Distinct RanBP1 nuclear export and cargo dissociation mechanisms between fungi and animals
Abstract
Ran binding protein 1 (RanBP1) is a cytoplasmic-enriched and nuclear-cytoplasmic shuttling protein, playing important roles in nuclear transport. Much of what we know about RanBP1 is learned from fungi. Intrigued by the long-standing paradox of harboring an extra NES in animal RanBP1, we discovered utterly unexpected cargo dissociation and nuclear export mechanisms for animal RanBP1. In contrast to CRM1-RanGTP sequestration mechanism of cargo dissociation in fungi, animal RanBP1 solely sequestered RanGTP from nuclear export complexes. In fungi, RanBP1, CRM1 and RanGTP formed a 1:1:1 nuclear export complex; in contrast, animal RanBP1, CRM1 and RanGTP formed a 1:1:2 nuclear export complex. The key feature for the two mechanistic changes from fungi to animals was the loss of affinity between RanBP1-RanGTP and CRM1, since residues mediating their interaction in fungi were not conserved in animals. The biological significances of these different mechanisms in fungi and animals were also studied.
https://doi.org/10.7554/eLife.41331.001eLife digest
Plant, animal and fungal cells all store their DNA inside the cell’s nucleus. Small molecules can freely cross the membrane that surrounds the nucleus, but pores in the membrane control when larger molecules enter or leave. This transport process is an essential part of healthy cell behavior.
To leave the nucleus, large molecules need to carry a coded sequence called a nuclear export signal. In yeast cells, which are often used to study cell biology, this sequence allows cargo to bind to a groove in so-called molecular cargo vehicles, such as a protein called CRM1. A protein called RanGTP binds to CRM1 to supply the energy needed to transport molecules across the membrane. Outside of the nucleus, another protein called RanBP1 closes up the groove in the CRM1 protein to help remove the cargo by interacting with RanGTP and CRM1 to form a ‘complex’.
The version of RanBP1 found in animal cells has its own nuclear export signal, which led researchers to question whether it works in the same way as yeast RanBP1. To find out, Li et al. compared yeast RanBP1 with mouse RanBP1. This revealed that mouse RanBP1 lacks the amino acids that allow it to interact with CRM1 in the fashion of yeast RanBP1. When unloading cargo from CRM1, mouse RanBP1 does not form a complex with Ran and CRM1; instead, it works entirely through removing RanGTP from CRM1. This process is more efficient than the one used by yeast cells, but it uses twice as much energy.
The results presented by Li et al. demonstrate that even processes that are essential to cells can be optimized to fit the needs of different species. Future work could potentially exploit the differences in the export processes used by fungi and animal cells to develop new anti-fungal treatments.
https://doi.org/10.7554/eLife.41331.002Introduction
Eukaryotic cells each have a nucleus which segregates the nucleoplasm and cytoplasm into two isolated compartments. Exchanges between these compartments are mainly mediated through nuclear pore complex (NPC), a semi-permeable channel that allows only certain classes of molecules to pass through, for example importins and exportins, which are collectively called karyopherin proteins (Beck and Hurt, 2017). Cargo entering the nucleus must possess a nuclear localization signal (NLS), which binds to an importin and enters nucleus through NPC (Rexach and Blobel, 1995). In the nucleus, the GTP-bound form of Ran (Ras-related nuclear) protein dissociates the importin-NLS cargo, and RanGTP-Importin is exported to cytoplasm (Izaurralde et al., 1997; Kutay et al., 1997). For a cargo’s nuclear export, its nuclear export signal (NES) forms a complex with exportin in the presence of RanGTP, and together the trimeric complex translocates to the cytoplasm through NPC (Ullman et al., 1997). In the cytoplasm, RanGTP complexes (with either importin or exportin-NES) are hydrolyzed to RanGDP by GTPase-activating protein RanGAP, dissembling the complexes and recycling karyopherins and Ran for further rounds of nuclear transport (Bischoff et al., 1995a).
However, importin or exportin-NES displays extremely high affinity (in the nM range) for RanGTP and inhibits RanGAP-facilitated RanGTP hydrolysis (Bischoff and Görlich, 1997; Askjaer et al., 1999). Efficient hydrolysis requires Ran binding proteins containing one or more Ran binding domains (RBDs, around 150 residues each) to dissociate RanGTP from karyopherin prior to hydrolysis (Beddow et al., 1995; Bischoff et al., 1995b; Vetter et al., 1999). In human, there are two such proteins, namely RanBP1 and RanBP2. While the predominantly cytoplasmic RanBP1 contains one RBD, the cytoplasmic rim-attached RanBP2 has four RBDs (Bischoff et al., 1995b). These RBDs are the tightest binders of RanGTP, Kd being around 1 nM, whereas it binds to RanGDP at only approximately 10 µM affinity (Görlich et al., 1996; Kuhlmann et al., 1997; Delphin et al., 1997).
