To examine the localization of endosomes and lysosomes in mouse MII oocytes, early or late endosomes were stained with anti-RAB5 or -RAB7 antibody, respectively, and their localization was compared with that of lysosomes stained with anti-LAMP1 antibody. Giant structures harboring lysosomes with early and late endosomes were detected (Figure 1A, Figure 1—figure supplement 1, Video 1). Although small punctate structures that are RAB5-positive but LAMP1-negative also spread over the cytosol, most giant structures were positive for RAB5 and LAMP1 (Video 1). Each giant structure in the MII oocytes was spherical, ellipsoidal, or concatenated with small spheres. These structures were located in the peripheral region just beneath the PM, excluding the metaphase plate region in proximity to the metaphase chromosomes. These structures were observed from the GV stage to the pronuclear-zygote (PN-zygote) stage but were mostly disassembled at the 2-cell stage. Dispersion and separation of RAB5 and LAMP1 signals after the first division indicated that these giant structures were transiently formed (Figure 1B). On the other hand, RAB5-positive and LAMP1-negative punctate structures tend to accumulate along with LAMP1-positive punctate structures larger than 1 μm at the late 2-cell stage.

Figure 1 with 1 supplement see all

Download asset Open asset

Video 1

Download asset

Analyses of the number, size, and distribution of LAMP1-positive organelles were carried out by reconstituting three-dimensional objects using LAMP1-positive signals in immunocytochemically stained oocytes and embryos (Figure 2—figure supplement 1). Although the LAMP1 signals on the PM increased in the 2-cell stages, reconstitution of the objects was carried out only for the cytoplasmic fraction. The total number of the LAMP1-positive objects was highest at the GV stage, and it decreased toward the late 2-cell stage, with a significant difference compared to that in MII oocytes (Figure 2A). Sorting of the objects based on their sizes (indicated with the diameters when converting the volume of each object to the corresponding sphere) revealed that the LAMP1-positive structures with diameters of 0.2–0.8 μm, which were prominent in GV oocytes, significantly decreased toward the MII stage, while the number of giant LAMP1-positive structures with diameters of 3–7 μm decreased during the post-fertilization changes at the early and late 2-cell stage relative to that in MII (Figure 2B). The ratio of the number of the LAMP1-positive structures clearly indicated a drastic increase in giant structures with 5–7 μm diameter during GV to MII transition (Figure 2C). The transiently increased LAMP1-positive structures with 9–10 μm diameter at the early 2-cell stage were observed as concatenated spheres that gathered upon cellular division; concurrently, prominent signals on the PM appeared, especially at the cleavage furrow and disappeared by the late 2-cell stage (Figure 2D and E). The total volume of LAMP1-positive objects was highest in MII, and it decreased over the early and late 2-cell stages (Figure 2F). LAMP1-positive structures with diameters of >3 μm were also observed in GV oocytes, but those larger than 5 μm in diameter were rarely detected, and the total volume of LAMP1-positive structures larger than 3 μm in diameter in MII oocytes accounted for 51.3% of the total volume. The large population of the LAMP1-positive structures with diameters larger than 3 μm in MII transitioned to structures with diameters of 1–3 μm during the 2-cell stages, as indicated by the percentage of the volume of each object size relative to the total volume (Figure 2G). The reconstitution of the objects above was conducted after the thresholding of the fluorescent intensity. On the other hand, objects with diameters of 6–7 μm in MII oocytes retained high intensity/volume, but those in GV oocytes or fertilized embryos revealed lower intensities (Figure 2—figure supplement 2).

Figure 2 with 2 supplements see all

Download asset Open asset

Figure 2—source data 1

Excel file providing the numerical source data to Figure 2.

https://cdn.elifesciences.org/articles/99358/elife-99358-fig2-data1-v1.xlsx

Download elife-99358-fig2-data1-v1.xlsx

Furthermore, the analysis of object distribution for GV and MII oocytes indicated that MII oocytes had a greater number of LAMP1-positive structures with >4 μm diameter in the cellular periphery, whereas GV oocytes had a greater number of these structures in the cellular medial regions (Figure 2H and I). These results suggest that the giant LAMP1-positive structures are assembled and localized to the cellular periphery during oocyte maturation.

