1. Biochemistry and Chemical Biology
  2. Cell Biology
Download icon

ULK3 regulates cytokinetic abscission by phosphorylating ESCRT-III proteins

  1. Anna Caballe
  2. Dawn M Wenzel
  3. Monica Agromayor
  4. Steven L Alam
  5. Jack J Skalicky
  6. Magdalena Kloc
  7. Jeremy G Carlton
  8. Leticia Labrador
  9. Wesley I Sundquist  Is a corresponding author
  10. Juan Martin-Serrano  Is a corresponding author
  1. King's College London School of Medicine, United Kingdom
  2. University of Utah School of Medicine, United States
Research Article
  • Cited 32
  • Views 2,767
  • Annotations
Cite this article as: eLife 2015;4:e06547 doi: 10.7554/eLife.06547

Abstract

The endosomal sorting complexes required for transport (ESCRT) machinery mediates the physical separation between daughter cells during cytokinetic abscission. This process is regulated by the abscission checkpoint, a genome protection mechanism that relies on Aurora B and the ESCRT-III subunit CHMP4C to delay abscission in response to chromosome missegregation. In this study, we show that Unc-51-like kinase 3 (ULK3) phosphorylates and binds ESCRT-III subunits via tandem MIT domains, and thereby, delays abscission in response to lagging chromosomes, nuclear pore defects, and tension forces at the midbody. Our structural and biochemical studies reveal an unusually tight interaction between ULK3 and IST1, an ESCRT-III subunit required for abscission. We also demonstrate that IST1 phosphorylation by ULK3 is an essential signal required to sustain the abscission checkpoint and that ULK3 and CHMP4C are functionally linked components of the timer that controls abscission in multiple physiological situations.

https://doi.org/10.7554/eLife.06547.001

eLife digest

Our cells multiply by dividing into two. Many proteins are involved in this process, including a group called the ESCRT-III complex. This group is required to complete the final stage of cell division when the single membrane that surrounds the two new daughter cells separates. Before the cell divides, its DNA—which is packaged in structures called chromosomes—is copied, and the two sets of chromosomes are pulled to opposite ends of the cell. This ensures that each daughter cell will have a complete set of DNA.

If the cell divides before the chromosomes have finished moving to opposite ends of the cell, the daughter cells may end up with the wrong number of chromosomes. This can lead to cancer or other diseases. To prevent this, cells have evolved a quality control system called the ‘abscission checkpoint’, which delays cell division until the chromosomes have properly separated. Previous studies have shown that when the checkpoint is active, an ESCRT-III complex protein called CHMP4C is inactivated by an enzyme, which prevents the cell from dividing.

Other signals that indicate that the new daughter cells are not yet ready to separate can also delay cell division, but it is not clear how those defects are detected by the checkpoint. Here, Caballe, Wenzel et al. found that a protein called ULK3 can bind to several proteins in the ESCRT-III complex, including one called IST1. In doing so, ULK3 is able to delay cell division if the chromosomes have not finished separating, if there are defects in the nucleus of the cell, or if the cell is experiencing high levels of mechanical tension at the site where the membrane will separate.

The experiments also show that ULK3 needs to bind to and regulate the activity of IST1 to sustain the abscission checkpoint, and that CHMP4C is required for this process. Caballe, Wenzel et al.'s findings reveal that ULK3 plays an essential role in controlling when a cell divides and imply that there may be additional proteins involved that release cells from the checkpoint delay imposed by ULK3. The next challenges will be to identify these proteins and to understand how all checkpoint proteins work together to regulate cell division.

https://doi.org/10.7554/eLife.06547.002

Introduction

Cytokinesis is the final stage of cell division when two daughter cells are physically separated. The process comprises several steps, including cleavage furrow ingression and abscission of the midbody—the thin intercellular bridge connecting the nascent daughter cells (Caballe and Martin-Serrano, 2011; Mierzwa and Gerlich, 2014). Midbody abscission occurs adjacent to the Flemming body, a central protein complex, and is mediated by the ESCRT pathway (endosomal sorting complexes required for transport) (Carlton and Martin-Serrano, 2007; Morita et al., 2007). The ESCRT machinery performs topologically equivalent membrane fission events throughout the cell, including intraluminal vesicle formation at the multivesicular body, retroviral particle release, plasma membrane wound repair and abscission (Hurley and Yang, 2008; Henne et al., 2011; McCullough et al., 2013; Jimenez et al., 2014). The core ESCRT machinery comprises five different factors or complexes: ALIX, ESCRT-I, ESCRT-II and ESCRT–III, and VPS4. In most cases, location-specific adaptors initially recruit the early-acting ALIX and ESCRT-I/-II factors, which then recruit the late-acting ESCRT-III and VPS4 complexes to mediate membrane fission. In late stages of cytokinesis, the Flemming body protein CEP55 binds TSG101 (ESCRT-I) and ALIX, which leads to ESCRT-III subunit recruitment (Carlton and Martin-Serrano, 2007; Morita et al., 2007; Carlton et al., 2008). ESCRT-III-based helical filaments form on either side of the Flemming body and induce cortical constriction, thereby promoting abscission (Elia et al., 2011; Guizetti et al., 2011). In addition to driving membrane scission mechanically, ESCRT-III proteins recruit cytokinetic cofactors that contain MIT (microtubule interacting and trafficking) domains. MIT domains bind short motifs within the C-terminal tails of ESCRT-III proteins called MIMs (MIT-interacting motifs), which become exposed and concentrated when the ESCRT-III proteins polymerize (McCullough et al., 2013). MIT domain-containing proteins that participate in cytokinesis include the AAA-ATPase VPS4 and its activator LIP5, which remodel and recycle the ESCRT-III subunits (Babst et al., 1998; Hurley and Yang, 2008; Lata et al., 2008), Spastin, an AAA-ATPase that severs microtubules, and MITD1, a membrane-binding protein that stabilizes the intercellular bridge (Yang et al., 2008; Connell et al., 2009; Skalicky et al., 2012; Hadders et al., 2012; Azmi et al., 2006).

Evolutionarily conserved monitoring mechanisms regulate the proper timing of events during cytokinesis progression (Agromayor and Martin-Serrano, 2013; Mierzwa and Gerlich, 2014). When chromosomes persist within the midbody, the abscission checkpoint (also known as NoCut) inhibits abscission until chromatin has been cleared from the spindle midzone, thereby preventing aberrant segregation or cleavage furrow regression and tetraploidy (Norden et al., 2006; Mendoza et al., 2009; Steigemann et al., 2009). Lagging chromosomes are sensed by the Aurora B kinase, which phosphorylates the ESCRT-III subunit CHMP4C to delay abscission (Capalbo et al., 2012; Carlton et al., 2012). Defective nuclear pore complex assembly also triggers Aurora B-dependent abscission delays (Mackay et al., 2010). The full signaling cascade that connects nuclear pores to abscission is not yet clear, but ESCRT proteins themselves are involved in the surveillance and clearance of defective nuclear pore complex assembly intermediates in S. cerevisiae (Webster et al., 2014). Tension forces applied by dividing cells on the midbody also regulate cytokinesis, with high-tension delaying abscission, and tension release triggering ESCRT-III assembly and membrane scission (Lafaurie-Janvore et al., 2013). How these different physiological inputs converge to influence abscission timing is not understood.

Here, we investigate the function of Unc-51-like kinase 3 (ULK3), a poorly characterized member of the ULK family of serine/threonine kinases that is predicted to contain tandem MIT domains (Row et al., 2007). Live-cell imaging analysis revealed that ULK3 regulates abscission timing in response to lagging chromosomes, defects in nuclear pore complex assembly, and tension forces at the midbody. Furthermore, our biochemical and structural studies show that the ULK3 MIT domains bind tightly to IST1, an ESCRT-III subunit required for cytokinesis (Agromayor et al., 2009; Bajorek et al., 2009a). Finally, we show that ULK3 phosphorylates IST1 and other ESCRT-III proteins and that IST1 phosphorylation provides an essential inhibitory signal in the abscission checkpoint, thereby ensuring proper coordination of the final events in cell division.

Results

ULK3 binds to ESCRT-III via tandem MIT domains

The predicted MIT domains in ULK3 suggested a novel mechanism of ESCRT regulation, and we, therefore, surveyed potential ULK3–ESCRT interactions using yeast two-hybrid (Y2H) experiments. ULK3 binding was observed for three ESCRT-III subunits: CHMP1A, CHMP1B, and CHMP2A, but not for other ESCRT complexes (Figure 1—figure supplement 1A). These interactions were confirmed by co-immunoprecipitation of Myc-tagged ESCRT-III proteins from mixed 293T cell lysates that contained One-strep-flag (OSF)-tagged ULK3 (Figure 1A, note interactions in lanes 2, 4, 6, and 14). This approach revealed that ULK3 also bound the ESCRT-III subunit IST1 (lane 26), an interaction not tested by Y2H because IST1 fusion constructs activated transcription non-specifically. Endogenous ULK3 also co-precipitated with overexpressed HA-tagged CHMP1A, CHMP1B, CHMP2A, or IST1, but not with CHMP2B (Figure 1B). Finally, endogenous IST1 was efficiently biotinylated in cells that expressed a biotin ligase BirA-ULK3 fusion protein, which promiscuously biotinylates proximal proteins (Figure 1C, lane 4, bottom panel) (Roux et al., 2012). Hence, ULK3 can interact with a specific subset of ESCRT-III proteins in cells.

Figure 1 with 1 supplement see all
ULK3 binds ESCRT-III via tandem MIT domains.

(A) Lysates from 293T cells overexpressing Myc-endosomal sorting complexes required for transport (ESCRT)-III proteins were mixed with lysates from cells non-transfected (−) or overexpressing One-strep-flag (OSF)-Unc-51-like kinase 3 (ULK3) (+). OSF-ULK3 proteins were bound to streptactin resin and bound ESCRT-III proteins were detected with α-Myc antibody (top). (B) Lysates from 293T cells expressing HA-ESCRT-III were immunoprecipitated with α-HA antibody and co-precipitated endogenous ULK3 protein was detected by Western blot with α-ULK3 antibody. (C) HeLa cells expressing ULK3 fused to the biotin protein ligase BirA-113G or unfused BirA were treated overnight with biotin. Vicinal biotinylated proteins were isolated with streptavidin-coated beads, and endogenous IST1 was found to be biotinylated, implying that it was in close proximity with ULK3. ‘Asterisks’ denote isolated BirA-Empty and BirA-ULK3, respectively, on α-Avidin blot (lanes 3 and 4). Images shown for both lysate and pull-down samples were cropped from the same blot in all cases. (D) Co-immunoprecipitation of Myc-IST1 with different ULK3 constructs. ‘Asterisks’ denote phosphorylated IST1 species. (E) Top: overlaid 15N-HSQC NMR spectra of 15N,13C-IST1 (residues 303–366) alone (black) or with 2 equivalents of ULK3(MIT)2 (residues 277–449) (red). Inset shows an expanded view of the boxed region in the spectrum. Bottom: individual IST1 backbone amide resonances perturbed (1) or not (−1) upon addition of ULK3(MIT)2. Ambiguous changes (due to spectral overlap) were scored as 0. (F) Fluorescence polarization (FP)-binding isotherms show interactions between different ULK3 MIT constructs corresponding to MIT2 (residues 359–449) or both MIT domains (ULK3(MIT)2) and fluorescently labeled IST1 peptides for MIT-interacting motifs (MIM) 1, MIM2, or both MIM1+MIM2 (MIMs). Data points are averages ±SD of at least three separate measurements, and curves show fits to simple 1:1 binding models with dissociation constants. (G) Crystal structure of the ULK3 MIT2-IST1 MIM1 complex. Inset shows key interacting side-chains (in green) with ULK3 M434 highlighted in red. Sequence alignment compares IST1 MIM1 to the consensus MIM1 sequence. See also Figure 1—figure supplement 1 and Figure 1—source data 1.

https://doi.org/10.7554/eLife.06547.003

ULK3 MIT2 binds IST1 MIM1

Fluorescence polarization (FP) binding assays indicated that ULK3 interacted more tightly with IST1 (KD ∼ 0.2 µM) than with other ESCRT-III proteins (KD ∼100 µM) (Figure 1F, and data not shown). We, therefore, focused on characterizing the IST1-ULK3 interaction. The IST1-binding site on ULK3 was mapped using co-precipitation experiments with Myc-tagged IST1 and different OSF-ULK3 deletion constructs. IST1 bound with similar efficiencies to full-length ULK3 (residues 1–472) and to a minimal construct that spanned just the C-terminal tandem MIT domains (residues 277–449, hereafter denoted ULK3(MIT)2; Figure 1D, lanes 2 and 5, respectively), but did not bind to the isolated ULK3 kinase domain (residues 1–270; lane 3). Thus, the ULK3 MIT domains form the primary IST1-binding site. As discussed below, co-expression of full-length ULK3 resulted in the appearance of lower mobility IST1 species, suggesting that the kinase can phosphorylate IST1 (Figure 1D, lane 2).

NMR chemical shift perturbation experiments were used to map ULK3-binding sites on IST1. IST1 contains two different MIT interaction motifs, termed MIM1 (residues 352–363) and MIM2 (residues 325–329), that were included within a C-terminal IST1 peptide used in these experiments (IST1303-366) (Agromayor et al., 2009; Bajorek et al., 2009a). Both MIMs exhibited backbone amide proton chemical shift perturbations upon titration of 15N-labeled IST1303-366 with ULK3(MIT)2, indicating that both IST1 MIMs can contact ULK3(MIT)2 (Figure 1E), whereas the upstream IST1 residues 303–317 were not perturbed. To assess the binding contributions of each MIM and MIT element, we performed FP-binding experiments with fluorescently labeled peptides comprising either one or both of the IST1 MIM elements and one or both ULK3 MIT domains. The tightest interaction was observed for ULK3(MIT)2 binding to a construct that spanned both IST1 MIMs (Figure 1F). However, nearly all of the binding energy was contributed by the IST1 MIM1 element, which bound ULK3 MIT2. Consistent with these experiments, IST1316-366 binding to ULK3(MIT)2 was reduced more than 100-fold by a single point mutation in the MIM1-binding site of ULK3 MIT2 (M434D), but not by an equivalent mutation in the MIM1-binding site of ULK3 MIT1 (residues 277–358, V338D mutant; <twofold, Figure 1F and Figure 1—figure supplement 1D). Hence, both IST1 MIM elements can contact both ULK3 MIT domains, but IST1 MIM1 binding to ULK3 MIT2 domain is the energetically dominant interaction.

Structure of IST1 MIM1-ULK3 MIT2 complex

We determined the crystal structure of ULK3 MIT2 in complex with IST1 MIM1 to 1.4 Å resolution (Figure 1G and Figure 1—source data 1). ULK3 residues 372–446 form the characteristic MIT three-helix bundle, and the IST1 MIM1 helix binds parallel to MIT helix 3 in the groove between MIT helices 2 and 3 (Figure 1G and Figure 1—figure supplement 1B). The N-terminus of the MIT domain (residues 360–373) forms a short helix that packs in the groove connecting MIT helices 1 and 3. This helix has not been seen in previous MIT domain structures and is expected to interfere sterically with the binding of canonical MIM2 (and MIM3) elements (Figure 1—figure supplement 1C). Core IST1 MIM1 residues make a series of interactions that are similar to those seen in other MIT-MIM1 complexes (see Figure 1F magnification and Figure 1—figure supplement 1B) (Obita et al., 2007; Stuchell-Brereton et al., 2007; Hadders et al., 2012; Guo and Xu, 2015). The ULK3 M434 residue is central to this interface (Figure 1G, red), which explains why the M434D mutation inhibits IST1 binding (Figure 1F and Figure 1—figure supplement 1D).

The interaction between ULK3 MIT2 and IST1 MIM1 (KD = 0.77 µM) is significantly tighter than many previously described MIT–MIM1 interactions (KD ∼2–100 µM). The additional binding energy appears to be contributed by N-terminal IST1 MIM1 residues I350 and F352, and by the central F359 residue, all of which make hydrophobic interactions that are absent in other MIM1-MIT complexes. Binding of the bulky hydrophobic IST1 MIM1 F352 and F359 residues is accommodated by complementary small ULK3 MIT2 interfacial residues A415 and G408, respectively. Charged or polar residues are found in equivalent positions of other MIT domains such as VPS4A (Figure 1—figure supplement 1B) or ULK3 MIT1. These interactions likely explain why IST1 MIM1 binds tightly and specifically to the ULK3 MIT2 domain.

ULK3 binding also mapped to the MIM1 of CHMP1B as binding was inhibited by removal of CHMP1B MIM1 or by MIM1 point mutations (Figure 1—figure supplement 1E, lanes 3–7 vs lane 2), but not by a mutation in the more extended CHMP1B MIM3 binding site (lane 8) (Yang et al., 2008). However, unlike IST1, the binding of CHMP1A and CHMP1B was reduced by point mutations in the MIM1-binding sites of either ULK3 MIT domain (Figure 1—figure supplement 1D, lanes 1–4 and Figure 1—figure supplement 1F). Thus, the binding specificities of the CHMP1A/B and IST1 proteins differ, and our data indicate that CHMP1 MIM1 elements can bind either ULK3 MIT domain.

ULK3 regulates abscission timing and is an essential component of the abscission checkpoint pathway

We used siRNA depletion to test whether ULK3 participates in endosomal sorting or virus budding. Effects on ESCRT-dependent lysosomal targeting were tested using two established assays; down-regulation of MHC class I by the Kaposi sarcoma-associated herpesvirus (KSHV) K3 protein (Hewitt et al., 2002), and degradation of Tetherin by the KSHV K5 protein (Agromayor et al., 2012). ULK3 depletion did not affect either of these ESCRT-dependent degradation reactions, whereas control depletion of TSG101 inhibited both processes (Figure 2—figure supplement 1A,B). Similarly, ULK3 depletion had no effect on ESCRT-dependent HIV-1 budding (Figure 2—figure supplement 1C). We, therefore, conclude that ULK3 is not required for either of these ESCRT pathway functions.

