• Figure 1.
    Download figureOpen in new tabFigure 1. SKN-1 promotes longevity and stress resistance in germline stem cell (GSC)(−) animals.

    (A, B) Wild type, skn-1(zu135), glp-1(bn18ts), and glp-1(bn18ts);skn-1(zu135) double mutants were assayed for lifespan at 25°C. skn-1(zu135) is a presumed null that is used throughout the study. Unless otherwise specified, glp-1(ts) refers to glp-1(bn18ts). (A) Composite survival curve. (B) Graph of mean lifespans. (CF) glp-1(ts) mutants require skn-1 for oxidative stress resistance. Day-3 adult glp-1(ts) and control worms treated with skn-1 RNAi or empty vector were exposed to (C, D) 5 mM sodium arsenite (AS) or (E, F) 15.4 mM tert-butyl hydroperoxide (TBHP). Data are represented as mean ± SEM. p < 0.001***. The interaction between glp-1 and skn-1 was significant for both lifespan and stress resistance (p < 0.001). Statistical analysis and replicates are in Tables 1, 2.

    DOI: http://dx.doi.org/10.7554/eLife.07836.003

    Figure 2.
    Download figureOpen in new tabFigure 2. GSCs inhibit SKN-1 activity in the intestine.

    (A) Representative images of SKN-1::green fluorescent protein (GFP) in intestinal nuclei; GFP channel (top), bright field (BF; bottom). (B) Accumulation of SKN-1::GFP in intestinal nuclei in GSC(−) animals. (C) skn-1-dependent activation of direct SKN-1 target genes (Robida-Stubbs et al., 2012) in response to GSC absence, detected by qRT-PCR. (D, E) Increased expression of gst-4p::GFP in the intestine of glp-1(ts) animals. Hypodermal gst-4p::GFP expression appeared to be unaffected. (D) Representative 10× images. (E) Intestinal gst-4p::GFP quantification. (FH) GSCs regulate SKN-1 parallel to DAF-16 and DAF-12. In (H), SKN-1 target genes are assayed by qRT-PCR. glp-1(ts) refers to glp-1(e2141ts), and horizontal black lines indicate strains lacking GSCs. (C, H) Data are represented as mean ± SEM. n = 3 for qRT-PCR samples. (B, EG) GFP quantification with high, medium, low scoring. Numbers above bars denote sample size. p < 0.05*; p < 0.01**; p < 0.001***.

    DOI: http://dx.doi.org/10.7554/eLife.07836.006

    Figure 7.
    Download figureOpen in new tabFigure 7. SKN-1 regulation in the GSC longevity pathway.

    GSC absence results in activation of transcription factors in the intestine, with SKN-1 being regulated in parallel to DAF-12 and DAF-16. Yolk transport to oocytes is disrupted by GSC loss, resulting in lipid accumulation in the intestine and body cavity. The resulting SKN-1 activation requires OA, the FAT-6/7 FA desaturases, and the lysosomal lipases LIPL-1/3. This lipid-based signaling to SKN-1 depends partially upon LBP-8, which transports FAs from the lysosome to the nucleus. SKN-1 induces transcription of genes involved in stress resistance, detoxification, proteasome maintenance, extracellular matrix, and lipid metabolism, thereby reducing fat storage and increasing stress resistance and lifespan. Magenta denotes processes that are active in the presence of GSCs.