To clarify the internal structure of this giant structure containing lysosomes and endosomes in the MII oocytes, we observed these in MII oocytes with in-resin correlative light and electron microscopy (CLEM) using immunological reaction (immune in-resin CLEM) with anti-RAB7 and -LAMP1 antibodies (Tanida et al., 2023; Mitsui et al., 2023). RAB7 and LAMP1 signals were well detected even in the ultrathin section (100 nm thickness) of the Epon-embedded MII oocyte, fixed with the mixture of 4% paraformaldehyde (PFA) and 0.025% glutaraldehyde (GA), which showed similar distribution as that shown in Figure 1, Figure 3—figure supplement 1. Toluidine blue staining in adjacent ultrathin sections revealed that the RAB7/LAMP1-double positive structures in the fluorescence observation were also positive for toluidine blue, with interspaces often found in the center of spheres (Figure 3A). Confocal fluorescent images of the ultrathin sections clarified that RAB7-positive signals were frequently observed on the periphery of these LAMP1-positive signals. Electron microscopic analysis of the RAB7/LAMP1-double positive region in the ultrathin sections revealed that the RAB7/LAMP1-double positive structures are assemblies of tubulo-vesicular structures, with either vacuolated or filled interiors (Figure 3B). The toluidine blue stain-positive structures were confirmed to match in size and peripheral distribution with those identified via RAB7/LAMP1 immunostaining, except for the metaphase plate, even under 2.5% GA conditions for precise ultrastructural observation (Figure 3C, Figure 3—figure supplement 2, Video 2). Therefore, we examined the ultrastructural morphology of toluidine blue-positive giant structures in MII oocytes fixed with 2.5% GA. The results showed that tubular membrane vesicles with a short diameter of approximately 60.5±15.9 nm assembled in the structure, with gaps in the cytoplasm of approximately 24.0±6.7 nm. Some of the vesicles also harbored lysosome-like electron-dense contents, while others displayed multilamellar or multivesicular body-like structures, and mitochondria appeared to be absent (Figure 3D). Based on these observations, we termed this membrane assembly the ELYSA.

Figure 3 with 2 supplements see all

Download asset Open asset

Video 2

Download asset

We next examined whether autophagy-related proteins are included in ELYSAs. LC3 is a key regulator of autophagy and often used as an autophagosome marker. It has been suggested that the autophagic activity is decreased in MII oocytes since puncta formation of a transgenically expressed GFP fusion protein with LC3 disappeared at the MII stage (Tsukamoto et al., 2008). Since GFP fluorescence may be quenched under acidic conditions, we examined the localization of LC3 in GV and MII oocytes by immunostaining with an anti-LC3 antibody. We found that LC3 hardly formed puncta in the cytoplasm, but part of the LC3 signal overlapped with ELYSA in both GV and MII oocytes (Figure 4A and B), suggesting that LC3-positive membrane structures were also present in the ELYSA. Further analysis of such double-positive structures for the LC3 and LAMP1 antibodies indicated that their number decreased drastically, while their total volume did not change during oocyte maturation (Figure 4—figure supplement 1A and B). Analysis of double-positive structures indicated that their average diameter significantly shifted from 2.36±0.31 μm (GV) to 3.78±0.20 μm (MII). Moreover, LAMP1-positive structures smaller than 2 μm in diameter were rarely positive for LC3 (Figure 4—figure supplement 1C and D). On the other hand, analysis of the distance from the cellular geometric center indicated that they tended to be observed at the periphery of oocytes in both stages (more than 80% in >30 μm in the MII oocyte), and no clear tendency of double positivity was observed along the distance (Figure 4—figure supplement 1E and F). A similar trend was observed for RAB5- and LAMP1-double positive structures, while the RAB5 signals tended to overlap with LAMP1 signals more specifically at the cellular periphery than LC3, even in the GV stage (Figure 4—figure supplement 1G and H).

Figure 4 with 1 supplement see all

Download asset Open asset

The localization of LAMP1-positive structures at the perinuclear (medial) region before oocyte maturation and the specific localization at the cell periphery after maturation (Figure 2H and I) is similar to the redistribution of the endoplasmic reticulum (ER) and the formation of cortical ER clusters. Fitzharris et al. showed that the inhibition of actin cytoskeleton polymerization disturbs ER migration and cortical ER cluster formation (FitzHarris et al., 2007). Thus, we examined the involvement of cytoskeletons in ELYSA formation by adding latrunculin A (LatA) or cytochalasin B (CCB) as inhibitors of actin polymerization and nocodazole (Noco) as an inhibitor of microtubule formation during in vitro maturation (IVM). While all the drugs inhibited polar body extrusion and metaphase plate formation as reported previously (FitzHarris et al., 2007), co-immunostaining of LC3 or RAB5 antibody with LAMP1 antibody revealed their persistent colocalization in ELYSAs (Figure 5A, Figure 5—figure supplement 1).

