1. Cell Biology

Diet-induced loss of adipose hexokinase 2 correlates with hyperglycemia

  1. Mitsugu Shimobayashi  Is a corresponding author
  2. Amandine Thomas
  3. Sunil Shetty
  4. Irina C Frei
  5. Bettina K Wölnerhanssen
  6. Diana Weissenberger
  7. Anke Vandekeere
  8. Mélanie Planque
  9. Nikolaus Dietz
  10. Danilo Ritz
  11. Anne Christin Meyer-Gerspach
  12. Timm Maier
  13. Nissim Hay
  14. Ralph Peterli
  15. Sarah-Maria Fendt
  16. Nicolas Rohner
  17. Michael N Hall  Is a corresponding author
  1. Biozentrum, University of Basel, Switzerland
  2. Department of Chronic Diseases and Metabolism, Laboratory of Clinical and Experimental Endocrinology, KU Leuven, Belgium
  3. University of Basel, Switzerland
  4. St. Clara Research Ltd, St. Claraspital, Switzerland
  5. Laboratory of Cellular Metabolism and Metabolic Regulation, VIB-KU Leuven Center for Cancer Biology, Belgium
  6. Department of Oncology, Laboratory of Cellular Metabolism and Metabolic Regulation, KU Leuven and Leuven Cancer Institute, Belgium
  7. Department of Biochemistry and Molecular Genetics, College of Medicine, University of Illinois at Chicago, United States
  8. Clarunis, Department of Visceral Surgery, University Centre for Gastrointestinal and Liver Diseases, Switzerland
  9. Stowers Institute for Medical Research, United States
  10. Department of Cell Biology and Physiology at the University of Kansas School of Medicine, United States
https://doi.org/10.7554/eLife.85103
Share this article
Cite this article
  1. Mitsugu Shimobayashi
  2. Amandine Thomas
  3. Sunil Shetty
  4. Irina C Frei
  5. Bettina K Wölnerhanssen
  6. Diana Weissenberger
  7. Anke Vandekeere
  8. Mélanie Planque
  9. Nikolaus Dietz
  10. Danilo Ritz
  11. Anne Christin Meyer-Gerspach
  12. Timm Maier
  13. Nissim Hay
  14. Ralph Peterli
  15. Sarah-Maria Fendt
  16. Nicolas Rohner
  17. Michael N Hall
(2023)
Diet-induced loss of adipose hexokinase 2 correlates with hyperglycemia
eLife 12:e85103.
https://doi.org/10.7554/eLife.85103
  2. Download BibTeX
  3. Download .RIS

Abstract

Chronically high blood glucose (hyperglycemia) leads to diabetes and fatty liver disease. Obesity is a major risk factor for hyperglycemia, but the underlying mechanism is unknown. Here, we show that a high-fat diet (HFD) in mice causes early loss of expression of the glycolytic enzyme Hexokinase 2 (HK2) specifically in adipose tissue. Adipose-specific knockout of Hk2 reduced glucose disposal and lipogenesis and enhanced fatty acid release in adipose tissue. In a non-cell-autonomous manner, Hk2 knockout also promoted glucose production in liver. Furthermore, we observed reduced hexokinase activity in adipose tissue of obese and diabetic patients, and identified a loss-of-function mutation in the hk2 gene of naturally hyperglycemic Mexican cavefish. Mechanistically, HFD in mice led to loss of HK2 by inhibiting translation of Hk2 mRNA. Our findings identify adipose HK2 as a critical mediator of local and systemic glucose homeostasis, and suggest that obesity-induced loss of adipose HK2 is an evolutionarily conserved mechanism for the development of selective insulin resistance and thereby hyperglycemia.

Editor's evaluation

This study reveals that expression of the glycolytic enzyme hexokinase 2 (HK2) in adipocytes is decreased in obesity and is associated with glucose intolerance and insulin resistance. The authors then show that adipose selective depletion of HK2 in mice causes systemic glucose intolerance, suggesting that the decreased HK2 may contribute to metabolic dysfunction in obese humans. These studies point to a potentially important new pathway that contributes to the regulation of metabolic health.

https://doi.org/10.7554/eLife.85103.sa0

Introduction

Vertebrates mediate glucose homeostasis by regulating glucose production and disposal in specific tissues (Roden and Shulman, 2019; Wasserman, 2009). High blood glucose stimulates pancreatic beta cells to secrete the hormone insulin which in turn promotes glucose disposal in skeletal muscle and adipose tissue and inhibits glucose production in liver. Although its contribution to glucose clearance is minor (Jackson et al., 1986; Kowalski and Bruce, 2014), adipose tissue plays a particularly important role in systemic glucose homeostasis (Abel et al., 2001; Shepherd et al., 1993). Adipose-specific knockout of insulin signaling components, such as the insulin receptor, mTORC2, and AKT, results in local and systemic insulin insensitivity (Beg et al., 2017; Cybulski et al., 2009; Frei et al., 2022; Jiang et al., 2003; Kumar et al., 2010; Sakaguchi et al., 2017; Shearin et al., 2016; Tang et al., 2016). However, we and others have reported that diet-induced obesity in mice causes adipose dysfunction, systemic insulin insensitivity, and hyperglycemia despite normal insulin signaling in white adipose tissue (WAT; Figure 1—figure supplement 1A; Shimobayashi et al., 2018; Tan et al., 2015). How does obesity cause systemic insulin insensitivity and hyperglycemia? In other words, how does diet induce hyperglycemia?

Here, we show that a high-fat diet induces early loss of the glycolytic enzyme HK2 specifically in adipose tissue. Loss of adipose HK2 leads to reduced glucose disposal by adipose tissue and increased glucose production in liver, ultimately causing glucose intolerance. Loss of adipose HK2 also decreased lipogenesis and increased fatty acid release in WAT. This and related findings in Mexican cavefish and adipose tissue of obese patients suggest that diet-induced downregulation of adipose HK2 contributes to hyperglycemia.

Results

HK2 is down-regulated in obese mice and humans

To determine the molecular basis of diet-induced hyperglycemia in mice, we performed an unbiased proteomic analysis on visceral white adipose tissue (vWAT) isolated from C57BL/6JRj wild-type mice fed a HFD for 4 weeks or normal diet (ND) (Figure 1—figure supplement 1B–D). We detected and quantified 6294 proteins of which 52 and 67 were up- and down-regulated, respectively, in vWAT of HFD-fed mice (Supplementary file 1). The glycolytic enzyme Hexokinase 2 (HK2), expressed in adipose tissue and muscle, was among the proteins significantly down-regulated in vWAT (Figure 1A). We focused on HK2 due to its role in glucose metabolism. HK2 phosphorylates glucose to generate glucose-6-phosphate (G6P), the rate-limiting step in glycolysis, in an insulin-stimulated manner. HK2 is the most abundant (~80%) of the three hexokinase isoforms expressed in vWAT but the only one down-regulated upon HFD (Figure 1A and Figure 1—figure supplement 1E). Quantification by immunoblotting revealed an approximately 60%, 90% and 50% reduction in HK2 expression in vWAT, subcutaneous WAT (sWAT), and brown adipose tissue (BAT), respectively, of 4 week HFD mice (Figure 1B–C). Consistent with reduced HK2 expression, hexokinase activity was decreased in WAT of HFD-fed mice (Figure 1D). HK2 expression was also decreased in WAT of ND-fed ob/ob mice, compared to littermate controls (Figure 1—figure supplement 1F), suggesting that loss of HK2 is common to different obesogenic conditions. A longitudinal study of HFD-fed mice revealed that HK2 down-regulation in adipose tissue occurred within one week of HFD and correlated with systemic insulin insensitivity (Figure 1—figure supplement 2A–F). HK2 expression was unchanged in skeletal muscle (Figure 1B). Expression of the glucose transporter GLUT4 was slightly reduced in vWAT at 4 weeks of HFD (Figure 1A and Figure 1—figure supplement 2D). In sWAT, GLUT4 was down-regulated at >1 week of HFD (Figure 1—figure supplement 2E). Confirming earlier observations (Shimobayashi et al., 2018; Tan et al., 2015), insulin signaling was normal in WAT at 4 weeks of HFD (Figure 1—figure supplements 1A and 2D–E). However, in BAT, insulin signaling was significantly downregulated within 1 week of HFD (Figure 1—figure supplement 2F). Shifting from HFD to 2 weeks of ND restored HK2 expression and normal blood glucose (Figure 1E–F and Figure 1—figure supplement 2C). Thus, loss of HK2 expression upon obesogenic conditions is an adipose-specific, transient physiological response that correlates with hyperglycemia.

Figure 1 with 2 supplements see all
Download asset Open asset
Loss of HK2 in obese mouse and obese human.

(A) The Log2 fold change (FC) of Hexokinase and GLUT4 protein expression in visceral white adipose tissue (vWAT) of normal diet (ND)- and 4 week high-fat diet (HFD)-fed wild-type C57BL/6JRj mice. Multiple t test, **q<0.0001. n=5 (ND) and 5 (HFD). (B) Immunoblot analyses of vWAT, subcutaneous WAT (sWAT), brown adipose tissue (BAT), and skeletal muscle from ND- and 4 week HFD-fed mice. CALX serves as a loading control. n=6 (ND) and 6 (HFD). (C) Quantification of panel B. Data is normalized to the loading control. Student’s t test. **p<0.01. (D) Hexokinase (HK) activity of vWAT and sWAT from ND- and 4 week HFD-fed mice. Student’s t test, *p<0.05, **p<0.01. n=5 (ND) and 5 (HFD). (E–F) Immunoblot analyses of vWAT (E) and sWAT (F) from ND-, 2 week HFD-, and 2 week HFD +2 week ND-fed mice. n=5 (ND), 5 (HFD), and 6 (HFD +ND). Data is normalized to the loading control. One-way ANOVA. *p<0.01, **p<0.01, ****p<0.0001. (G) Hexokinase (HK) activity of vWAT from lean, obese non-diabetic, and obese diabetic patients. Two-way ANOVA, *p<0.05. n=27 (lean), 30 (obese), and 14 (obese diabetic). (H) Comparison of vWAT HK activity from low or high HOMA-IR obese non-diabetic patients. Student’s t tests, *p<0.05. n=12 (low, HOMA-IR <2.9) and 18 (high, HOMA-IR >2.9). (I) Pearson’s correlation analyses of hexokinase activity and homeostatic assessment for insulin resistance (HOMA-IR) in obese patients. See Figure 1—source data 1.

Figure 1—source data 1

Uncropped blots and source data for graphs for Figure 1.

https://cdn.elifesciences.org/articles/85103/elife-85103-fig1-data1-v1.zip

Similar to our findings in mice, omental WAT (human vWAT) biopsies from obese non-diabetic and obese diabetic patients displayed a~30% reduction in hexokinase activity (Figure 1G and Supplementary file 2). Importantly, hexokinase activity was particularly low in obese non-diabetic patients with severe insulin resistance, compared to patients with mild insulin resistance (Figure 1H). Although hexokinase activity negatively correlated with insulin resistance in obese patients, this correlation was not statistically significant (Figure 1I), suggesting that loss of hexokinase activity may not be the only cause of insulin resistance in human. We note that Ducluzeau et al. observed a decrease in HK2 mRNA expression in adipose tissue of diabetic patients (Ducluzeau et al., 2001). Altogether, the above findings suggest that HK2 down-regulation in adipose tissue is a key event, possibly causal, in obesity-induced insulin insensitivity and hyperglycemia in mouse and human.

A loss-of-function hk2 mutation in hyperglycemic cavefish

Mexican cavefish (Astyanax mexicanus), also known as blind fish, are hyperglycemic compared to surface fish from which they are descended (Riddle et al., 2018; Figure 2A–B). Hyperglycemia, although a pathological condition in mouse and human, is a selected trait that presumably allows cave-dwelling fish to survive in nutrient-limited conditions. Among three independently evolved cavefish isolates, Pachón and Tinaja cavefish (names refer to the caves from which the fish were isolated) acquired a loss-of-function mutation in the insulin receptor gene, causing insulin resistance and hyperglycemia (Riddle et al., 2018; Figure 2B). The third isolate, Molino cavefish, is the most hyperglycemic but contains a wild-type insulin receptor gene and displays normal insulin signaling (Riddle et al., 2018). Since the phenotype of Molino fish is similar to that of HFD-fed mice (normal insulin signaling yet hyperglycemic), we hypothesized that this cavefish may be hyperglycemic due to a loss-of-function mutation in the hk2 gene. DNA sequencing of the hk2 gene of surface fish and the three cavefish variants revealed a mutation in the hk2 gene uniquely in Molino. The homozygous, missense mutation in the coding region of the Molino hk2 gene changed highly conserved arginine 42 (R42) to histidine (R42H) (Figure 2C and D). Based on the published structure of HK2 (Nawaz et al., 2018), R42 forms a salt bridge with aspartic acid 272 (D272) to stabilize the conformation of HK2 (Figure 2E), predicting that R42H destabilizes HK2 and is thus a loss-of-function mutation. To test this prediction, we expressed surface fish and Molino HK2 in HEK293T cells which have low intrinsic hexokinase activity. Indeed, Molino HK2 displayed little-to-no hexokinase activity compared to surface fish HK2 (Figure 2F). To test whether R42H causes loss of function in mammalian HK2, we examined hexokinase activity of recombinant mammalian HK2 containing the Molino mutation (HK2-R42H). HK2-R42H displayed ~50% hexokinase activity compared to HK2-WT, despite similar expression levels (Figure 2G). Thus, the R42H mutation may account for the hyperglycemia in Molino cavefish. In other words, R42H in Molino appears to be a genetically fixed version of what we observe in mice as a physiological down-regulation of HK2 in response to HFD. Although further study is required to link the R42H mutation to the hyperglycemic phenotype in Molino cavefish, the findings in Molino provide orthogonal evidence that the down-regulation of HK2 in mice is physiologically relevant in hyperglycemia.

Figure 2
Download asset Open asset
A loss-of-function HK2 variant in hyperglycemic Mexican cavefish.

(A) Surface fish and Mexican cavefish Molino. (B) Comparisons of phenotypes in surface fish, Pachón, Tinaja, and Molino. (C) DNA sequence of the Molino variant. (D) Amino acid sequence alignment of the HK2-R42H mutation within vertebrates. (E) Structural analyses revealed the presence of a salt bridge between Arginine 42 (R42) and Aspartic acid 272 (D272) in the human HK2 (PDB: 2MTZ). (F) HK activity and immunoblot analyses for lysates of HEK293T cells expressing surface or Molino HK2. Student’s t test, ****p<0.0001. N=4. (G) HK activity and immunoblots for lysates of HEK293T cells expressing control, HK2-WT, or HK2-R42H. Student’s t test, ****p<0.0001. N=4. See Figure 2—source data 1.

Figure 2—source data 1

Uncropped blots and source data for graphs for Figure 2.

https://cdn.elifesciences.org/articles/85103/elife-85103-fig2-data1-v1.zip

Adipose-specific Hk2 knockout causes hyperglycemia

The above findings altogether suggest that adipose-specific loss of HK2 may be a cause of hyperglycemia. To test this hypothesis, we first generated a stable HK2 knockdown pre-adipocyte 3T3-L1 cell line (Figure 3A–B). HK2-knockdown pre-adipocytes differentiated normally to produce mature adipocytes (Figure 3—figure supplement 1A–B). The glycolytic rate was lower in HK2-knockdown adipocytes compared to controls, as measured by extracellular acidification rate (ECAR) (Figure 3C) and lactate production (Figure 3D). Furthermore, although basal glucose accumulation did not differ, insulin-stimulated glucose accumulation was 50% lower in HK2-knockdown adipocytes (Figure 3E), despite normal insulin signaling (Figure 3A). The observation that HK2-knockdown has no effect on basal glucose accumulation is due to the fact that HK2 is inactive in the absence of insulin (Gottlob et al., 2001; Miyamoto et al., 2008). Thus, loss of HK2 decreases glucose disposal in insulin-stimulated adipocytes in vitro.

Figure 3 with 1 supplement see all
Download asset Open asset
Loss of adipose HK2 causes reduced glucose disposal in adipocytes.

(A) Immunoblot analyses of control and HK2 knockdown 3T3-L1 adipocyte lysates. Cells were stimulated with 100 nM insulin for 25 min. N=4. (B) HK activity of control and HK2 knockdown 3T3-L1 adipocytes. Student’s t test, ***p<0.001. N=3. (C) Extracellular acidification rate of control and HK2 knockdown 3T3-L1 adipocytes in response to glucose (10 mM) and 2-deoxyglucose (2DG, 50 mM). Two-way ANOVA. *p<0.05. N=2. (D) Lactate secreted into media by control and HK2 knockdown 3T3-L1 adipocytes treated with or without 100 nM insulin. One-way ANOVA. *p<0.05, **p<0.01. N=3. (E) 2DG uptake in control and HK2 knockdown 3T3-L1 adipocytes treated with or without 100 nM insulin. One-way ANOVA. ****p<0.0001. N=3. See Figure 3—source data 1.

