Physiological TLR4 regulation in human fetal membranes as an explicative mechanism of a pathological preterm case

  1. Corinne Belville
  2. Flora Ponelle-Chachuat
  3. Marion Rouzaire
  4. Christelle Gross
  5. Bruno Pereira
  6. Denis Gallot
  7. Vincent Sapin
  8. Loïc Blanchon  Is a corresponding author
  1. Team ‘Translational approach to epithelial injury and repair’, iGReD, Université Clermont Auvergne, France
  2. CHU Clermont-Ferrand, Biostatistics unit (DRCI) Department, France
  3. CHU Clermont-Ferrand, Obstetrics and Gynaecology Department, France
  4. CHU Clermont-Ferrand, Biochemistry and Molecular Genetic Department, France

Abstract

The integrity of human fetal membranes is crucial for harmonious fetal development throughout pregnancy. Their premature rupture is often the consequence of a physiological phenomenon that has been exacerbated. Beyond all the implied biological processes, inflammation is of primary importance and is qualified as ‘sterile’ at the end of pregnancy. In this study, complementary methylomic and transcriptomic strategies on amnion and choriodecidua explants obtained from the altered (cervix zone) and intact fetal membranes at term and before labour were used. By cross-analysing genome-wide studies strengthened by in vitro experiments, we deciphered how the expression of toll-like receptor 4 (TLR4), an actor in pathological fetal membrane rupture, is controlled. Indeed, it is differentially regulated in the altered zone and between both layers by a dual mechanism: (1) the methylation of TLR4 and miRNA promoters and (2) targeting by miRNA (let-7a-2 and miR-125b-1) acting on the 3’-UTR of TLR4. Consequently, this study demonstrates that fine regulation of TLR4 is required for sterile inflammation establishment at the end of pregnancy and that it may be dysregulated in the pathological premature rupture of membranes.

Editor's evaluation

This paper sheds light on mechanisms regulating TLR4 expression in fetal membranes.

https://doi.org/10.7554/eLife.71521.sa0

Introduction

Placenta and fetal membranes are extra embryonic tissues that are originally formed by trophoblastic cell differentiation. Although these organs are transitory, their integrities throughout pregnancy are essential for harmonious in utero fetal development. Protecting the fetus (which is considered a semiallogeneic graft), fetal membranes are composed of amnion and chorion, creating a 0.5 mm thick layer surrounding the amniotic cavity. They are important for the protection of the fetus against infections ascending the genital tract and for the initiation of programmed term rupture (Joyce et al., 2009; Kendal-Wright, 2007). The site of rupture is a particular and unique zone of altered morphology (ZAM) situated around the cervix (McLaren et al., 1999; McParland et al., 2003), which, along with a zone of intact morphology (ZIM), presents specific histological and cellular characteristics (El Khwad et al., 2006; Mauri et al., 2013; de Castro Silva et al., 2020). Furthermore, these processes lead to the emergence of a phenomenon called ‘sterile inflammation’, which occurs because of the release of numerous DAMP (damage-associated molecular pattern) molecules, such as HMGB1, the S100 protein family and HSPs (Zindel and Kubes, 2020), all of which provoke the release of proinflammatory cytokines (Gomez-Lopez et al., 2014).

Dysregulation of the fetal membrane’s integrity or premature activation of inflammatory pathways could lead to preterm premature rupture of membranes (PPROM), which is usually defined when occurring before 37 weeks of gestation and encountered in 1–3% of all births (Waters and Mercer, 2011). This is associated with a high mortality rate and significant morbidity in newborn survivors because of fetal prematurity and maternal complications (Goldenberg et al., 2008). Both sterile intra-amniotic inflammation and intra-amniotic infections (Gram-negative bacteria) are the causes for PPROM pathology, whereas transcriptomic profiles could be different (Konwar et al., 2018; Motomura et al., 2021; Musilova et al., 2015; Romero et al., 2006). Nevertheless, they share common cellular actors, such as surface-expressed pattern recognition receptors, as the innate components of the immune system, including the most frequently described toll-like receptor (TLR) family (Kawai and Akira, 2010; Newton and Dixit, 2012).

To better understand the physiological and pathological rupture of membranes, the molecular study of global changes in gene expression can be accomplished using high-scale technical analyses (Eidem et al., 2015; Haddad et al., 2006; Han et al., 2008; Kawai and Akira, 2010; Li et al., 2011; Lim et al., 2012). Surprisingly, only one unique transcriptome study focused on the ZIM or ZAM regions and amnion and chorion tissues, characterising a specific differential expression in a spontaneous rupture at term with labour; in the study, differences were observed in the chorion, though not in the amnion, specifically involving biological processes, such as extracellular matrix–receptor interaction and inflammation (Nhan-Chang et al., 2010). In addition to classical direct gene regulation by transcription factors, DNA methylation is another well-known epigenetic mechanism that can interfere with the transcriptional regulation of all RNA types. This has only been investigated in one study on the amnion methylation status between labour and nonlabour explants (Kim et al., 2009; Kim et al., 2013).

The purpose of our study is to exhaustively combine and correlate methylomic and transcriptomic analyses between ZIM and ZAM in the case of ‘sterile inflammation’. By cross-analysing our genome-wide studies, our objectives are to explain the different levels of gene expression by comparing the amnion/choriodecidua and the ZIM/ZAM. At term without labour (to avoid contraction influence and bacteria contamination at parturition), here by classifying genes into specific biological processes, we demonstrated that toll-like receptor 4 (TLR4), which is classically involved in the recognition of Gram-negative bacteria and that triggers an inflammatory response in chorioamnionitis leading to PPROM (Medzhitov et al., 1997; Poltorak et al., 1998), was overexpressed in the ZAM choriodecidua compared with the ZAM amnion. The mechanisms implying TLR4 in the physiological or pathological rupture of membrane in case of PPROM are well known. Triggering TLR4 will lead to NF-κB activation, leading to an increase of the release of proinflammatory cytokine, concentration of matrix metalloprotease and prostaglandin, which are well established actors of fetal membrane rupture (Robertson et al., 2020). Furthermore, we discovered that TLR4 regulation leads to layer and zone specificity. The latter occurred because of the hypomethylation of the TLR4 gene body in the ZAM choriodecidua, whereas its weak expression in the ZAM amnion layer was a direct consequence of the action of two hypomethylated miRNAs targeting the 3-UTR of TLR4: let-7a-2 and miR-125b-1. Therefore, the physiological choriodecidual overexpression of TLR4 could be exacerbated in PPROM, leading to the enhancement of the first step of early fetal membrane rupture.

Results

Methylomic analysis of fetal membranes allows for defining the Gene Ontology classification for the ZAM

After identifying the differentially hypermethylated genes between the amnion and choriodecidua on the whole genome between the ZIM and ZAM (Figure 1A), biological process analysis was performed; this has been represented by a four-way Venn diagram (Figure 1B). If the hypermethylated genes were clearly lower in the ZIM (1746 genes) than the ZAM (9830 genes), the specific genes only found in the ZIM (hyper- or hypomethylated; total number 98 [i.e., 10 + 88, as illustrated by black circles]) did not exhibit any statistically significant result (p-value < 0.01 with Bonferroni correction). In contrast, the specific genes modified in terms of methylation for the ZAM (total number 5750 [i.e., 3379 + 2371, as illustrated by white circles]) led to the discovery of the numerous biological processes detailed in Figure 1C. Specifically, the number of characterisations of an enrichment in Gene Ontology (GO) term IDs were clearly more concentrated and, thus, were more biologically significant in the case where a definite gene was more methylated in the amnion than in the choriodecidua (mA> mC). The biological process term IDs containing the most important gene number were the G protein-coupled receptor signalling pathways (such as for defence response, detection of stimulus or inflammatory response), which could be linked to sterile inflammation and the onset of parturition related to fetal membrane ruptures.

Differential cytosine methylation analysed for the zone of intact morphology (ZIM) and zone of altered morphology (ZAM).

(A) Genes affected by differential methylation between the amnion and choriodecidua, separately studied for the ZIM (left) and ZAM (right). (B) Four-way Venn diagram representing the number of genes with hypermethylated cytosines in the ZIM and ZAM according to methylomic analyses. mA> mC: a specific gene was more methylated in the amnion than in the choriodecidua. mA< mC: a specific gene was less methylated in the amnion than in the choriodecidua. (C) Gene Ontology (GO) term classifications for genes observed specifically in the ZAM: mA> mC (left panel) and mA< mC (right panel). Bonferroni correction was conducted for p-values < 0.01.

Transcriptomic analysis of fetal membranes in the ZAM is more relevant for downregulated genes in the amnion compared with the choriodecidua

To supplement the results obtained from methylome analysis, a transcriptomic study using the same samples was performed for the ZAM to compare the differences in gene expression between the amnion and choridecidua. We observed that 501 and 145 genes specific to the ZAM were down- and upregulated, respectively, when the expression levels were compared between the amnion and choriodecidua (a log2-fold change [FC] cut-off lower or higher than 2.8 [Figure 2, middle panel, Supplementary file 1c]).

Transcriptomic assay analysed for the zone of altered morphology (ZAM) in fetal membranes.