Figure 5 with 3 supplements see all

Download asset Open asset

Figure 5—source data 1

Excel file providing the numerical source data to Figure 5 and Figure 5—figure supplement 2.

https://cdn.elifesciences.org/articles/99358/elife-99358-fig5-data1-v1.xlsx

Download elife-99358-fig5-data1-v1.xlsx

3D object analysis of the oocytes with or without cytoskeletal inhibitor treatment indicated that the total number of LAMP1-positive structures was increased only by CCB, and the total volume of the structures was unaffected (Figure 5—figure supplement 2). We then classified LAMP1-positive structures by their diameters and found that the number of structures with diameters of 0.8–2.0 μm increased when oocytes were treated with LatA and CCB; very few structures with diameters of 4–7 μm that corresponded to the enlarged ELYSAs were detected upon treatment with actin polymerization inhibitors, not the tubulin inhibitor (Figure 5B). Further examination of the distance from the cell center of each LAMP1-positive structure with a diameter larger than 4 μm in IVM oocytes indicated that only the actin polymerization inhibitors reduced the number of large structures at the cell periphery but not in the cellular medial region (Figure 5C and D).

We studied the relationship between ELYSA formation and endosomal/lysosomal acidification in oocytes. V1A is a component of the V1-subunit of V-ATPase, which is associated with the outer lysosomal membrane and drives endosomal/lysosomal acidification. We used LAMP1-EGFP mRNA to observe ELYSA behaviors during oocyte maturation, with ATP6V1A-mCherry mRNA (V1A-mCherry: a core component of V-ATPase fused with the mCherry marker) to further examine the V1-subunit localization on ELYSAs. The mRNAs were injected into GV oocytes, and the oocytes were applied to IVM.

3D object analysis for the matured oocytes at the MII stage expressing LAMP1-EGFP revealed a larger number of smaller LAMP1-positive structures (diameter of 0.2–0.4 μm) and a smaller number of structures with diameters of 0.6–1.0 μm, compared to immunostaining (Figure 2), but not significant difference in larger size (Figure 6—figure supplement 1). Live-cell imaging of LAMP1-EGFP fluorescence captured the dynamics of LAMP1-positive organelles during oocyte maturation, notably demonstrating its stable expression after GV breakdown (GVBD, 2–3 hr after initiation of IVM), and revealed that the enlargement of ELYSAs larger than 5 μm in diameter occurred through the sequential assembly of smaller ELYSAs that constantly migrated and contacted each other (Figure 6A, Video 3).

Video 3

Download asset

Figure 6 with 1 supplement see all

Download asset Open asset

We then analyzed the localization of V1A-mCherry in the oocytes after IVM. Although it was indistinguishable whether V1-subunit molecules or V1-subunit-positive compartment were recruited to ELYSAs, V1A-mCherry signals were largely distributed on the ELYSA surface and rarely observed within ELYSAs in deconvolved confocal images (Figure 6B, Video 3).

We examined the relationship between ELYSA disappearance and the emergence of acidic membrane compartments during early development. LysoSensor probes exhibit increased fluorescence in a pH-dependent manner upon acidification and enable the semiquantitative analysis of cellular acidic compartments, whereas LysoTracker probes exhibit non-pH-dependent fluorescence. We first co-stained oocytes and embryos at various stages with LysoTracker Red and LysoSensor Green (in the same medium drop). LysoTracker showed a pronounced puncta-like signal after the 2-cell stage, as previously reported (Tsukamoto et al., 2013). In contrast, the ELYSAs in GV and MII oocytes were clearly identified by LysoSensor, whereas LysoTracker only produced a very dim signal. Thus, the ratio of LysoTracker/LysoSensor fluorescent intensities in the cytoplasm of each stage embryo indicated that ELYSAs were present at a low ratio. In contrast, embryos at the 4-cell stage and beyond displayed small punctate signals with a higher ratio (Figure 7). A comparison between LysoTracker and V1A-mCherry signals showed that these fluorescent signals colocalized well on small bright vesicles but not on the ELYSA. Both LysoTracker and V1A-mCherry puncta were reduced in embryos cultured in the presence of bafilomycin A₁, which inhibits the H⁺ translocation of V-ATPase (Figure 7—figure supplement 1). This suggests that LysoTracker detects membrane compartment acidification. However, it may not sufficiently capture this process within the ELYSA. In contrast, the results using LysoSensor suggest that lysosomes within the ELYSA were not completely neutralized and remained acidic at a lower level, even though V1A was difficult to localize.