In addition, RanBP1 in the cytoplasm functions in the disassembly of nuclear export complexes (also before RanGTP is hydrolyzed), through dissociating NES containing cargoes from the complexes (Floer and Blobel, 1999). CRM1 (Chromosomal Region Maintenance 1, also known as Exportin-1) is a major nuclear export factor that is responsible for nuclear export of a plethora of proteins containing NES sequence(s) (Stade et al., 1997). In yeast (S. cerevisiae), after binding to RanGTP and CRM1, RanBP1 allosterically closes the groove, releasing CRM1 cargoes into the cytoplasm (Koyama and Matsuura, 2010).
Sequence analysis indicates that in contrast with fungi RanBP1 (which includes yeast RanBP1), animal RanBP1 contains NES sequence C-terminal to its RBD (Zolotukhin and Felber, 1997) (Figure 1—figure supplement 1). It is reported that the NES of human RanBP1 (hRanBP1) is responsible for its cytoplasmic accumulation (RanBP1 is a shuttling protein) (Zolotukhin and Felber, 1997; Künzler et al., 2000). If animal RanBP1 binds to RanGTP-CRM1 similarly as yeast RanBP1 (yRanBP1), an apparent paradox then exists: its NES binding to CRM1 is inhibited by its own RBD. Specifically, if animal RanBP1 binds to CRM1 through NES in the nucleus to prepare for nuclear export, its RBD might immediately interact with RanGTP on CRM1 (because of proximity and high affinity) and dissociate its own NES before animal RanBP1 is exported. One may argue that NES may play a role in recruiting animal RanBP1 to CRM1. However, RanBP1-RanGTP-CRM1 complex displayed much higher affinity than NES-CRM1-RanGTP complex in yeast (Maurer et al., 2001); thus, the recruiting purpose seems unnecessary and unlikely. It should be noted that there are about ten residues between RBD and NES, which are insufficient to cover the distance (about 70 Å) between RBD and NES in space. Therefore in theory, the NES and RBD of animal RanBP1 would not bind to CRM1-RanGTP simultaneously. It is fascinating as to why animal RanBP1 requires an extra NES while fungi RanBP1 does not; what factor(s) prevents animal RBD from dissociating its own NES during its nuclear export; whether the NES of animal RanBP1 functions in cargo dissociation by direct competition with NES of cargo; and how animal RBD and NES binding to CRM1-RanGTP is regulated in time and space in cells. Intrigued by these long-standing questions, we performed biochemical, biophysical, and cellular studies on RanBP1 and related proteins. Our work not only solved those puzzles, but also discovered unexpected animal RanBP1 nuclear export and cargo dissociation mechanisms distinctive from those in the yeast.
Results
Mouse and yeast RanBP1 bind to CRM1-RanGTP differently
In yeast, RanBP1, RanGTP and CRM1 form a tight complex whereby RanBP1 forces H9 loop of CRM1 to allosterically close NES binding groove and dissociate NES. In order to visualize the mode of animal RanBP1’s binding to RanGTP-CRM1, we first attempted to solve the crystal structure of complex formed by mouse RanBP1 (mRanBP1), human RanGTP (hRanGTP) and human CRM1 (hCRM1). However, although the yeast complex formed readily as expected, the equivalent complex with animal proteins hardly formed under similar conditions (Figure 1A). The human and yeast Ran protein shares 83% sequence identity and are often used interchangeably (Koyama and Matsuura, 2010; Sun et al., 2013). When RanBP1, RanGTP and CRM1 were mixed at 5:3:1 molar ratio and passed through a size exclusion chromatography column, the yeast proteins formed stable complex and were co-eluted, but not the case for the animal proteins (Figure 1—figure supplement 2). Interestingly, a greater amount of animal complex was formed when concentration of RanGTP was increased (Figure 1B). In contrast, the yeast complex was not affected by RanGTP concentration (Figure 1B). It should be noted that the mammalian complex was dependent upon high RanGTP but not RanGDP concentration (Figure 1—figure supplement 3). These results suggest that mRanBP1 is somewhat different from yRanBP1, in forming complex with RanGTP-CRM1.

Mouse RanBP1 forms a nuclear export competent complex with hCRM1 only through its NES, and in a RanGTP concentration dependant manner.