Figure 3—source data 1

Uncropped blots and source data for graphs for Figure 3.

https://cdn.elifesciences.org/articles/85103/elife-85103-fig3-data1-v1.zip

To examine further the role of adipose HK2 in glucose homeostasis, and in particular the causality of HK2 loss in insulin insensitivity and hyperglycemia, we generated an adipose-specific Hk2 knockout (AdHk2KO) mouse in which the knockout was induced at 4–5 weeks of age (Figure 4—figure supplement 1A). In AdHk2KO mice, HK2 expression was decreased ~75% in vWAT,~70% in sWAT, and ~65% in BAT but unchanged in skeletal muscle (Figure 4A and Figure 4—figure supplement 1B–D). Glycolytic metabolites were also decreased in WAT (Figure 4B). Furthermore, insulin signaling was normal in adipose tissue (Figure 4A and Figure 4—figure supplement 1B–C) and other tissues (see below) of AdHk2KO mice. ND-fed AdHk2KO mice displayed slightly less fat mass and slightly more lean mass than controls, but no difference in overall body weight (Figure 4—figure supplement 2A–B). No significant difference was observed in the weight of individual organs except for a small decrease in vWAT and a small increase in liver weight (Figure 4—figure supplement 2C–D). vWAT and sWAT from AdHk2KO and control mice were morphologically indistinguishable (Figure 4—figure supplement 2E). AdHk2KO and control mice displayed similar mRNA expression and circulating levels of leptin and adiponectin (Figure 4—figure supplement 2F–I). Expression of brown adipocyte markers (Ucp1 and Dio2) was also unchanged in AdHk2KO mice (Figure 4—figure supplement 2J). The above similarities in adipose tissue from AdHk2KO and control mice are not surprising given that the HK2 knockout was induced at 4–5 weeks of age, after adipose tissue is fully developed. However, contrary to controls, ND-fed AdHk2KO mice were insulin insensitive and severely glucose intolerant as measured by conventional tolerance tests (Figure 4C–D). Moreover, glucose intolerance was observed in adipose-specific heterozygous Hk2 knockout mice (Figure 4—figure supplement 3A–C). These data indicate that partial loss of HK2, as observed in HFD-fed wild-type mice (Figure 1), is sufficient to cause glucose intolerance. We also measured the insulin insensitivity of AdHk2KO mice in hyperinsulinemic-euglycemic clamp conditions (Figure 4E–F and Figure 4—figure supplement 3D–F). Compared to control mice, AdHk2KO mice required significantly less or no infusion of glucose to maintain euglycemia (Figure 4E–F), despite similar hyperinsulinemia (Figure 4—figure supplement 3D). We note that the glycolytic rate before insulin infusion is higher in AdHk2KO mice (Figure 4—figure supplement 3F). The reason for this increased basal glycolytic rate is unknown. The above findings confirm that loss of HK2 specifically in adipose tissue is sufficient to cause insulin insensitivity and thereby hyperglycemia, even in ND-fed mice.

Figure 4 with 4 supplements see all
Download asset Open asset
Loss of adipose HK2 causes hyperglycemia in mice.

(A) Immunoblot analyses of HK2 expression and insulin signaling in vWAT of control and adipose-specific Hk2 knockout (AdHk2KO) mice. Mice were fasted overnight or fasted overnight and re-fed for 3 hours. Quantification data is normalized to a loading control. n=6. (B) Fold change (AdHk2KO/control) of metabolites in glycolysis and the pentose phosphate pathway in vWAT of control and AdHk2KO mice. Student’s t test. *p<0.05. n=9 (control) and 10 (AdHk2KO). (C) Insulin tolerance test (ITT) on control and AdHk2KO mice. The mice were fasted for 6 hours and injected with insulin (0.5 U/kg body weight). Two-way ANOVA. *p<0.05, ***p<0.001. n=6 (control) and 10 (AdHk2KO). (D) Glucose tolerance test (GTT) on control and AdHk2KO mice. Mice were fasted for 6 hours and injected with glucose (2 g/kg body weight). Two-way ANOVA for glucose curves and Student’s t test for AUC. *p<0.05, **p<0.01. n=7 (control) and 12 (AdHk2KO). (E–F) Hyperinsulinemic-euglycemic clamp studies on control and AdHk2KO mice. Mice were fasted for 6 hours. Under insulin clamp, euglycemia was maintained (E) by manipulating glucose infusion rate (F). Bar graph shows average glucose infusion rate under euglycemia. Two-way ANOVA for glucose infusion rate curve and Student’s t test for average glucose infusion rate, **p<0.01, ****p<0.0001. n=6 (control) and 7 (AdHk2KO). See Figure 4—source data 1.

Figure 4—source data 1

Uncropped blots and source data for graphs for Figure 4.

https://cdn.elifesciences.org/articles/85103/elife-85103-fig4-data1-v1.zip

We also investigated HFD-fed AdHk2KO mice. No significant difference was observed in fat mass, body weight, organ weight and insulin tolerance in AdHk2KO mice compared to controls, in mice fed a HFD for 12 weeks (Figure 4—figure supplement 4A–D). The similar phenotype of HFD-fed AdHk2KO and control mice was expected due to the HFD-induced, early loss of HK2 expression in the control mice (Figure 1A–B and Figure 1—figure supplement 2D–F).

Adipose-specific Hk2 knockout causes selective insulin resistance in liver

Consistent with reduced glucose accumulation observed in adipocytes in vitro (Figure 3E), we also observed reduced glucose uptake in adipose tissue in vivo, as measured upon injection of the glucose tracer 14C-2-deoxyglucose during our hyperinsulinemic-euglycemic clamp studies (Figure 5A). However, adipose tissue accounts for only <5% of glucose disposal (Jackson et al., 1986; Kowalski and Bruce, 2014). Thus, the insulin insensitivity and glucose intolerance observed in AdHk2KO mice (Figure 4C–F) cannot be explained solely by impaired glucose uptake in adipose tissue. Glucose uptake in skeletal muscle, which accounts for 70–80% of insulin-inducible glucose clearance (Kowalski and Bruce, 2014), was unimpaired in AdHk2KO mice (Figure 5A). Plasma insulin levels were also similar in AdHk2KO and control mice (Figure 5—figure supplement 1A–B). Moreover, insulin signaling was not affected in skeletal muscle and liver of fasted and re-fed AdHk2KO mice (Figure 4—figure supplement 1D and Figure 5—figure supplement 1C). These findings indicate that the severity of the glucose intolerance in AdHk2KO mice is not due to defects in glucose uptake in skeletal muscle, insulin secretion or insulin signaling in peripheral tissues.

Figure 5 with 1 supplement see all
Download asset Open asset
Loss of adipose HK2 causes reduced glucose disposal in adipose tissue and de-represses glucose production in liver.

(A) Glucose uptake measured at the end of hyperinsulinemic-euglycemic clamp. 2DG was injected 30 min prior to organ collections. The 2DG values were normalized by tissue mass used for the assay. Mann-Whitney test, *p<0.05, **p<0.01. n=5 (control) and 5 (AdHk2KO) mice. (B) Endogenous glucose production under basal and hyperinsulinemic-euglycemic clamp conditions. Mann-Whitney test, *p<0.05, **p<0.01. n=6 (control) and 7 (AdHk2KO) mice. (C) Pyruvate tolerance test (PTT) on control and AdHk2KO mice. Mice were fasted for 15 hours and injected with pyruvate (2 g/kg body weight). Two-way ANOVA, *p<0.05, **p<0.01. n=5 (control) and 6 (AdHk2KO). (D) mRNA levels of gluconeogenic genes (left) and lipogenic genes (rignt) in liver of control and AdHk2KO mice. Multiple t test, *p<0.05, **p<0.01. n=9 (control) and 12 (AdHk2KO). (E) De novo-synthesized plasma TG. Mice were treated with 3H-H2O and incorporation of 3H in plasma TG was measured. Student’s t test, *p<0.05. n=7 (control) and 5 (AdHk2KO). (F) Plasma triglyceride (TG) levels in control and AdHk2KO mice. Student’s t test, *p<0.05. n=8 (control) and 10 (AdHk2KO). (G) Plasma cholesterol, low density lipoprotein (LDL), or high density lipoprotein (HDL) levels in control and AdHk2KO mice. Multiple t test, **p<0.01. n=8 (control) and 10 (AdHk2KO). See Figure 5—source data 1.

Figure 5—source data 1

Source data for graphs for Figure 5.

https://cdn.elifesciences.org/articles/85103/elife-85103-fig5-data1-v1.zip

Another potential explanation for the severity of glucose intolerance in AdHk2KO mice is de-repression of hepatic glucose production. Adipose tissue is known to impinge negatively on glucose production in liver (Abel et al., 2001; Kumar et al., 2010; Tang et al., 2016; Vijayakumar et al., 2017), the main glucose producing organ. We indeed observed increased glucose production in AdHk2KO mice under hyperinsulinemic-euglycemic clamp conditions (Figure 5B). To test further whether the increased glucose production in AdHk2KO mice is due to enhanced gluconeogenesis, we performed a pyruvate tolerance test (PTT). AdHk2KO mice displayed significantly higher production of glucose upon pyruvate injection, compared to controls (Figure 5C). Consistent with the observed increase in pyruvate-dependent glucose production, gluconeogenic genes (G6pc and Pepck) were upregulated in AdHk2KO liver (Figure 5D). These findings suggest that enhanced hepatic glucose production accounts for the severity of glucose intolerance in AdHk2KO mice. Thus, loss of adipose HK2 non-cell-autonomously promotes glucose intolerance by enhancing hepatic glucose production.

We observed enhanced glucose production in AdHk2KO mice despite normal systemic insulin signaling, including in liver (Figure 5—figure supplement 1C). This is an apparent paradox because insulin signaling normally inhibits glucose production. To investigate this paradox, we examined hepatic lipogenic gene expression, another readout for insulin action. The insulin-stimulated transcription factors sterol regulatory element-binding protein 1 c (SREBP1c) and carbohydrate responsive element binding protein (ChREBP) activate fatty acid synthesis genes and thereby promote de novo lipogenesis in liver (Horton et al., 2002; Iizuka et al., 2004). Expression of Srebp1c, Mlxipl/Chrebp, and fatty acid synthesis genes (Acly, Scd1, Fasn, and Acc) was maintained, even mildly increased, in liver of AdHk2KO mice (Figure 5D). FASN and ACC protein levels were also slightly increased in liver of AdHk2KO mice (Figure 5—figure supplement 1C). These findings indicate that loss of adipose HK2 does not inhibit hepatic lipogenesis although hepatic glucose production is enhanced. The increased hepatic glucose production and maintained lipogenesis, as observed in AdHk2KO mice, resembles a condition in diabetic patients known as selective insulin resistance (Brown and Goldstein, 2008; see below). Thus, loss of adipose HK2 causes selective insulin resistance and thereby contributes to the pathogenesis of type 2 diabetes.

We note that hepatic triglyceride (TG) levels were unchanged in AdHk2KO mice despite increased expression of lipogenic genes and enzymes in liver (Figure 5D and Figure 5—figure supplement 1C–E) and increased de novo TG synthesis (Figure 5E). Most likely, de novo-synthesized hepatic TG in AdHk2KO mice is secreted and delivered to adipose tissue for storage, as suggested by the higher levels of circulating TG and cholesterol in AdHk2KO mice (Figure 5F–G).

Adipose-specific Hk2 knockout impairs lipogenesis and enhances fatty acid release in adipose tissue

How does loss of HK2 in adipose tissue increase hepatic glucose production? Adipose lipogenesis non-cell-autonomously inhibits hepatic glucose production (Vijayakumar et al., 2017). Adipose-specific knockout of the transcription factor ChREBP decreases adipose lipogenesis and thereby increases hepatic glucose production (Ortega-Prieto and Postic, 2019; Vijayakumar et al., 2017). Glucose-derived metabolites have been shown to promote ChREBP activity (Dentin et al., 2012; Kabashima et al., 2003; Kawaguchi et al., 2002; Kim et al., 2016; Li et al., 2010). Based on these observations, we hypothesized that HFD-induced loss of ChREBP activity and thus lipogenesis in adipose tissue may cause increased hepatic glucose production. To test this hypothesis, we examined Mlxipl/Chrebp expression in adipose tissue of AdHk2KO mice. ChREBP has two isoforms. Constitutively expressed ChREBPα promotes transcription of ChREBPβ which then activates lipogenic genes (Herman et al., 2012). Expression of Mlxipl-beta/Chrebp-beta, but not Mlxipl-alpha/Chrebp-alpha, was significantly decreased in adipose tissue of AdHk2KO mice (Figure 6A). Consistent with reduced Mlxipl-beta/Chrebp-beta expression, lipogenic genes and enzymes and ultimately lipogenesis were down-regulated in adipose tissue of AdHk2KO mice (Figure 6A–D). The above findings indicate that loss of adipose HK2 causes loss of ChREBP activity and lipogenesis in adipose tissue. Furthermore, our above findings combined with previous literature (Vijayakumar et al., 2017) suggest that loss of adipose HK2 promotes hepatic glucose production via loss of adipose lipogenesis. We note that adipose tissue weight in AdHk2KO mice is essentially unchanged (Figure 4—figure supplement 2C) despite loss of lipogenesis, likely due to a compensating supply of TG from liver (Figure 5D–F).

Figure 6
Download asset Open asset
Decreased lipogenesis and enhanced fatty acid release in adipose tissue in AdHk2KO mice.

(A) mRNA levels of fatty acid synthesis genes in vWAT (top), sWAT(middle), and BAT (bottom) from control and AdHk2KO mice. Multiple t test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. n=9 (control) and 12 (AdHk2KO) for vWAT and sWAT. n=10 (control) and 10 (AdHk2KO) for BAT. (B) Immunoblot analyses of fatty acid synthesis enzymes in vWAT of control and Adk2KO mice. n=6. (C) Quantification of panel B. Data is normalized to loading controls. Student’s t test. **p<0.01. ****p<0.0001. (D) De novo lipogenesis of vWAT explants of control and AdHk2KO mice. vWAT explants were treated with 3H-H2O in the absence or presence of 100 nM insulin for 1 hour. Two-way ANOVA, **p<0.01, ****p<0.0001. n=8 (control) and 10 (AdHk2KO). (E) Non-esterified fatty acid (NEFA) release of vWAT explants of control and AdHk2KO mice. vWAT explants were treated with or without 10 µM isoproterenol in the absence or presence of 100 nM insulin. Multiple t test, *p<0.05. n.s., not significant. n=10 (control) and 12 (AdHk2KO). (F) Plasma NEFA levels in control and AdHk2KO mice before (0 min) and after (15 min) glucose injection. Mice were fasted for 6 hours and injected with glucose (2 g/kg body weight). Two-way ANOVA, **p<0.001. n.s., not significant. n=10 (control) and 11 (AdHk2KO). (G) Plasma NEFA levels in control and AdHk2KO mice after (15 min) glucose injection was normalized by plasma NEFA levels at 0 min (before glucose injection) in E. Student’s t test, **p<0.01. n=10 (control) and 11 (AdHk2KO). See Figure 6—source data 1.

Figure 6—source data 1

Uncropped blots and source data for Figure 6.

https://cdn.elifesciences.org/articles/85103/elife-85103-fig6-data1-v1.zip

Non-esterified fatty acid (NEFA) released from adipose tissue, in addition to loss of adipose lipogenesis, promotes glucose production in liver (Perry et al., 2015; Titchenell et al., 2016). Furthermore, ChREBP in adipose tissue both promotes lipogenesis and inhibits NEFA release (Vijayakumar et al., 2017). Thus, we examined the effect of HK2 loss on NEFA release. Ex vivo, insulin inhibited isoproterenol-induced NEFA release in adipose tissue from control mice, but not in explants from AdHk2KO mice (Figure 6E). In vivo, glucose administration inhibited NEFA release only in control mice (Figure 6F–G) despite similar physiological increases insulin levels in fasted AdHk2KO and control mice (Figure 5—figure supplement 1B), in agreement with the above ex vivo experiment. These findings suggest that loss of HK2 simultaneously inhibits lipogenesis and promotes NEFA release in adipose tissue, both of which contribute to de-repression of hepatic glucose production.

Mechanisms of HFD-induced HK2 down-regulation

Our findings suggest that HFD causes loss of adipose HK2 and thereby triggers hyperglycemia. How does HFD down-regulate adipose HK2? To answer this question, we first examined Hk2 mRNA expression in HFD- and ND-fed mice. HFD-fed mice exhibited decreased Hk2 mRNA in sWAT but not in vWAT or BAT (Figure 7A). This suggests that HK2 synthesis is down-regulated at the transcriptional level in sWAT, and at a post-transcriptional level in vWAT and BAT. To investigate the post-transcriptional mechanism, we measured synthesis of HK2 in vWAT of HFD-fed mice. vWAT explants from HFD- or ND-fed mice were treated with L-azidohomoalanine (AHA), a methionine analog, and AHA-containing polypeptides were purified and quantified by mass spectrometry (Supplementary file 3). The amount of AHA-containing HK2 polypeptides was significantly decreased in vWAT explants from HFD-fed mice (Figure 7B). Thus, HFD down-regulates HK2 in vWAT by inhibiting Hk2 mRNA translation.

Figure 7 with 1 supplement see all
Download asset Open asset
Mechanism of HFD-induced HK2 down-regulation in adipose tissue.