Figure 7 with 1 supplement see all

Download asset Open asset

When LAMP1-EGFP mRNA was injected into fertilized oocytes, it was difficult to visualize the lysosomes due to the presence of a population that migrates onto the PM during the 2-cell stage. Thus, to examine the spatiotemporal relationship between V1A localization and lysosomal acidification during embryogenesis, we injected V1A-mCherry mRNA into PN-zygotes and cultured them in the presence of LysoSensor. It should be noted that stable detection of LysoSensor and V1A-mCherry fluorescence required 4–8 hr. In this process, localization of V1A signal to lysosomes was rarely observed until ELYSA disappearance or disassembly throughout the PN-zygote stage, but rapidly enhanced in the early 2-cell embryo stage. LysoSensor-positive punctate structures, where V1A-mCherry signal colocalize, increased in number during the transition from early to late 2-cell stage, indicating that lysosomal acidification is promoted after ELYSA disappearance (Figure 8, Video 4).

Figure 8

Download asset Open asset

Video 4

Download asset

Cathepsins are mainly responsible for the proteolytic activity in lysosomes. We visualized the proteolytic activity of cathepsin B, the expression of which has been confirmed in mouse embryos (Tsukamoto et al., 2013). Mouse oocytes and embryos at various stages were simultaneously collected and stained with Magic Red Cathepsin B staining solution to examine their relationship with the ELYSA. Magic Red staining showed that proteolytic activity was detected not only in the small, isolated membrane structures (mature lysosomes) but also in the ELYSA in the GV and MII oocytes, whereas small punctate structures were predominantly stained in other stages (Figure 9A, Figure 9—figure supplement 1A). The intensity plots of LysoSensor and Magic Red fluorescence revealed that the proteolytic activity indicated by the Magic Red signal in the ELYSA was detected, but not as strong as that in isolated punctate structures (lysosomes) in the GV and MII oocytes, and in developing embryos (Figure 9B, Figure 9—figure supplement 1B and C).

Figure 9 with 1 supplement see all

Download asset Open asset

Figure 9—source data 1

Excel file providing the numerical source data to Figure 9 and Figure 9—figure supplement 1.

https://cdn.elifesciences.org/articles/99358/elife-99358-fig9-data1-v1.xlsx

Download elife-99358-fig9-data1-v1.xlsx

Neither randomization nor blinding was used for animal selection (8–16 weeks of age). All experimental protocols involving animals were approved and performed in accordance with the guidelines of the Animal Care and Experimentation Committee of Gunma University (approval number 22-076). Hybrid B6D2F1 mice were purchased from the Japan SLC (Hamamatsu, Japan).

The following primary antibodies were used: rabbit monoclonal anti-RAB5 (C8B1; 3547; Cell Signaling Technology, Danvers, MA, USA), rabbit monoclonal anti-RAB7 (D95F2; 9367; Cell Signaling Technology), rat monoclonal anti-mouse LAMP1 (1D4B; sc-19992; Santa Cruz Biotechnology, Dallas, TX, USA), and mouse monoclonal anti-rat LC3 (Clones 4E12; M152-3; Medical and Biological Laboratories, Tokyo, Japan). The following secondary antibodies were used: goat anti-rabbit IgG (H+L) conjugated with Alexa Fluor 555 (A-21428; Thermo Fisher Scientific, Waltham, MA, USA), goat anti-rat IgG (H+L) cross-adsorbed secondary antibody conjugated with Alexa Fluor 488 and 647 (A-11006 and A-21247, respectively; Thermo Fisher Scientific), and goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody conjugated with Alexa Fluor 546 (A-11030; Thermo Fisher Scientific). The following inhibitors or solutions were used for IVM or embryonic culture assays: dimethyl sulfoxide (DMSO) (13406-55; Nacalai Tesque, Kyoto, Japan); LatA actin polymerization inhibitor that binds to monomer actin (428021; Sigma-Aldrich, St. Louis, MO, USA); CCB, an actin polymerization inhibitor that binds to the plus-end of polymerized actin (C6762; Sigma-Aldrich); and Noco, a tubulin polymerization inhibitor that binds to β-tubulin (M1404; Sigma-Aldrich). Stock solutions of LatA, CCB, or Noco were prepared by solubilizing each in DMSO at 200× concentration for the assays. Bafilomycin A₁ was dissolved in DMSO (L266; Dojindo, Kumamoto, Japan) at a final concentration of 25 nM.