We next tested whether ULK3 functions in cytokinetic abscission using live imaging of HeLa mCherry-Tubulin cells. ULK3-depleted cells proceeded through mitosis normally, but resolved their midbodies faster than control cells, at rates comparable to the abnormally rapid abscission observed in CHMP4C-depleted cells (Figure 2A and Figure 2—figure supplement 1D, Videos 1–3) (Carlton et al., 2012). In addition, endogenous ULK3 protein was detected by immunofluorescence staining at the Flemming body, where it is positioned to function during cytokinetic abscission (Figure 2B). Based on these results, we tested whether ULK3 was required for abscission delays induced by the abscission checkpoint. One event that triggers the abscission checkpoint is the presence of defectively assembled nuclear pore complexes (Mackay et al., 2010). As expected, partial depletion of Nucleoporin 153 (NUP153) induced abscission delays that increased the number of midbody-connected cells (Figure 2C, lane 1 vs 2). This phenotype was abrogated upon ULK3-depletion, despite comparable levels of NUP153 depletion (lane 2 vs 4). Active Aurora B (Aurora B pT232) is known to localize to the midbody of dividing cells both in control or NUP153-depleted cells (Mackay et al., 2010). Immunofluorescence imaging of cells treated as in Figure 2C revealed that ULK3 depletion did not alter the localization of phosphorylated Aurora B to the midbody in cells co-depleted of NUP153, indicating that ULK3 likely functions downstream of Aurora B in the abscission checkpoint (Figure 2—figure supplement 1E). These results were confirmed by live-cell imaging experiments, which demonstrated that ULK3 depletion abolished the 30-min abscission delay triggered by nuclear pore disruption (Figure 2D). Furthermore, partial depletion of NUP153 in two different clonal ULK3-knockout cell lines, in which the endogenous ULK3 locus was removed using a lentiviral CRISPR-Cas9 system (Ran et al., 2013), also failed to sustain the abscission checkpoint, as seen by a lack of an increase in midbody-connected cells when compared to non-targeting (NT) siRNA transfection, or control cell lines lacking guide RNAs against ULK3 (Figure 2E, lanes 8 and 10 vs lanes 2, 4, 6).

Figure 2 with 2 supplements see all
ULK3 regulates abscission timing.

(A) Asynchronous cultures of HeLa mCherry-Tubulin cells were transfected with the specified siRNA. Midbody resolution times were calculated from three separate experiments (mean times ±SD were non-targeting (NT): 96 ± 36 min; CHMP4C: 74 ± 26 min; ULK3: 74 ± 31 min). (B) HeLa cells were stained with Hoechst, α-Tubulin, and α-ULK3 antibody (Santa Cruz). ULK3 was observed at the Flemming body in 79% of observed midbodies (total n = 34). Image shows a representative example of Flemming body localization, with the ULK3 signal in green, Tubulin in red, and nuclei in blue. Bar = 5 μm. Inset shows an expanded view of the midbody. (C and D) HeLa mCherry-Tubulin cells transfected with NT or ULK3 siRNA were transfected with Nucleoporin 153 (NUP153) siRNA to trigger the abscission checkpoint. In (C), cells were fixed and stained with α-Tubulin antibody to visualize midbody-arrested cells. Data are represented as a mean percentage of midbodies ±SD from six separate experiments. NUP153 depletion levels as mean percentages from three independent experiments were lane 1: 100%, 2: 67%, 3: 108%, 4: 70%. In (D), midbody abscission times were analyzed (mean times are 1: 86 ± 22 min; 2: 118 ± 50 min; 3: 70 ± 15 min; 4: 81 ± 25 min). (E) Clonal HeLa cells stably expressing a lentiviral vector containing CRISPR-Cas9 with a guide RNA sequence targeting the ULK3 locus (δULK3-1 or δULK3-2) or without guide RNA (Controls) were transfected with NT or NUP153 siRNA as above and stained with α-Tubulin antibody to visualize midbody-arrested cells. Data are represented as the mean percentage increase in midbody-connected cells compared to the percentage of midbodies in NT-treated cells for each cell line ±SD from four separate experiments. Mean percentages of NUP153 depletion levels compared to HeLa + NT siRNA (lane 1) from four independent experiments were lane 1: 100%, 2: 52%, 3: 85%, 4: 52%, 5: 94%, 6: 51%, 7: 75%, 8: 48%, 9: 96%, 10: 48%. (F) HeLa YFP-lamina-associated polypeptide 2β (LAP2β) expressing cells were transfected with NT and ULK3 siRNA, and resolution times of intercellular chromatin bridges were quantified in three separate experiments (mean times are NT: 708 min; ULK3: 459 min). (G) Analysis of tension-dependent modulation of abscission time, mean times: 1: 120 ± 53 min; 2: 73 ± 19 min; 3: 77 ± 41 min; 4: 69 ± 20 min). Data in (A, D, FG) are represented as box plots showing median abscission times (A, D, and G) or LAP2β bridge resolution times (F). Here and throughout, whiskers mark 5–95 percentiles, box edges represent the first and third quartiles, and red bars denote the median. n = total number of events counted per sample. Cell lysates in (A, C, E, and F) were examined by Western blot using indicated antibodies. See also Figure 2—figure supplements 1 and 2, and Videos 1–11.

https://doi.org/10.7554/eLife.06547.006
Video 1
Representative example of asynchronous HeLa mCherry-Tubulin cells treated with non-targeting (NT) siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 90 min. Related to Figure 2 and Figure 2—figure supplement 1.

https://doi.org/10.7554/eLife.06547.009
Video 2
Representative example of asynchronous HeLa mCherry-Tubulin cells treated with ULK3 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 60 min. Related to Figure 2 and Figure 2—figure supplement 1.

https://doi.org/10.7554/eLife.06547.010
Video 3
Representative example of asynchronous HeLa mCherry-Tubulin cells treated with ULK3 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 60 min. Related to Figure 2 and Figure 2—figure supplement 1.

https://doi.org/10.7554/eLife.06547.011

Another trigger for the abscission checkpoint is the presence of lagging chromosomes within the midbody (Norden et al., 2006; Mendoza et al., 2009; Steigemann et al., 2009), and we tested whether ULK3 was also required for this process. The presence of chromatin bridges within the midbody was monitored by time-lapse microscopy in cells expressing YFP-tagged lamina-associated polypeptide 2β (LAP2β) (Steigemann et al., 2009). As described previously for CHMP4C-depleted cells (Carlton et al., 2012), LAP2β bridges were also resolved more rapidly upon depletion of ULK3 (Figure 2F and Figure 2—figure supplement 2A, Videos 4, 5). In control cells, persisting chromosome bridges were resolved in 680 min, whereas in ULK3-depleted cells, this resolution time was dramatically reduced to 300 min. Thus, our experiments demonstrate that ULK3 plays an essential role in supporting the Aurora B-dependent abscission checkpoint in response to either defective nuclear pore assembly or lagging chromosomes. Besides delaying abscission, Aurora B activation also prevents cleavage furrow regression in cells that contain chromosome bridges (Steigemann et al., 2009). As expected, the frequency of furrow regression increased in cells with lagging chromosomes, but ULK3 depletion did not change this proportion (Figure 2—figure supplement 2B,C, Videos 6, 7). This result indicates that ULK3 does not control furrow regression, but instead likely functions downstream of Aurora B in delaying abscission in response to chromatin bridges.

Video 4
Representative example of asynchronous HeLa cells stably expressing YFP-LAP2β transfected with NT siRNA.

Chromatin bridge resolution time is 510 min. Bridge resolution is indicated with an arrow. Related to Figure 2 and Figure 2—figure supplement 2.

https://doi.org/10.7554/eLife.06547.012
Video 5
Representative example of asynchronous HeLa cells stably expressing YFP-LAP2β transfected with ULK3 siRNA.

Chromatin bridge resolution time is 110 min. Bridge resolution is indicated with an arrow. Related to Figure 2 and Figure 2—figure supplement 2.

https://doi.org/10.7554/eLife.06547.013
Video 6
Representative example of asynchronous HeLa cells stably expressing YFP-LAP2β and mCherry-Tubulin, containing an intercellular chromatin bridge that resolves in 850 min when the daughter cells faithfully divide.

Bridge resolution is indicated with an arrow. Related to Figure 2—figure supplement 2.

https://doi.org/10.7554/eLife.06547.014
Video 7
Representative example of asynchronous HeLa cells stably expressing YFP-LAP2β and mCherry-Tubulin, containing an intercellular chromatin bridge that does not resolve and the cleavage furrow regresses.
https://doi.org/10.7554/eLife.06547.015

ULK3 functions in tension-dependent abscission regulation

A recent study revealed that the high-membrane tension of cells grown at low density delays abscission as compared to cells grown at high density (Lafaurie-Janvore et al., 2013). We, therefore, asked whether ULK3 also plays a role in this largely unexplored regulatory mechanism. Abscission events from Figure 2A were stringently segregated into two extreme groups: those for isolated cells (low density) and those for closely packed cells (high density). As reported previously, low-density cells showed significant abscission delays as compared to high-density cells (Figure 2G). In contrast, ULK3-depleted cells showed similar rapid abscission times regardless of the cell density (Figure 2G, lanes 3 and 4, Videos 8–11). Thus, ULK3 is also required to delay abscission in response to midbody tension.

Video 8
Representative example of low-density asynchronous HeLa mCherry-Tubulin cells treated with NT siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 170 min. Related to Figure 2.

https://doi.org/10.7554/eLife.06547.016
Video 9
Representative example of high-density asynchronous HeLa mCherry-Tubulin cells treated with NT siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 60 min. Related to Figure 2.

https://doi.org/10.7554/eLife.06547.017
Video 10
Representative example of low-density asynchronous HeLa mCherry-Tubulin cells treated with ULK3 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 60 min. Related to Figure 2.

https://doi.org/10.7554/eLife.06547.018
Video 11
Representative example of high-density asynchronous HeLa mCherry-Tubulin cells treated with ULK3 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 60 min. Related to Figure 2.

https://doi.org/10.7554/eLife.06547.019

ESCRT-III binding and catalytic activity are required for ULK3 checkpoint function

We next performed mutational analyses to test the requirements for ULK3 to function in the abscission checkpoint. The faster abscission in ULK3-depleted cells was restored to control levels by stable expression of an siRNA-resistant wild-type ULK3 construct (ULK3R WT, Figure 3A, lane 3), but not by expression of ULK3 proteins with inactivating mutations in the MIM1-binding sites of either (or both) MIT domains (ULK3R V338D, ULK3R M434D and ULK3R V338D, M434D; Figure 3A, lanes 4–6) or with an inactivating mutation in the ATP-binding site (K44H) of the kinase domain (Chan et al., 2009) (Figure 3E, lane 4 vs 3). Similarly, stable overexpression of these MIT (Figure 3B, Videos 12, 13) or catalytic (Figure 3F, lane 3 vs 2, Video 14) mutants did not change the timing of abscission, whereas ULK3R WT overexpression induced abscission delays (Figure 3B, Videos 15–17). The ULK3 MIT mutations did not alter ULK3 kinase activity (Figure 1—figure supplement 1G), and we, therefore, attribute their effects in abscission specifically to reductions in ESCRT-III binding. The efficacy of the K44H mutation was confirmed by the lack of auto-phosphorylation activity of GST-ULK3 K44H in an in vitro kinase assay (Figure 3C), and retention of ESCRT-III binding activity was confirmed by Y2H (Figure 3D). Thus, ULK3 modulates midbody resolution timing through both its kinase activity and ESCRT-III interactions.

ESCRT-III binding and kinase activity are required for ULK3 function.

(A) HeLa mCherry-Tubulin cells stably expressing empty vector or siRNA-resistant ULK3 (ULK3R) were transfected with the indicated siRNA. Midbody resolution times were calculated in three separate experiments (mean times were 1: 95 ± 32 min; 2: 71 ± 25 min; 3: 115 ± 61 min; 4: 80 ± 38 min; 5: 77 ± 34 min; 6: 74 ± 31 min). (B) HeLa mCherry-Tubulin cells expressing empty vector, ULK3 WT, V338D, or M434D were imaged live. Midbody resolution times were analyzed from three separate experiments (mean times were 1: 81 ± 29 min; 2: 159 ± 88 min; 3: 73 ± 23 min; 4: 83 ± 37 min). (C) In vitro kinase assay showing the auto-phosphorylation activity of GST-ULK3 WT and GST-ULK3 K44H. (D) Yeast two-hybrid (Y2H) assay with ULK3 WT and ULK3 K44H fused to VP16 binding to ESCRT-III proteins fused to Gal4. Data are represented as mean β-galactosidase activity ±SD from triplicate measurements of two separate experiments. (E) HeLa mCherry-Tubulin cells expressing either empty vector or ULK3R constructs were transfected with the indicated siRNA. Midbody resolution times were analyzed in three independent experiments (mean times were 1: 100 ± 42 min; 2: 77 ± 34 min; 3: 104 ± 57 min; 4: 74 ± 31 min). (F) HeLa mCherry-Tubulin cells expressing empty vector, ULK3 WT, or K44H were imaged live. Midbody resolution times were calculated in four separate experiments (mean times are 1: 122 ± 60 min; 2: 161 ± 73 min; 3: 113 ± 47 min). Cell lysates in (A, B, E, and F) were examined by Western blot using the indicated antibodies. See also Videos 12–17.

https://doi.org/10.7554/eLife.06547.020
Video 12
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and ULK3 V338D.

Midbody resolution is indicated with an arrow. Abscission time is 80 min. Related to Figure 3.

https://doi.org/10.7554/eLife.06547.024
Video 13
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and ULK3 M434D.

Midbody resolution is indicated with an arrow. Abscission time is 70 min. Related to Figure 3.

https://doi.org/10.7554/eLife.06547.025
Video 14
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and ULK3 K44H.

Midbody resolution is indicated with an arrow. Abscission time is 80 min. Related to Figure 3.

https://doi.org/10.7554/eLife.06547.026
Video 15
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and empty vector.

Midbody resolution is indicated with an arrow. Abscission time is 100 min. Related to Figure 3.

https://doi.org/10.7554/eLife.06547.021
Video 16
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and ULK3 WT.

Midbody resolution is indicated with an arrow. Abscission time is 160 min. Related to Figure 3.

https://doi.org/10.7554/eLife.06547.022
Video 17
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and ULK3 WT.

Midbody resolution is indicated with an arrow. Abscission time is 290 min. Related to Figure 3.

https://doi.org/10.7554/eLife.06547.023

Effects of ULK3 on the abscission machinery

The functional links with ESCRT-III subunits suggested that catalytically active ULK3 might regulate abscission timing by influencing ESCRT-III polymerization during cytokinesis. We tested this hypothesis by analyzing the midbody location of endogenous IST1, which is essential for abscission (Agromayor et al., 2009; Bajorek et al., 2009a). ULK3 overexpression altered IST1 midbody localization significantly, as indicated by a 1.5-fold increase in the proportion of IST1 found at the midbody rings and a marked ninefold increase in the proportion of midbodies containing a single ring of IST1 at the Flemming body (Figure 4A). Importantly, HA-ULK3 was seen to co-localize with IST1 at this Flemming body ring (in 42% of observed midbodies) (Figure 4B). Additionally, ULK3 and IST1 co-localized at midbody rings on both sides of the Flemming body (58% of cases) (Figure 4B), which could be a transient ULK3 localization rarely observed in steady-state conditions exacerbated in the overexpression context (compare to endogenous staining of ULK3 in Figure 2B).

Figure 4 with 1 supplement see all
Effects of ULK3 on IST1 localization at the midbody.

(A) HeLa mCherry-Tubulin cells stably expressing empty vector or ULK3 WT were stained with Hoechst and α-IST1 antibody. Cells connected by midbodies were classified by the localization pattern of IST1 as shown on the left panel, where Tubulin is red and IST1 is green. Bars = 1 μm. Data are represented as percentage of midbodies observed for each category from three separate experiments; n = total number of scored midbodies. Cells connected by chromatin bridges or multinucleated were excluded. (B and C) Panels show a representative example of Flemming body localization (B) or midbody rings (C), where the IST1 signal (middle left) co-localizes with HA-ULK3 (middle right) in HeLa YFP-Tubulin (left) cells expressing HA-ULK3 stained with α-IST1 and α-HA antibodies. ULK3 and IST1 co-localization was observed in 100% of midbodies with Flemming body localization for IST1 (n = 48). Merged channels are shown on the right (green: Tubulin, red: IST1, yellow: HA, blue: nuclei). Magnifications of the midbody are shown for each channel. Bar = 5 μm. See also Figure 4—figure supplement 1.

https://doi.org/10.7554/eLife.06547.027

As a second marker for ESCRT-III polymers, we investigated whether ULK3 overexpression altered the midbody localization of GFP-CHMP4B expressed at endogenous levels (Jouvenet et al., 2011). As with IST1, the proportion of midbodies exhibiting single Flemming body rings of GFP-CHMP4B also increased 20-fold upon ULK3 overexpression (Figure 4—figure supplement 1A,B). In contrast, overexpression of either ESCRT-binding deficient (M434D) or kinase-defective (K44H) ULK3 had no effect on GFP-CHMP4B localization (Figure 4—figure supplement 1A). Thus, the ability of ULK3 constructs to induce aberrant ESCRT-III localization correlates with their ability to delay abscission. Both WT and K44H ULK3 co-localized with GFP-CHMP4B polymers at the intercellular bridge (Figure 4—figure supplement 1C,D), while only ULK3 WT co-localized with GFP-CHMP4B at the Flemming body (39% vs 61% of ULK3/GFP-CHMP4B at the midbody rings) (Figure 4—figure supplement 1C), more closely reflecting the Flemming body localization observed for endogenous ULK3 in a context without overexpression (compare to Figure 2B). This observation suggests that ULK3 does not delay abscission by directly blocking or outcompeting ESCRT-III interactions required for polymerization. Instead, ULK3 apparently induces abscission delays and ESCRT-III mislocalization by phosphorylating substrates important for abscission completion. Taken together, these data show that catalytically active ULK3 changes the steady-state distribution of ESCRT-III proteins at the midbody, suggesting that the abscission delays induced by ULK3 are due, at least in part, to defective ESCRT-III polymerization.