    DOI: http://dx.doi.org/10.7554/eLife.07836.019

  • SetStrainMean lifespan ± SEM (days)Median lifespan (days)75th % (days)N% Mean lifespan Ext.p value
    Lifespan at 25°C
     Composite lifespan at 25°C with FUdR (from 2 replicates)
    C1N215.40 ± 0.21617133/148
    skn-1(zu135)14.66 ± 0.21516158/167
    glp-1(bn18ts)19.94 ± 0.32022164/17129.48<0.0001*
    glp-1(bn18ts);skn-1(zu135)15.23 ± 0.21518149/1703.89<0.0001†
    two-way ANOVA glp-1(ts) and skn-1 interaction<0.0001
     Replicate lifespans at 25°C with FUdR
    #1N213.99 ± 0.4141740/55
    skn-1(zu135)12.54 ± 0.3131441/50
    glp-1(bn18ts)22.46 ± 0.8252750/5560.54<0.0001*
    glp-1(bn18ts);skn-1(zu135)13.29 ± 0.4121453/706.00<0.0001†
    glp-1(ts) and skn-1 interaction<0.0001 
    #2N216.07 ± 0.2161793/93
    skn-1(zu135)15.42 ± 0.21517117/117
    glp-1(bn18ts)18.86 ± 0.31921114/11617.36<0.0001*
    glp-1(bn18ts);skn-1(zu135)16.42 ± 0.2171896/1006.49<0.0001†
    glp-1(ts) and skn-1 interaction0.0002
    Lifespan at 20°C (25°C during development, downshifted to 20°C at D1 adulthood)
     Lifespan at 20°C without FUdR
    #3N220.36 ± 0.6182142/50
    skn-1(zu135)18.39 ± 0.5181827/47
    glp-1(bn18ts)25.87 ± 1.3243335/6627.060.0002*
    glp-1(bn18ts);skn-1(zu135)20.02 ± 0.6182434/558.86<0.0001†
    glp-1(ts) and skn-1 interaction0.0230
     Composite lifespan at 20°C with FUdR (from 2 replicates)
    C2N220.51 ± 0.5212486/90
    skn-1(zu135)17.78 ± 0.4192088/94
    glp-1(bn18ts)24.52 ± 0.6252881/10419.55<0.0001*
    glp-1(bn18ts);skn-1(zu135)20.47 ± 0.5202491/9815.13<0.0001†
    glp-1(ts) and skn-1 interaction0.1892 
     Replicate lifespans at 20°C with FUdR
    #4N218.09 ± 0.4171933/37
    skn-1(zu135)14.78 ± 0.5141731/35
    glp-1(bn18ts)21.79 ± 1.0212828/5020.450.0002*
    glp-1(bn18ts);skn-1(zu135)16.83 ± 0.3171836/4313.87<0.0001†
    glp-1(ts) and skn-1 interaction0.1491
    #5N222.00 ± 0.6232553/53
    skn-1(zu135)19.40 ± 0.4202157/59
    glp-1(bn18ts)25.91 ± 0.7253053/5417.77<0.0001*
    glp-1(bn18ts);skn-1(zu135)22.80 ± 0.6242655/5517.53<0.0001†
    glp-1(ts) and skn-1 interaction0.6607
    • Percent lifespan extension refers to glp-1(ts) vs wild type or skn-1 control. p values were calculated by log-rank test. Symbols denote effect relative to N2* or glp-1(ts)†. The interaction effect of glp-1(ts) and skn-1 was calculated by two-way ANOVA using mean lifespan. The last p value reflects the specific requirement of skn-1 for glp-1(ts) lifespan, as opposed to its effect on lifespan in general. Homozygous skn-1 mutants produce eggs that do not hatch because of a catastrophic defect in developmental patterning but do not exhibit known defects in the germline itself (Bowerman et al., 1992).

  • Table 2.