GV oocytes were collected from the ovaries of female mice 46 hr after injection with pregnant mare serum gonadotropin or an anti-inhibin antibody (CARD HyperOva; Kyudo, Kumamoto, Japan) (Takeo and Nakagata, 2015). Antral follicles were suspended in 30 μL of FHM medium drops (Sigma-Aldrich) covered with liquid paraffin (Nacalai Tesque), punctured using 26G needles (Terumo, Tokyo, Japan), and the GV oocytes were collected using a glass needle with a mouth pipette. MII oocytes were collected from the oviducts of female mice 13 hr after injection with CARD HyperOva and 7.5 IU human chorionic gonadotropin (hCG; ASKA Pharmaceutical, Tokyo, Japan) 48 hr apart. The oviductal wall was punctured using a 26G needle to collect cumulus-oocyte complexes in 20 μL potassium simplex optimization medium (KSOM; Kyudo) drops covered with liquid paraffin.

Complementary DNA for mouse Lamp1 (accession number NM_001317353) or Atp6v1a (accession number NM_001358204) was amplified using PCR with High-fidelity Taq Polymerase, KOD FX Neo (Toyobo, Osaka, Japan), and a mouse ovary cDNA library as a template (Genostaff, Tokyo, Japan). The amplicon was then subcloned into the entry vector pDONR221 and transferred into the destination vectors pDEST-CMV-C-EGFP (Agrotis et al., 2019) (a gift from Robin Ketteler [Addgene plasmid # 122844; http://n2t.net/addgene:122844; RRID:Addgene_122844]; for Lamp1) or pDest-mCherry-N1 (Hong et al., 2010) (a gift from Robin Shaw [Addgene plasmid # 31907; http://n2t.net/addgene:31907; RRID:Addgene_31907]; for Atp6v1a) using Gateway recombination cloning technology. The following primer combinations were used for cloning: 5′-GCGCACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGGCGGCCCCCGGCG-3′ and 5′- GCGCACCACTTTGTACAAGAAAGCTGGGTTGATGGTCTGATAGCCGGCGTGACT –3′ (for Lamp1), or 5′- GCGCACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGGATTTCTCCAAGCTACCC-3′ and 5′-GCGCACCACTTTGTACAAGAAAGCTGGGTTGTCTTCAAGGCTACGGAATG-3′ (for Atp6v1a). The cDNA encoding Lamp1-EGFP or Atp6v1a-mCherry were amplified using the following primer combinations: 5′-CGCAAATGGGCGGTAGGCGTG-3′ and 5′-TCCAGCAGGACCATGTGATCGC-3′ (for Lamp1-EGFP), or 5′-CGCAAATGGGCGGTAGGCGTG-3′ and 5′-TTGGTCACCTTCAGCTTGG-3′ (for Atp6v1a-mCherry). RNA synthesis using each PCR amplicon as a template, poly-A tail addition, and mRNA purification were performed using an mMESSAGE mMACHINE T7 Ultra kit (Thermo Fisher Scientific) and MEGAclear transcription clean-up kit (Thermo Fisher Scientific), according to the manufacturer’s protocols. Synthesized mRNAs were dissolved in RNase-free demineralized water at a concentration of 400 ng/μL and frozen in aliquots until use.

IVM for the GV oocytes was conducted by washing the oocytes twice and culturing in alpha-modified Eagle’s minimum essential medium (Thermo Fisher Scientific) containing 5% (vol/vol) fetal bovine serum (FBS), 0.1 IU/mL follicle-stimulating hormone (MSD, Tokyo, Japan), 1.2 IU/mL of hCG (ASKA Pharmaceutical), and 4 ng/mL of epidermal growth factor (Thermo Fisher Scientific) for 17 hr at 37°C under a 5% CO₂ atmosphere (Morohaku et al., 2016). For in vitro fertilization, spermatozoa from a B6D2F1 epididymis were pre-incubated in a 100 μL modified human tubal fluid medium (Kyudo) drop covered with liquid paraffin and inseminated at a sperm concentration of 1.5×10⁵ per mL for 1.5 hr. Excess spermatozoa were washed out, and the oocytes were incubated in a 20 μL KSOM drop (Kyudo) for further development. IVM assays using LatA and CCB were performed by transferring oocytes to medium drops containing each inhibitor or DMSO 4 hr after the start of IVM (waiting for the completion of GVBD), as previously reported (FitzHarris et al., 2007). IVM media containing DMSO, LatA, or CCB was prepared by diluting the stock solution (1:400), and the final concentration of the inhibitors was 10 μM. The embryonic culture assay using bafilomycin A₁ was conducted by transferring the PN-zygote into a 20 μL drop of KSOM containing 25 nM bafilomycin A₁ covered with liquid paraffin at 6 hr post-fertilization (hpf). Embryos were transferred at 24, 48, and 72 hpf to freshly prepared KSOM containing bafilomycin A₁.

