the cell biology of Drosophila spermatogenesis, actin dynamics and embryonic development. The knowledge of the reproductive fitness is secondary, derived from the literature survey.

https://doi.org/10.7554/eLife.71279.sa2

Article and author information

Author details

  1. Courtney M Schroeder

    Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    court.mschroeder@gmail.com
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4526-8321
  2. Sarah A Tomlin

    1. Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, United States
    2. Howard Hughes Medical Institute, Fred Hutchinson Cancer Research Center, Seattle, United States
    Contribution
    Data curation, Formal analysis, Supervision, Investigation, Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
  3. Isabel Mejia Natividad

    1. Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, United States
    2. Howard Hughes Medical Institute, Fred Hutchinson Cancer Research Center, Seattle, United States
    Contribution
    Data curation, Formal analysis, Investigation
    Competing interests
    No competing interests declared
  4. John R Valenzuela

    Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, United States
    Contribution
    Data curation, Formal analysis, Investigation
    Competing interests
    No competing interests declared
  5. Janet M Young

    Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, United States
    Contribution
    Software, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8220-8427
  6. Harmit S Malik

    1. Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, United States
    2. Howard Hughes Medical Institute, Fred Hutchinson Cancer Research Center, Seattle, United States
    Contribution
    Conceptualization, Supervision, Funding acquisition, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6005-0016

Funding

Jane Coffin Childs Memorial Fund for Medical Research (Postdoctoral fellowship)

  • Courtney M Schroeder

National Institute of General Medical Sciences (K99GM137038)

  • Courtney M Schroeder

National Institute of General Medical Sciences (R01GM074108)

  • Harmit S Malik

Howard Hughes Medical Institute

  • Harmit S Malik

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Grace Yuh Chwen Lee for help with the initial McDonald-Kreitman analyses and Ching-Ho Chang for help with RNA-seq analysis. We thank Susan Parkhurst and Barbara Wakimoto for providing fly lines and technical advice and Akhila Rajan for allowing us to use her 29°C room for critical experiments. We also thank Mollie Manier for offering dissection protocols and helpful discussions about Arp53D-KO phenotypes, Leslie Vosshall for providing anti-Androcam antibodies, Kathleen Beckingham for discussing potential co-localization of Androcam and Arp53D, and Lynn Cooley and Christian Lehner for providing the topi-Gal4 fly line. Lastly, we thank Ching-Ho Chang, Lisa Kursel, Antoine Molaro, and Pravrutha Raman for providing comments on the manuscript as well as the rest of the Malik lab for useful discussions and especially Aida de la Cruz for Drosophila training. This work was funded by the Jane Coffin Childs Memorial Fund (CMS), an NIGMS K99 Pathway to Independence Award 1K99GM137038-01 (CMS), NIGMS grant R01GM074108 (HSM), and the Howard Hughes Medical Institute (HSM). HSM is an Investigator of the Howard Hughes Medical Institute.

Senior and Reviewing Editor

  1. Utpal Banerjee, University of California, Los Angeles, United States

Publication history

  1. Received: June 16, 2021
  2. Accepted: June 20, 2021
  3. Version of Record published: July 20, 2021 (version 1)

Copyright

© 2021, Schroeder et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 736
    Page views
  • 56
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cell Biology
    2. Immunology and Inflammation
    Ziwei Yang et al.
    Research Article

    Upon viral RNA recognition, the RIG-I signalosome continuously generates IFNs and cytokines, leading to neutrophil recruitment and inflammation. Thus, attenuation of excessive immune and inflammatory responses is crucial to restore immune homeostasis and prevent unwarranted damage, yet few resolving mediators have been identified. In the present study, we demonstrated that RTN3 is strongly upregulated during RNA viral infection and acts as an inflammation-resolving regulator. Increased RTN3 aggregates on the endoplasmic reticulum and interacts with both TRIM25 and RIG-I, subsequently impairing K63-linked polyubiquitination and resulting in both IRF3 and NF-κB inhibition. Rtn3 overexpression in mice causes an obvious inflammation resolving phenomenon when challenged with VSV, Rtn3-overexpressing mice display significantly decreased neutrophil numbers and inflammatory cell infiltration, which is accompanied by reduced tissue edema in the liver and thinner alveolar interstitium. Taken together, our findings identify RTN3 as a conserved negative regulator of immune and inflammatory responses and provide insights into the negative feedback that maintains immune and inflammatory homeostasis.

    1. Cell Biology
    2. Developmental Biology
    Emir E Avilés-Pagán et al.
    Research Advance Updated

    Control of mRNA translation is a key mechanism by which the differentiated oocyte transitions to a totipotent embryo. In Drosophila, the PNG kinase complex regulates maternal mRNA translation at the oocyte-to-embryo transition. We previously showed that the GNU activating subunit is crucial in regulating PNG and timing its activity to the window between egg activation and early embryogenesis (Hara et al., 2017). In this study, we find associations between GNU and proteins of RNP granules and demonstrate that GNU localizes to cytoplasmic RNP granules in the mature oocyte, identifying GNU as a new component of a subset of RNP granules. Furthermore, we define roles for the domains of GNU. Interactions between GNU and the granule component BIC-C reveal potential conserved functions for translational regulation in metazoan development. We propose that by binding to BIC-C, upon egg activation GNU brings PNG to its initial targets, translational repressors in RNP granules.