(A) Volcano plots represent the log10-adjusted p-values vs. the log2-fold change (FC). Up- and downregulated genes are shown in red and blue, respectively, limited bylog2 FC = 2.8. They are classified in a four-way-Venn diagram representing the gene numbers in zone of intact morphology (ZIM) and ZAM analyses withlog2 FC = 2.8. (B) Gene Ontology (GO) term classifications are shown for genes expressed only in the ZAM for log2 FC <2.8 (Bonferroni correction for p-values < 0.01). (C) GO term classifications are shown for genes expressed only in the ZAM for log2 FC >2.8 (uncorrected p-value < 0.01).

Analysis of the genes less expressed in the amnion than in the choriodecidua (i.e., log2 FC <2.8) underlined two statistically significant GO terms: response to external stimulus and female pregnancy (Figure 2, top panel). In the case where genes were more expressed in the amnion than in the choriodecidua (i.e., log2 FC >2.8), the biological processes exhibited no statistically significant result (p-value < 0.01 with Bonferroni correction). Analyses undertaken with uncorrected p-values did not provide relevant information because conventional tissue development or ossification was observed (Figure 2, bottom panel).

Combination of transcriptomic and methylomic results in the ZAM demonstrate that genes more expressed in the choriodecidua are linked to pregnancy pathologies

By cross-analysing the results obtained from the two preceding analyses (methylome and transcriptome), a total of 26 genes were hypermethylated in the choriodecidua, and more were expressed in the amnion (Supplementary file 1d). Biological process (GO term) analysis was not significant, which is likely because of the small number of studied genes and because the underlying generic processes were linked only to urogenital abnormalities, not to pathological pregnancy, as confirmed by the MeSH disease terms (Supplementary file 1e).

Conversely, 105 genes were hypermethylated in the amnion and were more expressed in the choriodecidua (Figure 3A and Supplementary file 1f); they could be classified as MeSH disease terms linked directly to pregnancy pathologies, such as placenta diseases (trophoblastic neoplasms, pre-eclampsia, fetal growth retardation, or placenta accreta), female urogenital diseases, and pregnancy complications (Supplementary file 1g). GO term analysis clearly identified three complementary pathways: response to external stimulus, detection of LPS, and inflammatory response. Interestingly, fetal membranes were sensitive to external stimuli, such as Gram-negative bacterial molecules and LPSs, in relation to the inflammatory response. Of all the genes classified in these processes, TLR4 was the only one represented in all these biological processes and, therefore, seems to play a central role in parturition at term. To validate this in silico observation and pave the way for describing TLR4’s importance, immunofluorescence experiments were first conducted to confirm the protein’s presence in the amnion and choriodecidua of the ZAM (Figure 3B). Considering the important role of TLR4 in sterile (regarding HMGB1 release) (Bredeson et al., 2014) or pathological inflammation (chorioamnionitis) (Robertson et al., 2020), the remainder of the study focused on the characterisation and regulation of TLR4 expression in fetal membranes, as ascertained by cross-analysis of the methylomic and transcriptomic results.

Common genes observed between the mA> mC methylomic results and choriodecidua/amnion transcriptomic analysis in the zone of altered morphology (ZAM).

(A) Gene Ontology (GO) terms’ representative distribution and their log10 p-values are shown for the 105 common genes across both genome-wide studies. (B) Representative TLR4 immunofluorescence (green staining) in the ZAM of fetal membranes in confocal analyses. Cell nuclei were visualised with Hoechst (blue) staining. A negative control was used without a primary antibody. Slides were observed at ×250 magnification for total fetal membranes (left and right): scale bar: 50 µm and ×400 for the amnion (middle): scale bar: 20 µm.

Figure 3—source data 1

Raw data for toll-like receptor 4 (TLR4) immunofluorescence in the fetal membranes by confocal microscopy.

https://cdn.elifesciences.org/articles/71521/elife-71521-fig3-data1-v1.zip
Figure 3—source data 2

Raw data for toll-like receptor 4 (TLR4) immunofluorescence in the amnion by confocal microscopy.

https://cdn.elifesciences.org/articles/71521/elife-71521-fig3-data2-v1.zip
Figure 3—source data 3

Raw data for toll-like receptor 4 (TLR4) immunofluorescence in the fetal membranes by confocal microscopy(negative control).

https://cdn.elifesciences.org/articles/71521/elife-71521-fig3-data3-v1.zip

The tissue specificity of TLR4 regulation at the end of pregnancy in the weak ZAM is because of hypermethylation in the amnion

Focusing on the TLR4 genomic zone, five cytosines distributed on the promoter, body, and UTR were studied using a methylomic array. The statistical study of the cytosine methylation β-values of the nine genomic DNA samples demonstrated that the five cytosines were hypermethylated in the amnion compared with the choriodecidua (Figure 4A). These results were confirmed by the bisulfite treatment and enzymatic digestion (taking advantage of the Taq I restriction site present only in this CpG zone) of the amnion and choriodecidua samples, here with a focus on only one cytosine: cg 05429895 (Figure 4B). Furthermore, of the nine RNA samples, the link between methylation and expression revealed by the methylomic and transcriptomic arrays was confirmed by quantitative RT-PCR (qRT-PCR) (Figure 4C) and Western blot (Figure 4D) analyses, showing a higher expression of TLR4 in the choriodecidua than in the amnion (mRNA fold: 40.65 and protein fold: 4.04).

The expression level of the toll-like receptor 4 (TLR4) gene is related to its cytosine methylation level in the amnion and choriodecidua from the zone of altered morphology (ZAM).

(A) The median ± interquartile ranges of the DNA methylation levels of the five cg probes on the TLR4 gene in the amnion and choriodecidua ZAMs. Each dot represents the individual β-value for one patient (n = 9). The probe set with significant differential methylation between the amnion and choriodecidua (Wilcoxon matched-pairs signed-rank test) is designated by an asterisk (**p-value < 0.01). (B) Control of the difference of methylation for the cg 05429895 between the amnion and choriodecidua after digestion with Taq I PCR products (438 bp) obtained after DNA bisulfite treatment. This probe, after being methylated in the amnion, was sensitive to Taq I and gave two fragments after digestion: 307 and 131 bp. (C) Relative expression of TLR4 transcripts for the nine samples of choriodecidua ZAM were significantly higher than for the amnion ZAM (Wilcoxon matched-pairs signed-rank test *p-value < 0.05). (D) The TLR4 protein was significantly overexpressed for the nine samples in the choriodecidua compared with the amnion (Wilcoxon matched-pairs signed-rank test *p-value < 0.05).

Figure 4—source data 1

Data on β-value for cg probes on the toll-like receptor 4 (TLR4) gene for Figure 4A.

https://cdn.elifesciences.org/articles/71521/elife-71521-fig4-data1-v1.xlsx
Figure 4—source data 2

Uncropped polyacrylamide gel for Figure 4B.

https://cdn.elifesciences.org/articles/71521/elife-71521-fig4-data2-v1.zip
Figure 4—source data 3

Quantitative RT-PCR (qRT-PCR) data and Western blot data for toll-like receptor 4 (TLR4) expression (Figure 4C).

https://cdn.elifesciences.org/articles/71521/elife-71521-fig4-data3-v1.xlsx

The tissue specificity of TLR4 regulation could be because of miRNA action

Because gene expression can also be regulated post-transcriptionally by the action of mi-RNA, it would be interesting to perform in silico analysis of differentially methylated miRNA (linked to TLR4) between the amnion and choriodecidua. The results showed that two miRNA (let-7a-2 and miR-125b-1) could target the 3’UTR region of TLR4 mRNA (Figure 5A). Focusing on these, all the cytosines studied on the methylomic chip were situated in the 5’ upstream miRNA sequence. Five of these six were statistically significant for overmethylation in the choriodecidua compared with the amnion for miR-125b-1 and for the unique one in let-7a-2 (Figure 5B upper and bottom panel). Using the same samples previously used for the quantification of mRNA TLR4, the expression of each pri-miRNA by qRT-PCR was checked. As expected, an overexpression of pri-miR-125b-1 was observed in the amnion compared with the choriodecidua (FC: 5.32). A weak basal expression level below the detection limit of the qPCR assay for pri-let-7a-2 did not allow for obtaining results that could reasonably be analysed (Figure 5C).

Two miRNAs potentially targeting the human 3’UTR-TLR4 (toll-like receptor 4) are differentially methylated in the zone of altered morphology (ZAM) between the amnion and choriodecidua.

(A) In silico computational target prediction analysis using TargetScan of the human 3’UTR-TLR4. This zone may be targeted by gene coding for MIR125B1 and LET7A2. (B) The median ± interquartile ranges of the DNA methylation cg probe levels for the MIR125B1 (top) and LET7A2 (bottom) genes for the nine samples in the amnion and choriodecidua ZAM. Each dot represents the individual β-value for one patient. The probe set with significant differential methylation between the amnion and choriodecidua (Wilcoxon matched-pairs signed-rank test) is designated by an asterisk (**p-value < 0.01, NS = not significant). (C) The relative expression of pri-miR-125b-1 (n = 9) and pri-let-7a-2 (n = 5) was determined. qRT-PCR experiments performed for each zone; tissue demonstrated that pri-miR-125b-1 was significantly overexpressed in the amnion compared with the choriodecidua ZAM, as expected from the differential methylation status (Wilcoxon matched-pairs signed-rank test *p-value < 0.05). The pri-let-7a-2 amount could not be rigorously determined (ND) in the choriodecidua.