(A, B, C) GST tagged mouse/yeast RanBP1 or mutants pull down of CRM1 in the presence of RanGTP. (A) While yeast proteins form a strong RanBP1-RanGTP-CRM1 complex, the animal proteins form a RanBP1-RanGTP complex with very weakly bound CRM1. (B) At increasing concentration of RanGTP, while yeast complex is not affected, animal CRM1 is increasingly bound to GST-mRanBP1-RanGTP. (C) Mutation (NESmut) or deletion of the NES of mRanBP1 (ΔC) abolishes hCRM1 binding at either high or low RanGTP concentration. (D) GST-NESmRanBP1 pull down of CRM1 in the presence of RanGTP and NES inhibitor MBP-NESMVM. NES of mRanBP1 binds to hCRM1 in the presence of RanGTP and is effectively outcompeted by MBP-NESMVM, suggesting that the NES of mRanBP1 binds to NES groove of CRM1. (E) GST-NES pull down of hCRM1 and different concentration of RanGTP to show that the NES of mRanBP1 is weaker than the well-studied NES of PKI cargo. (F) mCherry tagged different RanBP1 constructs were transfected into HeLa cells and treated with or without 5 µM CRM1 inhibitor KPT-330 for 3 hr. While mRanBP1 is exclusively cytoplasmic, mRanBP1 treatment with KPT-330 and NESmut are significantly re-localized to the nucleus. yRanBP1 is exclusively nuclear.
Mouse RanBP1’s NES is necessary for CRM1 binding and its nuclear export
To identify which region of mRanBP1 mediated the interaction with hCRM1, we cloned GST-tagged mRanBP1 mutants with NES mutation (termed as NESmut), the C terminus deletion (ΔC) or only the NES (NESmRanBP1). Surprisingly, both NESmut and ΔC lost binding to hCRM1 completely, in either low or high RanGTP concentration (Figure 1C). In contrast, NESmRanBP1 bound to hCRM1 in the presence of RanGTP, and was outcompeted by supraphysiological NES (Engelsma et al., 2008) from the Minute Virus of Mice (Figure 1D), suggesting that NESmRanBP1 is a regular NES that binds to NES groove on hCRM1. Further, the NES of mRanBP1 is weaker than that of regular NES from PKI (Protein kinase inhibitor) (Figure 1E). Previously, it was reported that the NES of mRanBP1 was essential for its nuclear export (Plafker and Macara, 2000). Indeed, while mRanBP1 was localized to the cytoplasm, NESmut (or mRanBP1 in the presence of CRM1 inhibitor KPT-330) was significantly re-localized to the nucleus (Figure 1F). Unexpectedly, yRanBP1 was exclusively localized in the nucleus (Figure 1F, right column), though RanBP1 proteins are known to be cytoplasmic localized proteins (Künzler et al., 2000; Plafker and Macara, 2000). The reason for this counter-intuitive observation will be explained in later sections. Altogether, these results conclude that the NES of mRanBP1 is necessary and sufficient for its interaction with hCRM1 in the presence of RanGTP, and this interaction is crucial for nuclear export of mRanBP1.
Mouse RBD dissociates cargo through sequestering RanGTP
Previously we showed that ΔC or NESmut did not bind to hCRM1 in the presence of RanGTP (Figure 1C). Relating to RanBP1’s function of CRM1 cargo dissociation, we wondered whether either ΔC or NESmut possesses cargo dissociation ability, and whether NESmRanBP1 is involved in dissociating cargo, possibly through direct competition with cargo’s NES. Pull down assay showed that ΔC or NESmut dissociated cargoes as potently as WT mRanBP1 (Figure 2A, Figure 2—figure supplement 1), suggesting that NES of mRanBP1 is dispensable for cargo dissociation. Further, if direct competition plays a role, the NES of mRanBP1 should be stronger than that of the cargo. However, our earlier result showed that NESmRanBP1 was weaker than cargo PKI’s NES (Figure 1E). Taken together, we conclude that mRanBP1 does not dissociate cargo through direct competition of cargo’s NES.

mRanBP1’s RBD dissociates CRM1 cargo through sequestering RanGTP.
(A–D) GST-NESPKI pull down of CRM1 and RanGTP in the presence of RanBP1 or its mutants. (A) NESmut or ΔC dissociates cargo as WT RanBP1. (B) High concentration of RanGTP inhibits cargo dissociation in animals but not yeast. (C) RanGTP-bound ΔC loses its ability in cargo dissociation while yeast RanGTP-RanBP1 remains competent. (D) ΔC dissociates cargo when its concentration is higher than that of RanGTP, and yRanBP1 dissociates cargo when its concentration is higher than that of CRM1.