    Stress resistance assays

    DOI: http://dx.doi.org/10.7554/eLife.07836.005

    SetStrainMean survival ± SEM (hrs)Median survival (hrs)75th % survival (hrs)N% Mean survival Ext.p value
    AS (day 1 adulthood) 25°C continuous; RNAi from L1
     #1N2 + vector RNAi20.20 ± 1.022.522.5122/122
    N2 + rme-2 RNAi39.51 ± 1.147.547.5117/11795.59<0.0001*
     #2N2 + vector RNAi26.82 ± 1.228.028.057/57
    N2 + rme-2 RNAi53.21 ± 0.952.571.5252/25298.44<0.0001*
    glp-1(bn18ts) + vector RNA53.06 ± 1.052.571.5216/21697.85<0.0001*
     #3N2 + vector RNAi (20°C)38.59 ± 0.647.547.5281/281
    N2 + rme-2 RNAi63.00 ± 0.771.571.5287/28763.25<0.0001*
     #4N2 + vector RNAi (20°C)49.10 ± 0.846.064.0306/306
    N2 + vector/skn-1 mix RNAi32.03 ± 0.640.040.0271/271
    N2 + vector/rme-2 mix RNAi65.38 ± 1.164.070.0361/36133.16<0.0001*
    N2 + rme-2/skn-1 mix RNAi33.76 ± 0.540.040.0409/4095.40<0.0001‡
    two-way ANOVA rme-2 and skn-1 interaction<0.0001
     #5N2 + vector RNAi23.18 ± 0.522.522.5125/125
    N2 + lipl-3 RNAi23.04 ± 0.622.528.0139/139
    N2 + sbp-1 RNAi11.01 ± 0.67.522.5163/163
    N2 + skn-1 RNAi20.88 ± 0.722.528.0115/115
    glp-1(bn18ts) + vector RNAi40.58 ± 1.147.547.5105/10575.05<0.0001*
    glp-1(bn18ts) + lipl-3 RNAi28.52 ± 1.028.032.5178/17823.77<0.0001†
    glp-1(bn18ts) + sbp-1 RNAi7.50 ± 0.56.07.5138/138−31.88<0.0001†
    glp-1(bn18ts) + skn-1 RNAi12.90 ± 0.99.022.5129/129−38.21<0.0001†
    glp-1(ts) and lipl-3 interaction<0.0001
    glp-1(ts) and sbp-1 interaction<0.0001
    glp-1(ts) and skn-1 interaction<0.0001
     #6N2 + vector RNAi24.36 ± 0.822.528.0121/121
    N2 + fat-6/7 mix RNAi15.56 ± 0.822.522.5159/159
    N2 + skn-1 RNAi20.94 ± 0.622.522.5124/124
    glp-1(bn18ts) + vector RNAi38.49 ± 1.547.547.598/9858.03<0.0001*
    glp-1(bn18ts) + fat-6/7 mix RNAi12.04 ± 0.79.022.5153/153−22.66<0.0001†
    glp-1(bn18ts) + skn-1 RNAi23.69 ± 0.928.032.5116/11613.13<0.0001†
    glp-1(ts) and fat-6/7 interaction<0.0001
    glp-1(ts) and skn-1 interaction<0.0001
    AS (day 3 adulthood) 25°C during development, 20°C from D1; RNAi from D1
     #7N2 + vector RNAi6.55 ± 0.37.08.0104/104
    N2 + skn-1 RNAi5.08 ± 0.25.07.0103/103
    glp-1(bn18ts) + vector RNAi19.36 ± 0.119.020.097/97195.57<0.0001*
    glp-1(bn18ts) + skn-1 RNAi7.86 ± 0.48.012.0100/10054.72<0.0001†
    glp-1(ts) and skn-1 interaction<0.0001
     #8N2 + vector RNAi8.31 ± 0.49.010.098/98
    N2 + skn-1 RNAi6.89 ± 0.38.09.090/90
    glp-1(bn18ts) + vector RNAi16.95 ± 1.020.026.081/81103.97<0.0001*
    glp-1(bn18ts) + skn-1 RNAi9.90 ± 0.410.012.091/9143.69<0.0001†
    glp-1(ts) and skn-1 interaction<0.0001
    TBHP (day 3 adulthood) 25°C during development, 20°C from D1; RNAi from D1
     #9N2 + vector RNAi9.02 ± 0.39.011.084/108
    N2 + skn-1 RNAi6.16 ± 0.26.07.063/98
    glp-1(bn18ts) + vector RNAi11.62 ± 0.311.013.061/6128.82<0.0001*
    glp-1(bn18ts) + skn-1 RNAi6.48 ± 0.18.07.063/655.19<0.0001†
    glp-1(ts) and skn-1 interaction<0.0001
     #10N24.29 ± 0.24.04.065/94
    skn-1(zu135)4.51 ± 0.15.03.073/74
    glp-1(bn18ts)6.25 ± 0.26.04.073/7445.69<0.0001*
    glp-1(bn18ts);skn-1(zu135)4.78 ± 0.15.04.073/755.99<0.0001†
    glp-1(ts) and skn-1 interaction<0.0001
    • Survival after sodium arsenite (AS) or tert-butyl hydroperoxide (TBHP) treatment was assayed in adult animals. The increase in oxidative stress resistance of glp-1(ts) germline stem cell (GSC(−)) animals was impaired by loss of fat-6/7, lipl-3, sbp-1, and skn-1. Representative assays are shown. Percent survival extension refers to glp-1(ts) or rme-2 RNAi vs the matching wild type or skn-1 control. p values were calculated by log-rank test. Symbols denote effect relative to N2*, glp-1(ts)†, or rme-2 RNAi‡. The interaction effect of GSC(−) or rme-2 with skn-1, or fat-6/7, lipl-3, and sbp-1 were calculated by two-way ANOVA using mean lifespan. The last p value reflects the specific requirement of each gene for GSC(−) or rme-2 stress resistance as opposed to its effect on stress resistance in general.