Figure 5—source data 1

Data on β-value for cg probes on the MIR125B1 and LET7A2 genes for Figure 5B.

https://cdn.elifesciences.org/articles/71521/elife-71521-fig5-data1-v1.xlsx
Figure 5—source data 2

Quantitative RT-PCR (qRT-PCR) data for pri-miR-125b-1 and pri-let-7a-2 (Figure 5C).

https://cdn.elifesciences.org/articles/71521/elife-71521-fig5-data2-v1.xlsx

Let-7a-2 and miR-125b-1 target 3’-UTR-TLR4

We first established that in the human cell line HEK293 (classically used in a gene reporter assay for testing miRNA targets), both miRNAs could decrease the amount of luciferase by targeting the 3’-UTR region of TLR4 mRNA (decrease by 40% for both miRNA tested) (Figure 6A). To choose a better cellular model to test this miRNA action linked with the fetal membrane environment, the relative amount of TLR4 mRNA was determined in various human amniotic cells. Figure 6B demonstrates that AV3 (one of the three tested amniocyte cell lines when compared with FL and WISH) was the most efficient and, therefore, was used for the experiments. For the in vitro models, AV3 (Figure 6C) and primary amniotic epithelial cells (Figure 6D) were used to confirm that both miRNAs clearly targeted TLR4 mRNA or protein accumulation, respectively. For the AV3 cell line, a significant decrease in the mRNA amount was observed from 12 hr after the transfection of let-7a-2 (decrease by 3.75) and miR-125b-1 (decrease by 10.83) or the cotransfection of let-7a-2+ miR-125b-1 (decrease by 9.5). This effect persisted only for let-7a-2 at 24 hr (decrease by 1.59), confirming the mobilisation of this cellular system. Furthermore, after 24 hr of transfection, a decrease in the amount of TLR4 protein was significantly demonstrated for let-7a-2 (decrease by 1.88); this was also the case after 48 hr for miR-125b-1 (decrease by 2.54) or for both transfections of let-7a-2+ miR-125b-1 (decrease by 2.64). The use of primary cells confirmed this physiological action with a decrease in the amount of TLR4 mRNA at 48 hr after the transfection of miR-125b-1 (decrease by 1.71) and cotransfection of let-7a-2+ miR-125b-1 (decrease by 2.16) and after 72 hr for the TLR4 protein for the three conditions (let-7a-2: decrease by 1.43; miR-125b-1: decrease by 1.71; let-7a-2 and miR-125b-1: decrease by 2.16).

miR-125b-1 and let-7a-2 target the human 3’UTR-TLR4 (toll-like receptor 4) and decrease TLR4 expression.

(A) Targeting of miR-125b-1 and let-7a-2 to the human 3’UTR of TLR4 mRNA using a Luciferase Reporter Gene Assay depending on human 3’UTR-TLR4 (pMIR-3’UTR TLR4-luc). HEK293 cells cotransfected for 48 hr with this construction and expressing plasmid of human pCMV, pre-mir125b1, or let7A2 (n = 5). Luciferase activity was normalised with the pRL-TK-Renilla luciferase level (median ± interquartile range, Kruskal–Wallis test with Dunn’s multiple comparison test, *p-value < 0.05). The results showed that both miRNAs could target the 3’-UTR zone of the TLR4 gene and decrease luciferase quantity. (B) Determination of endogenous TLR4 expression levels in human cell lines (HEK293 from embryonic kidney and FL, WISH, and AV3 from amniocytes) and in primary amniocyte cells quantified by quantitative RT-PCR (qRT-PCR) (n = 6). (C) Effects of miR-125b-1, let-7a-2, and the combination miR-125b-1+ let-7a-2 on TLR4 mRNA expression (n = 10 for 12 hr and n = 8 for 24 hr, left) and TLR4 protein (n = 7, right) in AV3 cells. Cells were transfected with expressing plasmid of human pCMV, or pre-mir125b1, or let7A2 and miR-125b-1+ let-7a-2 for 12 and 24 hr for mRNA and 24 and 48 hr for protein (median ± interquartile range, Kruskal–Wallis test with Dunn’s multiple comparison test, *p-value < 0.05, **p-value < 0.01). (D) Effects of miR-125b-1, let-7a-2, and the combination miR-125b-1+ let-7a-2 on TLR4 mRNA expression (n = 7 at least, left) at 48 hr and TLR4 protein (n = 5 at least, right) at 72 hr in primary amniocyte cells (median ± interquartile ranges, Kruskal–Wallis test with Dunn’s multiple comparison test, *p-value < 0.05, **p-value < 0.01, ***p-value < 0.001).

Figure 6—source data 1

Data on luciferase activity in HEK293 cells transfected with pMIR-3’UTR toll-like receptor 4 (TLR4)-luc and pre-mir125b1 or let7A2 (Figure 6A).

https://cdn.elifesciences.org/articles/71521/elife-71521-fig6-data1-v1.xlsx
Figure 6—source data 2

Quantitative RT-PCR (qRT-PCR) data for toll-like receptor 4 (TLR4) expression in Figure 6B.

https://cdn.elifesciences.org/articles/71521/elife-71521-fig6-data2-v1.xlsx
Figure 6—source data 3

Quantitative RT-PCR (qRT-PCR) data and Western blot data for toll-like receptor 4 (TLR4) expression in AV3 cells transfected with pre-miRNA (Figure 6C).

https://cdn.elifesciences.org/articles/71521/elife-71521-fig6-data3-v1.xlsx
Figure 6—source data 4

Quantitative RT-PCR (qRT-PCR) data and Western blot data for toll-like receptor 4 (TLR4) expression in amniocytes transfected with pre-miRNA (Figure 6D).

https://cdn.elifesciences.org/articles/71521/elife-71521-fig6-data4-v1.xlsx

Discussion

Worldwide, preterm birth is a serious medical problem, particularly when it comes to its long-term consequences throughout the entire life of premature infants. PPROM represents one-third of pregnancies that end prematurely and principally depends on an early scale and the kinetic activation of inflammation, signalling a cascade in gestational tissues.

Because the inflammatory mechanisms of preterm and term birth are broadly similar, understanding how human fetal membranes are prepared for their physiological rupture is essential and could be a molecular mechanism abnormally exacerbated during PPROM. Studies have partially documented and established that a weak zone (ZAM) situated in the cervix zone emerges at the end of the 9-month gestation period (McLaren et al., 1999) as a direct consequence of global layer disorganisation and weakening. All of these phenomena are key determinants of a rupture and could be directly linked to a common denominator: the regulation and modification of gene expression levels (Romero et al., 2006). For the first time, a complementary high-throughput approach was applied by performing both transcriptomic and methylomic analyses of the same samples. Moreover, one strength of our work is highlighting both the global geographical (ZIM/ZAM) and tissue layer (amnion vs. choriodecidua) differences in terms of DNA methylation and gene expression.

Indeed, our methylomic study established a global profile of fetal membranes in the ZIM and ZAM samples. The number of hypermethylated genes in the amnion or choriodecidua was more important in the ZAM than in the ZIM; this allowed us to perform a GO term classification focused on the ZAM, where cell adhesion, response to a stimulus, tissue development, and reproductive processes are significantly represented. We found some similarities with transcriptomic analysis, where overexpressed genes in the choriodecidua ZAM were linked to biological adhesion (important in tissue integrity), regulation of cell proliferation, extracellular matrix organisation, and responses to internal and external stimuli.

By cross-analysing both methods for the ZAM, a link for the 105 genes overexpressed in the choriodecidua and hypomethylated in the amnion with MeSH disease terms (e.g., pregnancy complication) was revealed. Especially in GO terms, these highlighted processes could be directly linked to preparation for parturition through a sterile inflammation cascade. We then turned our attention to TLR4, a major mediator of inflammation, for the following reasons: First, this upstream gatekeeper of innate immune activation was the only gene appearing in each of the considered GO terms, as illustrated in Figure 3A. Second, it is an important partner of many other genes included in our list of 105 genes (see Figure 3B). Third, TLR4 was already known to be expressed in the fetal membranes and cervices of animals (Gonzalez et al., 2007; Harju et al., 2005; Moço et al., 2013) and to play a role as a key regulator in a sterile or septic inflammatory reaction in response to aggression by a pathogen-associated molecular pattern/DAMP, which leads to PPROM (Chin et al., 2016; Li et al., 2010; Patni et al., 2007; Wang and Hirsch, 2003). Fourth, TLR4 is also known to be involved in parturition in the classical term of pregnancy, activating a sterile inflammation cascade (Choi et al., 2012; Wahid et al., 2015). Fifth, it could be considered a promising therapeutic target to prevent preterm birth through better control of its proinflammatory signalling.