Since ΔC-RanGTP did not bind to hCRM1 but still dissociated cargo (Figures 1C and 2A), we therefore speculated that ΔC dissociates cargo through sequestering RanGTP from the export complex, which would result in a transient, low-affinity binary complex of hCRM1 and NES cargo that automatically dissociates. Indeed, at high concentration of RanGTP, cargo dissociation activity of ΔC was fully inhibited (Figure 2B), because excess of RanGTP not only saturated (and inhibited) mRanBP1, but also allowed CRM1 to form complex with GST-PKI. Further, purified 1:1 complex of ΔC-RanGTP, where RBD was already saturated with RanGTP, was unable to dissociate cargo (Figure 2C). These results illustrate that the Ran binding domain, but not NESmRanBP1, is required for CRM1 cargo dissociation, through stripping RanGTP out of the nuclear export complexes.
Cargo dissociation mechanisms in yeast and animals
We also performed the above cargo dissociation experiments using yeast protein in parallel. In contrast to mRanBP1, cargo dissociation ability of yRanBP1 was not inhibited by excess of Ran, and yRanBP1-yRanGTP remained active to dissociate CRM1 cargo (Figure 2B and C). Further, when RanGTP is in large molar excess than CRM1, yRanBP1 dissociated cargo as long as its concentration was higher than CRM1 concentration; in contrast, mRanBP1 dissociated cargo only at concentration that was higher than that of RanGTP (Figure 2D). It is evident that yeast RanBP1 dissociates cargo through sequestering CRM1-RanGTP, distinctive from animal RanBP1’s cargo dissociation mechanism (Figure 3A).

CRM1 cargo dissociation mechanism in fungi and animals.
(A) In fungi, cargoes are actively released from CRM1’s NES groove by formation of RanBP1-RanGTP-CRM1 trimeric complex. RanGTP-RanBP1 transiently released from CRM1 is catalyzed by RanGAP. In animals, RanBP1 strips RanGTP from CRM1, resulting in dissociation of NES cargo from CRM1. RanGAP catalyzes further dissociation of Ran-RanBP1. (B) GAP mediated RanGTP hydrolysis (arbitrary unit) at different time points. CRM1 and NES (PKI) inhibit RanGTP hydrolysis in both human (cyan) and yeast (orange). Addition of RanBP1 increases the rate of GAP hydrolysis. While addition of yCRM1 partially inhibit GAP mediated hydrolysis, addition of hCRM1 does not. Error bars represent standard deviation of quadruple repeats. (C) In vitro nuclear export of GST cargo in the presence of human or yeast CRM1/Ran/RanBP1 using semi-permeabilized HeLa cells. The reactions were stopped at different time points and level of nuclear cargo was stained with anti-GST antibody. (D) Quantification and statistical analysis of nuclear cargo intensity after normalization by DNA intensity. Error bars represent standard error of measurements for each set of data containing measurements from at least 30 cells. ** denotes p<0.01.
-
Figure 3—source data 1
Nuclear export in the presence of human or yeast proteins using semi-permeablized cells.
- https://doi.org/10.7554/eLife.41331.012
Previously, it was reported that CRM1 or more generally karyopherins protect bound RanGTP from GAP mediated hydrolysis (Bischoff and Görlich, 1997; Lounsbury and Macara, 1997). We showed that indeed RanGTP hydrolysis is inhibited when complexed to CRM1 and NES (in the absence of RanBP1), both in yeast and in human. Since human proteins do not form tight trimeric CRM1-RanGTP-RanBP1 complex, it is predicted that hCRM1 would not protect RanGTP-RanBP1 from GAP hydrolysis like the yeast proteins. As expected, the rate of hydrolysis in yeast was partially inhibited with addition of yCRM1, while there was no change of hydrolysis rate with addition of hCRM1 (Figure 3B). Using semi-permeabilized cells, we further showed that when CRM1 is the rate limiting factor, nuclear export of cargo is indeed faster in the presence of human CRM1/Ran/RanBP1 than yeast proteins (Figure 3C,D), possibly due to faster rate of CRM1 recycling (by faster rate of GAP hydrolysis), although it does not rule out other possibilities (will be discussed later). These experiments are consistent with earlier reports that RanBP1 is required for RanGAP activity, and consistent with our model that animal CRM1/Ran/RanBP1 does not form high-affinity trimeric complex as in yeast.
RanBP1 forms complex with CRM1 and two RanGTP proteins in animals
Previously, we showed that mRanBP1 bound to hCRM1 through its NES and that ΔC did not dissociate cargo in excess of RanGTP. Since ΔC forms an extremely tight complex with RanGTP (Figure 1C), we hypothesized that when RanGTP is excessive, mRanBP1 binds to one RanGTP through its RBD and binds to hCRM1 through its NES, while hCRM1 simultaneously binds to another RanGTP, forming a tetrameric complex (RanGTP-mRanBP1)-hCRM1-RanGTP (Figure 4A). In this model, unlike the yRanBP1 that contacts both yCRM1 and yRanGTP, animal RanBP1’s RBD only binds to RanGTP (but not CRM1). Further, in contrast to H9 loop stabilized closure of NES groove in yeast (Koyama and Matsuura, 2010), animal CRM1’s H9 loop would be shifted away from the NES groove (as in pdb 3NC0) (Fung and Chook, 2014), opening its NES groove for interaction with NES of RanBP1 (Figure 4A). This model is consistent with all previous results, including that the binding between mRanBP1 and hCRM1 requires excessive RanGTP (Figure 1A,B), that NES is the only interacting site between mRanBP1 and hCRM1 (Figure 1C,D,F), and that ΔC-RanGTP does not dissociate CRM1 cargo (Figure 2).