ULK3 phosphorylates ESCRT-III subunits

We next tested whether ESCRT-III subunits are phosphorylated by ULK3. An in vitro kinase assay using recombinant ULK3 on immunoprecipitated HA-ESCRT-III proteins showed phosphorylation of CHMP1A, CHMP1B, CHMP2A, and IST1 (Figure 5A, middle blot, lanes 2, 3, 4, and 10), but not other ESCRT-III subunits. Analogous phosphorylation events were recapitulated in cells overexpressing OSF-ULK3 and Myc-tagged ESCRT-III proteins. The enhanced separation of phosphorylated species by electrophoresis on Phos-tag SDS-PAGE gels revealed ULK3-dependent phosphorylation of IST1, CHMP1A, CHMP1B, and CHMP2A, but not CHMP3 (Figure 5B, lane 2 and Figure 5—figure supplement 1A, lanes 2, 8, 14, and 20). Phosphorylation was confirmed by sensitivity to calf intestinal phosphatase (CIP) treatment (Figure 5B, lanes 4–6 and Figure 5—figure supplement 1A, lanes 4–6, 10–12, 16–18, and 22–24) and by expressing the inactive ULK3 K44H protein as a control (Figure 5B, lane 3 and Figure 5—figure supplement 1A, lanes 3, 9, and 15). These data demonstrate that ULK3 ESCRT-III binding partners are also substrates for phosphorylation.

Figure 5 with 1 supplement see all
Identification of ULK3 phosphorylation sites within IST1.

(A) In vitro kinase assay with recombinant ULK3 protein (middle) on immunoprecipitated HA-ESCRT-III proteins expressed in 293T cells. Western blot with α-HA antibody shows immunoprecipitated ESCRT-III proteins (top). (B) 293T cells co-transfected with Myc-IST1 and either empty vector, OSF-ULK3 WT or OSF-ULK3 K44H. Lysates were electrophoresed on a 10% Phos-tag gel to separate phosphorylated species (denoted by ‘asterisk’). Lysates were treated with calf intestinal phosphatase (CIP, lanes 4–6). (C) Identified phosphorylation sites mapped onto the IST1 domain structure (above) and onto the crystal structure of the IST1 N-terminal domain (below, PDB 3FRR) 39. (D) HeLa cells stably expressing empty vector, siRNA-resistant IST1 (IST1R) WT, or IST1R 4SA were transfected with siRNA and treated overnight with DMSO or Nocodazole. (E) HeLa cells were transfected with siRNA prior to overnight treatment with DMSO or Nocodazole. In (D and E), cell lysates were resolved on 10% Phos-tag gels and analyzed by western blot, where ‘asterisks’ denote bands corresponding to IST1 phosphorylated species, sensitive (*) or insensitive (**) to the 4SA mutation or ULK3/CHMP4C depletion. See also Figure 5—figure supplement 1.

https://doi.org/10.7554/eLife.06547.029

Identification of ULK3 phosphorylation sites on IST1

ULK3 phosphorylation of IST1 was characterized by mass spectrometry. To maximize IST1 phosphorylation, we co-overexpressed Myc-IST1 and OSF-ULK3 in 293T cells, affinity purified the IST1/ULK3 complexes, and determined the masses of intact IST1 proteins by electrospray ionization (ESI) mass-spectrometry. We observed four different IST1 species whose masses differed by ∼80 Da, the mass change corresponding to phosphorylation (Figure 5—figure supplement 1B). The different masses corresponded to Myc-IST1 proteins with 1–4 phosphates (and N-terminal acetylation). These assignments were confirmed by measuring the intact mass of Myc-IST1 co-expressed with a catalytically inactive ULK3 protein (K139R) (Maloverjan et al., 2010) and CIP treated (Figure 5—figure supplement 1B).

Phosphorylation sites were mapped by ESI/MS/MS analyses of IST1 peptides from tryptic and chymotryptic digests. These analyses confirmed that Myc-IST1 is N-terminally acetylated and identified four phosphorylated serine residues: S4, S99, S153, and S214. These sites are upstream of the IST1 MIM elements, either within the core ESCRT-III four-helix bundle (Muziol et al., 2006; Bajorek et al., 2009b) (residues 1–189; S4, S99, and S153) or in a flexible region flanking the core (S214; Figure 5C).

We next compared the phosphorylation status of endogenous IST1 in cycling cells vs Nocodazole-arrested cells. Mitotic arrest was confirmed by the presence of Histone 3 phosphorylation (P-H3), a marker for mitotic chromosome condensation (Hendzel et al., 1997) (Figure 5D). Nocodazole treatment induced accumulation of at least two different phosphorylated IST1 species (Figure 5D). A similar banding pattern was observed when endogenous IST1 was depleted and replaced by an siRNA-resistant wild-type IST1 construct (IST1R WT, lane 2 vs 4). However, the lowest mobility IST1 species was eliminated when the four mapped phosphorylated serine residues were mutated to alanine (IST1R 4SA, Figure 5D, lane 6). The IST1R 4SA mutant still formed intermediate mobility species, which suggests that additional site(s) on IST1 may be phosphorylated by ULK3 or other mitotic kinases. Formation of the lowest mobility phosphorylated IST1 species was ULK3-dependent, as it was also eliminated by depletion of ULK3 from Nocodazole-treated cells (Figure 5E, lane 5 vs 4). Taken together, these results indicate that ULK3 phosphorylates endogenous IST1 during mitosis.

ULK3-dependent phosphorylation of IST1 is required for abscission checkpoint signaling

To evaluate the functional consequences of IST1 phosphorylation by ULK3, we tested the ability of the IST1R 4SA mutant to support the abscission checkpoint. These experiments revealed that NUP153 depletion failed to trigger the abscission checkpoint when endogenous IST1 was replaced with IST1R 4SA (Figure 6A, lane 6 vs 2), whereas the checkpoint was fully functional when IST1R WT was used in this assay (Figure 6A, lane 4 vs 2). Similarly, intercellular chromatin bridges in cells depleted of endogenous IST1 but expressing IST1R 4SA resolved significantly faster than chromatin bridges in control cells or cells that expressed IST1R WT (Figure 6B). Importantly, both IST1R WT and IST1R 4SA were able to restore the abscission defects induced by IST1 depletion (Figure 6C, lanes 3–4 vs lane 2, and Figure 6D), indicating that IST1R 4SA is fully functional for cytokinesis under steady-state conditions. Similarly, IST1R 4SA retained its interactions with all known IST1-binding partners in Y2H assays (Figure 6—figure supplement 1A). It was notable that the IST1R 4SA could also still support abscission delays when the checkpoint was induced by low-cell tension. Specifically, the effects on tension-mediated abscission regulation were similar when cells expressed IST1R WT or IST1R 4SA (Figure 6—figure supplement 1B). Thus, the IST1R 4SA protein did not support the abscission checkpoint in response to chromatin within the midbody and nuclear pore disruption but retained other IST1 binding and abscission functions, including regulation of abscission timing in response to midbody tension. In contrast, a phosphomimetic IST1 mutant (IST1R 4SE: S4E, S99E, S153E, S214E) failed to restore abscission in IST1-depleted cells, as reflected by the accumulation of multinucleated and midbody-arrested cells (Figure 6C, lane 5 and Figure 6D, bottom panel). Furthermore, live-cell imaging confirmed that even when cells expressing IST1R 4SE did complete abscission, they did so more slowly than cells expressing IST1R WT or 4SA (Figure 6E, Videos 18–22). Collectively, these experiments indicate that ULK3 phosphorylation of IST1 delays abscission as an essential component of the abscission checkpoint in the presence of chromatin bridges within the midbody or incomplete nuclear pore assembly.

Figure 6 with 1 supplement see all
ULK3 phosphorylation of IST1 is required to sustain the abscission checkpoint and inhibits IST1 function in abscission.

(A) HeLa cells stably expressing empty vector, IST1R WT, or IST1R 4SA were co-transfected with the indicated siRNA and NUP153 siRNA to trigger the abscission checkpoint. Cells were fixed and stained with Hoechst and α-Tubulin antibody to visualize nuclei and midbodies, respectively. Data are represented as mean percentage of midbodies ±SD from four separate experiments, n = total number of scored midbodies. NUP153 depletion levels as a mean percentage quantified by Western blot from two independent experiments were lane 1: 100%, 2: 40%, 3: 85%, 4: 39%, 5: 120%, 6: 46%. (B) HeLa YFP-LAP2β cells expressing empty vector, IST1R WT, or IST1R 4SA were transfected with NT or IST1 siRNA, and resolution times of intercellular chromatin bridges were quantified in two separate experiments (mean times are 1: 906 min; 2: 965 min: 3: 638 min). (C and D) HeLa cells stably expressing empty vector, IST1R WT, IST1R 4SA, or IST1R 4SE were transfected with the indicated siRNA, fixed and stained with α-Tubulin antibody to visualize cytokinetic defects. Data in (C) are represented as mean percentage of midbody-arrested or multinucleated cells ±SD from three separate experiments. Microscopy images in (D) are representative examples from each sample in (C), shown as merged images of Tubulin (red) and nuclei (blue). ‘Asterisks’ and ‘arrowheads’ denote multinucleated and midbody-connected cells, respectively. Bars = 10 μm. (E) HeLa YFP-Tubulin cells stably expressing empty vector, IST1R WT, IST1R 4SA, or IST1R 4SE were transfected with the indicated siRNA. Live-cell imaging revealed midbody resolution times from two separate experiments (mean times were 1: 97 ± 33 min; 2: 204 ± 95 min; 3: 103 min ±48; 4: 98 ± 38 min; 5: 145 ± 65 min). Cell lysates in (A, B, C, and D) were examined by Western blot using the indicated antibodies. (F) Co-precipitation assay from 293T cells co-transfected with the indicated YFP and GST fusions. 10% of the volume eluted from the beads was analyzed by Western blot with α-YFP antibody to visualize bound proteins and α-GST as a control for pull-down efficiency. α-YFP Western blot on input lysates (top) is representative for all experiments, and empty YFP band was cropped from the same blot. See also Figure 6—figure supplement 1 and Videos 18–22.

https://doi.org/10.7554/eLife.06547.031
Video 18
Representative example of asynchronous HeLa cells stably expressing YFP-Tubulin and empty vector transfected with NT siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 90 min. Related to Figure 6.

https://doi.org/10.7554/eLife.06547.033
Video 19
Representative example of asynchronous HeLa cells stably expressing YFP-Tubulin and empty vector transfected with IST1 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 190 min. Related to Figure 6.

https://doi.org/10.7554/eLife.06547.034
Video 20
Representative example of asynchronous HeLa cells stably expressing YFP-Tubulin and siRNA-resistant IST1 (IST1R) WT transfected with IST1 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 90 min. Related to Figure 6.

https://doi.org/10.7554/eLife.06547.035
Video 21
Representative example of asynchronous HeLa cells stably expressing YFP-Tubulin and IST1R 4SA transfected with IST1 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 90 min. Related to Figure 6.

https://doi.org/10.7554/eLife.06547.036
Video 22
Representative example of asynchronous HeLa cells stably expressing YFP-Tubulin and IST1R 4SE transfected with IST1 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 180 min. Related to Figure 6.

https://doi.org/10.7554/eLife.06547.037

We next used a co-precipitation approach to test whether phosphorylation altered the interactions of IST1 with its binding partners (Figure 6F). These experiments revealed that the phosphomimetic mutations enhanced binding of YFP-IST1 4SE to both GST-VPS4 and GST-LIP5 as compared to YFP-IST1 WT and YFP-IST1 4SA (Figure 6F, lanes 20 and 24). In contrast, the interaction of YFP-IST1 4SE with GST-CHMP1B was unchanged (Figure 6F, lane 12), and the interaction with GST-CHMP2A remained negative. Thus, the enhanced binding effects of the IST1 phosphomimetic mutations were specific for VPS4 and its co-activator LIP5. These results suggest that ULK3 phosphorylation of IST1 may delay abscission by regulating the interaction of IST1 with late-acting components of the ESCRT machinery.

ULK3 and CHMP4C are functionally interconnected within the Aurora B-dependent abscission control pathway

The phenotypic similarities between CHMP4C and ULK3 in regulating the abscission checkpoint suggested connections between these proteins. Consistent with this idea, CHMP4C depletion eliminated the IST1 hyperphosphorylation induced by Nocodazole treatment, mimicking the effects of ULK3 depletion (Figure 5E, lane 6). This observation reveals a requirement for CHMP4C in IST1 phosphorylation and suggests a functional link between ULK3 and CHMP4C. To examine whether ULK3 and CHMP4C function in the same regulatory pathway, we tested whether ULK3 is required for the abscission delays induced by overexpression of GFP-CHMP4C (Carlton et al., 2012). GFP-CHMP4C overexpression increased the steady-state number of cells connected by midbodies, but ULK3 depletion reverted this phenotype to control levels (Figure 7A, lane 5 vs 4). Comparable effects were observed for cells treated with CHMP4C siRNA, which depleted both endogenous and exogenous CHMP4C (lane 6). Interestingly, ULK3 depletion did not alter GFP-CHMP4C localization within the central region of the midbody (Figure 7B), suggesting that ULK3 is not required for transmission of the Aurora B signal that targets CHMP4C to the Flemming body (Carlton et al., 2012). Endogenous ULK3 did co-localize with GFP-CHMP4C at the Flemming body, however, further supporting a functional connection between these proteins (Figure 7C).

Figure 7 with 1 supplement see all
ULK3 and CHMP4C are functionally interconnected within the abscission control pathway.

(A) HeLa cells expressing GFP-CHMP4C were transfected with NT, ULK3, or CHMP4C siRNA, fixed and stained with Hoechst and α-Tubulin antibody to visualize multinucleated and cells connected by midbodies. Data are represented as mean percentage of midbody-arrested cells ±SD from three separate experiments. (B) Confocal microscopy of HeLa GFP-CHMP4C cells treated as in (A). Magnifications of the midbody are shown. Data are represented as mean percentage of CHMP4C positive midbodies ±SD from two separate experiments (NT n = 110; ULK3 n = 43; CHMP4C n = 53). Bars = 5 μm. (C) HeLa GFP-CHMP4C cells were stained with α-ULK3 antibody. Panel shows a representative example of GFP-CHMP4C at the Flemming body co-localizing with endogenous ULK3 (94% of cases, n = 31). Merged channels are shown on the right (red: Tubulin, green: GFP, purple: ULK3, blue: nuclei). Magnifications of the midbody are shown for each channel. Bar = 5 μm. (D) HeLa GFP-CHMP4B or GFP-CHMP4C expressing cells were treated as in (A) and imaged live. Midbody resolution times were quantified in three separate experiments (mean times were 1: 106 ± 52 min; 2: 180 ± 114 min; 3: 105 ± 47 min). (E) HeLa cells expressing empty vector or ULK3 WT were transfected with the indicated siRNA, and midbody resolution times were scored in three separate experiments (mean times were 1: 84 ± 34 min; 2: 136 ± 87 min; 3: 110 ± 79 min). n = total number of events analyzed per sample. (F) HeLa cells expressing empty vector or ULK3 WT were treated with 1 μM DMSO or Aurora B inhibitor (ZM447439). Only cells at midbody stage were monitored and imaged live starting at the time of treatment. The time spent in abscission until midbody resolution was analyzed in two separate experiments (mean times were 1: 100 ± 57 min: 2: 171 ± 122 min: 3: 53 ± 41 min: 4: 54 ± 41 min). (G) HeLa cells were treated overnight with media containing DMSO or Nocodazole with or without 1 μM ZM44739 inhibitor. Cell lysates were resolved on 10% Phos-tag gels and analyzed by Western blot. ‘Asterisks’ denote bands corresponding to IST1 phosphorylated species that were sensitive (*) or insensitive (**) to Aurora B inhibition. (H) HeLa cells stably expressing HA-CHMP4CR or HA-CHMP4CRδINS (lacks residues 201–217) were transfected with NT or ULK3 siRNA prior to overnight treatment with media containing DMSO or Nocodazole. HA-CHMP4CR WT or δINS levels were quantified by infrared imaging; data are represented as mean percentage of phosphorylated CHMP4C (P-CHMP4C, higher molecular weight band) vs non-phosphorylated CHMP4C (lower molecular weight) ±SD from three separate experiments. Cell lysates in (A, D-F) were analyzed by Western blot with the indicated antibodies. See also Figure 7—figure supplement 1 and Videos 23–28.

https://doi.org/10.7554/eLife.06547.038

The effects of ULK3 on GFP-CHMP4C-dependent abscission delays were confirmed by live imaging of cells co-expressing mCherry-Tubulin. In agreement with the fixed-cell data, ULK3 depletion reverted CHMP4C-induced delays in midbody resolution to control levels (defined by cells expressing GFP-CHMP4B, Figure 7D, Videos 23–25). In a reciprocal experiment, CHMP4C depletion attenuated abscission delays imposed by ULK3 overexpression, although in this case the effect was incomplete (Figure 7E, Videos 26–28). ULK3-induced abscission delays were abolished upon treatment of cells at midbody stage with an Aurora B inhibitor (ZM447439) (Ditchfield et al., 2003). ZM447439-treated cells rapidly underwent abscission, implying that Aurora B activity is required in order for ULK3 to delay abscission (Figure 7F). These data indicate that ULK3 and CHMP4C act together in regulating abscission as part of the Aurora B-dependent abscission control pathway. The requirement for CHMP4C in abscission delay can be partially alleviated in cells overexpressing ULK3, however, suggesting that excess ULK3 can overcome upstream CHMP4C functions in regulating midbody resolution.

Video 23
Representative example of asynchronous HeLa cells stably expressing GFP-CHMP4B and mCherry-Tubulin transfected with NT siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 110 min. Related to Figure 7.

https://doi.org/10.7554/eLife.06547.040
Video 24
Representative example of asynchronous HeLa cells stably expressing GFP-CHMP4C and mCherry-Tubulin transfected with NT siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 140 min. Related to Figure 7.

https://doi.org/10.7554/eLife.06547.041
Video 25
Representative example of asynchronous HeLa cells stably expressing GFP-CHMP4C and mCherry-Tubulin transfected with ULK3 siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 80 min. Related to Figure 7.

https://doi.org/10.7554/eLife.06547.042
Video 26
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and empty vector transfected with NT siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 80 min. Related to Figure 7.

https://doi.org/10.7554/eLife.06547.043
Video 27
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and ULK3 transfected with NT siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 120 min. Related to Figure 7.

https://doi.org/10.7554/eLife.06547.044
Video 28
Representative example of asynchronous HeLa cells stably expressing mCherry-Tubulin and ULK3 transfected with CHMP4C siRNA.