According to a previous study (Krol et al., 2010)—and as confirmed by our qPCR and Western blot quantification—TLR4 was more expressed in the choriodecidua than in the amnion (Figure 4B and C). Targeting the choriodecidua is interesting because it is the first breaking layer in the different steps of the rupture of membranes (Méhats et al., 2011). This overexpression could be because of differential methylation and/or transcription factor fixations or could be a consequence of post-transcriptional regulation by miRNAs. miRNAs play crucial regulatory roles in biological and pathological processes; they are well documented in gestational tissues, such as the placenta, endometrium, and fetal membranes (Doridot et al., 2014; Gu et al., 2013; Kamity et al., 2019; Montenegro et al., 2007; Wang et al., 2016), and they have begun to be considered as potential biomarkers for pregnancy pathologies (Cretoiu et al., 2016). Indeed, studies have already shown that uninfluenced by labour, some miRNA expressions decrease in chorioamniotic membranes with gestational age (Montenegro et al., 2009; Montenegro et al., 2007). We found two miRNAs (mir-125b-1 and let-7a-2) that were hypermethylated in the choriodecidua compared with the amnion, which could potentially target TLR4 mRNA in the amnion to decrease its expression level. They were previously unknown to be able to specifically target TLR4, leading us to demonstrate the consequences of their transfection on the quantification of TLR4 mRNA and protein on the cell line AV3 or primary amniotic epithelial cells using the luciferase 3’UTR of the TLR4 reporter gene.

Surprisingly, these two miRNAs are part of an miR-100-let-7a-2 cluster host gene: MIR100HG. This cluster has never been studied in relation to the placenta or fetal membrane environment, unlike others such as C14MC, C19MC, and miR-371–3, whose expressions change during pregnancy between the whole and terminal villi (Gu et al., 2013; Morales-Prieto et al., 2013). In humans, 10 mature let-7s are synthesised and implicated in different physiological and pathological events, from embryogenesis to adult development, such as inflammatory responses and innate immunity (Roush and Slack, 2008). However, the latter finding could not be linked only to simple TLR4 targeting because both miRNAs were also already known to have implications for innate immunity by influencing not only the expression of interleukins and TNFα, but also cell senescence, which is another well-known phenomenon occurring at the end of fetal membrane life (Iliopoulos et al., 2009; Nyholm et al., 2014; Schulte et al., 2011; Tili et al., 2007).

On a global scale, the results obtained in the present study provide information regarding the implication of inflammation in the physiological rupture of fetal membranes. However, future studies are needed to exploit all the data accumulated during this work. Nevertheless, by focusing on a unique candidate—TLR4, which is a well-known actor in the physiological and pathological rupture of membranes—we have outlined the complex molecular process of gene regulation and have proposed a fetal membrane layer-specific model to better understand fetal membrane ruptures in the ZAM (Figure 7). This regulation is intriguing because it implies a double molecular mechanism of regulation (at the DNA and mRNA levels), which is apparently layer specific, though located in the same geographical area of the fetal membrane. These first results could doubtlessly be extrapolated to other genes by our high-scale studies and to gestational tissues or resident/circulating immune cells, such as neutrophils and monocytes/macrophages, which are implicated in the amplification of the inflammatory response in PPROM and physiological FM rupture (Galaz et al., 2020; Gomez-Lopez et al., 2022). Furthermore, to complete such investigations, the use of recently developed technology such as organ-on-chip will better mimic fetal–maternal communication and exchanges between tissue layer and cell types (Richardson et al., 2020).

A model for the regulation of toll-like receptor 4 (TLR4) expression in the zone of altered morphology (ZAM) of human fetal membranes.

Materials and methods

Human fetal membrane collection

Request a detailed protocol

By caesarean section, nine fetal membranes were collected at full term before labour and birth (Obstetrics Department, Estaing University Hospital, Clermont-Ferrand, France). All patients were Caucasian and presented with no pregnancy pathology (confirmed by macroscopic and microscopic placenta analyses and histological examinations that excluded chorioamnionitis). Supplementary file 1a describes the patients’ characteristics.

Four samples were collected from each patient (ZAM amnion, ZAM choriodecidua, ZIM amnion, and ZIM choriodecidua), as described by Choltus et al., 2020. Briefly, a suture sewn onto the FMs (from caesarean deliveries) in front of the cervix by the midwife allowed us to identify the ZAM; then, a 4 cm diameter circle was cut and considered the ZAM, and explants localised places away from circle boundary were considered the ZIM.

Genome-wide DNA methylation

Request a detailed protocol

Total genomic DNA from the amnion and choriodecidua was extracted using the QIAampDNA Mini Kit (Qiagen, Courtaboeuf, France), here following the manufacturer’s instructions. DNA concentration was determined by Qubit quantitation (Invitrogen, Thermo Fisher Scientific, Illkirch, France). Five hundred ng of extracted DNA was bisulfite treated using the EZ DNA Methylation kit (Proteigene, Saint-Marcel, France), following the manufacturer’s standard protocol, before being individually hybridised using HumanMethylation450 Analysis BeadChip (Illumina, San Diego, CA), which allowed for studying the 482,421 cytosines on the human genome. This array was conducted using Helixio (Saint-Beauzire, France). Specific CpG probe methylation differences between the tissues taken from the ZIM and ZAM regions or between the amnion and choriodecidua regions were analysed. To study each cytosine, methylation differences were defined as a change in β-values (Δβ) between two conditions with p-values less than 0.05 (after applying a Student’s paired t-test). The Monte Carlo method (Metropolis and Ulam, 1949) was then used to randomly stimulate the minimal (m) and maximal (M) Δβ-value for each chromosome. These limits permitted us to keep only the cytosine, in which Δβ was inferior to M or superior to M. Gene probes meeting the cut-off criteria for each comparison were submitted for Database for Gene Ontology (GO) enrichment (http://go.princeton.edu), in association with the REVIGO web server (http://revigo.irb.hr; as previously described by Supek et al., 2011) to identify the biological processes associated with the genes showing changes in methylation status.

Human GE 8 × 60 K expression arrays

Request a detailed protocol

Following the manufacturer’s instructions, total RNA was extracted using an RNeasy Mini Kit (Qiagen). RNA samples were quantified with a NanoDrop spectrophotometer (ThermoScientific, Thermo Fisher Scientific, Illkirch, France). RNA integrity was evaluated using a 2100 Bioanalyzer (Agilent Technologies, Les Ullis, France) and an RNA 6000 Nano Assay Kit. The mean RNA integrity number for all samples was 8.41.

A microarray (Sure Print G3 Human GE 8 × 60 K) was performed by Helixio (Saint-Beauzire, France) in accordance with Agilent Technologies. The data were analysed using Genespring GX 12.0 (Agilent Technologies).

The resulting gene lists from each pairwise comparison (ZIM vs. ZAM and amnion vs. choriodecidua, respectively) were filtered for the genes showing 2.8-fold changes at p < 0.01 using the Student’s–Newman–Keuls test with Benjamini–Hochberg corrections for the false discovery rates. Raw data were analysed with R (http://R-project.org) and Bioconductor (http://www.bioconductor.org) software. A generic GO term finder (http://go.princeton.edu) and REVIGO (http://revigo.irb.hr) with up- and downregulated probes were used to analyse the biological process of GO enrichment, and GePS Genomatix software (Release 2.4.0 Genomatix Software GmbH, Munich, Germany) was used for analysis of MeSH diseases (p < 0.01).

TLR4 immunofluorescent staining

Request a detailed protocol

Immunohistochemistry experiments performed on ZAM cryosections taken from the same samples (8 μm) were fixed in paraformaldehyde (4% in PBS); blocked with PBS-1X, Triton 0.1%, and SVF 10%; and incubated overnight with a monoclonal mouse anti-TLR4 antibody diluted 1:400 in PBS (Sc-293072, Santa-Cruz Biotechnology, Dallas, TX). A secondary antibody (donkey antimouse coupled with Alexa 488 Ig G [H + L]; Life Technologies, Thermo Fisher Scientific) diluted at 1:300 was incubated for 2 hr on slides. Following Hoechst nuclear staining, the samples were examined under an LSM510 Zeiss confocal microscope (Zeiss, Oberkochen, Germany). For the negative controls, sections were incubated without a primary antibody.

Bisulfite conversion and combined restriction analysis

Request a detailed protocol

Total DNA from the amnion and choriodecidua explants was bisulfite treated using an EZ DNA Methylation kit (Zymo Research, Proteigene). The converted DNA samples were used as templates for the PCR using specific primers of promoter TLR4 (containing the cytosine cg 05429895; promot-F: 5’ TTTAGAGAGTTATAAGGGTTATTT 3’; and promot-R: 5’ CTAACA TCATCCT CACTACTTC 3’). The PCR was performed using HotStart DNA Polymerase (Qiagen), and the products were digested with Taq I (New England Biolabs, Evry, France), which could recognise CpGs. Digested products were analysed on polyacrylamide gel.

Cell cultures

Request a detailed protocol

Primary amniocyte cells were collected from the amnion after trypsination and were cultured on six-well plates coated with bovine collagen type I/III (StemCell Technologies, Saint-Egrève, France), as described previously (Marceau et al., 2006; Prat et al., 2015). Human embryonic kidney (HEK) 293 cells were grown in Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS, GE Healthcare), 4 mM glutamine (Gibco), 1 mM sodium pyruvate (Hyclone), 1× nonessential amino acids (Gibco), 100 units/ml of penicillin, 100 µg/ml of streptomycin, and 0.25 µg/ml of amphotericin B (Hyclone).