Animal RanBP1, RanGTP and CRM1 form a tetrameric complex containing two RanGTP proteins.
(A) Model of animal and fungi RanBP1 nuclear export complexes. Yeast complex contains one RanGTP and animal complex contains two. Unlike yeast, animal RBD does not contact CRM1 and animal CRM1 has different conformation of NES groove and H9 loop. (B) GST-RanGTP pull down of Ran1-179 and CRM1 in the presence of mRanBP1, ΔC or buffer. Ran1-179 is bound when WT mRanBP1 is added, but not when ΔC is added. Size exclusion profiles and SDS-PAGE analysis of the peaks by animal (C) and yeast (D) RanBP1, RanGTP, RanGTP1-179 and CRM1 proteins mixed at 1:1:3:1 molar ratio. The first peak contains four bands for animal sample and three bands for yeast samples. ITC titration of RanGTP into animal (E) and yeast (F) CRM1-RanBP1 respectively. Figure E and F include two and one independent titration experiments, respectively. Global or single fit of Kd and ΔH is displayed in the figure respectively. Error bars represents 95% confidence interval of measurements. While animal proteins display an exothermic phase and an endothermic phase, yeast proteins only produce an exothermic phase.
To further validate this model, we analyzed the size exclusion peaks of yeast and animal RanBP1-RanGTP-CRM1 complexes mixed at a 2:5:1 molar ratio. The calculated RanGTP to RanBP1 molar ratio in the peak of the animal complex was approximately twice (2.05 fold) over that of the yeast complex (Figure 4—figure supplement 1), suggesting that animal complex contains two RanGTP proteins. To differentiate the two RanGTP proteins in the tetramer, we performed a pull down assay using GST-RanGTP and a truncated form of Ran, Ran1-179, which binds to CRM1 but does not bind to mRanBP1 due to lack of C-terminus. Clearly, Ran1-179 and hCRM1 bound to GST-RanGTP beads in the presence of mRanBP1 but not ΔC or buffer (Figure 4B). The bound Ran1-179 can be explained by the formation of the proposed tetrameric complex, where GST-RanGTP binds to mRanBP1, which further binds to hCRM1-Ran1-179 through the NES of mRanBP1. Though ΔC binds to GST-RanGTP, the lack of NES rendered it unable to bind CRM1; therefore there is a lack of Ran1-179 band in the bound fraction. By size exclusion chromatography, hCRM1, RanGTP, mRanBP1 and Ran1-179 formed a reasonable 1:1:1:1 complex, whereas Ran1-179 did not co-elute with CRM1, RanGTP and RanBP1 in yeast (Figure 4C and D). Further, RanGTP titration into hCRM1 and mRanBP1 by ITC produced an exothermic phase and an endothermic phase, representing the heat change from forming RanGTP-mRanBP1 and the tetrameric complex, respectively (Figure 4E). In contrast, the titration of RanGTP into yCRM1 and yRanBP1 displayed merely an exothermic phase representing the formation of the trimeric complex (Figure 4F). Taken together, we conclude that RanBP1 forms a tetrameric complex with CRM1 and two RanGTP proteins in animals (when RanGTP excessive), where RanBP1-RanGTP binds to CRM1-RanGTP through the NES of RanBP1.