Midbody resolution is indicated with an arrow. Abscission time is 90 min. Related to Figure 7.

https://doi.org/10.7554/eLife.06547.045

We next assessed the effect of ULK3-mediated phosphorylation of IST1 and CHMP4C in the context of the Aurora B-dependent abscission pathway. As shown in Figure 7G, the lowest mobility IST1 species observed in mitotically arrested cells was eliminated upon treatment with Aurora B inhibitor (lane 4 vs 3), whereas the intermediate mobility species was not altered by this treatment. These effects are similar to those observed for the IST1R 4SA mutant or upon ULK3 depletion. These observations suggest that the low-mobility species is required for abscission checkpoint function and that additional site(s) on IST1 could be phosphorylated by ULK3 or other mitotic kinases in an Aurora B-independent manner. We, therefore, tested whether immunoprecipitated HA-tagged CHMP4 proteins could be phosphorylated by ULK3 in vitro. CHMP4C was phosphorylated by recombinant ULK3 in these experiments, whereas CHMP4A and CHMP4B were not (Figure 7—figure supplement 1A). ULK3 phosphorylation was retained in a CHMP4C deletion mutant that lacked both the ALIX-binding site (McCullough et al., 2008) and the C-terminal insertion that is phosphorylated by Aurora B23,24 (CHMP4C 1–200; Figure 7—figure supplement 1B, lane 3). However, ULK3 phosphorylation was lost upon further deletion of the MIM2 element (CHMP4C 1–184; Figure 7—figure supplement 1B, lane 4). These results show that ULK3 and Aurora B target different residues in CHMP4C and indicate that ULK3-dependent phosphorylation requires the MIM2 region. In agreement with the in vitro data, CHMP4C phosphorylation was also observed in cells co-transfected with Myc-CHMP4C and OSF-ULK3 (Figure 7—figure supplement 1C) as was observed for other ULK3 ESCRT-III substrates.

We have previously shown that CHMP4C is phosphorylated at the start of mitosis and dephosphorylated as mitosis progresses (Carlton et al., 2012). This phosphorylation induces a mobility shift that can be followed by Western blot of cells expressing HA-CHMP4C at functional levels (Carlton et al., 2012) (Figure 7—figure supplement 1D). Importantly, mitotic CHMP4C phosphorylation was also observed for a HA-CHMP4C mutant that lacked the Aurora B target residues (CHMP4CδINS) (Figure 7—figure supplement 1D). Thus, Aurora B-independent phosphorylation of CHMP4C occurs during cell division. Quantitative Western blot revealed that mitotic arrest increased the fraction of phosphorylated CHMP4C (P-CHMP4C) to 81% vs 7% in asynchronous cells (Figure 7H, lane 3 vs 1). However, depletion of ULK3 reduced the mitotic fraction of P-CHMP4C to just 30% (Figure 7H, lane 4). These differences could not be attributed to gross changes in mitotic arrest because P-H3 levels remained constant upon ULK3 depletion. Similarly, the fraction of phosphorylated CHMP4CδINS increased in mitotic cells (Figure 7H, lane 7 vs 3), and phosphorylation levels were again reduced by ULK3 depletion, albeit not as dramatically as in the case of WT CHMP4C (Figure 7H, lane 8 vs 7 and 4). Hence, ULK3 contributes to mitotic CHMP4C phosphorylation, and ULK3-dependent phosphorylation and Aurora B-dependent phosphorylation of CHMP4C are separate events.

Discussion

Our study reveals that ULK3 is an essential component of the abscission checkpoint. ULK3 provides inhibitory signals to the abscission machinery that are sustained in response to defective nuclear pore complex assembly or the presence of lagging chromosomes within the midbody, thereby ensuring faithful cytokinesis progression. ULK3 is also the first identified component of a pathway that delays abscission in response to midbody tension.

Both ULK3 kinase and ESCRT-III-binding activities are required for abscission regulation and our data support a model in which ULK3 phosphorylates ESCRT-III proteins, and thereby, delays the membrane cleavage step of abscission. Consistent with this model, we have identified a subset of ESCRT-III proteins, particularly IST1, which are bound and phosphorylated by ULK3. The MIT2 domain of ULK3 binds the MIM1 of IST1 with unusually high affinity. In contrast, both MIT domains contribute significantly to CHMP1A/B binding, suggesting that MIM1 elements of CHMP1 and IST1 proteins bind ULK3 in distinct ways. Both MIT domains contribute to ULK3 functions in the abscission checkpoint. These observations suggest that IST1 engages the ULK3 MIT2 domain, whereas the other MIT site is occupied by other ESCRT-III proteins and/or by yet unidentified binding partners.

IST1 phosphorylation is required to mediate the abscission checkpoint and an IST1 phosphomimetic mutant failed to support abscission, indicating that phosphorylation inhibits at least one IST1 abscission function. We can envision different, non-exclusive mechanisms by which ULK3 phosphorylation of ESCRT-III proteins could delay abscission. In one model, ULK3 phosphorylation could directly prevent extension of ESCRT-III filaments to the abscission site either because phosphorylation stabilizes the auto-inhibited ESCRT-III conformation (Muziol et al., 2006; Lata et al., 2008; Bajorek et al., 2009b) or inhibits essential interactions within the polymer.

ESCRT-III phosphorylation could also modulate interactions with other components of the abscission machinery. Overexpression of catalytically active ULK3 induced both IST1 and CHMP4B to form single rings within the Flemming body, a phenotype rarely observed in control cells. Intriguingly, both endogenous ULK3 and functionally active CHMP4C also localize to the Flemming body (Capalbo et al., 2012; Carlton et al., 2012), suggesting that ULK3 may promote association of ESCRT-III subunits with abscission checkpoint regulators to form a cytokinetic inhibitory complex at the central region of the midbody. We also observed that phosphomimetic mutations enhanced IST1 interactions with the late-acting VPS4 protein and its activator LIP5 in cells. We speculate that these enhanced interactions are mediated by unidentified bridging factor(s) because the IST1 phosphorylation sites lie outside of the VPS4- and LIP5-binding sites. The Abscission/NoCut Checkpoint Regulator (ANCHR) protein delays abscission by retaining VPS4 at the Flemming body (Thoresen et al., 2014), and it is, therefore, possible that phosphorylated IST1 may collaborate with ANCHR. Moreover, IST1 can also inhibit VPS4 ATPase activity by forming an inactive IST1-VPS4 heterodimer (Dimaano et al., 2008), and phosphorylated IST1 could, therefore, delay abscission by inhibiting VPS4 ATPase activity or by inhibiting productive VPS4 recruitment by ESCRT-III proteins, including CHMP1 and IST1, which help localize VPS4 to the midbody late in cytokinesis (Agromayor et al., 2009; Bajorek et al., 2009a).

We have shown that ULK3 acts in concert with Aurora B to regulate abscission through CHMP4C. We favor a model in which ULK3 is activated during mitosis and functions downstream of Aurora B and CHMP4C. This would explain why mitotic phosphorylation of IST1 requires ULK3 and CHMP4C and why ULK3 overexpression can partially overcome the requirement for CHMP4C in abscission delay. Given that ULK3 phosphorylates multiple ESCRT-III subunits, the initial phosphorylation of CHMP4C by Aurora B could be subsequently ‘amplified’ by ULK3. Our data further show that ULK3 and Aurora B phosphorylate CHMP4C at different sites (Carlton et al., 2012). This is consistent with the functional interdependence of ULK3 and CHMP4C in the abscission checkpoint and could contribute to creating a feedback loop that sustains the inhibitory signal. Mitotic phosphorylation of CHMP4C then decreases at (or near) the time of abscission, suggesting that a checkpoint-dependent phosphatase may override ULK3 activity and provide an ‘all clear’ signal to complete abscission.

Finally, the recent identification of CHMP4C variants as risk factors for ovarian cancer suggests that abscission checkpoint defects may increase the tumorigenic potential of the daughter cells (Pharoah et al., 2013). The identification of ULK3 as an essential component of the abscission checkpoint, thus, opens a new avenue in the emerging relationship between the abscission checkpoint and tumor formation.

Materials and methods

Lists of plasmids, siRNA, antibodies, and cell lines used in this study are provided in Supplementary file 1.

Y2H assay

Yeast Y190 cells were co-transformed with 1 µg of each plasmid encoding the indicated proteins fused to the VP16 activation domain (pHB18) or the Gal4 DNA-binding domain (pGBKT7). Co-transformants were selected on SD-Leu-Trp agar for 3 days at 30°C. Protein–protein interactions were determined by β-galactosidase activity in yeast extracts using chlorophenol red-β-D-galactopyranoside (Roche, Switzerland) as a substrate.

Cell culture

HeLa and 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% Fetal Calf serum (FCS) and gentamycin 20 μg/ml; (no antibiotics were used to culture cells for experiments shown in Figures 1A,C,5B, Figure 5—figure supplement 1 and Figure 7—figure supplement 1C). Stable cells lines were generated using MLV-based retroviruses as described previously (Carlton and Martin-Serrano, 2007) and selected using puromycin (200 ng/ml) or G418 (500 μg/ml). For live-cell imaging experiments, imaging was performed between 4 and 10 days after selection was added to the transduced cells.

Transfections

Polyethylenimine (PEI; Polysciences, Germany) or Lipofectamine 2000 (Life Technologies, Carlsbad, CA) was used to transfect plasmids into 293T and HeLa cells respectively, according to manufacturer's instructions. For all siRNA assays, cells were transfected twice with 100 nM of siRNA using Dharmafect-1 (Dharmacon RNA Technologies, Lafayette, CO). For IST1 rescue experiments in Figure 6A,B, cells were transfected once with 100 nM of siRNA and fixed/imaged 12–16 hr after transfection. To trigger the abscission pathway by using partial depletion of NUP153, cells were co-transfected with 10 nM of NUP153 siRNA (diluted in NT siRNA).

Genome editing with CRISPR-Cas9 system

Two sets of guide RNA targeting the ULK3 locus were designed using the Zhang Lab website (http://crispr.mit.edu) and cloned into a lentiCRISPRv2 plasmid (Addgene, Cambridge, MA) (Sanjana et al., 2014). The sequences for the two sets of guide oligos were (quoted 5′ to 3′) set 1: CACCGCACGTACGCCACGGTGTACA and AAACTGTACACCGTGGCGTACGTGC; set 2: CACCGGGATCTCAATCTCCGTGAGG and AAACCCTCACGGAGATTGAGATCCC. Stable cell lines were generated by transfecting a 10-cm dish of 293T cells per construct, using 7.2 μg of lentiCRISPR, 7.2 μg p8.91 HIV Gag-pol, and 1.8 μg of VSV-G. 48 hr post-transfection, released virions were collected and concentrated through a 20% sucrose gradient by ultracentrifugation at 28,000 rpm for 1.15 hr at 4°C. Pelleted virions were re-suspended in serum free media overnight and used to transduce HeLa cells in 6-well per plate by spinoculation for 2 hr. After 2 days, puromycin (100 ng/ml) was used for selection and cells were maintained under selection until single cell clones were obtained by limiting dilution. After confirmation of efficient ULK3 knockout by Western blot, two δULK3 clones were selected and used for functional experiments.

OSF-ULK3 pull downs

For the experiment shown in Figures 1A, 2 × 106 293T cells were seeded in 10-cm dishes and each dish was singly transfected 18–24 hr later with plasmids encoding Myc-tagged ESCRT-III proteins or OSF-ULK3 (6 µg/dish) using PEI. To equalize expression levels, the following amounts of plasmids encoding Myc-tagged ESCRT-III proteins were transfected (with empty vector used as necessary to bring the total to 10 µg): 10 µg each of CHMP2A-Myc, CHMP2B-Myc, CHMP4B-Myc, CHMP4C-Myc, and CHMP6-Myc; 5 µg of CHMP4A-Myc; 1.5 µg of CHMP1A-Myc and Myc-IST1; 0.25 µg of CHMP1B-Myc, CHMP3-Myc, CHMP5-Myc, and CHMP7-Myc. Cells were harvested 48 hr post-transfection and lysed in 50 mM Tris pH 7.2, 150 mM NaCl, 0.5 mM MgCl2, 5 mM β-mercaptoethanol (BME), 0.2% Triton X-100 supplemented with DNAse I (Roche), and protease inhibitors (Sigma–Aldrich, St. Louis, MO). Lysates were clarified by centrifugation at 16,100×g for 10 min at 4°C. Lysates expressing ESCRT-III proteins were further diluted with lysate from untransfected cells to match expression levels and mixed with lysates prepared from cells expressing OSF-ULK3. Mixed lysates were incubated overnight (∼18 hr) at 4°C with 20 µl of pre-equilibrated streptactin sepharose resin (IBA Lifesciences, Germany) and washed once with wash buffer: 50 mM Tris, pH 7.2, 350 mM NaCl, 5 mM BME, 0.5 mM MgCl2, 0.2% Triton X-100 and three times with wash buffer containing 150 mM NaCl. After the final wash, the streptactin beads were aspirated to near dryness, and bound proteins were eluted by boiling in 20 µl of Laemmli sample buffer, resolved by SDS-PAGE, and examined by Western blotting.

For the experiment shown in Figure 1C, 293T cells were seeded in a 6-well plate at 0.25 × 104 cells/well and co-transfected 18–24 hr later with 1.5 µg of the indicated plasmids. Cells were harvested 48 hr post-transfection, lysed, and clarified as described above. Cell lysates were incubated with 20 µl of streptactin resin for 2 hr at 4°C. The streptactin resin was washed four times in lysis buffer and aspirated to near dryness. Bound proteins were eluted by boiling in 20 µl of Laemmli sample buffer, resolved by SDS-PAGE, and examined by Western blotting.

GST pull downs

For co-precipitation experiments, 293T cells from 6-well plates were transfected with 1 µg of plasmids encoding the indicated pCAGGS/GST and pCR3.1-YFP fusion proteins. 48 hr later, cells were lysed in 1 ml of lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100 and a protease inhibitor cocktail [complete mini-EDTA free, Roche]). Clarified lysates were incubated with glutathione–sepharose beads (Amersham Biosciences, Pittsburgh, PA) for 3 hr at 4°C and washed three times with wash buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, and 0.1% Triton X-100). Bound proteins were eluted by boiling in 100 µl of Laemmli sample buffer, resolved by SDS-PAGE, and examined by Western blotting.

Immunoprecipitations

4.5 × 106 293T cells were transfected with 20 µg of plasmids encoding HA-tagged proteins. After 48 hr, cells were lysed in 5 ml of lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100) containing a protease inhibitor cocktail (complete mini-EDTA free, Roche) and a phosphatase inhibitor mixture (PhosStop, Roche). After sonication, cleared lysates were incubated with 5 μg of monoclonal α-HA for 1 hr at 4°C, and then 40 μl of protein G-agarose for 2 hr at 4°C. Bead-bound complexes were washed four times in wash buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, and 0.1% Triton X-100), and bead-bound proteins were eluted by boiling in 80 µl of sample buffer, and examined by SDS-PAGE and Western blot.

Proximity-dependent biotin identification

This approach is based on the fusion of ULK3 to the Escherichia coli modified biotin protein ligase BirA-113G, which can promiscuously biotinylate vicinal proteins in vivo that are later isolated with streptavidin-coated beads (Roux et al., 2012). For these experiments, 2.5 × 106 HeLa cells stably expressing BirA-ULK3 were seeded in 10-cm dishes and treated overnight with 100 μM Biotin (Sigma–Aldrich). Cells were dissociated with Phosphate Buffer Saline (PBS) 0.5 mM EDTA, washed once with 1X PBS, and lysed in 500 μl of lysis buffer (50 mM Tris, pH 7.4, 500 mM NaCl, 5 mM EDTA, 0.4% SDS, 1 mM DTT and protease inhibitor cocktail). After a first pulse of sonication, Triton X-100 was added to a final concentration of 2%, samples were briefly sonicated again, and an equal volume of cold 50 mM Tris (pH 7.4) was added prior to a final pulse of sonication. Lysates were cleared by centrifugation for 5 min and incubated with avidin–agarose beads (Pierce, Rockford, IL) for 3 hr at 4°C and washed three times at 25°C with lysis buffer. Bound proteins were eluted by boiling in 100 µl of Laemmli sample buffer, resolved by SDS-PAGE, and examined by Western blotting.

Western blotting

Cell lysates or bead eluates were denatured in Laemmli buffer and resolved on polyacrylamide. Where indicated, Phos-tag (Wako Chemicals, Japan) and MnCl2 were added into 10% gels to induce mobility shifts in phosphorylated proteins, to final concentrations of 40 µM and 80 µM, respectively, for Figure 5B, Figure 5—figure supplement 1A and Figure 7—figure supplement 1C, or 25 µM and 50 µM, respectively, for Figures 5D,E,7G. Proteins were transferred onto nitrocellulose or PVDF membranes and probed with the indicated antibody in 1% or 5% milk. IRDye-conjugated secondary antibodies (Li-cor Biosciences, Lincoln, NE) were imaged using an Odyssey infrared scanner (Li-cor Biosciences). HRP-conjugated secondary antibodies (Pierce) were visualized using Amersham ECL Prime Western blotting detection reagent (GE Healthcare, Pittsburgh, PA) and ImageQuant LAS4000 system (GE Healthcare).

In vitro kinase assays

HA-tagged proteins were immunoprecipitated as described above. After four washes in wash buffer, bead-bound complexes were washed twice in wash buffer containing 0.5 M NaCl and twice in kinase assay buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 25 mM KCl, 5 mM MgCl2, 0.02% Triton X-100). Beads were resuspended in 40 μl of kinase assay buffer supplemented with 1 mM DTT. 100 ng of recombinant His-ULK3 (Abcam, UK) was added on ice where required. 2.5 μCi of ATP γ-32P was added and reactions were incubated with mixing at 30°C for 30 min. Reactions were terminated by addition of Laemmli buffer and boiling for 5 min. Lysates were then resolved by SDS-PAGE and transferred to nitrocellulose. Membranes were exposed to a storage phosphor screen, visualized using a Typhoon 9400 (GE Healthcare) and processed using ImageQuant. Subsequent Western blotting with polyclonal α-HA allowed visualization of immunoprecipitated proteins.

Alternatively, when using ULK3 GST-fusion plasmids, 2.2 × 106 293T cells were co-transfected with 2 µg of the indicated GST plasmid. After 48 hr, cells were harvested and lysed in 2 ml of GST pull-down lysis buffer. Cleared lysates were incubated with 25 μl glutathione–sepharose beads (Amersham Biosciences) for 2 hr at 4°C and washed twice with wash buffer, twice with wash buffer/0.5 M NaCl, and twice with kinase assay buffer. Kinase assays proceeded as described above.