Human epithelial amnion cells (AV3 cells, ATCC-CCL21; FL, ATCC-CCL62; WISH, ATCC-CCL25) were cultured in DMEM/F12 (Gibco) supplemented with 10% FBS (GE Healthcare), 4 mM glutamine (Gibco), 100 units/ml of penicillin, 100 µg/ml of streptomycin, and 0.25 µg/ml of amphotericin B (Hyclone).

Quantitative RT-PCR

Request a detailed protocol

Total RNA was isolated from the amnion, choriodecidua, human epithelial amnion cells (AV3, FL, and WISH) and primary amniocyte cells using an RNeasy Mini Kit (Qiagen) with DNAse I digestion, as described in the manufacturer’s protocol. After quantification with a NanoDrop spectrophotometer (Thermo Fisher Scientific), cDNA was synthesised from 1 μg of RNA using a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Thermo Fisher Scientific). qRT-PCRs were performed with a LightCycler 480 (Roche Diagnostics, Meylan, France) using Power SYBR Green Master Mix (Roche) and specific primers (described in Supplementary file 1b). Transcripts were quantified using the standard curve method. The ratio of interest (transcript/geometric) mean of two housekeeping genes (RPLP0 and RPS17) was determined. The results were obtained from at least six independent experiments, and all steps followed the MIQE guidelines (Bustin et al., 2009).

Western blot

Request a detailed protocol

Primary amniocyte and AV3 cells were lysed in a RIPA buffer (20 mM Tris-HCl pH = 7.5, 150 mM NaCl, 1% Nonidet P40, 0.5% sodium deoxycholate, 1 mM EDTA, 0.1% SDS, and 1× Complete Protease inhibitor cocktail (Roche)) for 30 min at 4°C. The amnion and choriodecidua samples were homogenisated, as previously described (Choltus et al., 2020). The protein concentration of the supernatant was determined using a Pierce BCA Assay Kit (Pierce). Forty µg of denaturated proteins were subjected to a Western blot analysis after 4–15% MiniPROTEAN TGX StainFree gel electrophoresis (Bio-Rad), which was followed by probing antibodies against TLR4 or β-Actin (TLR4:1:400, Sc-293072, Santa-Cruz Biotechnology, β-Actin:1:10,000, MA1-91399, Thermo Fisher Scientific). The signal was detected with a peroxidase-labelled antimouse antibody at 1:10,000 (Sc-2005, Santa-Cruz Biotechnology) and visualised with ECL or ECL2 Western blotting substrate (Pierce) using a ChemiDoc MP Imaging System and Image Lab software (Bio-Rad). The results were obtained from at least seven independent experiments, and the relative TLR4 ratio was expressed as a function of β-Actin or total protein loaded by well.

3’UTR-hTLR4 pMIR REPORT luciferase plasmid

Request a detailed protocol

The 3’UTR hTLR4 (2,223 bp, NM 138554) was amplified from 100 ng of genomic amnion DNA with 3’UTR-TLR4 primers containing Spe I restriction sites to facilitate subcloning: forward GAGAACTAGTAGAGGAAAAATAAAAACCTCCTG and reverse GAGA ACTAGTTTGATATTATAAAACTGCATATATTTA. PCR was performed with Phusion high-fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s instructions. After purification and digestion with Spe I (New England Biolabs), the fragment was subcloned into the Spe I site of the pMIR REPORT luciferase vector (Ambion, Thermo Fisher Scientific) to generate the construct pMIR-3’UTR-hTLR4. The insert sequence was checked by sequencing (Eurofins Genomics, Ebersberg, Germany).

In silico miRNA analysis

Request a detailed protocol

Putative miRNAs targeting the 3’UTR-TLR4 target gene miRNA were screened using the public database miRWalk with TargetScan, RNA22, and miRanda.

Dual-Luciferase Reporter Assays

Request a detailed protocol

HEK293 cells were cultured in six-well plates and transiently transfected at an 80–90% confluence using a Lipofectamine 3000 Transfection Kit (Invitrogen, Thermo Fisher Scientific). Each well received 100 ng of the pMIR REPORT Luciferase vector containing the 3’UTR-hTLR4 (without a negative control) in combination with 1 µg pCMV-MIR or pCMV-pre-mir125b1 (OriGene Technologies, Rockville, MD) or let7A2 generated in the laboratory and with 50 ng of pRL-TK Renilla luciferase plasmid (Promega). Briefly, the pre-let7A2 was amplified from 100 ng of genomic amnion DNA with pre-let7A2 primers containing SgfI/MluI restriction sites to facilitate subcloning: forward GAGAGCGATCGCTCGTCAACAGATATCAGAAGGC and reverse GAGAACGCGTAATGCTGCATTTTTTGTGACAATTT. PCR was performed with Advantage-HD DNA polymerase (Takara Bio, Saint-Germain-en-Laye, France), according to the manufacturer’s instructions. After purification and digestion with SgfI/MluI (New England Biolabs), the fragment was subcloned into the SgfI/MluI site of the pCMV-MIR vector to generate the construct pCMV-pre-let7A2. The insert sequence was checked by sequencing (Eurofins Genomics, Ebersberg, Germany). Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Charbonnières-les-Bains, France) 48 hr after transfection according to the manufacturer’s instructions using a Sirius luminometer (Berthold, Thoiry, France). Transfection efficiencies were normalised to the Renilla luciferase activities in the corresponding wells and reported to the control condition. Data were extracted from at least three experiments, each of which was performed in triplicate.

Transfection of primary amniocytes and AV3 cells

Request a detailed protocol

Primary amniocytes and AV3 were cultured in six-well plates. At 80–90% confluence, the cells were transiently transfected using a Lipofectamine 3000 Transfection Kit (Invitrogen, Thermo Fisher Scientific) according to the protocol with 1 µg expressing plasmid of human pCMV-pre-mir125b1, pre-let7A2, or a control (pCMV-MIR) purchased from OriGene. After 48 or 72 hr of culturing, the total RNA and proteins were collected and used for the qRT-PCR or Western blot experiments, respectively. Data were extracted from five experiments.

Statistical analysis

Request a detailed protocol

The results were analysed using PRISM software (GraphPad Software Inc, San Diego, CA). The quantitative data were presented as the medians ± interquartile ranges according to a Shapiro–Wilks test. Non-normally distributed data between the two groups were studied with a Wilcoxon matched-pairs signed-rank test for paired samples. To study several independent groups, a Kruskal–Wallis test was performed, followed by Dunn’s multiple comparison test. Values were considered significantly different at p < 0.05 (*), p < 0.01 (**) or p < 0.001 (***) throughout.

Data availability

- Term W/O labor Fetal membrane methylation status results are available at Arrayexpress :(http://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-10520). - Term W/O labor Fetal membrane mRNA expression results are available at Arrayexpress : (http://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-10516).

References

    1. Metropolis N
    2. Ulam S
    (1949) The Monte Carlo method
    Journal of the American Statistical Association 44:335–341.
    https://doi.org/10.1080/01621459.1949.10483310

Decision letter

  1. YM Dennis Lo
    Senior and Reviewing Editor; The Chinese University of Hong Kong, Hong Kong

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "TLR4 regulation in human fetal membranes as an explicative mechanism of a pathological preterm case" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by Y M Dennis Lo as the Senior Editor and Reviewing Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1. The study is highly descriptive and the authors should consider that sterile inflammation and microbe-associated inflammation induce distinct transcriptomic profiles in human fetal membranes, which was recently reported in Infect Immun. 2021 Apr 16;89(5):e00819-20. The authors could consider utilizing these publicly available data to enhance the translational value of their hypothesis.

2. There are currently available animal models of premature rupture of membranes (e.g., ultrasound-guided or mini-laparotomy). The authors should consider adding in vivo experiments to prove causality between TLR4 and rupture of membranes.

3. The authors focus on the rupture zone of the membranes, but fail to explain how the regulation of TLR4 mediates the process of membrane rupture.

4. The amnion layer is structurally different from the chorion. The chorion is infiltrated by innate immune cells during sterile and microbe-associated inflammation. The authors should consider evaluating the process of rupture of membranes in a more multi-dimensional manner, in which amnion, chorion, and immune cells are implicated.

5. The abstract, introduction and discussion would benefit from some rewriting. This would align the phraseology with English speakers, making some areas of these specific sections easier to follow.

6. Some of the text has a different color, or is highlighted and this need to be changed.

7. The data in figure 1 alludes to hypermethylated genes, using the approach is it possible to also indicate how many genes are hypomethylated? Line 135 in the results hints that this was analyzed this too.

8. Both in figures 1 and 2 many genes are shared by the ZIM and ZAM. Although these genes may not speak to the region specificity and what may be differentially occurring in the ZAM, they may inform about changes in the tissue at this gestational age globally in the tissues, will these be indicated in the supplementary data?

9. Written numerical data would improve the ability to follow the data in the results narrative and set order of magnitude context.

10. The final paragraph of the results describes the use of primary cells to confirm the decrease in TLR4 (line 236 onward) but the data is not shown. More description of the details would be helpful.

11. The data indicating the importance of TLR4 is intriguing, as is the data showing that the lower (or hypomethylated) TLR4 and MIR forms are more functional. This is summarized in figure 7 but not really discussed in the final section of the paper. This should be rectified.

12. The way in which the ZAM and ZIM regions are confirmed is not described in the methods. The reference describes the tissue collection. Were they marked or dyed in some way?