Detection of RanBP1 tetramer in the nucleus
Since the RanBP1 tetrameric complex forms only in excess of RanGTP, and since the nucleus is enriched with RanGTP (Izaurralde et al., 1997), we tried to detect the presence of nuclear tetramer using the bimolecular fluorescence complementation (BiFC) approach. We fused one Ran with CYFP (C-terminal fragment of YFP) and another Ran with NYFP (N-terminal fragment of YFP), and co-transfected the two plasmids into 293 T cells. The formation of the tetrameric complex would bring the fluorescent fragments within proximity, promoting the assembly of an intact YFP (Figure 5A). Please note that this assay would not differentiate which Ran fusion binds to RanBP1 (or CRM1) in the tetramer, and possibly that both configurations could elicit YFP signals. GST-mRanBP1 pull down showed that these fusion Ran proteins are still functional (Figure 5—figure supplement 1). When the fusion plasmids were co-transfected, weak YFP signals were observed (Figure 5B yellow arrows), suggesting possible tetramer formation. In fact, not all double fusion transfected cells emitted weak signals, possibly those cells did not have a detectable level of nuclear RanBP1 (Figure 5B white arrows). To generate an appropriate negative control for this experiment, we mutated C-terminus of Ran (A181W, P184H and L209H, named RanCmut, single mutation is insufficient to disrupt its tight binding to RanBP1), so that it is still active (able to promote CRM1-NES binding) but no longer binds to RanBP1, therefore unable to form RanBP1 tetramer (Figure 5C). When the two RanCmut fusion constructs were co-transfected, no YFP signal was observed (Figure 5B), suggesting that the weak signals that we observed earlier using RanWT are true signals.

RanBP1 tetrameric complex exists in the cell nucleus.
(A) Design of BiFC experiment. When the RanBP1 tetramer is formed, a YFP signal could be detected. This assay may not discriminate which Ran binds to RanBP1 (or CRM1) in the tetramer. (B) Representative immunofluorescence (HA and Myc) and fluorescence (YFP) images on cells co-transfected with fusion plasmids (labelled on top). NLS-hRanBP1 or NLS-hNESmut (hNESmut: human RanBP1 with NES mutation) was used to increase nuclear level of RanBP1 or its mutant. Nucleus was not stained so that the two transfected proteins could be stained without contaminating the YFP channel. The boundary of nucleus could be estimated by Ran fusions, which is mainly localized in the nucleus (see Figure 5—figure supplement 3). Results interpretation (middle panel) explains why the yellow fluorescence is observed or not. Bottom panel shows the nuclear YFP intensities of at least 20 cells (only florescent cells transfected with two Ran fusions) in the corresponding samples under the same level of illumination. **** denotes p<0.0001. (C) RanCmut is able to bind to CRM1 and NES (left panel) but not able to bind yRanBP1 (right panel).
The weak signals were probably due to low level of RanBP1 in the nucleus (Richards et al., 1996) and competition by endogenous RanGTP. In order to enhance the signals that we observed, we further transfected NLSSV40-fused hRanBP1 or hNESmut (which is the human version of NESmut) to artificially increase the nuclear pool of RanBP1 along with the two RanWT fusion plasmids. In contrast to NLS-hRanBP1 which significantly promoted nuclear YFP formation, NLS-hNESmut inhibited the weak YFP signals observed in the absence of NLS-hNESmut (possibly inhibiting tetramer formation by sequestering Ran fusions) (Figure 5B). This further demonstrates that NES is the only interface between mRanBP1 and CRM1, without which the formation of tetramer is inhibited. Consistent with the fact that RanGTP is almost absent in cytoplasm (Izaurralde et al., 1997), strong cytoplasmic YFP signals were not observed during image collection, validating that the complex forms only in excess of RanGTP. As an alternative approach, we measured the Fluorescence Resonance Energy Transfer (FRET) efficiency between CFP-Ran and Alexa Fluor 546 immuno-labelled Myc-Ran, while co-transfecting either RanBP1Δlinker-NLS (forms tetramer; linker refers to residues between RBD and NES; linker was deleted to reduce distances between two Rans and enhance FRET efficiency) or RanBP1ΔNES-NLS (does not form tetramer). In agreement with the BiFC experiment, the nuclear FRET efficiency is significantly (p<0.0001) higher when transfected with RanBP1Δlinker-NLS (Figure 5—figure supplement 2). In summary, we detected the RanBP1 tetrameric complex in (and only in) the nucleus of human cells.
Reasons for not forming trimeric RanBP1-RanGTP-CRM1 complex in animals
The key nuclear export and cargo dissociation mechanistic change from yeast to animals is the loss of binding between RanBP1-RanGTP and CRM1. We then asked why animal RanBP1-RanGTP did not bind to CRM1 as the yeast proteins. Through a pull down assay to test inter-species CRM1-RanGTP-RanBP1 complex formation, we found that in contrast to yRanBP1-hRanGTP-yCRM1 complex, neither yRanBP1-hRanGTP-hCRM1 nor ΔC-hRanGTP-yCRM1 complex was formed (Figure 6A). Therefore, neither hCRM1 nor ΔC is compatible for trimeric complex formation. We previously showed that yRanBP1 was unexpectedly localized in the nucleus of HeLa cells (Figure 1F). This could be explained by Figure 6A: yRanBP1 does not form trimeric or tetrameric complex with human CRM1/RanGTP, thus is not exported to the cytoplasm of HeLa cells.