Expression and purification of recombinant proteins

IST1 (residues 316–366, expressed as a His-SUMO-fusion protein) and GST-fusions of ULK3 (MIT)2 (residues 277–449) (WT and V338D or M434D mutants) and ULK3 MIT2 (359–449) were each expressed in 1 L cultures of BL21-Codon Plus (DE3) RIPL cells (Agilent, Santa Clara, CA) in ZYP-5052 auto-induction media (Studier, 2005). For crystallographic studies, ULK3(MIT)2 was additionally expressed in 2 L auto-induction PA-5052 media containing selenomethionine (SeMet) (Studier, 2005). All purification steps were performed at 4°C. For GST-fusions, cells were resuspended in lysis buffer (40 ml/L of culture) containing 50 mM Tris pH 8.0, 150 mM NaCl, 0.5 mM EDTA, 2 mM DTT, 0.125% sodium deoxycholate supplemented with protease inhibitors (aprotinin, leupeptin, pepstatin, and PMSF), lysozyme, and DNAse I (Roche). Cells were lysed by sonication, and the cell lysate was clarified by centrifugation for 45 min at 32,000×g. Clarified lysate was incubated for 1–2 hr with 15 ml GST resin (GE Healthcare) equilibrated with binding buffer: 50 mM Tris, pH 8.0, 150 mM NaCl, 2 mM DTT, and washed with 10 column volumes of binding buffer containing 500 mM NaCl and 10 column volumes of 150 mM NaCl-containing binding buffer. GST-affinity tags were removed from resin-bound ULK3 proteins by overnight incubation with PreScission Protease (0.3 mg) in 40 ml of GST-binding buffer at 4°C. Cleaved proteins were collected from the column flow through and dialyzed against Q-sepharose-binding buffer (20 mM Tris, pH 8.0, 50 mM NaCl, 2 mM DTT, 0.5 mM EDTA) for further purification by Q-sepharose anion exchange chromatography (GE Healthcare Life Sciences) with a linear gradient from 50 to 500 mM NaCl. Fractions containing ULK3 were pooled and dialyzed against gel filtration buffer (25 mM Tris, pH 7.2, 150 mM NaCl, 2 mM DTT, 0.5 mM EDTA) and further purified by Superdex-75 size exclusion chromatography (GE Healthcare Life Sciences). Typical protein yields were ∼15–20 mg/L culture in ZYP-5052 (rich) media and 2.5 mg/L culture in PA-5052 SeMet media.

Cells expressing His-SUMO-IST1316-366 were lysed by sonication in buffer (40 ml/L of culture) containing 50 mM Tris, pH 7.2, 200 mM NaCl, 5 mM imidazole, 5 mM DTT, 0.5 mM EDTA, and 0.125% sodium deoxycholate, supplemented with lysozyme, protease inhibitors, and DNAse I (Roche). Clarified cell lysate was incubated with 10 ml of cOmplete His-Tag purification resin (Roche) for 20 min, washed with 10 column volumes of wash buffer: 50 mM Tris, pH 7.2, 500 mM NaCl, 5 mM Imidazole, 5 mM DTT, 0.5 mM EDTA followed by 10 column volumes of wash buffer containing 150 mM NaCl. The His-SUMO affinity tag was removed from resin bound IST1 peptide by overnight incubation with UPL1 protease (0.1 mg) in 40 ml of the 150 mM NaCl wash buffer at 4°C. The cleaved IST1 peptide was collected from the column flow through and further purified by anion exchange and gel filtration chromatography as described above for ULK3 proteins. Typical IST1 peptide yields were 4.5 mg/L culture. Purified IST1 and ULK3 proteins contain non-native ‘GC’ and ‘GPHM’ residues at their N-termini, respectively. Masses of purified proteins were confirmed by ESI/MS as follows: IST1313-366 calculated = 5733 Da and experimental = 5732 Da; ULK3 (MIT)2 calculated = 19,355 Da and experimental 19,355 Da; ULK3(MIT)2 M434D calculated = 19,399 Da and experimental = 19,399 Da; ULK3(MIT)2 V338D calculated = 19,371 Da and experimental = 19,371 Da; ULK3 MIT2 calculated = 10,535 Da, and experimental = 10,535 Da.

Uniformly enriched 13C,15N-IST1303-366 was expressed as a TEV-cleavable GST fusion protein in 1 L of M9 minimal medium containing 2 g each of 15N-ammonium chloride and 13C-glucose. Cells were lysed by sonication in 40 ml of lysis buffer: 50 mM Tris pH 8.0, 100 mM NaCl, 1 mM DTT, 0.125% sodium deoxycholate, 0.1% Tween-20 in the presence of protease inhibitors (aprotinin, leupeptin, pepstatin, and PMSF) and lysozyme. Lysates were clarified as described above, and the supernatant was incubated with ∼15 ml of GST-sepharose resin (GE Healthcare Life Sciences) overnight at 4°C. The resin was washed with ∼10 column volumes of 20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM DTT, and bound protein was eluted in wash buffer containing 20 mM reduced l-glutathione. Eluted 15N,13C-IST1303-366 was dialyzed against 20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM DTT in the presence of TEV protease (at room temperature) to remove the GST tag. Following TEV cleavage, the IST1 peptide was dialyzed into Q-sepharose buffer: 20 mM Tris pH 8.0, 50 mM NaCl, 0.5 mM DTT, and purified by ion-exchange chromatography over a Q-sepharose column (GE Healthcare Life Sciences) using a linear gradient of 50–500 mM NaCl over ∼18 column volumes. Fractions containing 15N,13C-IST1303-366 were exchanged into 20 mM sodium phosphate pH 6.2, 25 mM NaCl, 0.1 mM EDTA, 0.1 mM NaN3, 0.5 mM DTT, and 10% D2O for NMR spectroscopy. The yield of purified 15N,13C-IST1303-366 peptide was ∼1.4 mg/L cell culture. The expected protein mass was confirmed by ESI/MS of an unlabeled sample: calculated = 7217 Da and experimental = 7216 Da.

NMR spectroscopy and data analysis

NMR data were recorded on a Varian INOVA 600 MHz spectrometer equipped with a cryogenic probe, processed using FELIX 2007 (Felix NMR, Inc.), and analyzed using SPARKY3 (Goddard and Kneller, 2001), AutoAssign (Zimmerman et al., 1997), and NMRViewJ (OneMoon Scientific). IST1303-366 backbone resonances were assigned using standard triple resonance experiments (Cavanagh, 2007) from a sample containing 0.4 mM uniformly 13C- and 15N-enriched IST1 in 20 mM sodium phosphate pH 6.2, 25 mM NaCl, 0.1 mM EDTA, 0.1 mM NaN3, 0.5 mM DTT, and 10% D2O. The chemical shifts for IST1 have been deposited in the Biological Magnetic Resonance Bank under accession number 25393.

Chemical shift perturbations induced by ULK3 binding to IST1 were identified by titrating 0.4 mM uniformly 13C- and 15N-enriched IST1 with increasing amounts of unlabeled ULK3 to final stoichiometries of (IST1 : ULK3): 0, 0.25, 0.5, 1.0, 1.1, and 2.0. The complex was in slow exchange on the NMR time scale. Chemical shifts were analyzed in NMRViewJ (OneMoon Scientific), and IST1 resonances that were shifted more than ½ peak width in the bound complex were given a score of ‘+1’. Unperturbed resonances were scored as ‘−1’ and resonances that could not be unambiguously assigned to either category owing to spectral overlap were scored as ‘0’.

Fluorescence polarization

IST1 MIMs peptide (residues 316–366, containing a non-native N-terminal ‘GC’ dipeptide) was expressed and purified as a His-SUMO fusion protein as described above. MIM1 (residues 344–366, containing a non-native, N-terminal cysteine) and MIM2 (residues 316–343, containing a non-native N-terminal ‘GC’ dipeptide) peptides were synthesized, purified, and fluorescently labeled in the University of Utah Peptide Synthesis Core. Briefly, MIM1 and MIM2 peptides were synthesized on an ABI 433 synthesizer (Applied Biosystems, Waltham, MA) with a cysteine at the N-terminus using Fmoc solid phase technology, common protecting groups, and HBTU chemistry on an ABI 433 synthesizer (Applied Biosystems). Both recombinant and synthesized peptides were purified by reversed phase chromatography using acetonitrile/water gradients with 0.1% trifluoroacetic acid in both solvents. Peptide-containing fractions were pooled and dried, then re-dissolved in DMSO. Fluorescent labeling was performed in DMSO at 4°C with approximately 1.3-fold molar excess of Oregon Green 488 maleimide (Life Technologies/Molecular Probes 06,034) dissolved in a 1:1 solution of acetonitrile:DMSO. The reaction progress was monitored by HPLC, and labeled peptides were separated from free dye and residual unlabeled peptides using the same reversed phase conditions described above. Labeled peptide masses were measured by MALDI-TOF-MS at the University of Utah Mass Spectrometry Core facility: dye-labeled MIMs, calculated = 6196 Da and experimental = 6192 Da; dye-labeled MIM1, calculated = 3298 Da and experimental = 3296 Da; and dye-labeled MIM2, calculated = 3483 Da and experimental = 3480 Da. Confirmed peptide fractions were dried under vacuum, redissolved in water, and concentrations were calculated using the absorbance of Oregon Green 488 at 491 nm (Extinction coefficient 83,000 cm−1 M−1 in 50 mM potassium phosphate, pH 9). FP experiments were performed in 60-µl binding reactions in binding buffer: 25 mM Tris, pH 7.2, 150 mM NaCl, 0.1 mg/mL Bovine Serum Albumin (BSA), 0.01% Tween-20, and 1 mM Dithiothreitol (DTT) using 250 pM fluor-labeled IST1 peptides and twofold dilutions of ULK3 proteins. FP was measured using a Tecan Infinite 200 plate reader with excitation at 485 nm and detection at 535 nm. Dissociation constants were calculated by fitting the increase in FP to a 1:1 binding equation using KaleidaGraph (Synergy Software) as described previously (Skalicky et al., 2012). Each binding isotherm was measured at least three times independently, and mean KD values are reported ±SD.

Crystallization and data collection

IST1 protein was mixed in a 1:1 molar ratio with native or SeMet-substituted ULK3 MIT2 protein to a final concentration of 10 mg/ml in 20 mM Tris, pH 8.0, 100 mM NaCl, 2 mM DTT, and 3 mM NaN3. ULK3:IST1 complexes were crystallized at 21°C in sitting drops by mixing equal volumes (2 μl) of protein complex solution and precipitant solution (1.6–1.8 M ammonium sulfate, 0.1 M MES pH 6.4–6.7, 0.01 M CoCl2). Crystals were transferred to a cryoprotectant solution containing precipitant supplemented with 30% glycerol, looped, and flash frozen in liquid nitrogen prior to data collection. X-ray diffraction data were collected remotely (Soltis et al., 2008) at SSRL beamlines 11-1 and 12-2. All data were processed using AutoXDS (Gonzalez and Tsai, 2010; Kabsch, 2010a; 2010b) at SSRL.

Structure determination and refinement

Initial attempts to crystallize ULK3 (MIT)2 (residues 277–449) in complex with both IST1 MIMs (residues 316–366) yielded crystals of a proteolytically truncated complex comprising ULK3 MIT2 and IST1 MIM1 fragments. The structure of this complex was determined using a data set derived from a crystal of SeMet-substituted ULK3 (MIT)2 in complex with IST1 MIMs, in which both components had undergone proteolysis. The SeMet ULK3/IST1 complex was solved in space group P3121 (a = 82.68 Å, b = 82.68 Å, c = 90.15 Å) with single-wavelength anomalous dispersion data at 0.9791 Å (2.1 Å resolution, Figure 1—source data 1). PHENIX (Hybrid Structure Search; HySS) (Afonine et al., 2012; Grosse-Kunstleve and Adams, 2003; McCoy et al., 2004) was used to locate and refine the positions for 3 of 4 possible SeMet sites in ULK3 MIT2. Phases were calculated and used to produce a 3.2 Å electron density map. Models for the three MIT molecules in the asymmetric unit were initially built into the electron density and the ULK3:IST1 models were rebuilt de novo in Coot (Emsley et al., 2010) and refined in PHENIX. The refined SeMet model was then used as an initial molecular replacement search model to determine structures from higher resolution native data sets (Phaser in PHENIX). The protein termini were identified in the proteolyzed structure and used to design new constructs (ULK3 MIT2: residues 359–449; IST1 MIM1 residues 344–366) for further crystallization. ULK3 MIT2 was expressed and purified as a recombinant protein (described above), and IST1 MIM1 was synthesized by the University of Utah Peptide Synthesis Core. The complex of the shorter constructs crystallized in space group R32 (a = 79.12 Å, b = 79.12 Å, c = 96.62 Å) with a single ULK3 MIT2:IST1 MIM1 complex in the asymmetric unit and the crystal diffracted to 1.38 Å resolution (Figure 1—source data 1). This structure is described herein, and data collection and refinement statistics are provided in Figure 1—source data 1. Structure coordinates have been deposited in the RCSB Protein Data Bank under PDB ID 4WZX. Chimera was used to analyze structures and generate figures (Pettersen et al., 2004).

In-cell phosphorylation assays

For experiments shown in Figure 5B, Figure 5—figure supplement 1A, and Figure 7—figure supplement 1C, 293T cells were co-transfected with PEI and plasmids encoding Myc-tagged ESCRT-III proteins and OSF-ULK3 WT, or OSF-ULK3-K44H or empty vector. For IST1, CHMP1A, CHMP1B, and CHMP3 experiments, transfections were performed in a 6-well plate seeded 18–24 hr earlier with 0.25 × 104 293T cells/well with the following plasmid amounts: 500 ng of OSF-ULK3 WT, 1.5 µg of OSF-ULK3 K44H, 1.5 µg Myc-IST1, 1 µg CHMP1A-myc, 1 µg CHMP1B-myc, and 1 µg CHMP3-Myc. Each transfection was brought to a total of 3 µg DNA with empty vector. CHMP4C and CHMP2A experiments were performed using cell lysates from 10-cm dishes seeded at 2.2 × 106 and transfected 18–24 hr later. Transfections contained the following plasmid quantities: 6 µg CHMP4C-Myc, 6 µg CHMP1A-Myc and 3–4 µg OSF-ULK3, 6 µg of OSF-ULK3 K44H, or 6 µg of empty vector. All transfections were brought to a total of 12 µg DNA with empty vector. Cells were harvested 48 hr post-transfection and lysed in buffer containing 50 mM Tris pH 7.2, 150 mM NaCl, 5 mM BME, 0.2% Triton X-100, 10 mM MgCl2 supplemented with DNAse I (Roche) and protease inhibitors (Sigma–Aldrich MOP8340). Cell lysates were clarified as described above. Where noted, 25 µl of each lysate was additionally treated with 40 units of CIP (New England Biolabs, Ipswich, MA) and incubated at 37°C for 1 hr. Gel samples were boiled in Laemmli sample buffer both pre-and post-CIP treatment, resolved by SDS-PAGE, and examined by Western blotting.

Mass spectrometric analyses of phosphorylated IST1 proteins

Ten 10-cm dishes of 293T cells were co-transfected (PEI) with 6 µg of plasmids expressing OSF-ULK3 or OSF-ULK3 K139R (kinase inactive Maloverjan et al., 2010), and 6 µg of Myc-IST1. Transfected cells were harvested after 48 hr and lysed by sonication in 50 mM Tris pH 7.2, 150 mM NaCl, 0.5 mM MgCl2, 5 mM DTT (or BME) in the presence of DNase I (Roche), Phos-Stop (Roche), and mammalian protease inhibitors (Sigma–Aldrich). Cell lysates were clarified by centrifugation at 16,100×g at 4°C for 10 min, and incubated with 75 µl of streptactin resin (IBA-Lifesciences for 2 hr at 4°C. Bound ULK3/IST1 complexes were washed once with lysis buffer containing 500 mM NaCl, three times with lysis buffer (150 mM NaCl), and eluted with lysis buffer containing 10 mM d-desthiobiotin. The OSF-ULK3 K139R/IST1 elution was additionally incubated with CIP (New England Biolabs, Ipswich, MA) at 37°C for 1 hr. Samples were purified prior to mass spectrometry analysis using a C18 ZipTip (Millipore, Temecula, CA) to remove salts and other small molecule contaminants according to the manufacturer's instructions. Proteins were eluted from the ZipTip with three consecutive 0.75 µl washes of 70% methanol, 1% formic acid, and one 1 µl wash of 98% methanol, 1% formic acid, with 2 µl of 1% formic acid added prior to ESI/MS analysis.

ESI/MS analyses of intact proteins were performed using a Quattro-II mass spectrometer (Micromass, Inc. UK). The ZipTip eluant was infused into the instrument at 3 µl/min flow rate. Data were acquired with a cone voltage of 50 eV, spray voltage of 2.8 kV, and scanning from 600 to 1400 Da in 4 s. Scans were accumulated for ∼1 min. Spectra were combined and multiply charged molecular ions were deconvoluted into a molecular mass spectrum using MaxEnt 3.4 software (Micromass, Inc.).

To identify phosphorylation sites, co-purified IST1 and ULK3 proteins were digested in solution with a TPCK-modified trypsin and Lys-C protease mixture (Promega, Madison, WI) or chymotrypsin (Princeton, Adelphia, NJ). Trypsin or chymotrypsin (in 50 mM ammonium bicarbonate) was added to the solution (adjusted to pH 7.9) at a ratio of approximately 1:25 (enzyme: protein). Samples were digested at 37°C overnight with trypsin or for 2–2.5 hr with chymotrypsin.

Immobilized metal affinity chromatography (IMAC) was used to enrich phospho-peptides from the trypsin- and chymotrypsin-digested proteins. The IMAC procedure was performed using SwellGel gallium (III) chelated mini-spin columns (Pierce), with minor modifications to the manufacturer's recommended procedure. Briefly, the trypsin- and chymotrypsin-digested proteins were acidified (pH < 3) with 10% acetic acid. The samples were then incubated on the column for 15 min, washed twice with 50 µl of 0.1% acetic acid, twice with 50 µl of 0.1% acetic acid in 10% acetonitrile, and once with 75 µl of nanopure water. Phosphopeptides were eluted with two 20-µl volumes of 25 mM ammonium bicarbonate (pH 9; adjusted with ammonium hydroxide), followed by 20 µl of 25 mM ammonium bicarbonate in 50% acetonitrile. All three eluant fractions were combined, dried down, and reconstituted in a solution of 5% acetonitrile with 0.1% formic immediately prior to nano-LC-MS/MS analysis.