13. Abstract – Should include an objective section to the rationale for this study and how it was done.

14. One major concern is that how reliable is an examination of the transcriptome and methylome of a membrane (regardless of zone) that are from term and not ruptured. How can this be related to pathologies? Isn't it better to create an in vitro model of disease state and then examine using explants? How do authors control cervical immune cell infiltration and their impact on ZAM?

15. Introduction is way too long and misses several recent references on PPROM pathology. This section needs to be trimmed by 2/3rds and update references and provide a hypothesis and objectives.

16. Several sections are unnecessary and not accurate.

E.g. Page 5 – line117 – TLR4 is not just for E. coli but for Gram negative bacteria and E. coli infection is very rare in PPROM. Several such misleading concepts and dogmatic statements are included. Please edit them out.

Page 8 – line 156 – …..more relevant and specific – please expand and explain this better.

TLR-4 and LPS – it is not clear why authors used LPS. TLR4 is a receptor for several DAMPs and other molecules and even certain viral particles. This should be discussed and generation of DAMPs in sterile environment should be included.

Page 11; line 229 – this is not a physiologic model. Please delete.

Page 11 – lines 233 23 – it is unclear what is meant by quick action and how is this measured without a functional assay? Change in transcript alone does not necessarily indicate a functional impact.

Page 14 – line 310 – please delete 'causal effect'. This study did not examine any causal effect. Mere association and the model tested with LPS is not totally relevant in PPROM.

17. Please delete the last paragraph in discussion. A therapy to block TLR4 is unlikely to have any impact on PPROM. PPROM results from underlying cellular or matrix derangements and is not necessarily caused by infection as a primary cause. It is a localized inflammation than systemic inflammation.

Reviewer #1 (Recommendations for the authors):

1. The study is highly descriptive and the authors should consider that sterile inflammation and microbe-associated inflammation induce distinct transcriptomic profiles in human fetal membranes, which was recently reported in Infect Immun. 2021 Apr 16;89(5):e00819-20. The authors could consider utilizing these publicly available data to enhance the translational value of their hypothesis.

2. There are currently available animal models of premature rupture of membranes (e.g., ultrasound-guided or mini-laparotomy). The authors should consider adding in vivo experiments to prove causality between TLR4 and rupture of membranes.

3. The authors focus on the rupture zone of the membranes, but fail to explain how the regulation of TLR4 mediates the process of membrane rupture.

4. The amnion layer is structurally different from the chorion. The chorion is infiltrated by innate immune cells during sterile and microbe-associated inflammation. The authors should consider evaluating the process of rupture of membranes in a more multi-dimensional manner, in which amnion, chorion, and immune cells are implicated.

Reviewer #2 (Recommendations for the authors):

The abstract, introduction and discussion would benefit from some rewriting. This would align the phraseology with English speakers, making some areas of these specific sections easier to follow.

Some of the text has a different color, or is highlighted and this need to be changed.

The data in figure 1 alludes to hypermethylated genes, using the approach is it possible to also indicate how many genes are hypomethylated? Line 135 in the results hints that this was analyzed this too.

Both in figures 1 and 2 many genes where shared by the ZIM and ZAM. Although these genes may not speak to the region specificity and what may be differentially occurring in the ZAM, they may inform about changes in the tissue at this gestational age globally in the tissues, will these be indicated in the supplementary data?

Written numerical data would improve the ability to follow the data in the results narrative and set order of magnitude context.

The final paragraph of the results describes the use of primary cells to confirm the decrease in TLR4 (line 236 onward) but the data is not shown. If this is the final decision, is may simply be indicated in parenthesis.

The data indicating the importance of TLR4 is intriguing, as is the data showing that the lower (or hypomethylated) TLR4 and MIR forms are more functional. This is summarized in figure 7 but not really discussed in the final section of the paper.

The way in which the ZAM and ZIM regions are confirmed is not described in the methods. The reference describes the tissue collection. Where they marked or dyed in some way?

Reviewer #3 (Recommendations for the authors):

Abstract – Should include an objective section to the rationale for this study and how it was done.

My major concern is that how reliable is a examining transcriptome and methylome of a membrane (regardless of zone) that are from term and not ruptured. How can this be related to pathologies? Isn't it better to create an in vitro model of disease state and then examine using explants? How do authors control cervical immune cell infiltration and their impact on ZAM?

Introduction is way too long and misses several recent references on PPROM pathology. This section needs to be trimmed by 2/3rds and update references and provide a hypothesis and objectives.

Several sections are unnecessary and not accurate.

E.g. Page 5 – line117 – TLR4 is not just for E. coli but for Gram negative bacteria and E. coli infection is very rare in PPROM. Several such misleading concepts and dogmatic statements are included. Please edit them out.

Page 8 – line 156 – …..more relevant and specific – please expand and explain this better.

TLR-4 and LPS – it is not clear why authors used LPS. TLR4 is a receptor for several DAMPs and other molecules and even certain viral particles. This should be discussed and generation of DAMPs in sterile environment should be included.

Page 11; line 229 – this is not a physiologic model. please delete.

page 11 – lines 233 23 – it is unclear what is meant by quick action and how is this measured without a functional assay? Change in transcript alone does not necessarily indicate a functional impact.

Page 14 – line 310 – please delete 'causal effect'. This study did not examine any causal effect. Mere association and the model tested with LPS is not totally relevant in PPROM.

Please delete the last paragraph in discussion. A therapy to block TLR4 is unlikely to have any impact on PPROM. PPROM results from underlying cellular or matrix derangements and not necessarily infection (as primary cause). It is a localized inflammation than systemic inflammation.

The manuscript is very hard to read and the writing needs to be improved. The manuscript needs better organization and lack cohesiveness.

Reference list needs to be updated substantially and should include recent work on PPROM.

https://doi.org/10.7554/eLife.71521.sa1

Author response

Reviewer #1 (Recommendations for the authors):

1. The study is highly descriptive and the authors should consider that sterile inflammation and microbe-associated inflammation induce distinct transcriptomic profiles in human fetal membranes, which was recently reported in Infect Immun. 2021 Apr 16;89(5):e00819-20. The authors could consider utilizing these publicly available data to enhance the translational value of their hypothesis.

We agree and decided to add the proposed article and modify the sentence of the first submitted version to take this suggestion into account (line 306-307).

2. There are currently available animal models of premature rupture of membranes (e.g., ultrasound-guided or mini-laparotomy). The authors should consider adding in vivo experiments to prove causality between TLR4 and rupture of membranes.

We agree that animal models are available. Nevertheless, we considered that such models are far from the human reality. In fact, animal models are often used for fetal membrane studies, but they are different regarding pregnancy physiology, structure and uterine environment, which hamper their use. In addition, these animal models are usually based on the injection of bacterial products. However, it is well known that the percentage of PPROM associated with microbial invasion can vary based on the weeks of gestation. In fact, early gestational ages are clearly linked to high microbial associated intra-amniotic inflammation prevalence (64.3% when <25 WGA), whereas this percentage subsequently decreases throughout gestation (Romero et al., 2015), reaching one-third at term, which is better linked with the gestational stage of their study. Furthermore, the quantification of TLR4 mRNA expression and protein in the case of PPROM without chorioamnionitis compared with term no labor without chorioamnionitis has already been carried out (Kim et al., 2004), indicating an absence of a clear link between chorioamnionitis and TLR4 expression. These observations support the fact that the TLR4 model in physiological rupture could be transposed—at least in part—to sterile PPROM and initiated by the presence of alarmins (i.e., HMGB1) and their binding to such type of receptors. Indeed, TLR4 is now well described as being stimulated by ligands other than LPS, such as HMGB1, a member of the DAMPs (Robertson et al., 2020). Finally, in an animal model of PPROM, an article underlined the importance of TLR4 in preterm labor by using TLR4 mice mutants in a sterile context (Wahid et al., 2015). This is why we decided (i) to not consider the proposal of the reviewer concerning animal models and (ii) removed Figure 3C (expression of TLR4 in the presence of LPS from bacterial origin), which helped keep a greater focus on the physiological rupture of fetal membranes without the involvement of bacterial presence.

3. The authors focus on the rupture zone of the membranes, but fail to explain how the regulation of TLR4 mediates the process of membrane rupture.

We agree with your comment; however, ‘how the regulation of TLR4 mediates the process of membrane rupture is not the topic of the manuscript. In addition, this has already been well established in previous publications. Nevertheless, we added a sentence in the introduction part between the lines lines 97-100: ‘The mechanisms implying TLR4 in the physiological or pathological rupture of membrane in case of PPROM are well known. Triggering TLR4 will lead to NF-κB activation, leading to an increase of the release of proinflammatory cytokine, concentration of matrix metalloprotease and prostaglandin, which are well established actors of fetal membrane rupture (Robertson et al., 2020).

4. The amnion layer is structurally different from the chorion. The chorion is infiltrated by innate immune cells during sterile and microbe-associated inflammation. The authors should consider evaluating the process of rupture of membranes in a more multi-dimensional manner, in which amnion, chorion, and immune cells are implicated.

According to the reviewer’s recommendation, at the end of the discussion, we added a sentence considering the essential fetal–maternal dialogue between amnion and choriodecidua, tissue layers and cell diversity: ‘Furthermore, to complete such investigations, the use of recently developed technology such as organ-on-chip (OOC) will better mimic fetal–maternal communication and exchanges between tissue layer and cell types’ (see lines 307-309).