(A) Hk2 mRNA levels in sWAT, vWAT, and BAT from ND- and 4 week HFD-fed mice. Student’s t test, **p<0.01. n=10 (sWAT from ND and HFD), 10 (vWAT from ND and HFD), 8 (BAT from ND), 10 (BAT from HFD). (B) Nascent polypeptides. vWATs isolated from ND- or 4 week HFD-fed mice were labled with L-azidohomoalanine (AHA), and AHA-incorporated polypeptides were measured by mass spectrometer. FASN and ACC serve as positive controls and CALX serves as a negative control. Multiple t test, *p<0.05, **p<0.01. n=4 (ND) and 4 (HFD). (C) Foxk1 and Foxk2 mRNA levels in sWAT from ND- or 4 week HFD-fed mice. Multiple t test, **p<0.01, ***p<0.001. n=10 (ND) and 10 (HFD). (D) Foxk1 and Foxk2 mRNA levels in vWAT of ND- or 4 week HFD-fed wild-type C57BL6JRj mice. No significant difference in multiple t test. n=10 (ND) and 10 (HFD). (E) Foxk1 and Foxk2 mRNA levels in BAT of ND- or 4 week HFD-fed wild-type C57BL6JRj mice. No significant difference in multiple t test. n=8 (ND) and 10 (HFD). See Figure 7—source data 1.

Figure 7—source data 1

Source data for graphs for Figure 7.

https://cdn.elifesciences.org/articles/85103/elife-85103-fig7-data1-v1.zip

Are there any other adipose proteins post-transcriptionally regulated like HK2? In our AHA-proteomics dataset (Supplementary file 3), we identified 155 proteins whose AHA incorporation positively correlated with HK2 AHA-incorporation. Pathway enrichment analysis of the 155 proteins yielded ribosomal proteins, the electron transport chain (ETC), oxidative phosphorylation (OXPHOS), fatty acid synthesis, and glycolysis as the top 5 pathways (Figure 7—figure supplement 1A–D). As demonstrated in Figure 6, downregulation of enzymes in fatty acid synthesis (e.g. FASN and ACC) was mainly due to reduced transcription (Figure 7—figure supplement 1C). However, reduced AHA-incorporation in ribosomal, ETC, and OXPHOS proteins was post-transcriptional (Figure 7—figure supplement 1B), suggesting that these proteins might be regulated in a manner similar to HK2. Regulated protein synthesis in adipose tissue may play an important role in the development of hyperglycemia.

It was recently reported that the forkhead transcription factors FOXK1 and FOXK2 promote Hk2 transcription in adipose tissue (Sukonina et al., 2019). We investigated whether the transcriptional down-regulation of Hk2 in sWAT is due to loss of FOXK1 and FOXK2. Foxk1 and Foxk2 expression was significantly decreased in sWAT, but not in vWAT or BAT, of HFD-fed mice (Figure 7C–E). Thus, HFD appears to down-regulate HK2 in sWAT by inhibiting FOXK1/2 and, thereby, expression of the Hk2 gene.

Discussion

How obesity causes insulin insensitivity and hyperglycemia is a long-standing question. In this study, we show that HFD causes hyperglycemia by inducing loss of HK2 specifically in adipose tissue. Loss of adipose HK2 is sufficient to cause glucose intolerance, in two ways (Figure 8). First, HK2 loss results in reduced glucose disposal by adipose tissue due to the inability of adipocytes to trap and metabolize non-phosphorylated glucose (Figure 5A). Second, loss of HK2 in adipocytes de-represses glucose production in liver (Figure 5B). We propose that loss of adipose HK2 is a mechanism of diet-induced insulin insensitivity and hyperglycemia.

Figure 8
Download asset Open asset
Diet-induced HK2 in adipose tissue promotes glucose intolerance.

(A) HK2 promotes lipogenesis and suppresses NEFA release in adipose tissue (left), suppressing hepatic glucose production (right) and thus maintaining glucose homeostasis. (B) Diet-induced loss of adipose HK2 triggers glucose intolerance via reduced glucose disposal in adipocytes (left) and de-repressed hepatic gluconeogenesis despite maintained lipogenesis (right).

In liver, insulin normally represses glucose production to decrease blood glucose and up-regulates lipogenesis to increase energy storage. Paradoxically, in type 2 diabetes, insulin fails to inhibit glucose production yet stimulates lipogenesis, hence the liver is selectively insulin resistant (Brown and Goldstein, 2008). Furthermore, previous findings suggest that selective insulin resistance occurs despite intact hepatic insulin signaling (Titchenell et al., 2016). Consistent with these previous findings, we observed that loss of adipose HK2 causes selective insulin resistance without affecting hepatic insulin signaling. Thus, we propose that loss of adipose HK2 is a mechanism for selective insulin resistance in liver and ultimately diabetes.

How does adipose HK2 control hepatic glucose production? As described above, one possible explanation is that decreased lipogenesis and increased NEFA release in adipose tissue, due to loss of HK2, promotes glucose production (Figure 6; Perry et al., 2015; Titchenell et al., 2016; Vijayakumar et al., 2017). Another interesting possibility is that loss of adipose HK2 causes increased hepatic glucose production via the central nervous system (CNS). Adipose tissue has a sensory nervous system (Blaszkiewicz et al., 2019; Fishman and Dark, 1987; Frei et al., 2022; Kreier et al., 2006; Makwana et al., 2021; Song et al., 2009; Wang et al., 2022) which may communicate with the liver via the sympathetic nervous system. Sympathetic activity promotes hepatic glucose production (Niijima and Fukuda, 1973; Shimazu and Fukuda, 1965). The above two models are not mutually exclusive since released bioactive fatty acids could act directly on the liver and/or adipose sensory neurons. A third possibility to explain increased hepatic glucose production is that increased glucose uptake by the liver due to reduced glucose disposal in adipose tissue may stimulate hepatic glucose production, consistent with the demonstration by Kim et al. that hepatic ChREBP promotes glucose production (Kim et al., 2016).

The phenotype of AdHk2KO mice is similar to that of adipose-specific GLUT4 knockout mice (Abel et al., 2001). Both knockout mice display reduced lipogenesis in adipose tissue and are hyperglycemic due to decreased glucose disposal in adipose tissue and increased glucose production in the liver (Vijayakumar et al., 2017). The phenotypic similarity of GLUT4 and HK2 knockout mice underscores the importance of adipose glucose metabolism in systemic insulin sensitivity and glucose homeostasis. However, our findings on diet-induced HK2 downregulation provide important new insight on the development of diet-induced hyperglycemia. First, unlike GLUT4, HK2 downregulation in adipose tissue correlates with HFD-induced hyperglycemia in mice (Figure 1—figure supplement 2). Second, it has been shown that glucose or a downstream metabolite(s) promotes ChREBP activity and lipogenesis in metabolic organs including adipose tissue (Ortega-Prieto and Postic, 2019). Two previous studies demonstrated that HFD prevents ChREBP activation and lipogenesis in adipose tissue, which leads to hyperglycemia due to enhanced hepatic glucose production in mice (Herman et al., 2012; Vijayakumar et al., 2017). Importantly, one of these studies showed that HFD inhibits ChREBP activity in adipose tissue independently of GLUT4 expression (Herman et al., 2012), concluding that the underlying mechanism of HFD-induced inhibition of ChREBP and hyperglycemia is still unknown. Our findings suggest that the physiological mechanism of HFD-induced inhibition of adipose ChREBP and lipogenesis, and consequently hyperglycemia, may be loss of HK2. Thus, we propose that the primary defect in adipose tissue of HFD-fed mice is not at the level of GLUT4 expression and glucose transport, but rather at the level of HK2 expression and glucose phosphorylation.

Can HFD-resistant HK2 expression in adipose tissue prevent diet-induced insulin insensitivity and hyperglycemia? To this point, our attempts to express HK2 in WAT of HFD-fed mice were unsuccessful (unpublished data), most likely because HK2 expression is tightly controlled at the post-transcriptional level (Figure 7). Importantly, expression of glucokinase (also known as HK4, hepatic hexokinase) in adipose tissue has been shown to prevent insulin insensitivity in HFD-fed mice (Muñoz et al., 2010). Elucidating the molecular mechanism of HFD-induced translational repression of HK2 may lead to a novel strategy in the treatment of insulin insensitivity and type 2 diabetes.

A previous study demonstrated that global heterozygous Hk2 knockout mice have normal, even better, glucose tolerance compared to controls (Heikkinen et al., 1999). How can one explain this apparent discrepancy between global Hk2 knockout and our adipose-specific Hk2 knockout? We note that adipose-specific GLUT4 knockout mice display glucose intolerance (Abel et al., 2001), but global GLUT4 knockout mice are glucose tolerant due to a compensatory increase in glucose uptake in liver (Katz et al., 1995; Ranalletta et al., 2005). We observed increased systemic glycolysis in AdHk2KO mice (Figure 4—figure supplement 3F). Global ablation of HK2 mice may provoke an even stronger compensatory response to maintain systemic glucose homeostasis. This may also explain the observation that global heterozygous Hk2 knockout mice display better glucose handling than wild-type controls (Heikkinen et al., 1999).

We note that Hk2 knockout did not completely phenocopy to the effect of obesity in mice and humans. While HK2 was decreased approximately 75% in vWAT of AdHk2KO mice (Figure 4A), HK2 expression in HFD-fed mice and HK activity in oWAT from obese patients were decreased only ~60% and~30%, respectively (Figure 1B and G). Is the reduction in HK2 in obese mice and patients sufficient to contribute to systemic insulin insensitivity and glucose intolerance? A previous study showed that adipose-specific Rab10 knockout mice display reduced GLUT4 translocation to the plasma membrane and thus a ~50% reduction in insulin-stimulated glucose disposal, in isolated adipocytes (Vazirani et al., 2016). Importantly, adipose-specific Rab10 knockout mice failed to suppress hepatic glucose production and were thus insulin insensitive, indicating that a limited disruption in glucose metabolism in adipose tissue can significantly impact systemic insulin sensitivity and glucose homeostasis. Thus, the partial loss of HK2 observed in obese mice and patients may be sufficient to impact systemic insulin sensitivity and thereby glucose homeostasis.

We found an HK2-R42H mutation in naturally hyperglycemic Mexican cavefish. To date, no human monogenic disease has been reported associated with mutations in the HK2 gene. However, 12 R42W and 4 R42Q alleles are reported in the genomAD database (Karczewski et al., 2020). Further studies are required to determine whether these alleles are loss-of-function and associated with diabetes.

Materials and methods

Mouse

Wild-type C57BL/6JRj mice were purchased from JANVIER LABS (Le Genest-Saint-lsle, France). Mice carrying Hk2 with exons 4–10 flanked by loxP sites (Hk2fl/fl) were previously described (Patra et al., 2013). Adipoq-CreERT2 mice were provided by Prof. Stefan Offermanns (MPI-HLR, Germany)(Sassmann et al., 2010). Hk2fl/fl mice were crossed with Adipoq-CreERT2 mice, and resulting Cre positive Hk2fl/+ mice were crossed with Hk2fl/fl mice to generate adipocyte-specific Hk2 knockout (Adipoq-CreERT2 positive Hk2fl/fl) mice (AdHk2KO). Hk2 knockout was induced by i.p. injection of 1 mg/mouse tamoxifen (Sigma-Aldrich, St. Louis, Missouri) in corn oil (Sigma-Aldrich, St. Louis, Missouri) for 7 days. Littermate Cre negative animals were used as a control. Control mice were also treated with tamoxifen.

Mice were housed at 22 °C in a conventional facility with a 12 hours light/dark cycle with unlimited access to water, and normal diet (ND, KLIBA NAFAG, Kaiseraugst, Switzerland) or high-fat diet (HFD: 60% kcal % fat NAFAG 2127, KLIBA, Kaiseraugst, Switzerland). Only male mice between 6 and 17 weeks of age were used for experiments.

Plasmids

pTwist-surface HK2 and pTwist-Molino HK2 plasmids were purchased from Twist Bioscience (South San Francisco, California). The R42H mutation was introduced into the pLenti-CMV-ratHK2 (DeWaal et al., 2018) by PCR using the oligos 5’atttctaggcACttccggaaggagatggagaaag3’ and 5’cttccggaaGTgcctagaaatctccagaagggtc3’. The desired sequence change was confirmed.Figure 4—figure supplement 1.

Cell culture

3T3-L1 and HEK293T cells were obtained from ATCC. We perform mycoplasma contamination every three month. The cell lines used were mycoplasma negative. HEK293T cells were cultured in M1 medium composed of DMEM high glucose (Sigma-Aldrich, St. Louis, Missouri) supplemented with 4 mM glutamine (Sigma-Aldrich, St. Louis, Missouri), 1 mM sodium pyruvate (Sigma-Aldrich, St. Louis, Missouri), 1 x penicillin and streptomycin (Sigma-Aldrich, St. Louis, Missouri), and 10% FBS (ThermoFisher Scientific, Waltham, Massachusetts). 3T3-L1 cells were cultured and differentiated as previously described (Zebisch et al., 2012). In brief, 3T3-L1 preadipocyte cells were maintained in M1 medium at 37 °C incubator with 5% CO2. For differentiation, cells were maintained in M1 medium for 2 days after reaching confluence. The cells were then transferred to M2 medium composed of M1 medium supplemented with 1.5 µg/mL insulin (Sigma-Aldrich, St. Louis, Missouri), 0.5 mM IBMX (AdipoGen LIFE SCIENCES, Liestal, Switzerland), 1 µM dexamethasone (Sigma-Aldrich, St. Louis, Missouri), and 2 µM rosiglitazone (AdipoGen LIFE SCIENCES, Liestal, Switzerland), defined as day 0 post-differentiation. After 2 days, the cells were transferred to M3 medium (M1 with 1.5 µg/mL insulin). At day 4 post-differentiation, cells were transferred back to M2 medium. From day 6 post-differentiation, cells were maintained in M3 with medium change every 2 days.

For Hk2 knockdown, MISSION shRNA (TRCN0000280118) or control pLKO plasmid were purchased from Sigma-Aldrich (St. Louis, Missouri) and co-transfected with psPAX2 (a gift from Didier Trono: Addgene plasmid # 12260) and pCMV-VSV-G (Stewart et al., 2003; a gift from Robert Weinberg: Addgene plasmid # 8454) into HEK293T cells. Supernatants containing lentivirus were collected one day after transfection, and used to infect undifferentiated 3T3-L1 cells. Transduced cells were selected by puromycin (Thermo Fisher Scientific, Waltham, Massachusetts). For all experiments, 8–14 days post-differentiated cells were used.

For HK2 overexpression in HEK293T cells, plasmids were transfected with jetPRIME (Polyplus-transfection, Illkirch-Graffenstaden, France) following manufacturer’s instructions.

Human biopsies

Omental white adipose tissue (oWAT) biopsies were obtained from lean subjects with normal fasting glucose level and body mass index (BMI) <27 kg/m2, from obese non-diabetic subjects with BMI >35 kg/m2 HbA1c<6.0%, and from obese diabetic sujects with BMI >35 kg/m2 HbA1c>6.1% (Supplementary file 2). All subjects gave informed consent before the surgical procedure. Patients were fasted overnight and underwent general anesthesia. All oWAT specimens were obtained between 8:30 and 12:00 am, snap-frozen in liquid nitrogen, and stored at –80 °C for subsequent use.

Proteomics

Tissues were pulverized and homogenized in a tissue lysis buffer containing 100 mM Tris (VWR, Radnor, Pennsylvania)-HCl (Merck, Burlington, Massachusetts) pH7.5, 2 mM EDTA (Sigma-Aldrich, St. Louis, Missouri), 2 mM EGTA (Sigma-Aldrich, St. Louis, Missouri), 150 mM NaCl (Sigma-Aldrich, St. Louis, Missouri), 1% Triton X-100 (Fluka Chemie, Buchs, Switzerland), cOmplete inhibitor cocktail (Sigma-Aldrich, St. Louis, Missouri) and PhosSTOP (Sigma-Aldrich, St. Louis, Missouri). Proteins were precipitated by trichloroacetic acid (Sigma-Aldrich, St. Louis, Missouri) and the resulting protein pellets were washed with cold acetone (Merck, Burlington, Massachusetts). 25 μg of peptides were labeled with isobaric tandem mass tags (TMT 10-plex, Thermo Fisher Scientific, Waltham, Massachusetts) as described previously (Ahrné et al., 2016). Shortly, peptides were resuspended in 20 μl labeling buffer (2 M urea (Sigma-Aldrich, St. Louis, Missouri), 0.2 M HEPES (Sigma-Aldrich, St. Louis, Missouri), pH 8.3) and 5 μL of each TMT reagent were added to the individual peptide samples followed by a 1 hour incubation at 25 °C. To control for ratio distortion during quantification, a peptide calibration mixture consisting of six digested standard proteins mixed in different amounts was added to each sample before TMT labeling. To quench the labelling reaction, 1.5 μL aqueous 1.5 M hydroxylamine solution (Merck, Burlington, Massachusetts) was added and samples were incubated for another 10 min at 25 °C followed by pooling of all samples. The pH of the sample pool was increased to 11.9 by adding 1 M phosphate buffer pH 12 (Sigma-Aldrich, St. Louis, Missouri) and incubated for 20 min at 25 °C to remove TMT labels linked to peptide hydroxyl groups. Subsequently, the reaction was stopped by adding 2 M hydrochloric acid (Merck, Burlington, Massachusetts) and until a pH <2 was reached. Finally, peptide samples were further acidified using 5% TFA (Thermo Fisher Scientific, Waltham, Massachusetts), desalted using Sep-Pak Vac 1 cc (50 mg) C18 cartridges (Waters, Milford, Massachusetts) according to the manufacturer’s instructions and dried under vacuum.