  • Table 3.

    C. elegans strains used in this study

    DOI: http://dx.doi.org/10.7554/eLife.07836.020

    CodeGenetic backgroundTransgeneReference
    AA003daf-12(rh61rh411)
    X
    (Shen et al., 2012)
    AA983glp-1(e2141ts) III;
    daf-12(rh61rh411) X
    (Shen et al., 2012)
    AA1049mir-241(n4315) V;
    mir-84(n4037) X
    (Shen et al., 2012)
    AA1709glp-1(e2141ts) III;
    mir-241(n4315) V;
    mir-84(n4037) X
    (Shen et al., 2012)
    AA2735glp-1(e2141ts)
    III
    (Shen et al., 2012)
    CF1903glp-1(e2141ts)
    III
    (Berman and Kenyon, 2006)
    CF1935daf-16(mu86) I;
    glp-1(e2141ts) III
    muIs109[daf-16p::GFP::
    DAF-16 + odr-1p::RFP] X
    (Berman and Kenyon, 2006)
    CL2166N2dvIs19[pAF15
    (gst-4p::GFP::NLS)] III
    (Link and Johnson, 2002)
    DH1033sqt-1(sc103) IIbIs1[vit-2p::VIT-2::
    GFP + rol-6(su1006)] X
    (Grant and Hirsh, 1999)
    EU31skn-1(zu135)
    IV
    (Bowerman et al., 1992)
    LD001N2ldIs7[SKN-1b/c::
    GFP + rol-6(su1006)]
    (An and Blackwell, 2003)
    LD002N2ldIs1[SKN-1b/c::
    GFP + rol-6(su1006)]
    (An and Blackwell, 2003)
    LD1025daf-2(e1370)
    III
    ldIs7[SKN-1b/c::
    GFP + rol-6(su1006)]
    (Tullet et al., 2008)
    LD1425glp-1(bn18ts)
    III
    ldIs1[SKN-1b/c::
    GFP + rol-6(su1006)]
    This study
    LD1434glp-1(bn18ts) III;
    skn-1(zu135) IV
    This study
    LD1473kri-1(ok1251) I;
    glp-1(bn18ts) III
    ldIs1[SKN-1b/c::
    GFP + rol-6(su1006)]
    This study
    LD1474tcer-1(tm1452) II;
    glp-1(bn18ts) III
    ldIs1[SKN-1b/c::
    GFP + rol-6(su1006)]
    This study
    LD1548N2Is[dhs-3p::DHS-3::
    GFP] I
    (Zhang et al., 2012)
    LD1549glp-1(bn18ts)
    III
    Is[dhs-3p::DHS-3::
    GFP] I
    This study
    LD1644sqt-1(sc103) II;
    glp-1(bn18ts) III
    bIs1[vit-2p::VIT-2::
    GFP + rol-6(su1006)] X
    This study
    LD1653glp-1(bn18ts)
    III
    (Dorsett et al., 2009)
    Outcrossed from DG2389
    LD1744glp-1(bn18ts)
    III
    ldEx119[pAF15
    (gst-4p::GFP::NLS) + rol-6(su1006)]
    This study
    TJ356N2zIs356[daf-16p::
    DAF-16a/b::GFP + rol-6] IV
    (Henderson and Johnson, 2001)
  • Table 4.