Both phospho-enriched and un-enriched peptides were analyzed using a nano-LC/MS/MS system equipped with a nano-HPLC pump (2D-ultra, Eksigent, Redwood City, CA) and an ESI-LTQ-FT-ICR mass spectrometer equipped with a nanospray ion source (ThermoElectron Corp., Waltham, MA). Approximately 5 µl of peptide samples were injected onto a dC18 nanobore LC column (75 μm ID × 100 mm length, 3 µm particles, made in house, Atlantis, Waters Corp., Milford, MA). Peptides were separated and eluted over a linear gradient of 5–96% acetonitrile in 0.1% formic acid with a constant total flow rate of 350 nl/min over 78 min. The LTQ-FT-ICR mass spectrometer was operated in the data-dependent acquisition mode with the ‘top 10’ most intense peaks observed in an FT primary scan selected for on-the-fly peptide fragmentation MS/MS acquisitions in the LTQ linear ion trap portion of the instrument. The LTQ linear ion trap was operated with the following parameters: precursor activation time 30 ms and activation Q at 0.25; collision energy at 35%; dynamic exclusion at low mass of 0.1 Da and high mass at 2.1 Da with one repeat count and 10 s duration. Spectra in the LTQ-FT-ICR were acquired from m/z 350 to 1400 Da at 50,000 resolving power with mass accuracies typically within 3 ppm mass error.

Raw data files were processed with BioWorks software (ThermoElectron Corp.) to generate peak lists (DTA). Resulting DTA files from each data acquisition file were searched to identify phosphopeptides against custom databases using the MASCOT search engine (Matrix Science Ltd.; version 2.2.7; in-house licensed). Molecular ions with +1, +2, or +3 charge states determined from an ESI-FTMS primary mass spectrum (LTQ-FT instrument) were typically considered. Searches for trypsin- or chymotrypsin-specific peptide cleavages allowed two missed cleavages, and a mass error tolerance of 5 ppm in the ESI-FT-ICR data and 0.5 Da for MS/MS ions. Peptide modifications included in the searches were oxidation on Met and/or phosphorylation on Ser, Thr, or Tyr residues. Identified peptides were accepted when the MASCOT ion score value exceeded 20, mass errors were less than 5 ppm, and expect values were less than 1. Peptide and phosphopeptide assignments were also manually validated. Sequence coverage of Myc-IST1 was 94%, with identified peptides encompassing 39 out of the 40 Ser and Thr residues. IST1 S4, S99, S153, and S214 phosphorylations were identified in 1, 2, 4, and 1 unique peptides, respectively. Phosphorylation sites were mapped onto the structure of IST1 (PDB ID 3FRR) (Bajorek et al., 2009b) using PyMOL (Version 1.3, Schrödinger, LLC, New York, NY).

Thymidine–nocodazole block

Cells were incubated in 2 mM thymidine DMEM for 18 hr, washed with PBS, released into complete DMEM for 4 hr, and arrested in mitosis using DMEM containing 50 ng/ml nocodazole. Mitotic cells were collected the next day by shake-off, washed in PBS, and lysed in sample buffer. Asynchronous vehicle-treated (DMSO) cultures were lysed at equivalent time points. For siRNA treatments, cell synchronization was initiated 24 hr after the second transfection. Where indicated, the Aurora B inhibitor ZM447439 (Santa Cruz Biotechnology, Dallas, TX) was used at 1 μM final concentration.

MHC I down-regulation assays

HeLa cells stably expressing KSHV-K3 (KK3) were a kind gift from Prof Paul Lehner (University of Cambridge, UK). HeLa KK3 cells (Hewitt et al., 2002) were seeded in a 12-well plate and transfected with siRNA (final concentration 100 nM) as described above. 24 hr after the second siRNA transfection, cells were harvested with PBS 0.5 mM EDTA, washed once in cold PBS, and incubated with PBS containing 2% serum and a FITC-conjugated α-MHC-I antibody (W6/32 clone, AbD Serotec) for 1 hr at 4°C. After washing with PBS 2% serum, cells were resuspended and fixed in 4% paraformaldehyde. Surface MHC-I staining was analyzed by flow cytometry on a FACS-Calibur (Becton–Dickinson, UK).

Tetherin degradation assay

HT1080/THN-HA and HT1080/THN-HA K5 have been previously described (Pardieu et al., 2010). Cells were seeded in 12-well plates and transfected with siRNA (final concentration 100 nM) as described above. 72 hr after the first siRNA transfection, cells were harvested with PBS 0.5 mM EDTA and resuspended in sample buffer. Total Tetherin-HA levels were analyzed by Western blot using α-HA and α-HSP90 antibodies, and visualized using Li-Cor secondary antibodies.

HIV infectivity

293T cells were transfected with 100 nM of siRNA as described above. 48 hr later, cells were co-transfected with an additional 100 nM of siRNA and 300 ng of HIV pNL/HXB provirus using Lipofectamine 2000. After 48 hr, indicator HeLa-TZM-bl cells (CD4+, CXCR4+, CCR5+, HIV-1 LTR-LacZ) were infected with 100 µl of harvested supernatant from 293T cells. After an additional 48 hr, β-galactosidase activity in cell lysates was measured using the chemiluminescent detection reagent Galacto-Star (Applied Biosystems). In parallel, culture supernatants collected 48 hr after initial transfection were clarified by low-speed centrifugation, and virions were obtained through a 20% sucrose cushion (14,000 rpm, 2 hr). Viral protein contents in cells and particle lysates were analyzed by Western blot using α-Gag antibody.

Immunofluorescence

Cells were fixed with 4% PFA (20 min) or 0.1% Tween-20, 2% PFA in PBS (10 min), and 100% methanol (2 min). Cells were blocked with PBS 1% BSA or 3% FCS in PBS, stained with the indicated primary antibodies and Alexa 594, 488, or 647 conjugated secondary antibodies (Invitrogen). Nuclei were visualized with Hoechst 33258. Coverslips were mounted in Mowiol. Samples were imaged using an AOBS SP2 confocal microscope (Leica, 60 × 1.4 N.A. oil-immersion objective). The AOTF was used to collect relevant narrow emission-λ windows for each fluorophore. Cells connected by midbodies were identified following tubulin staining, excluding multinucleated cells. For Figure 4 and Figure 4—figure supplement 1, data were collected using an Eclipse Ti-E Inverted CSU-X1 Spinning Disk Confocal (Nikon, Japan) equipped with an Ixon3 EM-CCD camera (Andor, UK). Images were acquired in series of 0.1 µm-spaced Z-stacks with a 100x objective. Deconvolution of 3D stacks was done using AutoQuant X3 Deconvolution Software (Media Cybernetics, Rockville, MD); projections were obtained using NIS-Elements Ar Microscope Imaging Software and merged using Photoshop.

Live imaging

HeLa cells stably expressing YFP/mCherry-Tubulin and/or YFP-LAP2β were seeded on poly-L-lysine coated glass-bottomed 24-well plates (MatTek) and transfected with siRNA as specified. Except where indicated, 24 hr after the second transfection cells were imaged for 24 hr on a Nikon Ti-Eclipse wide-field inverted microscope (Nikon 40 × 0.75 N.A. dry objective lens) equipped with Perfect Focus system and housed in a 37°C chamber (Solent Scientific, UK) fed with 5% CO2. Multiple fields of view were selected at various XY coordinates, where 3 slices were captured at a 1.25 μm Z-spacing. Images were acquired every 10 min using a CoolSnap HQ2 CCD camera (Photometrics, Tucson, AZ), controlled by NIS-Elements software. Frame-by-frame analysis was performed within NIS-Elements, where abscission time was quantified as the period between midbody formation and severing. Midbody formation was scored as the first frame where two separate cells connected by a compacted bundle of tubulin and fully reformed nuclei were observed. YFP-LAP2β expressing cells were imaged for 72 hr, and chromatin bridge resolution time was scored as the time between nuclear envelope reassembly and bridge resolution. Intercellular bridges that regressed or left the field of view were excluded. For experiments with Aurora B inhibitor, cells at midbody stage were identified prior to treatment with 1 μM ZM447439 (Santa Cruz Biotechnology), when imaging was initiated. Only cells at midbody stage where followed and time to abscission was scored following the same criteria as above. Selected TIF files were exported and assembled in Adobe Photoshop to generate movies with a 200-ms delay between each frame.

Statistics

All statistical significance was tested using the Mann–Whitney two-tailed U test: ***p < 0.0001, **p = 0.0003, *p < 0.05, ns p > 0.1.

References

  1. 1
  2. 2
  3. 3
  4. 4
    Knowing when to cut and run: mechanisms that control cytokinetic abscission
    1. M Agromayor
    2. J Martin-Serrano
    (2013)
    Trends in Cell Biology, 10.1016/j.tcb.2013.04.006.
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
    Protein NMR spectroscopy: principles and practice
    1. J Cavanagh
    2. WJ Fairbrother
    3. AG Palmer III
    4. M Rance
    5. NJ Skelton
    (2007)
    San Diego: Elsevier Academic Press.
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
    Features and development of Coot
    1. P Emsley
    2. B Lohkamp
    3. WG Scott
    4. K Cowtan
    (2010)
    Acta crystallographica. Section D, Biological crystallography 66:486–501.
    https://doi.org/10.1107/S0907444910007493
  21. 21
    SPARKY 3
    1. TD Goddard
    2. DG Kneller
    (2001)
    San Francisco: University of California.
  22. 22
    —autoxds_script
    1. A Gonzalez
    2. Y Tsai
    (2010)
    http://smb.slac.stanford.edu/facilities/software/xds/, —autoxds_script.
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
    XDS
    1. W Kabsch
    (2010a)
    Acta Crystallographica. Section D, Biological Crystallography 66:125–132.
    https://doi.org/10.1107/S0907444909047337
  36. 36
    Integration, scaling, space-group assignment and post-refinement
    1. W Kabsch
    (2010b)
    Acta Crystallographica. Section D, Biological Crystallography 66:133–144.
    https://doi.org/10.1107/S0907444909047374
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
    Simple algorithm for a maximum-likelihood SAD function
    1. AJ McCoy
    2. LC Storoni
    3. RJ Read
    (2004)
    Acta crystallographica. Section D, Biological crystallography 60:1220–1228.
    https://doi.org/10.1107/S0907444904009990
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
    Structural basis for budding by the ESCRT-III factor CHMP3
    1. T Muziol
    2. E Pineda-Molina
    3. RB Ravelli
    4. A Zamborlini
    5. Y Usami
    6. H Göttlinger
    7. W Weissenhorn
    (2006)
    Developmental Cell 10:821–830.
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
    GWAS meta-analysis and replication identifies three new susceptibility loci for ovarian cancer
    1. PD Pharoah
    2. YY Tsai
    3. SJ Ramus
    4. CM Phelan
    5. EL Goode
    6. K Lawrenson
    7. M Buckley
    8. BL Fridley
    9. JP Tyrer
    10. H Shen
    11. R Weber
    12. R Karevan
    13. MC Larson
    14. H Song
    15. DC Tessier
    16. F Bacot
    17. D Vincent
    18. JM Cunningham
    19. J Dennis
    20. E Dicks
    21. Australian Cancer Study
    22. Australian Ovarian Cancer Study Group
    23. KK Aben
    24. H Anton-Culver
    25. N Antonenkova
    26. SM Armasu
    27. L Baglietto
    28. EV Bandera
    29. MW Beckmann
    30. MJ Birrer
    31. G Bloom
    32. N Bogdanova
    33. JD Brenton
    34. LA Brinton
    35. A Brooks-Wilson
    36. R Brown
    37. R Butzow
    38. I Campbell
    39. ME Carney
    40. RS Carvalho
    41. J Chang-Claude
    42. YA Chen
    43. Z Chen
    44. WH Chow
    45. MS Cicek
    46. G Coetzee
    47. LS Cook
    48. DW Cramer
    49. C Cybulski
    50. A Dansonka-Mieszkowska
    51. E Despierre
    52. JA Doherty
    53. T Dörk
    54. A du Bois
    55. M Dürst
    56. D Eccles
    57. R Edwards
    58. AB Ekici
    59. PA Fasching
    60. D Fenstermacher
    61. J Flanagan
    62. YT Gao
    63. M Garcia-Closas
    64. A Gentry-Maharaj
    65. G Giles
    66. A Gjyshi
    67. M Gore
    68. J Gronwald
    69. Q Guo
    70. MK Halle
    71. P Harter
    72. A Hein
    73. F Heitz
    74. P Hillemanns
    75. M Hoatlin
    76. E Høgdall
    77. CK Høgdall
    78. S Hosono
    79. A Jakubowska
    80. A Jensen
    81. KR Kalli
    82. BY Karlan
    83. LE Kelemen
    84. LA Kiemeney
    85. SK Kjaer
    86. GE Konecny
    87. C Krakstad
    88. J Kupryjanczyk
    89. D Lambrechts
    90. S Lambrechts
    91. ND Le
    92. N Lee
    93. J Lee
    94. A Leminen
    95. BK Lim
    96. J Lissowska
    97. J Lubiński
    98. L Lundvall
    99. G Lurie
    100. LF Massuger
    101. K Matsuo
    102. V McGuire
    103. JR McLaughlin
    104. U Menon
    105. F Modugno
    106. KB Moysich
    107. T Nakanishi
    108. SA Narod
    109. RB Ness
    110. H Nevanlinna
    111. S Nickels
    112. H Noushmehr
    113. K Odunsi
    114. S Olson
    115. I Orlow
    116. J Paul
    117. T Pejovic
    118. LM Pelttari
    119. J Permuth-Wey
    120. MC Pike
    121. EM Poole
    122. X Qu
    123. HA Risch
    124. L Rodriguez-Rodriguez
    125. MA Rossing
    126. A Rudolph
    127. I Runnebaum
    128. IK Rzepecka
    129. HB Salvesen
    130. I Schwaab
    131. G Severi
    132. H Shen
    133. V Shridhar
    134. XO Shu
    135. W Sieh
    136. MC Southey
    137. P Spellman
    138. K Tajima
    139. SH Teo
    140. KL Terry
    141. PJ Thompson
    142. A Timorek
    143. SS Tworoger
    144. AM van Altena
    145. D van den Berg
    146. I Vergote
    147. RA Vierkant
    148. AF Vitonis
    149. S Wang-Gohrke
    150. N Wentzensen
    151. AS Whittemore
    152. E Wik
    153. B Winterhoff
    154. YL Woo
    155. AH Wu
    156. HP Yang
    157. W Zheng
    158. A Ziogas
    159. F Zulkifli
    160. MT Goodman
    161. P Hall
    162. DF Easton
    163. CL Pearce
    164. A Berchuck
    165. G Chenevix-Trench
    166. E Iversen
    167. AN Monteiro
    168. SA Gayther
    169. JM Schildkraut
    170. TA Sellers
    (2013)
    362–370, Nature Genetics, 45, 370e1-2, 10.1038/ng.2564.
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65

Decision letter

  1. Mohan Balasubramanian
    Reviewing Editor; University of Warwick, United Kingdom

eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.

Thank you for sending your work entitled "ULK3 regulates cytokinetic abscission by phosphorylating ESCRT-III proteins" for consideration at eLife. Your article has been favorably evaluated by Tony Hunter (Senior Editor) and three reviewers, one of whom is a member of our Board of Reviewing Editors.

The Reviewing Editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing Editor has assembled the following comments to help you prepare a revised submission.

The referees’ comments are appended verbatim below. We have also specified the points that need to be addressed (with experiments or text changes).

Referee 1:

This is an interesting paper by Martin-Serrano and colleagues on the mechanism of cytokinetic abscission. They identify a protein kinase, ULK3 that binds a number of components of the ESCRT III com-lex. ULK3 is the second kinase (after Aurora B) to enter into this pathway. Abscission happens more rapidly in cells defective in ULK3 and therefore the authors hypothesize that ULK3 is part of the abscission checkpoint that delays abscission until lagging chromosomes are fully segregated and until NPC are properly formed. ULK3 regulates the timing of abscission through phosphorylation and modulation of function of a member of the ESCRT complex protein IST1. ULK3 also functions with CHMP4C to regulate timing of abscission.

1) There is a large body of work in this paper and some important conclusions as well. My main concern stems from how the experiments are done in general, in that the entire study depends on over expression and siRNA based knockdown. In particular all protein-protein interactions have been performed with over expressed ULK3 and localization also done with over expressed ULK3. I think with genome editing working very efficiently through the suite of approaches (ZFN, TALEN, CRISPR/CAS9), I would want to see them make ULK3-HA or ULK3GFP in cell lines expressed off the native promoter to localize the protein and perform immunoprecipitations (for example see the Drubin lab papers on endocytosis in mammalian cells).

It is essential that this point is addressed either with a cell line expressing a chromosomally tagged ULK3 or the use of a ULK3 antibody, since all three referees have raised this point.

2) Similarly, given that ULK3 performs a checkpoint function via IST1 and CHMP4C (i.e. ULK3 is likely non-essential for growth and cell division), they should be also able to make a full deletion of ULK3 in cell lines to determine the precise phenotype. Having a precise deletion will also allow them to address the relationship between ULK3 and Aurora B (parallel vs. linear pathways) and ULK3 and CHMP4C more convincingly. They might also find that ULK3 deletion does not survive, in which case they would have unearthed something new.

You do not have to do this; however, you need to address the issue concerning Aurora B which is pointed out by all three referees.

Thus, despite the fact that the paper is full of very interesting findings, some more precise approaches will fortify the conclusions.

Referee 2:

In this manuscript, Caballe et al. report the identification of the kinase ULK3 as a novel regulator of abscission. They show that ULK3 directly binds and phosphorylates several ESCRT-III subunits, and provide a detailed structural characterization of the interactions between the MIT domains of ULK3 and the MIM domains of ESCRT-III subunit IST1. They further show that ULK3 is required to delay abscission in response to the depletion of a nucleoporin (NUP153), to the release of mechanical midbody tension, and to the presence of chromosome bridges at the cleavage plane. The authors further identify ULK3-dependent phosphorylation sites on IST1, which contribute to the regulation of abscission timing, and they show that ULK3 phosphorylates CHMP4C to mediate the abscission delay. Based on these data, the authors propose that ULK3 is a regulator of a previously identified "abscission checkpoint" that monitors chromosome segregation and nuclear pore integrity. Overall, the manuscript presents high quality data and convincing interpretation. The new insights into the regulation of abscission are very interesting and relevant for a broad cell biological readership.