TMT-labeled peptides were fractionated by high-pH reversed phase separation using a XBridge Peptide BEH C18 column (3,5 µm, 130 Å, 1 mm x 150 mm, Waters, Milford, Massachusetts) on an 1260 Infinity HPLC system (Agilent Technologies, Santa Clara, California). Peptides were loaded on column in buffer A (20 mM ammonium formate (Sigma-Aldrich, St. Louis, Missouri) in water, pH 10) and eluted using a two-step linear gradient from 2% to 10% in 5 min and then to 50% buffer B (20 mM ammonium formate (Sigma-Aldrich, St. Louis, Missouri) in 90% acetonitrile (Thermo Fisher Scientific, Waltham, Massachusetts), pH 10) over 55 min at a flow rate of 42 µl/min. Elution of peptides was monitored with a UV detector (215 nm, 254 nm) and a total of 36 fractions were collected, pooled into 12 fractions using a post-concatenation strategy as previously described (Wang et al., 2011) and dried under vacuum.

Dried peptides were resuspended in 20 μl of 0.1% aqueous formic acid (Sigma-Aldrich, St. Louis, Missouri) and subjected to LC–MS/MS analysis using a Q Exactive HF Mass Spectrometer fitted with an EASY-nLC 1000 (both Thermo Fisher Scientific, Waltham, Massachusetts) and a custom-made column heater set to 60 °C. Peptides were resolved using a RP-HPLC column (75 μm×30 cm) packed in-house with C18 resin (ReproSil-Pur C18–AQ, 1.9 μm resin; Dr. Maisch GmbH, Ammerbuch, Germany) at a flow rate of 0.2 μL/min. The following gradient was used for peptide separation: from 5% B to 15% B over 10 min to 30% B over 60 min to 45% B over 20 min to 95% B over 2 min followed by 18 min at 95% B. Buffer A was 0.1% formic acid (Sigma-Aldrich, St. Louis, Missouri) in water and buffer B was 80% acetonitrile (Thermo Fisher Scientific, Waltham, Massachusetts), 0.1% formic acid (Sigma-Aldrich, St. Louis, Missouri) in water.

The mass spectrometer was operated in DDA mode with a total cycle time of approximately 1 s. Each MS1 scan was followed by high-collision-dissociation (HCD) of the 10 most abundant precursor ions with dynamic exclusion set to 30 s. For MS1, 3e6 ions were accumulated in the Orbitrap over a maximum time of 100 ms and scanned at a resolution of 120,000 FWHM (at 200 m/z). MS2 scans were acquired at a target setting of 1e5 ions, accumulation time of 100 ms and a resolution of 30,000 FWHM (at 200 m/z). Singly charged ions and ions with unassigned charge state were excluded from triggering MS2 events. The normalized collision energy was set to 35%, the mass isolation window was set to 1.1 m/z and one microscan was acquired for each spectrum.

The acquired raw-files were converted to the mascot generic file (mgf) format using the msconvert tool (part of ProteoWizard, version 3.0.4624 (2013-6-3)). Using the MASCOT algorithm (Version 2.4.1, Matrix Science, Boston Massachusetts), the mgf files were searched against a decoy database containing normal and reverse sequences of the predicted SwissProt entries of Mus musculus (https://www.ebi.ac.uk/, release date 2014/11/24), the six calibration mix proteins (Ahrné et al., 2016) and commonly observed contaminants (in total 50214 sequences for Mus musculus) generated using the SequenceReverser tool from the MaxQuant software (Version 1.0.13.13). The precursor ion tolerance was set to 10 ppm and fragment ion tolerance was set to 0.02 Da. The search criteria were set as follows: full tryptic specificity was required (cleavage after lysine or arginine residues unless followed by proline), 3 missed cleavages were allowed, carbamidomethylation (C) and TMT6plex (K and peptide N-terminus) were set as fixed modification and oxidation (M) as a variable modification. Next, the database search results were imported into the Scaffold Q+software (version 4.3.2, Proteome Software Inc, Portland, Oregon) and the protein false identification rate was set to 1% based on the number of decoy hits. Proteins that contained similar peptides and could not be differentiated based on MS/MS analysis alone were grouped to satisfy the principles of parsimony. Proteins sharing significant peptide evidence were grouped into clusters. Acquired reporter ion intensities in the experiments were employed for automated quantification and statically analysis using a modified version of our in-house developed SafeQuant R script (Ahrné et al., 2016). This analysis included adjustment of reporter ion intensities, global data normalization by equalizing the total reporter ion intensity across all channels, summation of reporter ion intensities per protein and channel, calculation of protein abundance ratios and testing for differential abundance using empirical Bayes moderated t-statistics. Finally, the calculated p-values were corrected for multiple testing using the Benjamini−Hochberg method (q-value). Deregulated proteins were selected by log2(fold change)>0.6 or log2(fold change)<–0.6, q-value <0.01.

Immunoblots

Tissues or cells were homogenized in a lysis buffer containing 100 mM Tris (Merck, Burlington, Massachusetts) pH7.5, 2 mM EDTA (Sigma-Aldrich, St. Louis, Missouri), 2 mM EGTA (Sigma-Aldrich, St. Louis, Missouri), 150 mM NaCl (Sigma-Aldrich, St. Louis, Missouri), 1% Triton X-100 (Fluka Chemie, Buchs, Switzerland), cOmplete inhibitor cocktail (Sigma-Aldrich, St. Louis, Missouri) and PhosSTOP (Sigma-Aldrich, St. Louis, Missouri). Protein concentration was determined by the Bradford assay (Bio-rad), and equal amounts of protein were separated by SDS-PAGE, and transferred onto nitrocellulose membranes (GE Healthcare, Chicago, Illinois). Antibodies used in this study were as follows: AKT (Cat#4685 or Cat#2920), AKT-pS473 (Cat#4060), AKT-pT308 (Cat#13038), PRAS40-pT246 (Cat#2997), PRAS40 (Cat#2691), HK2 (Cat#2867), S6-pS240/244 (Cat#5364), S6 (Cat#2217), FASN (Cat#3189), ACC (Cat#3662), HA tag (Cat#3724) and ChREBP (Cat#58069) from Cell Signaling Technology (Danvers, Massachusetts), GLUT4 (Cat# NBP2-22214, Bio-Techne, Abingdon, United Kingdom), HSP90, (Cat#sc-13119, Santa Cruz Biotechnology, Dallas, Texas), CALNEXIN (Cat#ADI-SPA-860-F, Enzo Life Sciences, Farmingdale, New York) and ACTIN (Cat#MAB1501, Merck, Burlington, Massachusetts). For quantification, the specific signals were normalized to a loading control.

Metabolomics

Tissues (25–30 mg) were finely ground in a cryogenic grinding before the extraction. Metabolite extraction was performed, in a mixture ice/dry ice, by a cold two-phase methanol–water–chloroform extraction (Elia et al., 2017; van Gorsel et al., 2019). The samples were resuspended in 900 μl of precooled methanol/water (5/3) (v/v) and 100 µL of 13C yeast internal standard. Afterwards, 500 μl of precooled chloroform was added to each sample. Samples were vortexed for 10 min at 4 °C and then centrifuged (max. speed, 10 min, 4 °C). The methanol–water phase containing polar metabolites was separated and dried using a vacuum concentrator at 4 °C overnight and stored at −80 °C.

For the detection of the pentose phosphate pathway and glycolysis intermediates by LC-MS, a 1290 Infinity II liquid chromatography (Agilent Technologies, Santa Clara, California) with a thermal autosampler set at 4 °C, coupled to a Q-TOF 6546 mass spectrometer (Agilent Technologies, Santa Clara, California) was used. Samples were resuspended in 100 µL of 50% methanol and a volume of 5 µL and 20 μL of sample were injected on Agilent InfinityLab Poroshell 120 HILIC-Z column, 2.1 mm × 150 mm, 2.7 μm, PEEK-lined. The separation of metabolites was achieved at 50 °C with a flow rate of 0.25 ml/min. A gradient was applied for 32 min (solvent A: 10 mM ammonium acetate in water with 2.5 μM InfinityLab Deactivator Additive, pH = 9 – solvent B: 10 mM ammonium acetate in water/acetonitrile 15:85 (v:v) with 2.5 μM InfinityLab Deactivator Additive, pH = 9) to separate the targeted metabolites (0 min: 96%B, 2 min: 96%B, 5.5 min: 88%B, 8.5 min: 88%B, 9 min: 86%B, 14 min: 86%B, 19 min: 82%B; 25 min: 65%B, 27 min: 65%B, 28 min: 96%B; 32 min: 96%B).

The MS operated in negative full scan mode (m/z range: 50–1200) using a shealth gas temperature of 350 °C (12 L/min) and a gas temperature at 225 °C (13 L/min). The nebulizer was set at 35 psi, the fragmentor at 125 V and the capillary at 3500 V. Data was collected using the Masshunter software (Agilent Technologies, Santa Clara, California) and normalized by 13C yeast internal standard and the protein content.

For the detection of Acetyl-CoA by LC-MS, a Dionex UltiMate 3000 LC System (Thermo Fisher Scientific, Waltham, Massachusetts) with a thermal autosampler set at 4 °C, coupled to a Q Exactive Orbitrap mass spectrometer (Thermo Fisher Scientific, Waltham, Massachusetts) was used. Samples were resuspended in 100 µL of 50% MeOH and a volume of 10 μl of sample was injected on a C18 column (Acquity UPLC HSS T3 1.8 µm 2.1x100 mm). The separation of metabolites was achieved at 40 °C with a flow rate of 0.25 ml/min. A gradient was applied for 40 min (solvent A: 10 mM Tributyl-Amine, 15 mM acetic acid – solvent B: Methanol) to separate the targeted metabolites (0 min: 0%B, 2 min: 0%B, 7 min: 37%B, 14 min: 41%B, 26 min: 100%B, 30 min: 100%B, 31 min: 0%B; 40 min: 0%B).

The MS operated in negative full scan mode (m/z range: 70–1050 and 750–850 from 5 to 25 min) using a spray voltage of 4.9 kV, capillary temperature of 320 °C, sheath gas at 50.0, auxiliary gas at 10.0. Data was collected using the Xcalibur software (Thermo Fisher Scientific, Waltham, Massachusetts) and analyzed with Matlab for the correction of natural abundance. Data were normalized by 13C yeast internal standard and the protein content.

RNA isolation and quantitative RT-PCR

Total RNA was isolated with TRIzol reagent (Sigma-Aldrich, St. Louis, Missouri) and RNeasy kit (Qiagen, Hilden, Germany). RNA was reverse-transcribed to cDNA using iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, California). Semiquantitative real-time PCR analysis was performed using fast SYBR green (Applied Biosystems, Waltham, Massachusetts). Relative expression levels were determined by normalizing each CT values to Tbp using the ∆∆CT method. The sequence for the primers (Microsynth, Balgach, Switzerland) used in this study was as follows:

  • Fasn-fw: 5’GCTGCGGAAACTTCAGGAAAT3’,

  • Fasn-rv: 5’AGAGACGTGTCACTCCTGGACTT3’,

  • Acc-fw: 5’AAGGCTATGTGAAGGATG3’,

  • Acc-rv: 5’CTGTCTGAAGAGGTTAGG3’,

  • G6pc-fw: 5’CCATGCAAAGGACTAGGAACAA3’,

  • G6pc-rv: 5’TACCAGGGCCGATGTCAAC3’,

  • Pepck-fw: 5’CCACAGCTGGTGCAGAACA3’,

  • Pepck-rv: 5’GAAGGGTCGATGGCAAA3’,

  • Chrebp-fw: 5’CACTCAGGGAATACACGCCTAC3’,

  • Chrebp-rv: 5’ATCTTGGTCTTAGGGTCTTCAGG3’,

  • Chrebp-alpha-fw: 5’CGACACTCACCCACCTCTTC3’,

  • Chrebp-alpha-rv: 5’TTGTTCAGCCGGATCTTGTC3’,

  • Chrebp-beta-fw: 5’TCTGCAGATCGCGTGGAG3’,

  • Chrebp-beta-rv: 5’CTTGTCCCGGCATAGCAAC3’,

  • Hk2-fw: 5’ACGGAGCTCAACCAAAACCA3’,

  • Hk2-rv: 5’TCCGGAACCGCCTAGAAATC3’,

  • Foxk1-fw: 5’GGCTGTCACTCAGAATGGAA3’,

  • Foxk1-rv: 5’GAGGCAGATGTGGTAGTGGAG3’,

  • Foxk2-fw: 5’CCACGGGAACTATCAGTGCT3’,

  • Foxk2-rv: 5’GTCATCCTTTGGGCTGTCTC3’,

  • Lep-fw: 5’TCACACACGCAGTCGGTATC3’,

  • Lep-rv: 5’ACTCAGAATGGGGTGAAGCC3’,

  • Adipoq-fw: 5’TGACGACACCAAAAGGGCTC3’,

  • Adipoq-rv: 5’ACGTCATCTTCGGCATGACT3’,

  • aP2-fw: 5’TCGGTTCCTGAGGATACAAGAT3’,

  • aP2-rv: 5’TTTGATGACTGTGGGATTGAAG3’,

  • Ucp1-fw: 5’TGATGAAGTCCAGACAGACAGTG3’,

  • Ucp1-rv: 5’TTATTCGTGGTCTCCCAGCATAG3’,

  • Dio2-fw: 5’GAGGAAGGAAGAAGAGGAAGCAA3’,

  • Dio2-rv: 5’TTCTTCCAGTGTTTTGGACATGC3’,

  • Tbp-fw: 5’TGCTGTTGGTGATTGT3’,

  • Tbp-rv: 5’CTTGTGTGGGAAAGAT3’.

Hexokinase assay

For measuring hexokinase activity of surface fish HK2, Molino HK2, wild-type rat HK2 or rat HK2-R42H, HEK293T cells were transfected with plasmids containing these HK2 sequences, and cells were harvested at 24 hours after transfection. Hexokinase activity were measured with cell lysates or tissue lysates with a hexokinase assay kit (Abcam, Cambridge, United Kingdom) following manufacturer’s instructions. The final glucose concentration in the hexokinase assay was 4 mM. The hexokinase activities were normalized to the protein content in lysates.

Seahorse analyses

Measurements were performed with an XF96 Extracellular Flux Analyzer (Seahorse Bioscience of Agilent Technologies, Santa Clara, California) following manufacturer’s instructions.

Lactate measurement

Differentiated adipocytes were starved serum overnight and stimulated with 100 nM insulin for 2 hours. Extracellular lactate was measured with the Lactate Pro 2 analyzer (Axon Lab, Stuttgart, Germany).

3H-2DG uptake assay in vitro

Differentiated adipocytes were starved for serum for 5 hours and then incubated in Krebs Ringer Phosphate Hepes (KRPH) buffer composed of 0.6 mM Na2HPO4 (Fluka Chemie, Buchs, Switzerland), 0.4 mM NaH2PO4 (Fluka Chemie, Buchs, Switzerland), 120 mM NaCl (Sigma-Aldrich, St. Louis, Missouri), 6 mM KCl (Merck), 1 mM CaCl2 (Merck, Burlington, Massachusetts), 1.2 mM MgSO4 (Merck, Burlington, Massachusetts), 12.5 mM HEPES (Thermo Fisher Scientific, Waltham, Massachusetts), 0.2% fatty acid-free BSA (Sigma-Aldrich, St. Louis, Missouri) pH7.4 with or without 100 nM insulin (Sigma-Aldrich, St. Louis, Missouri) for 20 min. Cells were incubated with cold 50 µM 2DG (Sigma-Aldrich, St. Louis, Missouri) containing 0.25 µCi 3H-2-deoxyglucose (2DG, Perkin Elmer, Waltham, Massachusetts) for 5 min and washed three times with cold PBS (Sigma-Aldrich, St. Louis, Missouri). Cells were lysed in the tissue lysis buffer and cleared by centrifugation at 14,000 g for 10 min. Incorporated 3H-2DG was measured with a scintillation counter (Perkin Elmer, Waltham, Massachusetts).

Insulin tolerance test, glucose tolerance test, pyruvate tolerance test

For the insulin and glucose tolerance tests, mice were fasted for 6 hours and insulin Humalog (i.p. 0.75 or 0.5 U/kg body weight, Lilly, Indianapolis, Indiana) or glucose (2 g/kg body weight, Sigma-Aldrich, St. Louis, Missouri) was given, respectively. For the pyruvate tolerance test, mice were fasted for 15 hours and pyruvate (2 g/kg body weight, Sigma-Aldrich, St. Louis, Missouri) was administered. Blood glucose was measured with a blood glucose meter (Accu-Check, Roche Diabetes Care, Indiana polis, Indiana).

Hyperinsulinemic-euglycemic clamp

Hyperinsulinemic-euglycemic clamp was performed as previously described (Smith et al., 2018). In brief, mice were fasted for 6 hours and anesthetized by i.p. injection of 6.25 mg/kg acetylpromazine (Fatro, Bologna, Italy), 6.25 mg/kg midazolam (Sintetica, Val-de-Travers, Switzerland) and 0.31 mg/kg fentanyl (Mepha, Aesch, Switzerland). An infusion needle were placed into the tail vein and 3H-glucose (Parkin Elmer, Waltham, Massachusetts) was infused for 60 min to achieve steady-state levels. Thereafter, the hyperinsulinemic clamp started with a bolus dose (3.3mU) and a constant infusion of insulin (0.09 mU/min) and 3H-glucose. A variable infusion of 12.5% D-glucose (Sigma-Aldrich, St. Louis, Missouri) was used to maintain euglycemia. Blood glucose was measured with a a blood glucose meter (Accu-Check, Roche Diabetes Care, Indiana polis, Indiana) every 5–10 min and the glucose infusion rate was adjusted to maintain euglycemia. Blood samples were taken to determine steady-state levels of [3H]-glucose. After 90 min from the start of the insulin clamp, 14C-2-Deoxyglucose (Parkin Elmer, Waltham, Massachusetts) was i.p. administered to assess tissue-specific glucose uptake. Mice were euthanized by cervical dislocation and the organs were removed and frozen. 3H-glucose and 14C-2-DG phosphate counts in plasma and tissues were measured by a scintillation counter.