Reviewer #2 (Recommendations for the authors):

The abstract, introduction and discussion would benefit from some rewriting. This would align the phraseology with English speakers, making some areas of these specific sections easier to follow.

Some of the text has a different color, or is highlighted and this need to be changed.

The introduction and discussion are modified, as requested. For English language editing, the paper was submitted to Scribendi for Editing and Proofreading (www.scribendi.com). This service is commonly used by the team to improve English articles prepared by the research team before final submission; this has been added in the acknowledgement part of the manuscript. The highlighted portions and different colours of the text are now suppressed.

The data in figure 1 alludes to hypermethylated genes, using the approach is it possible to also indicate how many genes are hypomethylated? Line 135 in the results hints that this was analyzed this too.

We thank the reviewer for this relevant comment. In fact, Figure 1B (Venn diagram) focused on the ZAM zone because there is no significant changes in methylation status in the ZIM zone. Concerning the ZAM, in Figure 1B, the left-upper part indicates genes where the methylation status is higher in amnion compared with the choriodecidua (i.e., 3379). For the right-upper part, genes are hypermethylated in the choriodecidua compared with the amnion (i.e., 2371). In the middle part, the 980 genes encountered in ZAM zone do not show a methylation difference between these two layers. To be exhaustive, we made three lists of these genes. To future readers, we have provided a supplementary file 2 containing a sheet regarding methylome ZAM (three lists of genes) (sheet 1).

Both in figures 1 and 2 many genes where shared by the ZIM and ZAM. Although these genes may not speak to the region specificity and what may be differentially occurring in the ZAM, they may inform about changes in the tissue at this gestational age globally in the tissues, will these be indicated in the supplementary data?

Thank you for this comment. We decided to provide a supplementary file 2 with a sheet regarding transcriptome (two lists of common genes). It details the genes that are commonly under- or overexpressed in the ZIM and ZAM when comparing the amnion to choriodecidua in function of fold change (log2 FC). We did the same for genes overexpressed in the choriodecidua (sheet 2).

Written numerical data would improve the ability to follow the data in the results narrative and set order of magnitude context.

We agree with this comment and added numerical data of the median +/- interquartile range in the text, when justified (Figure 4C and 4D, Figure 5C, Figure 6A, C and D).

The final paragraph of the results describes the use of primary cells to confirm the decrease in TLR4 (line 236 onward) but the data is not shown. If this is the final decision, is may simply be indicated in parenthesis.

If we understand this recommendation, the requested results concerning the primary cells were already detailed in Figure 6D and described at the end of correponding paragraph. To be more relevant, we separated the text of Figure 6C (AV3 cell line) and Figure 6D (primary amniotic cells).

The data indicating the importance of TLR4 is intriguing, as is the data showing that the lower (or hypomethylated) TLR4 and MIR forms are more functional. This is summarized in figure 7 but not really discussed in the final section of the paper.

We thank the reviewer for this comment. To complete Figure 7, at the end of the discussion, we added the following paragraph: ‘This regulation is intriguing because it implies a double molecular mechanism of regulation (at the DNA and mRNA levels), which is apparently layer specific, though located in the same geographical area of the fetal membrane’ (line 300-302). The latter could doubtlessly be extrapolated to other genes by our high-scale studies and to gestational tissues or resident/circulating immune cells, such as neutrophils, which are implicated in the amplification of the inflammatory response in late gestation’. Furthermore, we specified this more in the figure and the legend for the model concerning the ‘ZAM zone’.

The way in which the ZAM and ZIM regions are confirmed is not described in the methods. The reference describes the tissue collection. Where they marked or dyed in some way?

To complete the methods used to differentiate and collect the ZIM and ZAM zones, we decided to add some more information at the end of the paragraph entitled ‘Human fetal membrane collection’ in the Materials and methods part. The text added is as follows: ‘Briefly, a suture sewn onto the FMs (from caesarean deliveries) in front of the cervix by the midwife allowed us to identify the ZAM; then, a 4 cm diameter circle was cut and considered the ZAM, and explants localised places away from circle boundary were considered the ZIM’. This method has been commonly used, validated and published by the team for several years.

Reviewer #3 (Recommendations for the authors):

Abstract – Should include an objective section to the rationale for this study and how it was done.

The ‘instructions for authors’ never mentions that the abstract should contained subheadings (only for medical publications) or specific parts such as ‘objective and rationale’. Furthermore, we believe that an explanation of how the study is conducted is already present in the abstract, so we decided to not include the modification proposed by the reviewer.

My major concern is that how reliable is a examining transcriptome and methylome of a membrane (regardless of zone) that are from term and not ruptured. How can this be related to pathologies? Isn't it better to create an in vitro model of disease state and then examine using explants? How do authors control cervical immune cell infiltration and their impact on ZAM?

Following these comments, we would like to bring up the following:

– We aim to provide to the scientific community an exhaustive list of genes that could be differentially regulated in term of transcription between the ZAM and ZIM in both FM layers.

– TLR4 was underlined and is already known as an actor in FM weakening (Robertson et al., 2020). This reference has been added in the new version of the article.

– TLR4 could be activated in sterile or microbial inflammation. In fact, early gestational ages are clearly linked to high-microbial-associated intra-amniotic inflammation prevalence (64.3% when <25 WGA), whereas this percentage subsequently decreases throughout gestation (Romero et al., 2015), reaching to one-third at term, which is more in line with the gestational stage of the current study. These observations support the fact that the TLR4 model in physiological rupture could be transposed—at least in part—to PPROM.

– Concerning cervical immune cell infiltration and their impact on the ZAM, we considered that the present article is not directly linked to this because we compare globally the layer and zone that contain a ‘pool’ of different cell types, such as immune cells. Such information regarding immune response were already published and investigated (Marcellin et al., 2017).

Introduction is way too long and misses several recent references on PPROM pathology. This section needs to be trimmed by 2/3rds and update references and provide a hypothesis and objectives.

Based on this comment, the introduction is now shorter than the initial version. Furthermore, newer references have been added in this version.

Several sections are unnecessary and not accurate.

E.g. Page 5 – line117 – TLR4 is not just for E. coli but for Gram negative bacteria and E. coli infection is very rare in PPROM. Several such misleading concepts and dogmatic statements are included. Please edit them out.

We agree with this comment. E. coli was replaced in the introduction with ‘Gram-negative bacteria’. Furthermore, a new recent reference was added in the text regarding the implication of TLR4 in the case of preterm birth and fetal inflammatory injury (Robertson et al., 2020).

Page 8 – line 156 – …..more relevant and specific – please expand and explain this better.

We agree with the comment and modified the sentence to be clearer while quickly focusing on the significant results.

TLR-4 and LPS – it is not clear why authors used LPS. TLR4 is a receptor for several DAMPs and other molecules and even certain viral particles. This should be discussed and generation of DAMPs in sterile environment should be included.

We agree with this comment. Our choice to present this figure was only to confirm that TLR4, when activated by LPS, leads to a proinflammation activation in amnion and choriodecidua. Hence, we decided to remove Figure 3C in the new version of the manuscript. Furthermore, we added two references at the end of this part to better justify the choice to focus on TLR4 global transcriptional regulation.

Page 11; line 229 – this is not a physiologic model. please delete.

This has been carried out in the new version.

page 11 – lines 233 23 – it is unclear what is meant by quick action and how is this measured without a functional assay?

We agree with the comment. We replaced ‘quick action’ with ‘mobilisation’ to be more general and avoid this ‘speed notion’.

Change in transcript alone does not necessarily indicate a functional impact.

Page 14 – line 310 – please delete 'causal effect'. This study did not examine any causal effect. Mere association and the model tested with LPS is not totally relevant in PPROM.

We thank the reviewer for this comment. Nevertheless, this part of the sentence is not the ‘causal effect’ but ‘causal information’, but we decided to delete ‘causal’ and keep only ‘information’.

Please delete the last paragraph in discussion. A therapy to block TLR4 is unlikely to have any impact on PPROM. PPROM results from underlying cellular or matrix derangements and not necessarily infection (as primary cause). It is a localized inflammation than systemic inflammation.

We agree with the comment and deleted the end of the discussion part.

The manuscript is very hard to read and the writing needs to be improved. The manuscript needs better organization and lack cohesiveness.

We thank the reviewer for this comment. First, we simplified the first submitted version of the manuscript (particularly the introduction part). Second, we know that sometimes, high-scale studies could be complex to interpret when there are a lot of data available. This why we decided to limit the number of figures and tables and to offer in a public manner all the obtained data. Third, the paper was submitted to Scribendi for Editing and Proofreading (www.scribendi.com). This service is commonly used by the team to improve English articles prepared by the research team before final submission; this has been added in the acknowledgement part of the manuscript.

Reference list needs to be updated substantially and should include recent work on PPROM.

This was done along with the addition of recent and supplementary references in the new version of the manuscript.