Specific comments:

1) The authors show that depletion of ULK3 leads to premature resolution of anaphase chromosome bridges and use this as an argument that ULK3 functions in a previously identified Aurora B-dependent "abscission checkpoint" (Steigemann et al., 2009). The previous study, however, reported that loss-of-function of the Aurora B-dependent "abscission checkpoint" results in cleavage furrow regression rather than in premature resolution of chromosome bridges. The authors explain the different phenotypes by proposing that ULK3 functions downstream of Aurora B. There are, however, no data directly supporting this interpretation and ULK3 could also have a function independent of Aurora B. The authors should rephrase the Discussion accordingly.

It is essential you do this, since all three referees make this point.

2) The authors show that overexpressed HA-ULK3 co-localizes with IST1, either at the Flemming body (Figure 4B) or at midbody rings (Figure 4–figure supplement 1C). As the overexpression of HA-ULK3 may potentially result in its mislocalization, it would be important to validate this observation by staining with antibodies against endogenous ULK3 in unperturbed conditions. In addition, quantification and statistical data analysis should be added to the ULK3 localization experiments shown in Figure 4B and Figure 4–figure supplement 1C.

It is essential you address this, since all three referees have asked for this.

Referee 3:

In this study, Caballe et al., describe the role of a novel protein kinase, ULK3, in the regulation of cytokinetic abscission. Using an impressive range of experimental approaches, this study characterizes ULK3 and dissects its interplay with ESCRT-III proteins as key regulators of abscission. An especially tight interaction was found between ULK3 and the ESCRT-III component IST1, and the authors determined the crystal structure of the ULK3 MIT2-IST1 MIM1 complex at 1.4 Å resolution. Importantly, by invoking a novel kinase as a central regulatory node, this study substantially develops our understanding of the poorly characterized abscission checkpoint. Considering the importance of cytokinetic/abscission fidelity in maintenance of genome integrity and prevention of tumorigenesis, this manuscript is of potential interest to a broad readership.

However, even though this study brings forward numerous exciting observations regarding ULK3 and ESCRT-III proteins, it does not always manage to combine these observations into a coherent story with a clear-cut molecular mechanism of action. Furthermore, the manuscript fails to relate ULK3 function to existing literature describing the abscission checkpoint and implicating Aurora B and downstream components.

Specific comments:

1) The authors state that ULK3 is part of the Aurora B-mediated abscission checkpoint. If they want to maintain this statement they should further explore the ULK3-Aurora B relationship. Using similar nocodazole-release experiments to those shown in Figure 7–figure supplement 1, the authors have previously concluded that the mobility shift of CHMP4C during mitosis (due to phosphorylation) was dependent on Aurora B activity (PMID:22422861; Figure 4D-I). In turn, CHMP4C phosphorylation by Aurora B was found to depend on the 'INS' region. Using the same setup in the current study, the authors find that deleting the 'INS' region has no effect on CHMP4C phosphorylation during mitosis, with ULK3 being the main regulator of mitotic phosphorylation in the current study (Figure 7E). How do the authors explain this apparent discrepancy? To this end, and to mechanistically link the current study with existing literature, the authors should explore the relationship between Aurora B and ULK3 in more detail. Does ULK3 control interaction of Aurora B with CHMP4C? Does Aurora B provide the additional phosphorylation on IST1? This can be addressed using Aurora B inhibitors.

This point needs to be addressed with experiments as all referees have raised this.

2) The live imaging described in this study was performed by taking 3 z sections at 1.25μM intervals, and imaging every 10 minutes. This appears very little when considering the mildness of ULK3 phenotypes (with the mean difference sometimes as little as 20 minutes), the apparent variation between experiments (NT control mean values ranging from 80 to 100 minutes) and the fact that intercellular bridges can move significantly in Z, thus temporarily moving out of the plane of focus and obscuring time of abscission. Another consequence is poor temporal alignment of cells as exemplified in Figure 2–figure supplement 1 (compare the t=0 time point for the non-targeting vs. ULK3 siRNAs in panel D; these cells are very different). To give the reader a better indication of the phenotypes involved, mean abscission time and associated standard deviation for important phenotypes should be mentioned in the Results text, as should the imaging frequency.

This point is important and needs to be validated with experiments.

3) The data relating to cell density (Figure 2E) are very interesting as they hint towards a role for ULK3 in tension-dependent abscission control, but they complicate interpretations of the other live imaging panels. These tension effects are larger (120min vs. 70min) than most other ULK3 live imaging phenotypes in Figure 2 and 3 (with only Figure 3B exceeding this). The authors need to describe whether and how cell density, cell mobility and other tensile variables are considered and excluded as possible contributors to the phenotypes described in the other figure panels.

This requires careful explanation, but experiments are not required.

4) ULK3-dependent regulation of ESCRT-III subunits by phosphorylation is potentially one of the most exciting points of the study. However, in the current presentation, this regulation is incoherent and lacks mechanistic depth. For example, the authors describe ULK3 dependent phosphorylation of IST1, and identify 4 phosphorylation sites in IST1. However, it is unclear which of these are attributed to ULK3 and which are involved in abscission checkpoint signaling, complicating interpretation of results with the 4SA/E mutants in relation to ULK3. The authors should assess and clarify whether all 4 sites are ULK3 dependent, and if not, which ones are. This analysis could be done using in vitro kinase assays on recombinant proteins or by purifying IST1 from ULK3 depleted cells, followed by phospho-MS/MS analysis. Have the authors analyzed the single SA mutants? This is important since IST1 phospho-mutant phenotypes do not mimic ULK3 phenotypes, with ULK3 overexpression only mildly delaying abscission (Figure 3), but the IST1 4SE showing strong effects on abscission and multinucleation (Figure 6B). This discrepancy should be addressed.

Furthermore, does the IST1 4SA mutant mimic ULK3 depletion with respect to tension control of abscission or abscission in presence of chromatin bridges? Conversely, can the IST1 4SE mutant sustain checkpoint arrest in the absence of ULK3? (This is essential).

5) Overexpression of ULK3 alters the localization frequencies of IST1 and CHMP4B to the Flemming body. The authors should complement with localization studies in ULK3-depleted cells to rule out overexpression-induced artifacts.

This is essential.

6) A very interesting lead is provided by evidence that phosphorylated IST1 shows remarkably increased interaction with VPS4 and LIP5, but the implications of this exciting observation are not explored in a cellular context. This should be done, especially when considering the central position of VPS4 in the abscission checkpoint and ESCRT-III dynamics in general. Is VPS4 localization affected in the IST1 4SE mutant, and where does the 4SE mutant itself localize in normal cells? Does it localize to the Flemming body, as could be expected from Figure 4? Furthermore, the position of the IST1 phosphorylation sites outside the MIM motifs leads the authors to suggest the existence of a bridging factor, but to lend more credibility to this statement the IST1 4SE mutant should be included in the yeast-2-hybrid setup shown in Figure 6–figure supplement 1. Considering the published interaction between ANCHR, CHMP4C and VPS4, the authors should explore whether IST1 4SE, ANCHR and CHMP4C associate, and if so, whether this is stronger than for the WT IST1.

You do not have to do this, since it is beyond the scope of a study on IST1.

7) Furthermore, the relation between ULK3 and other ESCRT-III subunits should be explored further to see whether there is a more general trend in ULK3 effects on ESCRT-III: Does ULK3 overexpression similarly relocalize other phosphorylation targets such as CHMP1A, CHMP1B and CHMP2A to the Flemming body?

It is not essential that you do this, since the paper is mainly about IST1.

8) Figure 3C and D provide a critical argument that actual kinase activity is required for ULK3 function during abscission. However, Figure 3D suggests that association of kinase dead ULK3 (K44H) with ESCRT-III subunits is more tight than the WT ULK3 (2-10 fold higher beta-galactosidase activity), which could have major effects on cellular function of ULK3 and ESCRT-III. Since Figure 1C suggests that kinase activity does not affect IST1 interaction with ULK3, is it possible that K44H affects ULK3 structure beyond its effect on kinase activity? This should be discussed. Also, since IST1 is a major component of this study, Figure 3C should include IST1 interaction data.

This is mostly about rewriting with some data that you might already have.

9) The proposed ULK3-CHMP4C link is not entirely convincing and seems almost like an afterthought. These proteins do not interact, and the authors do not explore the significance of the phosphorylation event in any detail (e.g. no mapping of target sites, no ULK3-specific phosphoCHMP4C mutants to see if this affects abscission timing etc.). On the other hand, several datasets points towards interplay between CHMP4C and ULK3 that are left undiscussed: For example, ULK3 KD seems to affect the overall level of CHMP4C (Figure 2B). Can the authors explain this? Does ULK3 control CHMP4C stability, and can this be rescued by WT, K44M or M434D ULK3 alleles? Additionally, ULK3 SDS-PAGE mobility is altered upon CHMP4C knockdown (Figure 5E). Could this reflect altered ULK3 modifications, such as phosphorylation? This should be discussed. In the absence of further data the authors should play down their statements about the ULK3-CHMP4C link (This part could be deleted).

https://doi.org/10.7554/eLife.06547.047

Author response

Referee 1:

1) There is a large body of work in this paper and some important conclusions as well. My main concern stems from how the experiments are done in general, in that the entire study depends on over expression and siRNA based knock down. In particular all protein-protein interactions have been performed with over expressed ULK3 and localization also done with over expressed ULK3. I think with genome editing working very efficiently through the suite of approaches (ZFN, TALEN, CRISPR/CAS9), I would want to see them make ULK3-HA or ULK3GFP in cell lines expressed off the native promoter to localize the protein and perform immunoprecipitations (for example see the Drubin lab papers on endocytosis in mammalian cells).

It is essential that this point is addressed either with a cell line expressing a chromosomally tagged ULK3 or the use of a ULK3 antibody, since all three referees have raised this point.

Regarding the reviewer’s concern with our experimental strategy of using siRNA followed by rescue with siRNA-resistant constructs (Figures 3A and 3E), we would emphasize that this approach remains a robust experimental approach in which functional studies can exclude off-target effects. Nonetheless, we have taken the reviewer’s advice and used the CRISPR-Cas9 system to delete the ULK3 gene. New data in Figure 2E shows that full deletion of ULK3 in two separate cell clones results in abscission checkpoint failure in response to disrupted nucleopores. This result is entirely consistent with our siRNA data.

We have also added new data to strengthen the conclusion that ULK3 and IST1 interact at physiological levels. In particular we have fused ULK3 to the R113G mutant of the E. coli BirA biotin ligase, which biotinylates lysine residues of proteins in close proximity. The BirA-ULK3 construct was then stably expressed in HeLa cells that were supplemented with biotin and subjected to streptavidin precipitation, demonstrating the specific association of BirA-ULK3 with the endogenous IST1 (Figure 1C). This new data is consistent with our result in Figure 1B, showing the interaction of HA-IST1 with the endogenous ULK3.

Lastly, we have now identified a commercial antibody that detects ULK3 in immunofluorescence imaging experiments. The new data in Figure 2B using this antibody shows the localization of endogenous ULK3 at the central region of the midbody. We also show in Figure 7C that endogenous ULK3 co-localizes at the midbody with GFP-CHMP4C expressed at physiological levels, thus further supporting a role for ULK3 in cytokinetic abscission and a functional association between ULK3 and CHMP4C.

2) Similarly, given that ULK3 performs a checkpoint function via IST1 and CHMP4C (i.e. ULK3 is likely non-essential for growth and cell division), they should be also able to make a full deletion of ULK3 in cell lines to determine the precise phenotype. Having a precise deletion will also allow them to address the relationship between ULK3 and Aurora B (parallel vs. linear pathways) and ULK3 and CHMP4C more convincingly. They might also find that ULK3 deletion does not survive, in which case they would have unearthed something new.

You do not have to do this; however, you need to address the issue concerning Aurora B which is pointed out by all three referees.

As explained above, our new data show that cell lines deleted of ULK3 survive, but they do not sustain the abscission checkpoint activity. The fact that these cells are viable is consistent with our model that ULK3’s main function is to regulate the abscission machinery.

As requested by the three reviewers, we have addressed further the functional relationship between ULK3 and Aurora B and we now provide compelling evidence that abscission regulation by ULK3 requires Aurora B. More specifically, we show that the Aurora B inhibitor ZM447439 abrogates the abscission delays induced by ULK3 overexpression (Figure 7F). We also show that the treatment with the Aurora B inhibitor induces alterations in the mitotic phosphorylation of IST1 (Figure 7G), a phenotype that is reminiscent of the effects in IST1 phosphorylation observed in ULK3-depleted cells (Figure 5E). Lastly, we have further analysed midbodies in the context of nucleopore disruption, showing that active Aurora B persists at the midbody in ULK3-depleted cells (Figure 2–figure supplement 1E). Altogether, these new lines of evidence support our original model whereby ULK3 is a downstream component of the Aurora B-dependent abscission checkpoint.

Referee 2:

In this manuscript, Caballe et al. report the identification of the kinase ULK3 as a novel regulator of abscission. They show that ULK3 directly binds and phosphorylates several ESCRT-III subunits, and provide a detailed structural characterization of the interactions between the MIT domains of ULK3 and the MIM domains of ESCRT-III subunit IST1. They further show that ULK3 is required to delay abscission in response to the depletion of a nucleoporin (NUP153), to the release of mechanical midbody tension, and to the presence of chromosome bridges at the cleavage plane. The authors further identify ULK3-dependent phosphorylation sites on IST1, which contribute to the regulation of abscission timing, and they show that ULK3 phosphorylates CHMP4C to mediate the abscission delay. Based on these data, the authors propose that ULK3 is a regulator of a previously identified "abscission checkpoint" that monitors chromosome segregation and nuclear pore integrity. Overall, the manuscript presents high quality data and convincing interpretation. The new insights into the regulation of abscission are very interesting and relevant for a broad cell biological readership.

Specific comments:

1) The authors show that depletion of ULK3 leads to premature resolution of anaphase chromosome bridges and use this as an argument that ULK3 functions in a previously identified Aurora B-dependent "abscission checkpoint" (Steigemann et al., 2009). The previous study, however, reported that loss-of-function of the Aurora B-dependent "abscission checkpoint" results in cleavage furrow regression rather than in premature resolution of chromosome bridges. The authors explain the different phenotypes by proposing that ULK3 functions downstream of Aurora B. There are, however, no data directly supporting this interpretation and ULK3 could also have a function independent of Aurora B. The authors should rephrase the Discussion accordingly.

It is essential you do this, since all three referees make this point.

As discussed above we provide three new pieces of information supporting the idea that ULK3 functions downstream of Aurora B in the regulation of abscission.

2) The authors show that overexpressed HA-ULK3 co-localizes with IST1, either at the Flemming body (Figure 4B) or at midbody rings (Figure 4–figure supplement 1C). As the overexpression of HA-ULK3 may potentially result in its mislocalization, it would be important to validate this observation by staining with antibodies against endogenous ULK3 in unperturbed conditions. In addition, quantification and statistical data analysis should be added to the ULK3 localization experiments shown in Figure 4B and Figure 4–figure supplement 1C.

It is essential you address this, since all three referees have asked for this.

As noted above, we have now shown that endogenous ULK3 localizes to the central region of the midbody. Nevertheless, we thank the reviewer for pointing the lack of clarity in our description of the localization of overexpressed HA-ULK3. This construct localizes to both the Flemming body (42% of midbodies analyzed) and the midbody rings (58%). We now have added a panel in both Figure 4 and Figure 4–figure supplement 1C to show these localizations and we have included the corresponding quantification data in the figure legend. We have also scored the localization of the endogenous ULK3, finding a Flemming body localization in 93% of the cases vs 7% of cases showing localization to the midbody rings. Therefore overexpressed HA-ULK3 is not mislocalized although it has a higher tendency to localize to the midbody rings. Our interpretation of this difference is that the endogenous ULK3 likely shuttles between the Flemming body and the rings, whereas the overexpressed protein is more stabilized at the rings.

Owing to technical limitations, the co-localization of endogenous ULK3 and IST1 cannot be determined because both antibodies were raised in rabbits.

Referee 3:

Even though this study brings forward numerous exciting observations regarding ULK3 and ESCRT-III proteins, it does not always manage to combine these observations into a coherent story with a clear-cut molecular mechanism of action. Furthermore, the manuscript fails to relate ULK3 function to existing literature describing the abscission checkpoint and implicating Aurora B and downstream components.

Specific comments:

1) The authors state that ULK3 is part of the Aurora B-mediated abscission checkpoint. If they want to maintain this statement they should further explore the ULK3-Aurora B relationship. Using similar nocodazole-release experiments to those shown in Figure7–figure supplement 1, the authors have previously concluded that the mobility shift of CHMP4C during mitosis (due to phosphorylation) was dependent on Aurora B activity (PMID:22422861; Figure 4D-I). In turn, CHMP4C phosphorylation by Aurora B was found to depend on the 'INS' region. Using the same setup in the current study, the authors find that deleting the 'INS' region has no effect on CHMP4C phosphorylation during mitosis, with ULK3 being the main regulator of mitotic phosphorylation in the current study (Figure 7E). How do the authors explain this apparent discrepancy? To this end, and to mechanistically link the current study with existing literature, the authors should explore the relationship between Aurora B and ULK3 in more detail. Does ULK3 control interaction of Aurora B with CHMP4C? Does Aurora B provide the additional phosphorylation on IST1? This can be addressed using Aurora B inhibitors.

This point needs to be addressed with experiments as all referees have raised this.

As discussed above, our new data demonstrate a functional connection between ULK3 and Aurora B, and support the notion that ULK3 is a downstream effector of Aurora B in the abscission checkpoint. This connection is further supported by our observation that mitotic phosphorylation of IST1 is reduced in cells treated with Aurora B inhibitor. This experiment shows that this additional phosphorylation of IST1 requires Aurora B but does not show that Aurora B itself phosphorylates IST1. We believe that a more likely alternative is that Aurora B activates a downstream kinase, such as ULK3, that phosphorylates IST1.