Hematoxylin and eosin staining

Tissues were fixed in 4% formalin (Leica Biosystems, Wetzlar, Germany), embedded in paraffin (Leica Biosystems, Wetzlar, German), and sliced into 3-µm-thick section. Tissue sections were stained with Hematoxylin (Sigma-Aldrich, St. Louis, Missouri) and eosin (Waldeck, Münster, Germany), and imaged by Axio Scan. Z1 slidescanner (Zeiss, Oberkochen, Germany).

In vivo lipogenesis

Ad libitum-fed mice were i.p. injected with 1 mCi 3H-H2O (American Radiolabeled Chemicals, St. Louis, Missouri) and sacrificed with i.p.160 mg/kg ketamine (Streuli Pharma, Uznach, Switzerland) and 24 mg/kg xylazine (Streuli Pharma, Uznach, Switzerland). For triglyceride extraction, plasma samples were mixed with 1 mL of 2-propanol (Merck, Burlington, Massachusetts) /n-hexane (Merck, Burlington, Massachusetts) /1 N H2SO4 (Sigma-Aldrich, St. Louis, Missouri) (4:1:1) and incubated for 30 min. ddH2O and n-hexane were added and the resulting n-hexane phase was collected, dried, and counted by a scintillation counter.

Ex vivo lipogenesis

vWAT explants were washed and incubated with low glucose DMEM (Sigma-Aldrich, St. Louis, Missouri) supplemented with 2% fatty acid-free BSA (Sigma-Aldrich, St. Louis, Missouri) and 20 mM HEPES (Thermo Fisher Scientific, Waltham, Massachusetts). Explants were further washed with a buffer containing 10 mM HEPES (Thermo Fisher Scientific, Waltham, Massachusetts), 116 mM NaCl (Sigma-Aldrich, St. Louis, Missouri), 4 mM KCl (Merck, Burlington, Massachusetts), 1.8 mM CaCl2 (Merck, Burlington, Massachusetts), 1 mM MgCl2 (Fluka Chemie, Buchs, Switzerland), 4.5 mM D-glucose (Sigma-Aldrich, St. Louis, Missouri), and 2.5% fatty acid-free BSA (Sigma-Aldrich, St. Louis, Missouri). 2 µCi of 3H-H2O (Perkin Elmer) was added in the absence or presence of 100 nM insulin (Sigma-Aldrich, St. Louis, Missouri). After 4.5 hours, explants were washed with cold PBS (Sigma-Aldrich, St. Louis, Missouri) three times and frozen in liquid nitrogen. Triglycerides were extracted as described above and 1/3 of the n-hexane phase was used for triglyceride measurement. For fatty acid extraction, the remaining hexane phase was deacylated with ethanol (Merck, Burlington, Massachusetts):water:saturated KOH (Merck, Burlington, Massachusetts) (20:1:1) at 80 °C for 1 hour, neutralized with formic acid (Sigma-Aldrich, St. Louis, Missouri). Fatty acid was extracted with n-hexane and dried. The incorporation of 3H was counted by a scintillation counter and normalized to tissue weight.

Ex vivo NEFA release

vWAT explants were washed and incubated with low glucose DMEM (Sigma-Aldrich, St. Louis, Missouri) supplemented with 2% fatty acid-free BSA (Sigma-Aldrich, St. Louis, Missouri) and 20 mM HEPES (Thermo Fisher Scientific, Waltham, Massachusetts) for 2 hours. Explants were washed twice with Krebs-Ringer phosphate buffer (0.6 mM Na2HPO4 (Fluka Chemie, Buchs, Switzerland), 0.4 mM NaH2PO4 (Merck, Burlington, Massachusetts), 120 mM NaCl (Sigma-Aldrich, St. Louis, Missouri), 6 mM KCl (Merck, Burlington, Massachusetts), 1 mM CaCl2 (Merck, Burlington, Massachusetts), 1.2 mM MgSO4 (Merck, Burlington, Massachusetts), 70 mM HEPES (Thermo Fisher Scientific, Waltham, Massachusetts), 5 mM glucose (Sigma-Aldrich, St. Louis, Missouri), 2% fatty acid-free BSA (Sigma-Aldrich, St. Louis, Missouri), pH7,4). Explants were treated with DMSO or 10 µM isoproterenol (Sigma-Aldrich, St. Louis, Missouri) in the absence or presence of 100 nM insulin (Sigma-Aldrich, St. Louis, Missouri) for 2 hours. Explants were transferred to chloroform (Sigma-Aldrich, St. Louis, Missouri): methanol (Sigma-Aldrich, St. Louis, Missouri):100% acetic acid (Merck, Burlington, Massachusetts) (200:100:3) and incubated at 37 °C for 1 hour, and protein concentration was determined by BCA assay (Pierce). Non-esterified fatty acid levels in conditioned media were determined by a colorimetric assay kit (Sigma-Aldrich, St. Louis, Missouri), and normalized with protein amounts in the explants.

AHA-incorporation

vWAT from ND- or HFD-fed mice were immediately incubated in low glucose DMEM (Sigma-Aldrich, St. Louis, Missouri) containing 50 µM azidohomoalanine (AHA, Thermo Fisher Scientific, Waltham, Massachusetts) for 30 min. The tissues were frozen, pulverized, lysed by bio-rupture and clarified by centrifugation at 15,000 g for 15 min twice. 100 µg of protein was used for CLICK reaction (Thermo Fisher Scientific, Waltham, Massachusetts) chemistry following the manufacturer’s instructions. Biotinylated protein was pulled-down after mixing with streptavidin magnetic beads (Thermo Fisher Scientific, Waltham, Massachusetts) for 2 hours at 4 °C. The pulled-down protein was digested with trypsin (Promega, Madison, Wisconsin). The digested peptides were acidified using 5% TFA (Thermo Fisher Scientific, Waltham, Massachusetts) and desalted using C18 columns (Waters, Milford, Massachusetts). The eluted peptides were dried and analyzed by mass spectrometry.

Metabolites measurement

Plasma insulin levels were measured by ultrasensitive mouse insulin ELISA kit (Crystal Chem, Downers Grove, Illinois) according to the manufacturer’s instructions. Plasma Leptin levels were measured by mouse Leptin ELISA kit (Crystal Chem, Downers Grove, Illinois) according to the manufacturer’s instructions. Plasma Adiponectin levels were measured by mouse Adiponectin ELISA kit (Crystal Chem, Downers Grove, Illinois) according to the manufacturer’s instructions. Hepatic triglyceride levels were measured using a triglyceride assay kit (Abcam, Cambridge, United Kingdom) according to the manufacturer’s instructions. Plasma triglyceride and cholesterol levels were measured by a biochemical analyzer (Cobas c III analyser, Roche Diagnostics, Indianapolis, Indiana). Plasma NEFA levels were measured by colorimetric NEFA (Sigma-Aldrich, St. Louis, Missouri).

Body composition measurement

Body composition was measured by nuclear magnetic resonance imaging (Echo Medical Systems, Houston, Texas).

Study approval

All animal experiments were performed in accordance with federal guidelines for animal experimentation and were approved by the Kantonales Veterinäramt of the Kanton Basel-Stadt (#31986–3040) or KU Leuven animal ethical committee (#206/2020). For human biopsies, the study protocol was approved by the Ethikkomission Nordwest- und Zentralschweiz (EKNZ, BASEC 2016–01040).

Statistics

Sample size was chosen according to our previous studies and published reports in which similar experimental procedures were described. The investigators were not blinded to the treatment groups except for the hyperinsulinemic-euglycemic clamp study. All data are shown as the mean ± SEM. Sample numbers are indicated in each figure legend. For mouse experiments, n represents the number of animals, and for cell culture experiments, N indicates the number of independent experiments. To determine the statistical significance between 2 groups, an unpaired two-tailed Student’s t test, Mann-Whitney test, or multiple t test was performed. For more than three groups, one-way ANOVA was performed. For ITT, GTT, PTT, glucose infusion rate, weigh curve data, two-way ANOVA was performed. All statistical analyses were performed using GraphPad Prism 9 (GraphPad Software, San Diego, California). A p value of less than 0.05 was considered statistically significant.

Data availability

All gel images and numerical data are uploaded as source data.

References

    1. Shepherd PR
    2. Gnudi L
    3. Tozzo E
    4. Yang H
    5. Leach F
    6. Kahn BB
    (1993)
    Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue
    The Journal of Biological Chemistry 268:22243–22246.
    1. Wasserman DH
    (2009) Four grams of glucose
    American Journal of Physiology. Endocrinology and Metabolism 296:E11–E21.
    https://doi.org/10.1152/ajpendo.90563.2008

Decision letter

  1. Michael Czech
    Reviewing Editor; University of Massachusetts Medical School, United States
  2. Carlos Isales
    Senior Editor; Augusta University, United States
  3. Amira Klip
    Reviewer; Hospital for Sick Children, Canada

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting the paper "Diet-induced loss of adipose Hexokinase 2 triggers hyperglycemia" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: David E James (Reviewer #3).

Comments to the Authors:

We are sorry to say that, after consultation with the reviewers, we have decided that this work will not be considered further for publication by eLife.

Specifically, a key finding in your study--that adipose HK2 KO causes systemic glucose intolerance--is expected based on previous data on GLUT4, but it doesn't mimic conditions observed in obesity where the inhibition on HK2 expression is not complete. Experiments that would be required to test the effects of adipose HK2 depletion that mirrors what is observed in obesity will be difficult but may be possible. The reviews provided below address other important concerns that reflect what is viewed as a preliminary stage of the study. If you are able in the future to address the several specific points raised in the reviews with additional experiments in a detailed and compelling way, and still wish to have it evaluated by eLife, we will do so.

Reviewer #1 (Recommendations for the authors):

This is an interesting manuscript which reports effects of adipose HK2 KO in an attempt to determine the role of hexokinase in adipocytes as it relates to whole body metabolism. The data indicate that VAT HK2 is strongly downregulated in obesity/HFD, while SAT shows some decrease as well, although less of an effect than seen in VAT. The adipose tissue selective KO causes marked changes in systemic glucose tolerance. The authors conclude that this ability of adipose HK2 to modify glucose tolerance is due to its requirement for the esterification of FA that is released in lipolysis. Therefore, in HK2KO adipocytes, more FA is released into the circulation and is hypothetically able to induce gluconeogenesis by known mechanisms. The following two most important concerns are noted:

1. It is not surprising that HK2 KO in adipocytes causes glucose intolerance, as previous work has clearly demonstrated that inhibiting glucose metabolism in adipocytes has this consequence. In this regard, adipocyte GLUT4KO shows a similar phenotype and this has been studied in great detail in the past. Similar to GLUT4, the authors show here that HK2 is also decreased in obesity, and therefore could contribute to decreasing adipocyte glucose metabolism and the effect on glucose tolerance. However, a full KO of HK2 does not mimic the physiological system in obesity since HK2 is diminished but not totally inhibited in the obese state in humans and in the SAT of mice, while the KO completely eliminates the enzyme. Since glucose transport is considered to be rate limiting for glucose uptake, the argument hinges on whether the level of decrease in HK2 in obesity is actually contributing much to a decrease in glucose metabolism compared to the contribution of the decreased GLUT4. A much more informative experiment would be to study het mice where HK2 might be decreased to a more physiological level that is actually seen in obesity rather than the full KO where the result is difficult to interpret.

2. The text goes beyond the data in attributing correlation to causation. Examples are Figure 5 and Figure 6 legends that ascribe defined mechanisms to what are essentially correlations that are observed. It is not shown definitively in the data of Figure 5, for example, that de novo lipogenesis deficiency causes increased hepatic gluconeogenesis. As a matter of fact, hepatic gluconeogenesis is not measured in this Figure. And the NEFA data are correlative with the decreased adipose tissue de novo lipogenesis. Similarly, Figure 6 doesn't show mechanism, only correlation.

Reviewer #2 (Recommendations for the authors):

It is well established that feeding mice with western diets causes insulin resistance in liver, adipose tissue and muscle. There are many studies that propose various mechanisms for this effect. This paper describes a completely new and exciting mechanism involving changes in the expression of hexokinase 2, an important glycolytic enzyme, in adipose tissue. The authors provide sufficient evidence to show that the expression of hexokinase 2 in adipose tissue is able to regulate whole body metabolism. However, there are some issues that the authors could address prior to further consideration of the study. For example, further information that might address the mechanism for the fall in hexokinase 2 would be valuable and an explanation for the disparity between some of the measures of insulin sensitivity are also necessary.

This is a terrific study that brings new light on this heavily studied problem of metabolic dysfunction in the high fat fed mouse. The data is for the most part of very high quality and the manuscript is well written and researched.

1. The biggest issue for me with this paper is the huge discrepancy between the 'clamp' data and the other measures of insulin action. I have personally never seen such a massive defect in insulin action by clamp as this. It essentially shows that there is zero response to insulin whatsoever in these mice. Yet all other tests (GTT, ITT etc) show a relatively mild phenotype. The tissue specific glucose uptake is also not in step with this defect in that the liver defect is mild, there is no apparent defect in muscle and the only real defect is in adipose tissue, which theoretically accounts for a small proportion of whole body glucose utilisation. The other issue is that in absolute terms 2DG uptake in muscle is on par with WAT which seems worthy of questioning. I was unable to find the insulin levels generated during the clamp so I am not sure if that is a problem. I strongly urge the authors to go back over these data to see if they can spot a calculation error.

2. Given that the authors have deep proteomics data from these mice it would be interesting to run a co-regulation analysis (e.g. WGCNA) to determine if there are other proteins in the data that behave like HK2, as this might provide some mechanistic hints.

3. The mechanism for the loss of insulin regulation of lipolysis in the HK Mice is interesting. I was not particularly convinced by the glycerol data as measures of plasma glycerol are not particularly informative as it probably has a very high flux. So as a minimum I think this part needs expansion.

4. In your AHA experiments which are very nice it would be valuable if you could show some 'control' proteins that do not behave like HK2.

5. It would be fascinating to know if deletion of HK2 has affected GLUT4 translocation? I know this might be a bit of a stretch for the authors but it might be easily achievable in your 3T3-L1 cells if you could express t

Reviewer #3 (Recommendations for the authors):

In this manuscript, Shimobayashi et al. investigate the molecular pathogenesis of high-fat diet induced insulin resistance with a focus on adipose tissue. The authors show that short-term (4 weeks) high-fat diet is sufficient to cause glucose intolerance in male mice. Through a proteomic screen, they identify downregulation of HK2 in visceral fat as one of many changes in the adipose proteome in this timeframe. The authors observe that HK2 expression and HK activity is reduced in adipose tissue in human obesity. The authors propose that down-regulation of adipose HK2 is an early and critical step in the pathogenesis of insulin resistance. The authors also observe that the hyperglycemic Molino Cavefish sub-species carries an inactivating mutation in HK2 and propose that this contributes to hyperglycemia in this model organism. The authors generate adipose specific HK2 knockout mice and show that this is sufficient to cause peripheral insulin resistance with reduced glucose uptake in WAT and BAT as well as hepatic insulin resistance with increased glucose production. This is a well-written manuscript conducted with sophistication and technical expertise. The comprehensive phenotyping of the adipose HK2 KO mice is a strength and the phenotypes are clear and robust. However, as detailed below, previously published data not discussed in this manuscript indicates that substantial reductions in HK2 activity in vivo are insufficient to cause systemic insulin resistance and this undermines the author's conclusion that downregulation of HK2 is the critical step in high-fat diet induced changes in adipose function.

Concerns:

1. Prior literature (PMID: 10428828) indicates that global HK2 heterozygous mice demonstrated a 50% reduction in tissue HK2 activity (in both adipose and muscle) but have normal glucose homeostasis including normal glucose tolerance and insulin action. Although the authors show that complete ablation of adipose HK2 can impair systemic glucose metabolism, the previously published work calls in to question the physiological importance intermediate reductions in adipose HK2 activity that are commonly observed with obesity or dietary interventions. This is particularly true for humans where mean adipose HK activity is reduced by ~ 50% in people with obesity with substantial variance and overlap with those who are lean. The current work must be discussed with respect to this prior literature. Is there a dose-dependent effect of adipose-selective loss of HK2 on glucose homeostasis that is not apparent in global heterozygous mice?

2. Pg. 4-5, "…. expression of the glucose transporter GLUT4 was not affected in vWAT within 4 weeks of HFD (Figure 1A and Figure S1L)." Although the data in Figure 1A supports this conclusion in vWAT, in Figures S1L it appears there is significant down regulation of GLUT4 at 1 and 2 weeks on HFD in vWAT. Although there is some recovery at week 4, Glut4 levels still appear lower than at week 0. These and other blots throughout the manuscript should be quantified. What is the level of GLUT4 expression in BAT? If GLUT4 is diminished in this time frame, this may require significant revision of the authors' conclusions and discussion.

3. Figure 1C; G6P, F6P, and F1,6P are not significantly reduced in adipose tissue with HFD which argues against HK2 as the pivotal enzymatic step controlling the rate of glucose flux into adipose in this condition. Measurement of static metabolite levels are likely not sufficient to draw any firm conclusions on this and the authors should consider flux analysis using stable isotopes which may be much more informative.