Immunostaining of oocytes or embryos was performed as previously described (Morita et al., 2021). Oocytes or embryos were cultured to the indicated stages and fixed in 4% PFA (Nacalai Tesque) in phosphate-buffered saline (PBS) containing 0.1 mg/mL polyvinyl alcohol (PVA; Sigma-Aldrich; PVA/PBS) for 15 min at 25–27°C. After fixation, the cells were permeabilized with PVA/PBS containing 0.1% Triton X-100 (Sigma-Aldrich) for 30 min at 25–27°C and washed three times with PVA/PBS. After blocking with 10% FBS (Thermo Fisher Scientific) in PBS for 1 hr at room temperature, the cells were incubated with the aforementioned primary antibodies (1:100 for all) overnight at 4°C. Next, the cells were washed three times in PVA/PBS and incubated with anti-mouse, rat, or rabbit IgG secondary antibodies coupled with Alexa Fluor 488, 555, or 564 (1:200 for all; Thermo Fisher Scientific) at 25–27°C for 2–4 hr. Thereafter, the cells were incubated with PVA/PBS containing 10 μg/mL Hoechst 33342 (Dojindo) for 10 min and washed with fresh PVA/PBS a few times. Subsequently, control and nonspecific staining were performed by processing oocytes and embryos in the absence of primary antibodies. The oocytes and embryos were imaged in PVA/PBS microdrops in 35 mm glass-bottomed dishes (MatTek Corporation, Ashland, MA, USA). For each position, confocal images at 81 z-axis planes with 1 μm increments were acquired on an IX-71 inverted microscope (Olympus Corporation, Tokyo, Japan) equipped with a CSU W-1 confocal scanner unit (Yokogawa Electric Corporation) using a 60× silicone immersion lens UPLSAPO60XS (Olympus Corporation).

Acidic organelles in the oocytes were visualized using LysoTracker Red DND-99 and LysoSensor Green DND-189 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Briefly, the oocytes or embryos at target stages for one experimental round were obtained simultaneously and incubated in a large drop of reaction mixture (KSOM containing 1/10,000 Magic Red stock solution dissolved in DMSO and 1/1000 LysoSensor Green DND-189 stock solution dissolved in DMSO) for 30 min at 37°C under 5% CO₂ in a humidified atmosphere in liquid paraffin in a 35 mm glass-bottomed dish (MatTek Corporation). Subsequently, confocal images at 41 z-axis planes with 2 μm increments were obtained using a CSU W-1 spinning disk confocal microscope with a 30× silicone immersion lens UPLSAPO30XS (Olympus Corporation). Acquisition conditions for fluorescence excited by 470 nm (LysoSensor) and 555 nm (LysoTracker) lasers were determined in preliminary experiments to be almost 1:1 intensities between the two wavelengths for cytosolic punctate structures in the 2-cell embryo. Further generation of ratio images for LysoTracker/LysoSensor fluorescence were carried out using Fiji software (Schindelin et al., 2012). Averaged intensity projection was carried out, determining background intensity of each field by subtracting the averaged intensities of four cellular blank regions from the whole image. Then, 32-bit ratio images for LysoTracker/LysoSensor fluorescence of cytosolic regions were generated by processing images with ‘Math/Divide’ function in Fiji, and ‘fire’ lookup table images were converted to RGB images.

Intracellular cathepsin activity was assayed in oocytes or embryos using Magic Red Cathepsin B or Cathepsin L detection kits (ImmunoChemistry Technologies LLC, Davies, CA, USA) according to the manufacturer’s instructions. Briefly, the oocytes or embryos at target stages for one experimental round were obtained simultaneously and incubated in a large drop of reaction mixture (KSOM containing 1/250 Magic Red stock solution dissolved in DMSO and 1/1000 LysoSensor Green DND-189 stock solution dissolved in DMSO) for 25 min at 37°C under 5% CO₂ in a humidified atmosphere in liquid paraffin in a 35 mm glass-bottomed dish (MatTek Corporation). Thereafter, Hoechst 33342 (10 μg/mL) was added to the drop to a final concentration of 10 μg/mL, and incubated for 5 min. Subsequently, oocytes or embryos at the same stage were collected, and confocal images at 41 z-axis planes with 2 μm increments for both 470 nm (LysoSensor) and 555 nm (Magic Red) lasers were obtained on a CSU W-1 spinning disk confocal microscopy using a 30× silicone immersion lens UPLSAPO30XS (Olympus Corporation).