Based on the reviewer’s comments we realized that further clarification is needed to answer the apparent discrepancy on the Aurora B requirement for CHMP4C phosphorylation. It should be pointed out that we have looked at CHMP4C phosphorylation with two different approaches, by looking at changes in mobility using SDS-PAGE and by performing in vitro phosphorylation assays with recombinant kinases. These methods complement each other although it is well known that phosphorylation events do not result necessarily in mobility shifts. Our published data and the results in this manuscript indicate that Aurora B and ULK3 phosphorylate CHMP4C at separate sites with different consequences on the mobility of this protein in SDS-PAGE. In this context, we previously observed that the INS region is required for in vitro phosphorylation of CHMP4C by recombinant Aurora B (PMID:22422861; Figure 4G-H), but we never showed that this insertion is required for the mobility shift observed in mitotically arrested cells. We have now done these experiments showing that deletion of the INS region does not alter the mobility shift of CHMP4C in mitosis whereas ULK3 depletion inhibits this shift (Figure 7H). The fact that Aurora B inhibitors reduce the mitotic phosphorylation of CHMP4C as measured by mobility shifts (PMID:22422861; Figure 4F) is now better explained by the new data indicating that ULK3 is a downstream effector of Aurora B, thus suggesting that Aurora B inhibition is likely to have a knock-on effect on ULK3 activity thus preventing the mitotic phosphorylation of CHMP4C. We have now included a model as the striking image to clarify this point.

Lastly, we agree with the reviewer that regulation of the Aurora B/CHMP4C interaction by ULK3 is possible. However, the Aurora B/CHMP4C interaction is not detectable by conventional methods other than in vitro kinase assays. This is not entirely surprising as the interaction of Aurora B with its physiological substrates is thought to be transient and these physical interactions have been rarely reported in the literature.

2) The live imaging described in this study was performed by taking 3 z sections at 1.25μM intervals, and imaging every 10 minutes. This appears very little when considering the mildness of ULK3 phenotypes (with the mean difference sometimes as little as 20 minutes), the apparent variation between experiments (NT control mean values ranging from 80 to 100 minutes) and the fact that intercellular bridges can move significantly in Z, thus temporarily moving out of the plane of focus and obscuring time of abscission. Another consequence is poor temporal alignment of cells as exemplified in Figure 2–figure supplement 1 (compare the t=0 time point for the non-targeting vs. ULK3 siRNAs in panel D; these cells are very different). To give the reader a better indication of the phenotypes involved, mean abscission time and associated standard deviation for important phenotypes should be mentioned in the Results text, as should the imaging frequency.

This point is important and needs to be validated with experiments.

We disagree with the reviewer regarding the “mildness” of the ULK3 phenotypes. We emphasize the fact that these differences are highly significant and the magnitude of this difference is equivalent to the effects observed in CHMP4C-depleted cells, thus highlighting the biological relevance of this phenotype. Regarding the apparent variation between experiments, this reflects the normal day-to-day variation in abscission time that is observed in HeLa cells and our experiments are specifically designed to neutralize this issue. Crucially, equivalent cell cultures were treated in parallel with the different siRNAs, thus excluding cell density as a source of uncontrolled variability. Moreover, the data were acquired in parallel using a motorized microscope to ensure that the differences in abscission time are meaningful. Importantly, the small fraction of midbodies that moved out of the plane of focus were excluded from the analysis. Regarding the temporal alignment of cells, it is worth noting that midbody formation occurs less than 10 minutes after the end of anaphase. Hence, the apparent differences pointed by the reviewer represent stages that are very close in time. Moreover, to ensure that the differences observed are not due to potential artifacts associated with the scoring of midbody formation, we have re-analyzed an entire figure (including three independent experiments) using the end of anaphase instead of midbody formation as t=0. As Author response image 1 shows, both types of analysis result in similar differences in the abscission time. The slightly longer abscission times observed when end of anaphase was used as t=0 are expected as this is an earlier event than midbody formation.

The mean abscission time and standard deviations are now mentioned in the text.

3) The data relating to cell density (Figure 2E) are very interesting as they hint towards a role for ULK3 in tension-dependent abscission control, but they complicate interpretations of the other live imaging panels. These tension effects are larger (120min vs. 70min) than most other ULK3 live imaging phenotypes in Figure 2 and 3 (with only Figure 3B exceeding this). The authors need to describe whether and how cell density, cell mobility and other tensile variables are considered and excluded as possible contributors to the phenotypes described in the other figure panels.

This requires careful explanation, but experiments are not required.

Cell division events included in the tension analysis represent extreme cases of differing cell densities within the experiment, thus explaining the larger differences in abscission time observed upon ULK3 depletion. We now have modified the text to make this point clearer.

4) ULK3-dependent regulation of ESCRT-III subunits by phosphorylation is potentially one of the most exciting points of the study. However, in the current presentation, this regulation is incoherent and lacks mechanistic depth. For example, the authors describe ULK3 dependent phosphorylation of IST1, and identify 4 phosphorylation sites in IST1. However, it is unclear which of these are attributed to ULK3 and which are involved in abscission checkpoint signaling, complicating interpretation of results with the 4SA/E mutants in relation to ULK3. The authors should assess and clarify whether all 4 sites are ULK3 dependent, and if not, which ones are. This analysis could be done using in vitro kinase assays on recombinant proteins or by purifying IST1 from ULK3 depleted cells, followed by phospho-MS/MS analysis. Have the authors analyzed the single SA mutants? This is important since IST1 phospho-mutant phenotypes do not mimic ULK3 phenotypes, with ULK3 overexpression only mildly delaying abscission (Figure 3), but the IST1 4SE showing strong effects on abscission and multinucleation (Figure 6B). This discrepancy should be addressed.

Furthermore, does the IST1 4SA mutant mimic ULK3 depletion with respect to tension control of abscission or abscission in presence of chromatin bridges? Conversely, can the IST1 4SE mutant sustain checkpoint arrest in the absence of ULK3? (This is essential).

A) Regarding the reviewers’ concern that the 4SE mutant phenotype is more severe than our ULK3 overexpression phenotype, we would argue that this is the expected result because, the phosphomimetic Ser to Glu mutations are irreversible. We envision a model in which ULK3 delays abscission by phosphorylating IST1, rendering it incapable of functioning in abscission. If cells do not contain defects like lagging chromatin or misformed nuclear pores, they are released from the checkpoint, IST1 is dephosphorylated, and abscission proceeds. This model is consistent with our observation that IST1 cycles between phosphorylated and de-phosphorylated states throughout the cell cycle, with the phospho-IST1 species accumulating during mitosis (as mimicked by nocodazole treatment, Figures 5D, E and Figure 7G). This “dephosphorylation” event cannot occur for the 4SE IST1 mutant. Moreover, we would point out that cells that express the IST1 4SE that escape abscission failure have delays (48 min) (Figure 6E), that are comparable to the delays induced by ULK3 overexpression (78 min and 39 min in two different experiments). Thus, IST1 4SE either inhibits abscission altogether or induces abscission delays that are comparable to ULK3 overexpression.

B) In response to the reviewer’s question whether the IST1 4SA mutant mimics ULK3 depletion with respect to tension control of abscission or abscission in presence of chromatin bridges, we have now examined the activities of the IST1 4SA mutant under both of these conditions (in addition to nuclear pore depletion, which was included in our original submission (Figures 6B, Figure 6–figure supplement 1B and Figure 6A, respectively). As expected the IST1 4SA mutant fails to delay abscission in response to nuclear pore depletion and lagging chromatin at the intercellular bridge. Surprisingly, however, the IST1 4SA mutant behaves like the wild type IST1 protein in response to tension. These observations imply that abscission delays that are triggered via (lack of) tension require different signals and/or may not be as sensitive to IST1 phosphorylation as delays triggered through nuclear pores or lagging chromatin. This result is interesting because it could mean that delays in abscission in response to tension may require additional ULK3 substrates and/or additional, unidentified phosphorylation sites on IST1.

5) Overexpression of ULK3 alters the localization frequencies of IST1 and CHMP4B to the Flemming body. The authors should complement with localization studies in ULK3-depleted cells to rule out overexpression-induced artifacts.

This is essential.

We appreciate the reviewer’s suggestion. However, we believe that the feasibility of the proposed experiment is unclear. Only a very small fraction of abscission events will be significantly delayed by the abscission checkpoint in unperturbed situations. For example, less than 5% of the cell division events have lagging chromosomes that delay abscission. Thus, the analysis of CHMP4B/IST1 localization in ULK3-depleted cells would mainly reveal the localization of these proteins in abscission events in which the abscission checkpoint would not normally be on. In contrast, ULK3 overexpression provides a unique opportunity for meaningful localization studies because this situation induces (or mimics) the abscission checkpoint in a large fraction of the cell division events. Additionally, our claim of ULK3-dependent midbody CHMP4B and IST1 relocalization is further supported by our new data showing that endogenous ULK3 and overexpressed ULK3 exhibit similar localization patterns.

6) A very interesting lead is provided by evidence that phosphorylated IST1 shows remarkably increased interaction with VPS4 and LIP5, but the implications of this exciting observation are not explored in a cellular context. This should be done, especially when considering the central position of VPS4 in the abscission checkpoint and ESCRT-III dynamics in general. Is VPS4 localization affected in the IST1 4SE mutant, and where does the 4SE mutant itself localize in normal cells? Does it localize to the Flemming body, as could be expected from Figure 4? Furthermore, the position of the IST1 phosphorylation sites outside the MIM motifs leads the authors to suggest the existence of a bridging factor, but to lend more credibility to this statement the IST1 4SE mutant should be included in the yeast-2-hybrid setup shown in Figure 6–figure supplement 1. Considering the published interaction between ANCHR, CHMP4C and VPS4, the authors should explore whether IST1 4SE, ANCHR and CHMP4C associate, and if so, whether this is stronger than for the WT IST1.

You do not have to do this, since it is beyond the scope of a study on IST1.

7) Furthermore, the relation between ULK3 and other ESCRT-III subunits should be explored further to see whether there is a more general trend in ULK3 effects on ESCRT-III: Does ULK3 overexpression similarly relocalize other phosphorylation targets such as CHMP1A, CHMP1B and CHMP2A to the Flemming body?

It is not essential that you do this, since the paper is mainly about IST1.

8) Figure 3C and D provide a critical argument that actual kinase activity is required for ULK3 function during abscission. However, Figure 3D suggests that association of kinase dead ULK3 (K44H) with ESCRT-III subunits is more tight than the WT ULK3 (2-10 fold higher beta-galactosidase activity), which could have major effects on cellular function of ULK3 and ESCRT-III. Since Figure 1C suggests that kinase activity does not affect IST1 interaction with ULK3, is it possible that K44H affects ULK3 structure beyond its effect on kinase activity? This should be discussed. Also, since IST1 is a major component of this study, Figure 3C should include IST1 interaction data.

This is mostly about rewriting with some data that you might already have.

We agree with the reviewer that the K44H mutant gives a stronger signal than WT ULK3 with the ESCRT-III subunits but these differences should be interpreted with caution as the quantitative value of the yeast two-hybrid assay is very limited (beyond revealing whether or not two proteins interact). Moreover, the binding of WT or K44H ULK3 to ESCRT-III subunits such as IST1 is comparable when these interactions are tested by co-precipitation assays (see Author response image 2), suggesting that the K44H mutation does not affect the ULK3 structure beyond its kinase activity.

As noted in the text, two hybrid data for the ULK3/IST1 interaction are not included in Figure 3D (or elsewhere) because both proteins induce reporter gene expression when they are fused to the GAL4 DNA binding domain.

9) The proposed ULK3-CHMP4C link is not entirely convincing and seems almost like an afterthought. These proteins do not interact, and the authors do not explore the significance of the phosphorylation event in any detail (e.g. no mapping of target sites, no ULK3-specific phosphoCHMP4C mutants to see if this affects abscission timing etc.). On the other hand, several datasets points towards interplay between CHMP4C and ULK3 that are left undiscussed: For example, ULK3 KD seems to affect the overall level of CHMP4C (Figure 2B). Can the authors explain this? Does ULK3 control CHMP4C stability, and can this be rescued by WT, K44M or M434D ULK3 alleles? Additionally, ULK3 SDS-PAGE mobility is altered upon CHMP4C knockdown (Figure 5E). Could this reflect altered ULK3 modifications, such as phosphorylation? This should be discussed. In the absence of further data the authors should play down their statements about the ULK3-CHMP4C link (This part could be deleted).

We agree that this is not a major aspect of our study, but we nevertheless believe that our paper is strengthened by its inclusion.

https://doi.org/10.7554/eLife.06547.048

Article and author information

Author details

  1. Anna Caballe

    Department of Infectious Diseases, King's College London School of Medicine, London, United Kingdom
    Contribution
    AC, Conceived the project, Wrote the manuscript, Performed live-imaging and functional experiments, Performed binding, phosphorylation and microscopy experiments, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article
    Contributed equally with
    Dawn M Wenzel
    Competing interests
    No competing interests declared.
  2. Dawn M Wenzel

    Department of Biochemistry, University of Utah School of Medicine, Salt Lake City, United States
    Contribution
    DMW, Conceived the project, Wrote the manuscript, Performed biochemical, structural and phosphorylation/mass spectrometry studies, Conception and design, Acquisition of data
    Contributed equally with
    Anna Caballe
    Competing interests
    No competing interests declared.
  3. Monica Agromayor

    Department of Infectious Diseases, King's College London School of Medicine, London, United Kingdom
    Contribution
    MA, Conceived the project, Wrote the manuscript, Performed binding, phosphorylation and microscopy experiments, Conception and design, Acquisition of data, Drafting or revising the article
    Competing interests
    No competing interests declared.
  4. Steven L Alam

    Department of Biochemistry, University of Utah School of Medicine, Salt Lake City, United States
    Contribution
    SLA, Performed structural studies, Acquisition of data, Analysis and interpretation of data
    Competing interests
    No competing interests declared.
  5. Jack J Skalicky

    Department of Biochemistry, University of Utah School of Medicine, Salt Lake City, United States
    Contribution
    JJS, Performed structural studies, Acquisition of data, Analysis and interpretation of data
    Competing interests
    No competing interests declared.
  6. Magdalena Kloc

    Department of Infectious Diseases, King's College London School of Medicine, London, United Kingdom
    Contribution
    MK, Performed binding experiments, Acquisition of data, Analysis and interpretation of data
    Competing interests
    No competing interests declared.
  7. Jeremy G Carlton

    Department of Infectious Diseases, King's College London School of Medicine, London, United Kingdom
    Present address
    Division of Cancer Studies, King's College London School of Medicine, London, United Kingdom
    Contribution
    JGC, Performed phosphorylation experiments, Acquisition of data, Analysis and interpretation of data
    Competing interests
    No competing interests declared.
  8. Leticia Labrador

    Department of Infectious Diseases, King's College London School of Medicine, London, United Kingdom
    Contribution
    LL, Performed microscopy experiments, Acquisition of data, Analysis and interpretation of data
    Competing interests
    No competing interests declared.
  9. Wesley I Sundquist

    Department of Biochemistry, University of Utah School of Medicine, Salt Lake City, United States
    Contribution
    WIS, Conceived the project, Wrote the manuscript, Conception and design, Analysis and interpretation of data, Drafting or revising the article
    For correspondence
    wes@biochem.utah.edu
    Competing interests
    WIS: Reviewing editor, eLife.
  10. Juan Martin-Serrano

    Department of Infectious Diseases, King's College London School of Medicine, London, United Kingdom
    Contribution
    JM-S, Conceived the project, Wrote the manuscript, Conception and design, Drafting or revising the article
    For correspondence
    juan.martin_serrano@kcl.ac.uk
    Competing interests
    No competing interests declared.

Funding

Medical Research Council (MRC) (G0802777)

  • Juan Martin-Serrano

Wellcome Trust (WT102871MA)

  • Juan Martin-Serrano

National Institutes of Health (NIH) (GM112080)

  • Wesley I Sundquist

American Cancer Society (PF-14-102-01-CSM)

  • Dawn M Wenzel

University of Utah (Huntsman Cancer Institute (5P30CA042014-25))

  • Wesley I Sundquist

Kings College London (PhD Studentship)

  • Anna Caballe

U.S. Department of Energy (DE-AC02-76SF00515)

  • Wesley I Sundquist

National Institute of General Medical Sciences (NIGMS) (P41GM103393)

  • Wesley I Sundquist

National Institutes of Health (NIH) (GM082545)

  • Steven L Alam
  • Jack J Skalicky

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank the Nikon Imaging Centre at KCL for technical support. We thank the following colleagues for advice or technical assistance: Stuart Neil, Krishna Parsawar (U.U. Mass Spectrometry Core), Scott Endicott (U.U. Peptide Synthesis Core), Chris Hill, John McCullough, Frank Whitby, Leremy Colf, and Kira Miller. University of Utah core facilities were supported in part by Huntsman Cancer Institute Center Support Grant number 5P30CA042014-25. This work was funded by grants from the Medical Research Council (G0802777) and Wellcome Trust (WT102871MA) to JM-S, NIH GM112080 (WIS), NIH GM082545 (SLA and JJS), a KCL School of Medicine PhD Studentship (AC), and an American Cancer Society Postdoctoral Fellowship PF-14-102-01-CSM (DMW). We thank the UK NIHR Comprehensive BRC at KCL for an equipment grant. Use of the Stanford Synchrotron Radiation Lightsource, SLAC National Accelerator Laboratory, is supported by the U.S. Department of Energy, Offices of Science, Office of Basic Energy Sciences under Contract No. DE-AC02-76SF00515. The SSRL Structural Molecular Biology Program is supported by the DOE Office of Biological and Environmental Research, and by the NIH, National Institute of General Medicine Sciences (including P41GM103393). The contents of this publication are solely the responsibility of the authors and do not necessarily represent the official views of NIGMS or NIH. The funding sources were not involved in the study design, data collection and interpretation, or decision to submit the work for publication.

Reviewing Editor

  1. Mohan Balasubramanian, University of Warwick, United Kingdom

Publication history

  1. Received: January 18, 2015
  2. Accepted: May 23, 2015
  3. Accepted Manuscript published: May 26, 2015 (version 1)
  4. Version of Record published: June 22, 2015 (version 2)

Copyright

© 2015, Caballe et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 2,767
    Page views
  • 796
    Downloads
  • 32
    Citations

Article citation count generated by polling the highest count across the following sources: Scopus, Crossref, PubMed Central.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Biochemistry and Chemical Biology
    Adam J Pollak et al.
    Research Article Updated
    1. Biochemistry and Chemical Biology
    2. Structural Biology and Molecular Biophysics
    Renuka Kudva et al.
    Short Report Updated