4. The authors note that multiple species of cavefish are hyperglycemic and identify a variant in Molino cavefish in the HK2 gene (Figure 2) with reduced activity in vitro. As the authors note, independently evolved Cavefish have repeatedly developed distinct mutations in genes regulating diverse aspects of metabolism and fuel homeostasis including mutations in the insulin receptor and MC4R to survive their nutrient depleted environment. The authors suggest that the HK2 mutation may mediate the hyperglycemia in the Molino sub-species. While the hypothesis is interesting and testable, no experiments are performed in this manuscript that tests the role of HK2 mutant in the glycemic phenotype. As presented, the presence of the HK2 mutation in hyperglycemic fish is entirely correlative and does not provide strong support for the conclusion that HK2 plays a causal role in hyperglycemia.

5. Pg. 9, line 201: "However, adipose tissue accounts for only <5% of glucose disposal (Jackson et al., 1986; Kowalski and 203 Bruce, 2014)." These estimates do not consider the role of BAT in glucose disposal which is likely substantial in mice as suggested by the author's own data (Figure 4A). How much of the phenotype is driven by reduced BAT glucose uptake? BAT glucose uptake may be less relevant in larger animals including humans which may diminish the importance of these findings for human insulin resistance.

6. To support the hypothesis that the incomplete reductions in HK2 activity that are observed with high-fat diet in mice or obesity and diabetes in humans are important, the authors should determine with adipose HK2 heterozygosity is sufficient to impair glucose homeostasis.

7. The data regarding the HK variant in Molino cavefish is intriguing, but correlative and preliminary. It doesn't substantially help the key arguments. The authors should consider crossing Molino fish with surface fish to determine whether the hyperglycemic phenotype segregates with the HK2 mutation.

8. Figure 1C, 3E. The authors should show heat maps for metabolite levels for all animals rather than an aggregate fold change. It is difficult to interpret these results without some idea of the variance in the measures across animals. Were statistics for metabolites corrected for multiple comparisons?

9. Pg 5, line 112: "Importantly, hexokinase activity inversely correlated with insulin resistance in obese non-diabetic patients (Figure 1F)." The data shows that mean HK activity is ~ 30% lower in people with high HOMA-IR compared to low HOMA-IR. Correlation was not tested. However, given the substantial overlap in HK activity between groups, this is worth examining. Is the variance in HK activity a major 'contributor' to the variance in HOMA-IR by regression?

10. Figure 3E. Is this in fed or fasted mice? Does feeding status make a difference in these metabolite levels? The significant difference in pyruvate, but not upstream metabolites suggest important regulation in proximity to pyruvate production or catabolism, and not necessarily at the HK2 step.

11. What was the insulin infusion rate during the hyperinsulinemic-euglycemic clamps?

12. Adipose HK2 KO increases endogenous glucose production and appears to increase hepatic ChREBP activity along with ChREBP targets. Is this increase in ChREBP activity due to increased liver glucose uptake as a result of impaired WAT/BAT glucose uptake – i.e. shunting of glucose to the liver? Activation of ChREBP in the liver has been shown to regulate G6Pc expression and drive glucose production (PMID: 27669460). Could this be an alternative explanation for the increased glucose production in adipose HK2 KO mice?

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Diet-induced loss of adipose Hexokinase 2 triggers hyperglycemia" for further consideration by eLife. Your revised article has been evaluated by Carlos Isales (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:

There are a number of concerns raised by the reviewers that will only require text or format changes that you may wish to consider. The editors feel you should carefully consider these and make changes to the text that you deem appropriate in revising the interpretations and provide more caution in interpretations. See reviewers' comments.

One issue that does seem to be critical is to directly address the issue that your HK2 KO and even the Het KO reduce HK2 more than obesity in humans (nearly 100% and about 70%, respectively vs only about 30% in obesity). Further, the improvement in glucose tolerance is very small in the hetKO, which brings into question whether the smaller decrease in HK2 in obesity does actually have a significant contribution to glucose tolerance. No ITT is provided for the hetKO either. Again, if you do not wish to provide further data on this issue, the text should clearly note this result in the Results section and discuss this problem in the Discussion, and include caution on the significance of the decrease in HK2 in obesity in contributing to insulin resistance in humans.

Reviewer #1 (Recommendations for the authors):

This is an excellent study and the authors have properly responded to most of the comments of the reviewers. The study extends previous reports that genetic disruptions of glucose metabolism in adipose (WAT and BAT) affect whole-body glucose homeostasis. Prior studies include KO of GLUT4, RAB10, and ChREBP. Of note, KO of RAB10 in brown fat (UCP1 CRE) also induces whole-body glucose dysregulation. The RAB10 KO studies (PMID: 34303022, PMID: 27207531) should be included in the discussion because RAB10 KO causes an approximate 50% reduction in insulin-stimulated glucose uptake yet still has a large whole-body metabolic impact, in line with the argument the authors make about obesity/HFD causing a partial reduction in HK2 that has large whole body effect.

Some comments for the authors to consider:

1. There are a couple of instances in which the description of the data does not completely jive with the data presented. For example, on page 3, they state "Consistent with reduced HK2 expression, hexokinase activity, and downstream glycolytic metabolites were decreased in.…". However, the data in Figure 1d do not support a change in glycolic metabolites. Only 2PG is reduced. Strikingly, there is no reduction in G6P, the product of HK2, and perhaps the metabolite most likely to be changed. Just looking at the data, one would conclude that HFD has little effect on glycolic metabolites. I realize there are potential issues with steady-state versus flux measurements but it doesn't seem appropriate to conclude a change in glycolytic intermediates because that is what is expected if the data do not support the conclusion. If the method is not appropriate to measure a difference, then the steady-state data should be removed from the manuscript or flux performed.

Similarly, I am not sure how to interpret the data in Figure 1G, H, and I. The data in H show a statistically significant difference between "high" and "low" HOMO-IR groups in HK activity, although the effect size is very small. The text refers to severe and mild insulin resistance (HOMO-IR) groupings. What is the homo-IR cutoff for this distinction? Is this accepted or is it based on the structure of this data (e.g., quartiles)? What do the data for HK activity look like for the obese diabetic group (from panel G)? Are those all low HK activity?

The Pearson's correlation in panel I, although trending to a negative correlation, is not significant, which I believe is what one would expect if HK activity was not the only contributor to HOMO-IR. However, the authors suggest the failure to achieve statistical significance is because the measurement (HK activity rather than HK2 amount) is insufficient, which then begs the question of the validity of the measurement for the analyses in panel H.

I do not mean to be nit-picking here but I believe the major impact of the paper rests on linking a reduction in HK2 to obesity/insulin resistance since, as noted above, it is known that disruptions in glucose metabolism of adipocytes induce whole-body glucose intolerance. Re-describing and or re-analyzing the human data seems in order.

2. I agree with the authors that the Molino fish data are "cool" but they also disrupt the flow of the work (and as noted in the previous review they are somewhat "superficial" from the metabolism perspective). Might I suggest they move these data to the end of the result section, where they will not disrupt the flow and be appreciated as further support for the hypothesis linking HK2 to hyperglycemia?

3. I think the 3T3-L1 experiments are of limited value and could be removed without impacting the conclusions of the work. I might be missing the point of these data but I think all they show is that HK2 has a role in in vitro differentiated adipocytes. I am not sure how that impacts the conclusions of the study.

Reviewer #2 (Recommendations for the authors):

The response to previous reviews (by other reviewers) seems highly appropriate to this reviewer. Incurring in the analysis of heterozygotic adipocyte HK2 mice addressed major points brought in during that first review. There is an important point that however requires consideration.

This reviewer would only like to raise the following points that could be attended to with appropriate discussion in the text:

1. The findings presented do not support that there is a defect in glucose transport in adipocytes. There is a reduction in glucose deposition in adipose tissue during a hyperinsulinemic clamp of adipose-specific HK2 KO mice (Figure 5) and there is lower insulin-stimulated 2-deoxyglucose deposition in insulin-stimulated 3T3-L1 adipocytes depleted of HK2. However, there is no change in glucose-6-phosphate levels in adipose tissue of 4-week HFD-fed mice (Figure 1 D) and there is also no difference in the basal 2-deoxyglucose deposition in the HK2-depleted 3T3-L1 adipocytes (Figure 3E). Since 2-deoxyglucose deposition depends on hexokinase activity, it is not clear why the reduction was only seen in response to insulin. These findings deserve some comment, and the end of the 2nd paragraph of page 13 as well as the 1st paragraph of the Discussion could also be accordingly amended.

2. The above findings also mean that the model in figure 8 must be modified (it currently shows less glucose transport into adipocytes). The model should also include the other two possibilities for crosstalk with the liver mentioned on page 12 (3rd paragraph of Discussion).

3. Figure 1: Please indicate in the legend to 1A that mRNA levels are being quantified.

4. Please indicate in the y-axis of Figure 7A that the results refer to HK2 (the figures identify all other genes in the other panels).

5. Supplemental Figure S2D: The levels of GLUT4 in the immunoblot do not jive with the quantifications of the 5 n's. It would be ideal if a more representative immunoblot were shown.

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your work entitled "Diet-induced loss of adipose Hexokinase 2 triggers hyperglycemia" for further consideration by eLife. Your revised article has been evaluated by Carlos Isales (Senior Editor) and a Reviewing Editor.

The manuscript has been improved but there is one last remaining issue that needs to be addressed, as outlined below:

The authors appropriately clarified in the Results section and in the Discussion section that the experimental perturbations in reducing HK2 were greater than that caused by obesity. They also included caution in the interpretation and now correctly used the word "may" to describe the effect of HK2 in obesity on hyperglycemia. However, the title remains a definitive statement, which does not seem appropriate in the absence of further definitive data, which is not provided. Please consider providing a more general title.

https://doi.org/10.7554/eLife.85103.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

Reviewer #1 (Recommendations for the authors):

This is an interesting manuscript which reports effects of adipose HK2 KO in an attempt to determine the role of hexokinase in adipocytes as it relates to whole body metabolism. The data indicate that VAT HK2 is strongly downregulated in obesity/HFD, while SAT shows some decrease as well, although less of an effect than seen in VAT. The adipose tissue selective KO causes marked changes in systemic glucose tolerance. The authors conclude that this ability of adipose HK2 to modify glucose tolerance is due to its requirement for the esterification of FA that is released in lipolysis. Therefore, in HK2KO adipocytes, more FA is released into the circulation and is hypothetically able to induce gluconeogenesis by known mechanisms. The following two most important concerns are noted:

1. It is not surprising that HK2 KO in adipocytes causes glucose intolerance, as previous work has clearly demonstrated that inhibiting glucose metabolism in adipocytes has this consequence. In this regard, adipocyte GLUT4KO shows a similar phenotype and this has been studied in great detail in the past. Similar to GLUT4, the authors show here that HK2 is also decreased in obesity, and therefore could contribute to decreasing adipocyte glucose metabolism and the effect on glucose tolerance. However, a full KO of HK2 does not mimic the physiological system in obesity since HK2 is diminished but not totally inhibited in the obese state in humans and in the SAT of mice, while the KO completely eliminates the enzyme. Since glucose transport is considered to be rate limiting for glucose uptake, the argument hinges on whether the level of decrease in HK2 in obesity is actually contributing much to a decrease in glucose metabolism compared to the contribution of the decreased GLUT4. A much more informative experiment would be to study het mice where HK2 might be decreased to a more physiological level that is actually seen in obesity rather than the full KO where the result is difficult to interpret.

We addressed this concern by characterizing adipose-specific heterozygous HK2 knockout mice. The partial loss of adipose HK2 causes glucose intolerance (Figure S5).

2. The text goes beyond the data in attributing correlation to causation. Examples are Figure 5 and Figure 6 legends that ascribe defined mechanisms to what are essentially correlations that are observed. It is not shown definitively in the data of Figure 5, for example, that de novo lipogenesis deficiency causes increased hepatic gluconeogenesis. As a matter of fact, hepatic gluconeogenesis is not measured in this Figure. And the NEFA data are correlative with the decreased adipose tissue de novo lipogenesis. Similarly, Figure 6 doesn't show mechanism, only correlation.

Relying on known mechanisms (PMID: 29069585, 25662011, and 27238637), we concluded that increased NEFA release and decreased adipose lipogenesis contribute to increased hepatic gluconeogenesis in adipose-specific Hk2 knockout (AdHk2KO) mice. We agree with this reviewer that we do not provide direct evidence that goes beyond correlation in the current study. Thus, we softened our conclusion for these figures (now Figure 6). In the Discussion, we discuss how loss of adipose HK2 might be linked to increased hepatic glucose production and thus glucose intolerance in AdHk2KO mice (Page 12).

Reviewer #2 (Recommendations for the authors):

It is well established that feeding mice with western diets causes insulin resistance in liver, adipose tissue and muscle. There are many studies that propose various mechanisms for this effect. This paper describes a completely new and exciting mechanism involving changes in the expression of hexokinase 2, an important glycolytic enzyme, in adipose tissue. The authors provide sufficient evidence to show that the expression of hexokinase 2 in adipose tissue is able to regulate whole body metabolism. However, there are some issues that the authors could address prior to further consideration of the study. For example, further information that might address the mechanism for the fall in hexokinase 2 would be valuable and an explanation for the disparity between some of the measures of insulin sensitivity are also necessary.

Please find our response to these concerns directly below.

This is a terrific study that brings new light on this heavily studied problem of metabolic dysfunction in the high fat fed mouse. The data is for the most part of very high quality and the manuscript is well written and researched.

We thank the reviewer for finding our study ‘terrific’ and of ‘very high quality.’

1. The biggest issue for me with this paper is the huge discrepancy between the 'clamp' data and the other measures of insulin action. I have personally never seen such a massive defect in insulin action by clamp as this. It essentially shows that there is zero response to insulin whatsoever in these mice. Yet all other tests (GTT, ITT etc) show a relatively mild phenotype. The tissue specific glucose uptake is also not in step with this defect in that the liver defect is mild, there is no apparent defect in muscle and the only real defect is in adipose tissue, which theoretically accounts for a small proportion of whole body glucose utilisation. The other issue is that in absolute terms 2DG uptake in muscle is on par with WAT which seems worthy of questioning. I was unable to find the insulin levels generated during the clamp so I am not sure if that is a problem. I strongly urge the authors to go back over these data to see if they can spot a calculation error.

We went back over the data and checked calculations. We did not identify an error. As one can see in the glucose infusion data (Figure 5F and its source data), we did not need to infuse glucose in 4 out of 6 KO mice to maintain euglycemia (150 mg/dL, Figure 5E and its source data). Since reduced glucose infusion was already obvious in the raw data, it could not be the case that the defect in insulin action is due to a calculation error.

Finally, it is important to note that the conclusion drawn from our clamp data is in line with other tests. The clamp data support our conclusion that adipose-specific HK2 loss causes insulin insensitivity and glucose intolerance.

Please note that 2DG uptake is normalized to the mass of the analyzed tissue (approx.0.05-0.1 g), not to the mass of the whole tissue. Since muscle mass (lean mass, 70-80% of body weight) is much larger than WAT (1-2% of bodyweight) and BAT (0.5% of bodyweight) mass, our data still show that the majority of 2DG (glucose) is disposed in muscle. This is mentioned in the legend of figure 5A.

2. Given that the authors have deep proteomics data from these mice it would be interesting to run a co-regulation analysis (e.g. WGCNA) to determine if there are other proteins in the data that behave like HK2, as this might provide some mechanistic hints.

As requested, we performed a co-regulation analysis in the AHA-proteome and RNAseq data to identify proteins whose expression correlated with HK2. We identified 155 proteins whose AHA incorporation was downregulated and correlated with the AHA incorporation of HK2 in WAT of HFD-fed mice. Next, we performed a pathway enrichment analysis to identify pathways regulated like HK2. The top five pathways enriched among the 155 proteins are ribosomal proteins, the electron transport chain (ETC), oxidative phosphorylation (OXPHOS), fatty acid (FA) synthesis, and glycolysis (Figure S9A). Interestingly, similar to HK2, the AHA incorporation into ribosomal proteins and proteins in ETC and OXPHOS was reduced without affecting the level of their encoding RNAs (Figure S9B), suggesting that HK2 might be regulated in a similar way as ribosomal proteins and proteins in ETC and OXPHOS. How these proteins including HK2 are post-transcriptionally regulated is for future investigation. This analysis (Figure S9) is now included in the manuscript in the last section of the Results.

3. The mechanism for the loss of insulin regulation of lipolysis in the HK Mice is interesting. I was not particularly convinced by the glycerol data as measures of plasma glycerol are not particularly informative as it probably has a very high flux. So as a minimum I think this part needs expansion.

We agree with the reviewer. Since the mechanism of how loss of HK2 causes increased glycerol release is beyond the scope of this study and is not part of our main conclusions, we removed the glycerol data from the manuscript.

4. In your AHA experiments which are very nice it would be valuable if you could show some 'control' proteins that do not behave like HK2.

We had CALX as a control protein in the submitted manuscript. It is still included, now in Figure 7B. Furthermore, in response to this request, we now include all mass spec quantified proteins in the AHA experiment together with RNA seq data as Supplemental Table S3. These data can be informative for the scientific community to further study post-transcriptionally controlled proteins in adipose tissue of HFD-fed mice.

5. It would be fascinating to know if deletion of HK2 has affected GLUT4 translocation? I know this might be a bit of a stretch for the authors but it might be easily achievable in your 3T3-L1 cells if you could express t

We respectfully agree with the review that this is a ‘stretch’ for the current study.