    qRT-PCR primers used in this study

    DOI: http://dx.doi.org/10.7554/eLife.07836.021

    GeneSequenceAnnotationPrimer pair
    gst-4K08F4.7Glutathione S-transferaseFWD: CCCATTTTACAAGTCGATGG
    REV: CTTCCTCTGCAGTTTTTCCA
    F20D6.11F20D6.11Flavin-adenine dinucleotide (FAD)-binding oxidoreductaseFWD: GGAAATTCTCGGTAGAATCGAA
    REV: ACGATCACGAACTTCGAACA
    nit-1ZK1058.6NitrilaseFWD: AATCCTCCGACTATCCCTTG
    REV: AGCGAATCGTTTCTTTTGTG
    rpn-6.1F57B9.1019S non-ATPase subunitFWD: AATATTGGAAAAGCACCTGAAATGT
    REV: TTTGATGTGGAAGTGAAGTCATTGT
    lipl-3R11G11.14Lysosomal triglyceride lipaseFWD: ATGGGCAGGCAAATCCACCA
    REV: AGTTGTTCTGCGCAATTATA
    *cdc-42R07G3.1Housekeeping geneFWD: CTGCTGGACAGGAAGATTACG
    REV: CTCGGACATTCTCGAATGAAG
    *Y45F10D.4Y45F10D.4Housekeeping geneFWD: GTCGCTTCAAATCAGTTCAG
    CREV: GTTCTTGTCAAGTGATCCGACA
    • Select primer sequences were obtained from previous publications (Robida-Stubbs et al., 2012; Vilchez et al., 2012; O'Rourke and Ruvkun, 2013).

  • The following dataset was generated:

    Steinbaugh MJ, Dreyfuss JM, Blackwell TK, 2015,RNA-seq analysis of germline stem cell removal and loss of SKN-1 in C. elegans, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63075, Publicly available at the NCBI Gene Expression Omnibus (Accession no: GSE63075).

    The following previously published datasets were used:

    Zhong M, Snyder M, Slightam C, Kim S, Murray J, Waterston R, Gerstein M, Niu W, Janette J, Raha D, Agarwal A, Reinke V, Sarov M, Hyman A, 2011,Identification of Transcription Factor SKN-1::GFP Binding Regions in L1, http://intermine.modencode.org/release-33/report.do?id=77000137, Publicly available at modMine (Accession no: modENCODE_2622).

    Zhong M, Snyder M, Slightam C, Kim S, Murray J, Waterston R, Gerstein M, Niu W, Janette J, Raha D, Agarwal A, Reinke V, Sarov M, Hyman A, 2013,Identification of Transcription Factor SKN-1::GFP Binding Regions in L2, http://intermine.modencode.org/release-33/report.do?id=77000379, Publicly available at modMine (Accession no: modENCODE_3369).

    Zhong M, Snyder M, Slightam C, Kim S, Murray J, Waterston R, Gerstein M, Niu W, Janette J, Raha D, Agarwal A, Reinke V, Sarov M, Hyman A, 2013,Identification of Transcription Factor SKN-1::GFP Binding Regions in L3, http://intermine.modencode.org/release-33/report.do?id=77000500, Publicly available at modMine (Accession no: modENCODE_3838).