References:

Bredeson S, Papaconstantinou J, Deford JH, Kechichian T, Syed TA, Saade GR, Menon R. 2014. HMGB1 promotes a p38MAPK associated non-infectious inflammatory response pathway in human fetal membranes. PLoS One 9:e113799. doi:10.1371/journal.pone.0113799

Gomez-Lopez N, Romero R, Galaz J, Bhatti G, Done B, Miller D, Ghita C, Motomura K, Farias-Jofre M, Jung E, Pique-Regi R, Hassan SS, Chaiworapongsa T, Tarca AL. 2021. Transcriptome changes in maternal peripheral blood during term parturition mimic perturbations preceding spontaneous Preterm birth†. Biol Reprod ioab197. doi:10.1093/biolre/ioab197

Kim YM, Romero R, Chaiworapongsa T, Kim GJ, Kim MR, Kuivaniemi H, Tromp G, Espinoza J, Bujold E, Abrahams VM, Mor G. 2004. Toll-like receptor-2 and -4 in the chorioamniotic membranes in spontaneous labor at term and in preterm parturition that are associated with chorioamnionitis. American Journal of Obstetrics and Gynecology 191:1346–1355. doi:10.1016/j.ajog.2004.07.009

Marcellin L, Schmitz T, Messaoudene M, Chader D, Parizot C, Jacques S, Delaire J, Gogusev J, Schmitt A, Lesaffre C, Breuiller-Fouché M, Caignard A, Vaiman D, Goffinet F, Cabrol D, Gorochov G, Méhats C. 2017. Immune Modifications in Fetal Membranes Overlying the Cervix Precede Parturition in Humans. JI 198:1345–1356. doi:10.4049/jimmunol.1601482

Robertson SA, Hutchinson MR, Rice KC, Chin P-Y, Moldenhauer LM, Stark MJ, Olson DM, Keelan JA. 2020. Targeting Toll-like receptor-4 to tackle preterm birth and fetal inflammatory injury. Clin Transl Immunology 9:e1121. doi:10.1002/cti2.1121

Romero R, Miranda J, Chaemsaithong P, Chaiworapongsa T, Kusanovic JP, Dong Z, Ahmed AI, Shaman M, Lannaman K, Yoon BH, Hassan SS, Kim CJ, Korzeniewski SJ, Yeo L, Kim YM. 2015. Sterile and microbial-associated intra-amniotic inflammation in preterm prelabor rupture of membranes. The Journal of Maternal-Fetal and Neonatal Medicine 28:1394–1409. doi:10.3109/14767058.2014.958463

Wahid HH, Dorian CL, Chin PY, Hutchinson MR, Rice KC, Olson DM, Moldenhauer LM, Robertson SA. 2015. Toll-Like Receptor 4 Is an Essential Upstream Regulator of On-Time Parturition and Perinatal Viability in Mice. Endocrinology 156:3828–3841.

https://doi.org/10.7554/eLife.71521.sa2

Article and author information

Author details

  1. Corinne Belville

    Team ‘Translational approach to epithelial injury and repair’, iGReD, Université Clermont Auvergne, Clermont-ferrand, France
    Contribution
    Conceptualization, Investigation, Methodology, Writing - original draft
    Competing interests
    No competing interests declared
  2. Flora Ponelle-Chachuat

    Team ‘Translational approach to epithelial injury and repair’, iGReD, Université Clermont Auvergne, Clermont-ferrand, France
    Contribution
    Formal analysis, Methodology, Software
    Competing interests
    No competing interests declared
  3. Marion Rouzaire

    Team ‘Translational approach to epithelial injury and repair’, iGReD, Université Clermont Auvergne, Clermont-ferrand, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  4. Christelle Gross

    Team ‘Translational approach to epithelial injury and repair’, iGReD, Université Clermont Auvergne, Clermont-ferrand, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  5. Bruno Pereira

    CHU Clermont-Ferrand, Biostatistics unit (DRCI) Department, clermont-ferrand, France
    Contribution
    Conceptualization, Methodology, Software
    Competing interests
    No competing interests declared
  6. Denis Gallot

    1. Team ‘Translational approach to epithelial injury and repair’, iGReD, Université Clermont Auvergne, Clermont-ferrand, France
    2. CHU Clermont-Ferrand, Obstetrics and Gynaecology Department, Clermont-ferrand, France
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  7. Vincent Sapin

    1. Team ‘Translational approach to epithelial injury and repair’, iGReD, Université Clermont Auvergne, Clermont-ferrand, France
    2. CHU Clermont-Ferrand, Biochemistry and Molecular Genetic Department, Clermont-Ferrand, France
    Contribution
    Methodology, Supervision, Writing - original draft
    Competing interests
    No competing interests declared
  8. Loïc Blanchon

    Team ‘Translational approach to epithelial injury and repair’, iGReD, Université Clermont Auvergne, Clermont-ferrand, France
    Contribution
    Funding acquisition, Methodology, Project administration, Supervision, Writing - original draft
    For correspondence
    loic.blanchon@uca.fr
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8842-0162

Funding

Auvergne Rhone-Alpes Region Jeune Chercheur Framework (Not applicable)

  • Loïc Blanchon

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

LB was supported in carrying out this work by the Auvergne-Rhone-Alpes region’s Jeune Chercheur framework. This research was conducted with the scientific support and expertise of Helixio (Saint-Beauzire, France).

The authors thank Scribendi proofreading services (Canada) for their English language editing of the initial and revised version of the article.

Ethics

This study was approved by the "Comité de Protection des Personnes (CPP)" under the reference: AU-765 and Codecoh number: DC-2008–558. Informed consent was obtained from the participants. The experiments conformed to the principles set in the World Medical Association Declaration of Helsinki.

Senior and Reviewing Editor

  1. YM Dennis Lo, The Chinese University of Hong Kong, Hong Kong

Publication history

  1. Received: June 22, 2021
  2. Preprint posted: June 28, 2021 (view preprint)
  3. Accepted: January 17, 2022
  4. Version of Record published: February 4, 2022 (version 1)

Copyright

© 2022, Belville et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 273
    Page views
  • 47
    Downloads
  • 1
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Corinne Belville
  2. Flora Ponelle-Chachuat
  3. Marion Rouzaire
  4. Christelle Gross
  5. Bruno Pereira
  6. Denis Gallot
  7. Vincent Sapin
  8. Loïc Blanchon
(2022)
Physiological TLR4 regulation in human fetal membranes as an explicative mechanism of a pathological preterm case
eLife 11:e71521.
https://doi.org/10.7554/eLife.71521

Further reading

    1. Cell Biology
    Jia Chen, Daniel St Johnston
    Research Article

    In the adult Drosophila midgut, basal intestinal stem cells give rise to enteroblasts that integrate into the epithelium as they differentiate into enterocytes. Integrating enteroblasts must generate a new apical domain and break through the septate junctions between neighbouring enterocytes, while maintaining barrier function. We observe that enteroblasts form an apical membrane initiation site (AMIS) when they reach the septate junction between the enterocytes. Cadherin clears from the apical surface and an apical space appears between above the enteroblast. New septate junctions then form laterally with the enterocytes and the AMIS develops into an apical domain below the enterocyte septate junction. The enteroblast therefore forms a pre-assembled apical compartment before it has a free apical surface in contact with the gut lumen. Finally, the enterocyte septate junction disassembles and the enteroblast/pre-enterocyte reaches the gut lumen with a fully-formed brush border. The process of enteroblast integration resembles lumen formation in mammalian epithelial cysts, highlighting the similarities between the fly midgut and mammalian epithelia.

    1. Cell Biology
    2. Genetics and Genomics
    Julie Trolle, Ross M McBee ... Harris H Wang
    Short Report

    Major genomic deletions in independent eukaryotic lineages have led to repeated ancestral loss of biosynthesis pathways for nine of the twenty canonical amino acids1. While the evolutionary forces driving these polyphyletic deletion events are not well understood, the consequence is that extant metazoans are unable to produce nine essential amino acids (EAAs). Previous studies have highlighted that EAA biosynthesis tends to be more energetically costly2,3, raising the possibility that these pathways were lost from organisms with access to abundant EAAs in the environment4,5. It is unclear whether present-day metazoans can reaccept these pathways to resurrect biosynthetic capabilities that were lost long ago or whether evolution has rendered EAA pathways incompatible with metazoan metabolism. Here, we report progress on a large-scale synthetic genomics effort to reestablish EAA biosynthetic functionality in mammalian cells. We designed codon-optimized biosynthesis pathways based on genes mined from Escherichia coli. These pathways were de novo synthesized in 3 kilobase chunks, assembled in yeasto and genomically integrated into a Chinese Hamster Ovary (CHO) cell line. One synthetic pathway produced valine at a sufficient level for cell viability and proliferation, and thus represents a successful example of metazoan EAA biosynthesis restoration. This prototrophic CHO line grows in valine-free medium, and metabolomics using labeled precursors verified de novo biosynthesis of valine. RNA-seq profiling of the valine prototrophic CHO line showed that the synthetic pathway minimally disrupted the cellular transcriptome. Furthermore, valine prototrophic cells exhibited transcriptional signatures associated with rescue from nutritional starvation. 13C-tracing revealed build-up of pathway intermediate 2,3-dihydroxy-3-isovalerate in these cells. Increasing the dosage of downstream ilvD boosted pathway performance and allowed for long-term propagation of second-generation cells in valine-free medium at a consistent doubling time of 3.2 days. This work demonstrates that mammalian metabolism is amenable to restoration of ancient core pathways, paving a path for genome-scale efforts to synthetically restore metabolic functions to the metazoan lineage.