Reviewer #3 (Recommendations for the authors):

In this manuscript, Shimobayashi et al. investigate the molecular pathogenesis of high-fat diet induced insulin resistance with a focus on adipose tissue. The authors show that short-term (4 weeks) high-fat diet is sufficient to cause glucose intolerance in male mice. Through a proteomic screen, they identify downregulation of HK2 in visceral fat as one of many changes in the adipose proteome in this timeframe. The authors observe that HK2 expression and HK activity is reduced in adipose tissue in human obesity. The authors propose that down-regulation of adipose HK2 is an early and critical step in the pathogenesis of insulin resistance. The authors also observe that the hyperglycemic Molino Cavefish sub-species carries an inactivating mutation in HK2 and propose that this contributes to hyperglycemia in this model organism. The authors generate adipose specific HK2 knockout mice and show that this is sufficient to cause peripheral insulin resistance with reduced glucose uptake in WAT and BAT as well as hepatic insulin resistance with increased glucose production. This is a well-written manuscript conducted with sophistication and technical expertise. The comprehensive phenotyping of the adipose HK2 KO mice is a strength and the phenotypes are clear and robust. However, as detailed below, previously published data not discussed in this manuscript indicates that substantial reductions in HK2 activity in vivo are insufficient to cause systemic insulin resistance and this undermines the author's conclusion that downregulation of HK2 is the critical step in high-fat diet induced changes in adipose function.

Concerns:

1. Prior literature (PMID: 10428828) indicates that global HK2 heterozygous mice demonstrated a 50% reduction in tissue HK2 activity (in both adipose and muscle) but have normal glucose homeostasis including normal glucose tolerance and insulin action. Although the authors show that complete ablation of adipose HK2 can impair systemic glucose metabolism, the previously published work calls in to question the physiological importance intermediate reductions in adipose HK2 activity that are commonly observed with obesity or dietary interventions. This is particularly true for humans where mean adipose HK activity is reduced by ~ 50% in people with obesity with substantial variance and overlap with those who are lean. The current work must be discussed with respect to this prior literature. Is there a dose-dependent effect of adipose-selective loss of HK2 on glucose homeostasis that is not apparent in global heterozygous mice?

We thank the reviewer for pointing this out. We addressed this concern by characterizing adipose-specific heterozygous HK2 knockout mice. The heterozygous KO mice are glucose intolerant, compared to controls. This information is now added to the manuscript (Figure S5).

Indeed, a previous study demonstrated that global heterozygous Hk2 knockout mice have normal, even better, glucose tolerance compared to controls [PMID: 10428828]. How can we explain this apparent discrepancy? We note that adipose-specific GLUT4 knockout mice display glucose intolerance [PMID: 11217863], but global GLUT4 knockout mice are glucose tolerant due to a compensatory increase in glucose uptake in liver [PMID: 7675081, 15793230]. We observed increased systemic glycolysis in AdHk2KO mice (see Figure S4N). Global ablation of HK2 mice may provoke an even stronger compensatory response to maintain systemic glucose homeostasis. This may also explain the observation that global heterozygous Hk2 knockout mice display better glucose handling than wild-type controls [PMID: 10428828]. This text has now been added to the Discussion in the revised manuscript.

2. Pg. 4-5, "…. expression of the glucose transporter GLUT4 was not affected in vWAT within 4 weeks of HFD (Figure 1A and Figure S1L)." Although the data in Figure 1A supports this conclusion in vWAT, in Figures S1L it appears there is significant down regulation of GLUT4 at 1 and 2 weeks on HFD in vWAT. Although there is some recovery at week 4, Glut4 levels still appear lower than at week 0. These and other blots throughout the manuscript should be quantified. What is the level of GLUT4 expression in BAT? If GLUT4 is diminished in this time frame, this may require significant revision of the authors' conclusions and discussion.

As requested, we have quantified immunoblots including those indicated above. GLUT4 expression in vWAT was slightly reduced at 4 weeks of HFD feeding. Also, we have included immunoblots of BAT as requested. GLUT4 expression in BAT was slightly reduced, but significantly only at 2 weeks of HFD. In all fat depots, we observed that HK2 expression is decreased more than GLUT4 expression, supporting our claim that HK2 expression correlates with diet-insulin insensitivity.

3. Figure 1C; G6P, F6P, and F1,6P are not significantly reduced in adipose tissue with HFD which argues against HK2 as the pivotal enzymatic step controlling the rate of glucose flux into adipose in this condition. Measurement of static metabolite levels are likely not sufficient to draw any firm conclusions on this and the authors should consider flux analysis using stable isotopes which may be much more informative.

We agree with the reviewer that measuring static levels of glycolytic and PPP metabolites is not sufficient to make a firm conclusion. However, we present reduced glycolytic and PPP metabolites as additional supporting evidence for diet-induced HK2 downregulation in adipose tissue of HFD-fed mice, in addition to downregulation of HK2 expression itself (Figures 1A, 1B, 1E, 1F) and tissue hexokinase activity (Figure S1F).

4. The authors note that multiple species of cavefish are hyperglycemic and identify a variant in Molino cavefish in the HK2 gene (Figure 2) with reduced activity in vitro. As the authors note, independently evolved Cavefish have repeatedly developed distinct mutations in genes regulating diverse aspects of metabolism and fuel homeostasis including mutations in the insulin receptor and MC4R to survive their nutrient depleted environment. The authors suggest that the HK2 mutation may mediate the hyperglycemia in the Molino sub-species. While the hypothesis is interesting and testable, no experiments are performed in this manuscript that tests the role of HK2 mutant in the glycemic phenotype. As presented, the presence of the HK2 mutation in hyperglycemic fish is entirely correlative and does not provide strong support for the conclusion that HK2 plays a causal role in hyperglycemia.

We agree with the reviewer. We do not claim that the HK2 variant is the driver for hyperglycemia in Molino cavefish. We are currently breeding surface and Molino cavefish to perform a quantitative trait (QTL) analysis. However, Mexican tetra become sexually mature and can be mated after 8 months but ideally at more than 1 year old, and Molino cavefish are especially difficult to produce (PMID: 30638199). Taking these challenges into account, we need a minimum of 2-3 years of investigations to complete the QTL analysis. In the current manuscript, we only conclude that the HK2 variant (R42H) found in Molino is a loss-of-function mutation based on our enzyme assay (Figures 2F-2G) and add that it is supporting orthogonal evidence that HK2 loss affects glucose homeostasis. Also, it is a very cool result.

5. Pg. 9, line 201: "However, adipose tissue accounts for only <5% of glucose disposal (Jackson et al., 1986; Kowalski and 203 Bruce, 2014)." These estimates do not consider the role of BAT in glucose disposal which is likely substantial in mice as suggested by the author's own data (Figure 4A).

Note that the glucose uptake rate in Figure 4A (now in Figure 5A) is normalized to the tissue mass (mg tissue) tested in the assay. When we calculate glucose uptake rate per depot (based on glucose uptake and tissue weight) in control mice, the glucose uptake rate is 7.5 ug/min in WAT and 13.6 ug/min in BAT. Since the number of WAT depots is more than that of BAT depots in humans and even in mice, we believe that the contribution of BAT in glucose disposal is almost identical to that of WAT. We have not added this information to the manuscript but can do so if the reviewer insists.

How much of the phenotype is driven by reduced BAT glucose uptake?

This is an important question, and we are currently generating Ucp1-Cre, Hk2fl/fl mice to answer this question. We believe that characterization of BAT-specific HK2 knockout mice is beyond the scope of the current study.

BAT glucose uptake may be less relevant in larger animals including humans which may diminish the importance of these findings for human insulin resistance.

Please see the above.

6. To support the hypothesis that the incomplete reductions in HK2 activity that are observed with high-fat diet in mice or obesity and diabetes in humans are important, the authors should determine with adipose HK2 heterozygosity is sufficient to impair glucose homeostasis.

As requested, we have examined heterozygous knockout mice and these new experiments have been added to the manuscript. Please see our reply point 1 above.

7. The data regarding the HK variant in Molino cavefish is intriguing, but correlative and preliminary. It doesn't substantially help the key arguments. The authors should consider crossing Molino fish with surface fish to determine whether the hyperglycemic phenotype segregates with the HK2 mutation.

We believe that identification of the loss-of-function Hk2 variant in Molino cavefish is an important finding although it is indeed correlative at this stage. Also, please see our reply to the point 4 above.

8. Figure 1C, 3E. The authors should show heat maps for metabolite levels for all animals rather than an aggregate fold change. It is difficult to interpret these results without some idea of the variance in the measures across animals. Were statistics for metabolites corrected for multiple comparisons?

As requested, we now changed the heat maps to bar graphs. The conclusion is the same as before. We performed Student’s t-test for each metabolite since we normalized each metabolite in KO to that in control and do not compare different metabolites.

9. Pg 5, line 112: "Importantly, hexokinase activity inversely correlated with insulin resistance in obese non-diabetic patients (Figure 1F)." The data shows that mean HK activity is ~ 30% lower in people with high HOMA-IR compared to low HOMA-IR. Correlation was not tested. However, given the substantial overlap in HK activity between groups, this is worth examining. Is the variance in HK activity a major 'contributor' to the variance in HOMA-IR by regression?

As requested, we calculated Pearson’s R between HOMA-IR and HK activity in obese non-diabetic patients. We observed only a trend toward negative correlation. This is now added to the manuscript (see Figure 1I). However, we also mention in the text that, “the lack of statistical significance is possibly due to the fact that, in the absence of an antibody that recognizes human adipose HK2, we measured total hexokinase activity rather than specifically HK2 expression or activity.” The fact that we measured total HK activity most likely masked some of the effect of loss of specifically HK2.

10. Figure 3E. Is this in fed or fasted mice? Does feeding status make a difference in these metabolite levels? The significant difference in pyruvate, but not upstream metabolites suggest important regulation in proximity to pyruvate production or catabolism, and not necessarily at the HK2 step.

The data in Figure 3E (now Figure 4B) are from ad libitum-fed mice. In this study, the metabolomics data are provided to support reduced HK2 activity (Figure 3B), glucose uptake (Figures 3E and 5A), and glycolysis (Figure 3D) in adipose tissue/adipocytes of the HK2 KO/KD. We agree that the metabolomics alone cannot firmly allow the conclusion that glycolysis is downregulated in adipose tissue of AdHk2KO mice. However, all the data taken together, strongly support the conclusion that loss of adipose HK2 causes reduced glucose influx in adipose tissue/adipocytes.

11. What was the insulin infusion rate during the hyperinsulinemic-euglycemic clamps?

The insulin infusion rate was 0.09 mU/min. This information is now included in the method section (Page 24).

12. Adipose HK2 KO increases endogenous glucose production and appears to increase hepatic ChREBP activity along with ChREBP targets. Is this increase in ChREBP activity due to increased liver glucose uptake as a result of impaired WAT/BAT glucose uptake – i.e. shunting of glucose to the liver? Activation of ChREBP in the liver has been shown to regulate G6Pc expression and drive glucose production (PMID: 27669460). Could this be an alternative explanation for the increased glucose production in adipose HK2 KO mice?

We thank the reviewer for bringing this to our attention. We agree that glucose shunting to the liver due to impaired WAT/BAT glucose uptake in the KO mice can be alternative mechanism for the increased glucose production in the KO mice. This mechanism is now included in the Discussion (Page 12).

[Editors’ note: what follows is the authors’ response to the second round of review.]

One issue that does seem to be critical is to directly address the issue that your HK2 KO and even the Het KO reduce HK2 more than obesity in humans (nearly 100% and about 70%, respectively vs only about 30% in obesity). Further, the improvement in glucose tolerance is very small in the hetKO, which brings into question whether the smaller decrease in HK2 in obesity does actually have a significant contribution to glucose tolerance. No ITT is provided for the hetKO either. Again, if you do not wish to provide further data on this issue, the text should clearly note this result in the Results section and discuss this problem in the Discussion, and include caution on the significance of the decrease in HK2 in obesity in contributing to insulin resistance in humans.

In the Results section, we now indicate the % reduction in HK2 expression in HFD-fed mice, AdHk2KO mice and the % reduction in HK activity in obese/diabetic patients.

Now it reads;

Page 3, “Quantification by immunoblotting revealed an approximately 60%, 90% and 50% reduction in HK2 expression in vWAT, subcutaneous WAT (sWAT), and brown adipose tissue (BAT), respectively, of 4-week HFD mice (Figures 1B-C).”

Page 4, “Similar to our findings in mice, omental WAT (human vWAT) biopsies from obese non-diabetic and obese diabetic patients displayed a ~30% reduction in hexokinase activity (Figure 1G and Supplementary file 2). ”Page 6,

“In AdHk2KO mice, HK2 expression was decreased ~75% in vWAT, ~70% in sWAT, and ~65% in BAT but unchanged in skeletal muscle (Figure 4A and Figure 4 —figure supplements 1B-D).“

-> As requested, we now include a paragraph in the Discussion section dealing with the issue that our HK2 KO does not completely phenocopy adipose tissue of obese mice and patients.

It reads;

Page 13, “We note that Hk2 knockout did not completely phenocopy to the effect of obesity in mice and humans. While HK2 was decreased approximately 75% in vWAT of AdHk2KO mice (Figure 4A), HK2 expression in HFD-fed mice and HK activity in oWAT from obese patients were decreased only ~60% and ~30%, respectively (Figures 1B and 1G). Is the reduction in HK2 in obese mice and patients sufficient to contribute to systemic insulin insensitivity and glucose intolerance? A previous study showed that adipose-specific Rab10 knockout mice display reduced GLUT4 translocation to the plasma membrane and thus a ~50% reduction in insulin-stimulated glucose disposal, in isolated adipocytes (Vazirani et al., 2016). Importantly, adipose-specific Rab10 knockout mice failed to suppress hepatic glucose production and were thus insulin insensitive, indicating that a limited disruption in glucose metabolism in adipose tissue can significantly impact systemic insulin sensitivity and glucose homeostasis. Thus, the partial loss of HK2 observed in obese mice and patients may be sufficient to impact systemic insulin sensitivity and thereby glucose homeostasis.”

Reviewer #1 (Recommendations for the authors):

This is an excellent study and the authors have properly responded to most of the comments of the reviewers. The study extends previous reports that genetic disruptions of glucose metabolism in adipose (WAT and BAT) affect whole-body glucose homeostasis. Prior studies include KO of GLUT4, RAB10, and ChREBP. Of note, KO of RAB10 in brown fat (UCP1 CRE) also induces whole-body glucose dysregulation. The RAB10 KO studies (PMID: 34303022, PMID: 27207531) should be included in the discussion because RAB10 KO causes an approximate 50% reduction in insulin-stimulated glucose uptake yet still has a large whole-body metabolic impact, in line with the argument the authors make about obesity/HFD causing a partial reduction in HK2 that has large whole body effect.

We thank the reviewer for this suggestion. We now cite and discuss the study on adipose-specific Rab10 knockout mice (PMID: 27207531) suggesting that a limited reduction in insulin-stimulated glucose disposal in adipose tissue impact systemic insulin sensitivity and glucose homeostasis (see above). We did not include the other paper (PMID: 34303022), because this other study focuses on characterization of brown adipose tissue (BAT)-specific RAB10 knockout mice and we do not characterize a BAT-specific HK2 knockout mice in the current study.

Some comments for the authors to consider:

1. There are a couple of instances in which the description of the data does not completely jive with the data presented. For example, on page 3, they state "Consistent with reduced HK2 expression, hexokinase activity, and downstream glycolytic metabolites were decreased in.…". However, the data in Figure 1d do not support a change in glycolic metabolites. Only 2PG is reduced. Strikingly, there is no reduction in G6P, the product of HK2, and perhaps the metabolite most likely to be changed. Just looking at the data, one would conclude that HFD has little effect on glycolic metabolites. I realize there are potential issues with steady-state versus flux measurements but it doesn't seem appropriate to conclude a change in glycolytic intermediates because that is what is expected if the data do not support the conclusion. If the method is not appropriate to measure a difference, then the steady-state data should be removed from the manuscript or flux performed.

As requested, we removed the data of Figure 1D and modified the text accordingly.

Similarly, I am not sure how to interpret the data in Figure 1G, H, and I. The data in H show a statistically significant difference between "high" and "low" HOMO-IR groups in HK activity, although the effect size is very small. The text refers to severe and mild insulin resistance (HOMO-IR) groupings. What is the homo-IR cutoff for this distinction? Is this accepted or is it based on the structure of this data (e.g., quartiles)? What do the data for HK activity look like for the obese diabetic group (from panel G)? Are those all low HK activity?

As indicated in the legend of Figure 1H, the HOMA-IR cut-off of severe and mild insulin resistance is 2.9, which was described as a median value in diabetic patients (PMID:3899825).

We have also performed similar analyses for the obese diabetic group (see Author response image 1). Although most patients with HOMA-IR>2.9 displayed low HK2 activity, there is only one patient with HOMA-IR<2.9 in the obese and diabetes group. Since we do not have sufficient patient numbers to draw a solid conclusion in this group, we do not include this analysis in the manuscript.

Author response image 1
Download asset Open asset

The Pearson's correlation in panel I, although trending to a negative correlation, is not significant, which I believe is what one would expect if HK activity was not the only contributor to HOMO-IR. However, the authors suggest the failure to achieve statistical significance is because the measurement (HK activity rather than HK2 amount) is insufficient, which then begs the question of the validity of the measurement for the analyses in panel H.