Sequence deviation of RanBP1 and CRM1 from their yeast orthologs prevents binding between RanBP1-RanGTP and CRM1 in animals.
(A) Cross-species pull down of CRM1 using immobilized GST-yRanBP1 or GST-ΔC in the presence of RanGTP. (B) Superimposition of hRanBP1-hRan (1K5G, yellow and green) and hCRM1 (3GB8, blue) onto yRanBP1(cyan)-hRan(green)-yCRM1(magenta) crystal structure (4HAT). N-terminus of hRanBP1 (surface representation) is located between intimately packed RanGTP and CRM1 and thus possibly hinders their binding in animals. Heat repeats 6–15 (H6–H15) of CRM1 are labelled. (C) Zoom in of boxed region in 6B shows RanBP1-CRM1 interface and adjacent residues (shown as sticks) that are different between species. (D) GST-RanBP1 and its mutants pull down of yCRM1 and RanGTP. TM contains mutations A114V, A119S and Δ1–37, in addition to NES mutation. A114V and N-terminal deletion collectively rescue binding to yCRM1-RanGTP. (E) GST-yRanBP1 pull down of human and yeast CRM1 mutants in the presence of RanGTP. Both RanBP1 and Ran interacting regions of CRM1 are important for trimeric complex formation. (F) In the yRanBP1-hRan-yCRM1 crystal structure, yCRM1 and hRanGTP residues that form hydrogen bonds (dash lines) are displayed as magenta sticks. The structurally non-conserved hCRM1 residues are displayed as blue sticks. To improve clarity, main chain atoms (except glycine) and conserved residues are omitted.
It should be noted that human and yeast Ran proteins are not critical for trimeric complex formation. In this study, we discovered a small difference between human and yeast Ran, that is hRan-yRanBP1-yCRM1 complex has lower affinity than yRan-yRanBP1-yCRM1 (Figure 4F; refer also to Maurer et al., 2001). This reduction in affinity agrees with pull down that hRan-yRanBP1-yCRM1 but not yRan-yRanBP1-yCRM1 could be dissembled by NES (which is the reason for using yRan but not hRan for yeast complex in cargo dissociation experiments in Figure 2). Though the affinity of Ran-yRanBP1-yCRM1 is significantly reduced with hRan, we showed that hRan-yRanBP1-yCRM1 complex formed readily by pull down (Figure 6A), and this complex is competent in cellular nuclear export (will be presented in a later section).
The above results suggested that essential residues for trimeric complex formation in yeast CRM1/RanBP1 were not conserved in animals. When crystal structures of hRanBP1-hRanGTP (pdb:1K5G) and hCRM1 (pdb:3GB8) were aligned onto yCRM1-hRan-yRanBP1 (pdb:4HAT), several differences between RanBP1 and CRM1 of the two species were observed (Figure 6B,C). First, unlike yRanBP1 (17), hRanBP1 residues preceding its RBD domain are ordered and inserted between the closely-packed RanGTP and CRM1 (Figure 6B), possibly hindering trimeric complex formation by steric clash. Second, V150 that is in close proximity with yCRM1 in yRanBP1 corresponds to A114 in hRanBP1 (Figure 6C). V150 is conserved to be valine or isoleucine in fungi (Figure 6—figure supplement 1), but not conserved in hRanBP2 and RanBP1 from human, mouse, zebrafish and frog (Figure 1—figure supplement 4). The residues discussed above were mutated in NESmut and yRanBP1 to test whether they impact binding towards yCRM1 in the presence of RanGTP. Pull down results showed that either A114V or deletion of N terminus (Del 1–37) on NESmut could partially rescue binding to yCRM1 (Figure 6D, lane 2 and 4). In agreement, V150A mutation in yRanBP1 partially inhibited binding of yCRM1 (Figure 6D, lane 7 and 8). In contrast, mutation of more distant residue (A119 in NESmut mutated to yeast-equivalent S) did not significantly affect binding. Triple mutant (A114V, A119S and Del1-37, labelled as TM) rescued yCRM1 binding to a comparable level as yRanBP1 (Figure 6D, lane 6,7). Taken together, both the N-terminus and CRM1 interacting region of animal RanBP1 are incompatible for trimeric complex formation.
Similarly, several regions of CRM1 were mutated to identify critical sequence changes that abolished the formation of trimeric complex in animals. In the yRanBP1 binding interface, side chain of the strictly conserved yCRM1 T753 is in close contact with yRanBP1 V150 (Figure 6C). The corresponding residue in human is Q742, being strictly conserved in animals. Pull down results showed that Q742T mutation partially rescued binding between hCRM1 and yRanBP1-RanGTP (Figure 6E, lane 3). Similarly, T753Q or T753G mutation in yCRM1 also reduced its binding to yRanBP1-RanGTP (Figure 6E, lane 5–8). V739A mutation in hCRM1 (V739 equivalent residues in yCRM1 is A), however, did not rescue binding (Figure 6E, lane 2).