In-resin CLEM was performed as previously described with some modifications (Tanida et al., 2023; Mitsui et al., 2023). Briefly, oocytes were fixed in 4% PFA and 0.025% GA. After permeabilization with 50 μg/mL digitonin (Nacalai Tesque) and 0.02% Triton X-100, oocytes were washed with PVA/PBS three times and incubated with PBS containing 10% (wt/vol) FBS (Thermo Fisher Scientific) for 1 hr at room temperature. Thereafter, oocytes were incubated with PVA/PBS containing primary antibody overnight at 4°C. After incubation with a secondary antibody in PVA/PBS for 2 hr, oocytes were fixed in 4% PFA and 2.5% GA, embedded in 1.5% agarose, stained with osmium tetroxide, dehydrated with graded ethanol solutions (QY1), and embedded in epoxy resin (Oken Shoji, Tokyo, Japan). Ultrathin sections of Epon-embedded oocytes (100 nm thickness) were prepared using a Leica UC6 ultramicrotome (Leica, Nussloch, Germany) and placed on glass coverslips. Subsequently, fluorescence microscopy images of the sections were obtained using a Nikon A1RHD25 confocal laser scanning microscope with a NIS-Elements software (Nikon, Tokyo, Japan). Electron microscopic images were observed using a Helios Nanolab 660 FIB-SEM instrument (FEI Company, Hillsboro, OR, USA).

For conventional electron microscopy, the oocytes were fixed in the presence of 2% PFA and 2.5% GA and stained with osmium tetroxide. After dehydration with ethanol, the oocytes were embedded in epoxy resin, as described above. Sections were cut at a thickness of 100 nm using a UC6 ultramicrotome, mounted on glass coverslips, stained with uranyl acetate and lead citrate, and observed under a Regulus8240 scanning electron microscope (Hitachi High-Tech Corporation, Tokyo, Japan).

Serial semi-thin sections were cut at a thickness of 300 nm using a UC6 ultramicrotome and mounted on glass slides. Next, the sections were stained with 1% toluidine blue/0.1 M PB, and images were obtained using a BX50 light microscope (Olympus Corporation). Serial toluidine blue-stained images were aligned using FIJI (National Institutes of Health, MD, USA) with plugin-linear stack alignment using SIFT (LSAS), and 3D reconstruction was performed using Amira software (Thermo Fisher Scientific).

Microinjection of mRNA into GV oocytes was performed as previously described (Umeda et al., 2020; Kato et al., 2016). Briefly, antral follicles were harvested in FHM medium containing 250 μM of dbcAMP using 26G needles (Terumo). After dissociating the cumulus cells by pipetting, the oocytes were transferred to medium supplemented with 250 μM of dbcAMP and 10 μM of CCB (Sigma-Aldrich). Thereafter, mRNA injection into the oocytes was performed using a piezo-micromanipulator (Primetech, Tokyo, Japan) with a glass capillary needle. The mRNA concentrations were 50 and 100 ng/μL for V1A-mCherry and Lamp1-EGFP, respectively. The oocytes were washed three times and used for IVM. Microinjection of mRNA into zygote stage embryo (at 3–4 hpf) was carried out as previously described (Morita et al., 2021). The concentration of mRNA was the same as that in the GV oocytes.

Low-invasive confocal fluorescence imaging of oocytes/embryos was performed as previously described (Nozawa et al., 2018; Satouh et al., 2017; Satouh et al., 2012) with slight modifications. Briefly, on an inverted microscope IX-71 (Olympus Corporation) equipped with a CSU W-1 confocal scanner unit (Yokogawa Electric Corporation), an incubation chamber (Tokai Hit, Fujinomiya, Japan) was set at 37°C on the microscope stage, with a gas mixture of 5% CO₂ introduced into the chamber at 150 mL/min. Oocytes/embryos were placed in 8 μL of IVM medium or KSOM drops covered with liquid paraffin (Nacalai Tesque) in 35 mm glass-bottomed dishes (MatTek Corporation). Subsequently, confocal images at 41 z-axis planes with 2 μm increments for excitation lasers of 470 and 555 nm from an LDI-7 Laser Diode Illuminator (89 North, Williston, VT, USA) were obtained every 30 or 60 min during IVM or embryonic culture observation, respectively, through optimized band-pass filters using 30× silicone immersion lens UPLSAPO30XS (Olympus Corporation).