    Zhong M, Snyder M, Slightam C, Kim S, Murray J, Waterston R, Gerstein M, Niu W, Janette J, Raha D, Agarwal A, Reinke V, Sarov M, Hyman A, 2013,Identification of Transcription Factor SKN-1::GFP Binding Regions in L4, http://intermine.modencode.org/release-33/report.do?id=77000600, Publicly available at modMine (Accession no: modENCODE_4631).

    Staab TA, Griffen TC, Corcoran C, Evgrafov O, Knowles JA, Sieburth D, 2013,SKN-1 from the JASPAR CORE database, http://jaspar.genereg.net/cgi-bin/jaspar_db.pl?rm=browse&db=core&tax_group=nematodes, Publicly available at the JASPAR (Accession no: MA0547.1).

    Zhong M, Snyder M, Slightam C, Kim S, Murray J, Waterston R, Gerstein M, Niu W, Janette J, Raha D, Agarwal A, Reinke V, Sarov M, Hyman A, 2011,Identification of Transcription Factor SKN-1::GFP Binding Regions in L1, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE25810, Publicly available at the NCBI Gene Expression Omnibus (Accession no: GSE25810).

    Zhong M, Snyder M, Slightam C, Kim S, Murray J, Waterston R, Gerstein M, Niu W, Janette J, Raha D, Agarwal A, Reinke V, Sarov M, Hyman A, 2013,Identification of Transcription Factor SKN-1::GFP Binding Regions in L3, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE48710, Publicly available at the NCBI Gene Expression Omnibus (Accession no: GSE48710).

    Zhong M, Snyder M, Slightam C, Kim S, Murray J, Waterston R, Gerstein M, Niu W, Janette J, Raha D, Agarwal A, Reinke V, Sarov M, Hyman A, 2013,Snyder_SKN-1_GFP_L4, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE46772, Publicly available at the NCBI Gene Expression Omnibus (Accession no: GSE46772).

  • Supplementary file 1.

    (a) List of genes activated by GSC absence. The gene list is sorted by functional grouping, then by fold change of mRNA expression in glp-1(ts) relative to wild type. A fold change cutoff of 4 (p < 0.05; n = 1306) was used (see Figure 3—figure supplement 1 for rationale). A more conservative fold change cutoff of 5 that captured fewer genes (n = 615) was used for DAVID cluster analysis. FDR denotes false discovery rate. (b) List of genes activated by SKN-1 in wild-type animals. The gene list is sorted by functional grouping, then by fold change of mRNA expression in WT skn-1 RNAi-treated worms relative to WT control vector-treated worms. A fold change cutoff of 0.67 (n = 295) was used to enrich for higher confidence SKN-1 targets. (c) List of genes activated by SKN-1 in GSC(−) animals. The gene list is sorted by functional grouping, then by fold change of mRNA expression in glp-1(ts) skn-1 RNAi-treated worms relative to glp-1(ts) control vector-treated worms. A fold change cutoff of 0.67 (p < 0.05; n = 529) was used to enrich for higher confidence SKN-1 targets. (d) List of genes activated by GSC absence in a SKN-1-dependent manner. The gene list is sorted by functional grouping, then by fold change of mRNA expression in glp-1(ts) skn-1 RNAi-treated worms relative to glp-1(ts) control vector-treated worms. We employed a GSC(−) fold change cutoff of >4 and skn-1 RNAi cutoff of <0.67 to generate the list (see Figure 3—figure supplement 1 for GSC(−) FC cutoff rationale). Statistics were generated by min analysis. Predicted SKN-1 binding sites were determined using 1.5 kb upstream sequences from WBcel235 and the SKN-1 JASPAR matrix (Staab et al., 2013a). SKN-1::GFP ChIP-seq binding analysis was performed using the L1, L2, and L3 data sets available from modENCODE (Niu et al., 2011). Additional details are available in ‘Materials and methods’.

    DOI: http://dx.doi.org/10.7554/eLife.07836.022

    Download source data [supplementary-file-1.media-1.xlsx]