I do not mean to be nit-picking here but I believe the major impact of the paper rests on linking a reduction in HK2 to obesity/insulin resistance since, as noted above, it is known that disruptions in glucose metabolism of adipocytes induce whole-body glucose intolerance. Re-describing and or re-analyzing the human data seems in order.

We have modified the text describing the Figure 1I, as suggested.

Now it reads on page 4;

“Although hexokinase activity negatively correlated with insulin resistance in obese patients, this correlation was not statistically significant (Figure 1I), suggesting that loss of hexokinase activity may not be the only cause of insulin resistance in human.”

2. I agree with the authors that the Molino fish data are "cool" but they also disrupt the flow of the work (and as noted in the previous review they are somewhat "superficial" from the metabolism perspective). Might I suggest they move these data to the end of the result section, where they will not disrupt the flow and be appreciated as further support for the hypothesis linking HK2 to hyperglycemia?

The Molino data provide an important link between reduced HK2 activity and hyperglycemia, similar to adipose tissue of obese mice. Thus, we believe that describing the Molino data before generating and characterizing adipose-specific Hk2 knockout mice is appropriate.

3. I think the 3T3-L1 experiments are of limited value and could be removed without impacting the conclusions of the work. I might be missing the point of these data but I think all they show is that HK2 has a role in in vitro differentiated adipocytes. I am not sure how that impacts the conclusions of the study.

The 3T3-L1 data are more supporting evidence that HK2 is important for glucose disposal in adipocytes. Thus, we prefer to keep the 3T3-L1 data as they are.

Reviewer #2 (Recommendations for the authors):

The response to previous reviews (by other reviewers) seems highly appropriate to this reviewer. Incurring in the analysis of heterozygotic adipocyte HK2 mice addressed major points brought in during that first review. There is an important point that however requires consideration.

This reviewer would only like to raise the following points that could be attended to with appropriate discussion in the text:

1. The findings presented do not support that there is a defect in glucose transport in adipocytes. There is a reduction in glucose deposition in adipose tissue during a hyperinsulinemic clamp of adipose-specific HK2 KO mice (Figure 5) and there is lower insulin-stimulated 2-deoxyglucose deposition in insulin-stimulated 3T3-L1 adipocytes depleted of HK2. However, there is no change in glucose-6-phosphate levels in adipose tissue of 4-week HFD-fed mice (Figure 1 D) and there is also no difference in the basal 2-deoxyglucose deposition in the HK2-depleted 3T3-L1 adipocytes (Figure 3E). Since 2-deoxyglucose deposition depends on hexokinase activity, it is not clear why the reduction was only seen in response to insulin. These findings deserve some comment, and the end of the 2nd paragraph of page 13 as well as the 1st paragraph of the Discussion could also be accordingly amended.

We do not argue that there is a defect in glucose ‘transport’ in HK2-depleted adipocytes. Indeed, we conclude, “loss of HK2 decreases glucose disposal in insulin-stimulated adipocytes” (Line 5 on page 6).

Regarding the observation that there is no difference in basal 2-deoxyglucose “deposition” in HK2 knockdown adipocytes compared to controls, it is well established that insulin promotes HK2 activity by promoting translocation of HK2 to mitochondria where HK2 uses ATP exiting mitochondria to phosphorylate glucose (PMID: 18064042, 11390360). Thus, in the absence of insulin, HK2 is inactive in control adipocytes, and we do not expect to see the deference in basal 2-deoxyglucose disposal in HK2 knockdown adipocytes. To clarify this point, we modified the text as follows on pages 6:

“Furthermore, although basal glucose accumulation did not differ, insulin-stimulated glucose accumulation was 50% lower in HK2-knockdown adipocytes (Figure 3E), despite normal insulin signaling (Figure 3A). The observation that HK2-knockdown has not effect on basal glucose accumulation is due to the fact that HK2 is inactive in the absence of insulin (Gottlob et al., 2001; Miyamoto, Murphy, and Brown, 2008). Thus, loss of HK2 decreases glucose disposal in insulin-stimulated adipocytes in vitro.”

2. The above findings also mean that the model in figure 8 must be modified (it currently shows less glucose transport into adipocytes). The model should also include the other two possibilities for crosstalk with the liver mentioned on page 12 (3rd paragraph of Discussion).

Figure 8 reflects less glucose disposal, not less glucose transport. To increase clarity, we modified the figure legend. It now reads:

“B. Diet-induced loss of adipose HK2 triggers glucose intolerance via reduced glucose disposal in adipocytes (left) and de-repressed hepatic gluconeogenesis despite maintained lipogenesis (right).” We refrain from including the other two possible models (the control of hepatic glucose production by neuronal inputs or increased glucose uptake in the liver) in Figure 8 since we did not test them in this study.

3. Figure 1: Please indicate in the legend to 1A that mRNA levels are being quantified.

Figure 1A is a quantification of the proteome data. We modified the legend and it now reads;

“A. The Log2 fold change (FC) of Hexokinase and GLUT4 protein expression in visceral white adipose tissue (vWAT) of normal diet (ND)- and 4-week high fat diet (HFD)-fed wild-type C57BL/6JRj mice. Multiple t test, **q<0.0001. n=5 (ND) and 5 (HFD).”

4. Please indicate in the y-axis of Figure 7A that the results refer to HK2 (the figures identify all other genes in the other panels).

The y-axis of Figure 7A refers to and has been already indicated as Hk2 mRNA.

5. Supplemental Figure S2D: The levels of GLUT4 in the immunoblot do not jive with the quantifications of the 5 n's. It would be ideal if a more representative immunoblot were shown.

We now provide a representative blot.

[Editors’ note: what follows is the authors’ response to the third round of review.]

The manuscript has been improved but there is one last remaining issue that needs to be addressed, as outlined below:

The authors appropriately clarified in the Results section and in the Discussion section that the experimental perturbations in reducing HK2 were greater than that caused by obesity. They also included caution in the interpretation and now correctly used the word "may" to describe the effect of HK2 in obesity on hyperglycemia. However, the title remains a definitive statement, which does not seem appropriate in the absence of further definitive data, which is not provided. Please consider providing a more general title.

As requested, we changed the title to “Diet-induced loss of adipose Hexokinase 2 correlates with hyperglycemia.”

https://doi.org/10.7554/eLife.85103.sa2

Article and author information

Author details

  1. Mitsugu Shimobayashi

    1. Biozentrum, University of Basel, Basel, Switzerland
    2. Department of Chronic Diseases and Metabolism, Laboratory of Clinical and Experimental Endocrinology, KU Leuven, Leuven, Belgium
    Contribution
    Conceptualization, Resources, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Methodology, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    mitsugu.shimobayashi@kuleuven.be
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6936-0990

  2. Amandine Thomas

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Data curation, Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared

  3. Sunil Shetty

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Data curation, Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared

  4. Irina C Frei

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Data curation, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared

  5. Bettina K Wölnerhanssen

    1. University of Basel, Basel, Switzerland
    2. St. Clara Research Ltd, St. Claraspital, Basel, Switzerland
    Contribution
    Resources, Data curation, Project administration
    Competing interests
    is affiliated with St. Clara Research Ltd. The author has no other competing interests to declare

  6. Diana Weissenberger

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared

  7. Anke Vandekeere

    1. Laboratory of Cellular Metabolism and Metabolic Regulation, VIB-KU Leuven Center for Cancer Biology, Leuven, Belgium
    2. Department of Oncology, Laboratory of Cellular Metabolism and Metabolic Regulation, KU Leuven and Leuven Cancer Institute, Leuven, Belgium
    Contribution
    Data curation, Funding acquisition, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6836-3834

  8. Mélanie Planque

    1. Laboratory of Cellular Metabolism and Metabolic Regulation, VIB-KU Leuven Center for Cancer Biology, Leuven, Belgium
    2. Department of Oncology, Laboratory of Cellular Metabolism and Metabolic Regulation, KU Leuven and Leuven Cancer Institute, Leuven, Belgium
    Contribution
    Data curation, Investigation, Methodology
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7052-7084

  9. Nikolaus Dietz

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Data curation, Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7300-4342

  10. Danilo Ritz

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Data curation, Formal analysis, Validation, Investigation, Methodology
    Competing interests
    No competing interests declared

  11. Anne Christin Meyer-Gerspach

    1. University of Basel, Basel, Switzerland
    2. St. Clara Research Ltd, St. Claraspital, Basel, Switzerland
    Contribution
    Resources, Data curation
    Competing interests
    is affiliated with St. Clara Research Ltd. The author has no other competing interests to declare

  12. Timm Maier

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Data curation, Investigation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-7459-1363

  13. Nissim Hay

    Department of Biochemistry and Molecular Genetics, College of Medicine, University of Illinois at Chicago, Chicago, United States
    Contribution
    Resources
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-6245-3000

  14. Ralph Peterli

    Clarunis, Department of Visceral Surgery, University Centre for Gastrointestinal and Liver Diseases, Basel, Switzerland
    Contribution
    Resources, Data curation
    Competing interests
    No competing interests declared

  15. Sarah-Maria Fendt

    1. Laboratory of Cellular Metabolism and Metabolic Regulation, VIB-KU Leuven Center for Cancer Biology, Leuven, Belgium
    2. Department of Oncology, Laboratory of Cellular Metabolism and Metabolic Regulation, KU Leuven and Leuven Cancer Institute, Leuven, Belgium
    Contribution
    Data curation, Formal analysis, Funding acquisition, Project administration
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6018-9296

  16. Nicolas Rohner

    1. Stowers Institute for Medical Research, Kansas City, United States
    2. Department of Cell Biology and Physiology at the University of Kansas School of Medicine, Kansas City, United States
    Contribution
    Data curation, Formal analysis, Investigation, Methodology, Project administration
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3248-2772

  17. Michael N Hall

    Biozentrum, University of Basel, Basel, Switzerland
    Contribution
    Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing
    For correspondence
    m.hall@unibas.ch
    Competing interests
    No competing interests declared

Funding

Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (179569)

  • Michael N Hall

Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (NCCR182880)

  • Michael N Hall

Schweizerischer Nationalfonds zur Förderung der Wissenschaftlichen Forschung (161510)

  • Mitsugu Shimobayashi

KU Leuven (STG/20/020)

  • Mitsugu Shimobayashi

KU Leuven (C14/22/116)

  • Mitsugu Shimobayashi

European Foundation for the Study of Diabetes

  • Mitsugu Shimobayashi

Fonds Wetenschappelijk Onderzoek

  • Anke Vandekeere

Fonds Wetenschappelijk Onderzoek (G098120N)

  • Sarah-Maria Fendt

Fonds Baillet Latour

  • Sarah-Maria Fendt

Louis-Jeantet Foundation

  • Michael N Hall

Universität Basel

  • Michael N Hall

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Stefan Offermanns (MPI-HLR, Germany), Didier Trono (EPFL, Switzerland), Robert Weinberg (MIT, USA), Christine Riggenbach (St. Claraspital), Christoph Handschin (Biozentrum), the Imaging Core Facility (Biozentrum), and the Proteomics Core Facility (Biozentrum) for providing reagents and technical support. We acknowledge support from the Swiss National Science Foundation (project 179569 and NCCR 182880 to MNH and 161510 to MS), KU Leuven internal fund (Project STG/20/020 and C14/22/116 to MS), European Foundation of the study of Diabetes/Novo Nordisk Foundation (MS), a FWO PhD fellowship (AV), FWO (Project G098120N to SMF), Fonds Baillet Latour (SMF), The Louis Jeantet Foundation (MNH), and the Canton of Basel (MNH). None of the funding sources was involved in study design, data collection and interpretation, or the decision to submit the work for publication.

Ethics

Human subjects: Informed onset was obtained from all participants, and the study protocol was approved by the Ethikkomission Nordwest- und Zentralschweiz (EKNZ BASEC 2016-01040).

All animal experiments were performed in accordance with federal guidelines for animal experimentation and were approved by the Kantonales Veterinäramt of the Kanton Basel-Stadt (#31986 - 3040) or KU Leuven animal ethical committee (#206/2020).

Senior Editor

  1. Carlos Isales, Augusta University, United States

Reviewing Editor

  1. Michael Czech, University of Massachusetts Medical School, United States

Reviewer

  1. Amira Klip, Hospital for Sick Children, Canada

Publication history

  1. Preprint posted: December 28, 2019 (view preprint)
  2. Received: November 22, 2022
  3. Accepted: February 19, 2023
  4. Version of Record published: March 15, 2023 (version 1)

Copyright

© 2023, Shimobayashi et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 446
    Page views
  • 85
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Mitsugu Shimobayashi
  2. Amandine Thomas
  3. Sunil Shetty
  4. Irina C Frei
  5. Bettina K Wölnerhanssen
  6. Diana Weissenberger
  7. Anke Vandekeere
  8. Mélanie Planque
  9. Nikolaus Dietz
  10. Danilo Ritz
  11. Anne Christin Meyer-Gerspach
  12. Timm Maier
  13. Nissim Hay
  14. Ralph Peterli
  15. Sarah-Maria Fendt
  16. Nicolas Rohner
  17. Michael N Hall
(2023)
Diet-induced loss of adipose hexokinase 2 correlates with hyperglycemia
eLife 12:e85103.
https://doi.org/10.7554/eLife.85103

Categories and tags

Research organisms

Further reading

    1. Structural Biology and Molecular Biophysics
    2. Cell Biology

    Mechanosensitive pore opening of a prokaryotic voltage-gated sodium channel

    Peter R Strege, Luke M Cowan ... Arthur Beyder
    Research Article Updated

    Voltage-gated ion channels (VGICs) orchestrate electrical activities that drive mechanical functions in contractile tissues such as the heart and gut. In turn, contractions change membrane tension and impact ion channels. VGICs are mechanosensitive, but the mechanisms of mechanosensitivity remain poorly understood. Here, we leverage the relative simplicity of NaChBac, a prokaryotic voltage-gated sodium channel from Bacillus halodurans, to investigate mechanosensitivity. In whole-cell experiments on heterologously transfected HEK293 cells, shear stress reversibly altered the kinetic properties of NaChBac and increased its maximum current, comparably to the mechanosensitive eukaryotic sodium channel NaV1.5. In single-channel experiments, patch suction reversibly increased the open probability of a NaChBac mutant with inactivation removed. A simple kinetic mechanism featuring a mechanosensitive pore opening transition explained the overall response to force, whereas an alternative model with mechanosensitive voltage sensor activation diverged from the data. Structural analysis of NaChBac identified a large displacement of the hinged intracellular gate, and mutagenesis near the hinge diminished NaChBac mechanosensitivity, further supporting the proposed mechanism. Our results suggest that NaChBac is overall mechanosensitive due to the mechanosensitivity of a voltage-insensitive gating step associated with the pore opening. This mechanism may apply to eukaryotic VGICs, including NaV1.5.

    1. Cell Biology
    2. Immunology and Inflammation

    HUWE1 controls tristetraprolin proteasomal degradation by regulating its phosphorylation

    Sara Scinicariello, Adrian Soderholm ... Gijs A Versteeg
    Research Article

    Tristetraprolin (TTP) is a critical negative immune regulator. It binds AU-rich elements in the untranslated-regions of many mRNAs encoding pro-inflammatory mediators, thereby accelerating their decay. A key but poorly understood mechanism of TTP regulation is its timely proteolytic removal: TTP is degraded by the proteasome through yet unidentified phosphorylation-controlled drivers. In this study, we set out to identify factors controlling TTP stability. Cellular assays showed that TTP is strongly lysine-ubiquitinated, which is required for its turnover. A genetic screen identified the ubiquitin E3 ligase HUWE1 as a strong regulator of TTP proteasomal degradation, which we found to control TTP stability indirectly by regulating its phosphorylation. Pharmacological assessment of multiple kinases revealed that HUWE1-regulated TTP phosphorylation and stability was independent of the previously characterized effects of MAPK-mediated S52/S178 phosphorylation. HUWE1 function was dependent on phosphatase and E3 ligase binding sites identified in the TTP C-terminus. Our findings indicate that while phosphorylation of S52/S178 is critical for TTP stabilization at earlier times after pro-inflammatory stimulation, phosphorylation of the TTP C-terminus controls its stability at later stages.

    1. Cell Biology

    Defects in lipid homeostasis reflect the function of TANGO2 in phospholipid and neutral lipid metabolism

    Agustin Leonardo Lujan, Ombretta Foresti ... Vivek Malhotra
    Research Article

    We show that TANGO2 in mammalian cells localizes predominantly to mitochondria and partially at mitochondria sites juxtaposed to lipid droplets (LDs) and the endoplasmic reticulum. HepG2 cells and fibroblasts of patients lacking TANGO2 exhibit enlarged LDs. Quantitative lipidomics revealed a marked increase in lysophosphatidic acid (LPA) and a concomitant decrease in its biosynthetic precursor phosphatidic acid (PA). These changes were exacerbated in nutrient-starved cells. Based on our data, we suggest that TANGO2 function is linked to acyl-CoA metabolism, which is necessary for the acylation of LPA to generate PA. The defect in acyl-CoA availability impacts the metabolism of many other fatty acids, generates high levels of reactive oxygen (ROS), and promotes lipid peroxidation. We suggest that the increased size of LDs is a combination of enrichment in peroxidized lipids and a defect in their catabolism. Our findings help explain the physiological consequence of mutations in TANGO2 that induce acute metabolic crises, including rhabdomyolysis, cardiomyopathy, and cardiac arrhythmias, often leading to fatality upon starvation and stress.