Series of confocal images with 81 z-axis planes with 1 μm increments for LAMP1 immunostaining were used for 3D object analysis. Fields to analyze were cropped for each oocyte/embryo, and the upper and lower end of LAMP1 fluorescent signals in the cytosol were examined to determine the center plane (middle height) of the cell. The cellular region in the center plane was used for masking and determination of the geometric center (as a 3D center) of each oocyte. Deletion of the signals from the polar body or zona pellucida was carried out manually. Objects were profiled using the 3D object counter plugin (Bolte and Cordelières, 2006) of Fiji software (Schindelin et al., 2012), to measure the number, volume, geometric center of each object, and mean distance from the geometrical center of the object to its surface. Thresholding was carried out after background subtraction using the Fiji software, manually applying intensities of 600–1200 as threshold to recognize objects separately. Signals on PM were eliminated both via size filtering (0–5000 μm³) of the 3D object counter plugin and manual erasing. The distal distance of each object from the 3D center of the oocyte was used for distribution analysis to avoid underestimation of the distance of large ELYSA. This was calculated by adding the distance from the 3D center of the oocyte to the geometric center of each object and the mean distance from the geometrical center of the object to its surface. Distance calculation and generation of bar graphs were carried out using Excel 2016 software (Microsoft, Redmond, WA, USA). Object-based colocalization analysis for the punctate structures were performed using the JACoP plugin in the ImageJ Fiji software (Bolte and Cordelières, 2006). Confocal z-stack images of multiple wave length for LAMP1 and LC3 or RAB5 antibodies were acquired for each oocyte as above, and object-based colocalization was examined by identifying coincidence of geometric centers of LC3 or RAB5 objects overlapping on LAMP1 objects. All of the LAMP1-positive 3D objects were listed with the 3D object counter plugin applied with same threshold, and the colocalized LAMP1-positive objects were identified and analyzed using the Excel 2016 software.

Analysis of the acquired images, including the generation of a line plot of intensity, adjustment of intensity, and generation of montage images at a uniform intensity, was performed using Fiji software (Schindelin et al., 2012). To enhance the images, a Gaussian Blur filter (at a sigma radius of 1) and auto-adjustment of the intensity were applied to the stack of images. To adjust the intensity, auto-adjustment of the intensity was applied to each image. The movies were concatenated using Premiere Pro software (Adobe, San Jose, CA, USA).

Sample sizes were estimated based on previous studies using similar experiments, and results from preliminary experiments were examined to ensure statistical power more than 0.8 using statistical power analysis in the G*Power software (Faul et al., 2007). Statistical analyses and generation of dot plot graphs were performed using GraphPad Prism 8 (GraphPad Software, Boston, MA, USA). The significance of difference among groups were compared using one-way ANOVA and Tukey’s multiple comparison test. The experimenters were not blinded because of a limitation in the availability of experienced personnel. Images indicated in the figures were selected as representative among at least 10 oocytes/embryos from independent experiments of three times or more.

The vector for the expression of Lamp1-EGFP or Atp6v1a-mCherry is available from the corresponding authors upon reasonable request.

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

We would like to thank Editage (https://www.editage.jp/) for English language editing.

This study was supported by the Japan Society for the Promotion of Science KAKENHI (Grant Numbers 19H05711, 20H00466, 24H02031 to K Sato, 21H02435, 22H02872, and 22H04652 to I Tanida, and 20K22744 to J Yamaguchi), Takeda Science Foundation to K Sato (Grant Number 2024095741), the Mochida Memorial Foundation for Medical and Pharmaceutical Research, Takeda Science Foundation (Grant Number 2022093867), and The Cell Science Research Foundation to Y Satouh. This work was partly supported by the Project for Elucidating and Controlling Mechanisms of Aging and Longevity from the Japan Agency for Medical Research and Development (AMED 21gm5010003 to Y Uchiyama, 22gm1710001 s0201 and 23gm1710001s0202 to I Tanida) and by the MEXT-supported Program for the Strategic Research Foundation at Private Universities (to Y Uchiyama), and the Center of Genomic and Regeneration Medicine, Juntendo University Graduate School of Medicine (to Y Uchiyama and I Tanida).This work was partly supported by the joint research program of the Institute for Molecular and Cellular Regulation, Gunma University (24014 to I Tanida and K Sato).

All experimental protocols involving animals were approved and performed in accordance with the guidelines of the Animal Care and Experimentation Committee of Gunma University (Approval No. 22-076).

1. Preprint posted: May 29, 2024
2. Sent for peer review: May 29, 2024
3. Reviewed Preprint version 1: July 26, 2024
4. Reviewed Preprint version 2: January 31, 2025
5. Version of Record published: March 17, 2025

You can cite all versions using the DOI https://doi.org/10.7554/eLife.99358. This DOI represents all versions, and will always resolve to the latest one.

© 2024, Satouh et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.