Besides the yRanBP1 interaction surface discussed above, yRanBP1 binds to yCRM1 indirectly through RanGTP. Human RanGTP forms 26 hydrogen bonds with yCRM1 in yRanBP1-hRan-yCRM1 structure (Figure 6—figure supplement 2), and those residues that form hydrogen bonds are strictly conserved in yeast Ran (Figure 6—figure supplement 3). However, six hydrogen bonds are predicted to be lost if yCRM1 is replaced with hCRM1 (Figure 6F, Figure 6—figure supplement 4). Five hydrogen bonds are contributed by N-terminal residues (E172, Q42, N116) in yCRM1, and one by a C terminal residue (D947) (Figure 6F, Figure 6—figure supplement 2). Instead of making single mutations individually, the N-terminal 200 residues of hCRM1 were replaced with yeast equivalent residues 1–188, and the chimera protein (hCRM1N_swap) was able to weakly bind to yRanBP1-RanGTP (Figure 6E, lane 4). Similarly, when the N-terminal 1–188 region of yCRM1 was replaced by human equivalent N-terminal region 1–200 (yCRM1N_swap), binding to yRanBP1-RanGTP was significantly reduced (Figure 6E, lane 9). Pull down assay did not produce a significant difference by further mutating D947 (data not shown). Therefore, loss of binding between hCRM1 and yRanBP1-RanGTP is due to sequence divergence of hCRM1 from yCRM1, including the RanBP1 contact surface and Ran contact surfaces.
Identified mutations play important roles in RanBP1 localization and nuclear export of cargo
Previously, we showed that yeast RanBP1 is localized in the nucleus in HeLa cells. When yCRM1 was co-transfected with yRanBP1, yRanBP1 was significantly (p<0.0001) relocalized to the cytoplasm (Figure 7A,B), suggesting that yCRM1 but not endogenous hCRM1 formed a nuclear export complex with yRanBP1. In contrast, co-transfected yCRM1T753Q, the mutant that displayed reduced binding to yRanBP1-RanGTP by pull down, barely promoted nuclear export of yRanBP1 (p<0.0001). Similarly, the predominantly nucleus-localized tipple mutant of NESmut (NESmut) was significantly (p<0.0001) exported to the cytoplasm when co-transfected with yCRM1, but not yCRM1T753Q (Figure 7C,D). These cellular studies fully recapitulated what was observed by pull down (Figure 6), supporting the molecular mechanism for loss of trimeric complex formation in animals.

Residues that play important roles in RanBP1 localization and nuclear export of cargo.
(A) mCherry tagged yRanBP1 was transfected alone or co-transfected with EGFP-yCRM1 or EGFP-yCRM1T753Q mutant, and visualized under microscope. (B) Quantification and statistical analysis of yRanBP1 localization in 7A. Ratio of nuclear yRanBP1 for each cell is calculated as its nuclear intensity divided by total cellular intensity. Error bars represent standard deviation of each set of data containing measurements from at least 30 cells. (C) mCherry tagged NESmut was transfected alone or co-transfected with EGFP-yCRM1 or EGFP-yCRM1T753Q mutant, and visualized under microscope. (D) Quantification and statistical analysis of NESmut localization in 7C. (E) Subcellular localization of endogenous RanBP1, NFκB and transfected mCherry-NLS under the treatment of siCRM1 and transfection of different EGFP-CRM1 constructs. mCherry-NLS is constructed as mCherry-NESPKI-MBP-NLSSV40 in pmCherry-C1 plasmid. (F–H) Quantification and statistical analysis of nuclear ratio of RanBP1, NFκB and mCherry-NLS in 7E.
Endogenous human RanBP1 knock-down and further rescue with mCherry-tagged yRanBP1, yRanBP1V150A, mRanBP1, ΔC or NESmut did not change the localization of endogenous CRM1, the nuclear export cargo NFκB and the transfected nuclear import cargo GFP-NLS (Figure 7—figure supplement 1). This is probably due to the presence of functionally redundant RanBP2 in mammals (Villa Braslavsky et al., 2000), though RanBP1 is reported to be an essential gene in yeast (Petersen et al., 2000). Cargo’s proper localization also suggests that the nucleus concentration of mis-localized RanBP1 is probably too low to disrupt the cellular RanGTP gradient (which is critical for nuclear transport) (Izaurralde et al., 1997). On the other hand, cytoplasmic localization of endogenous RanBP1 and NFκB was inhibited by siCRM1, which could be rescued by the expression of either hCRM1 and yCRM1T753Q, but not yCRM1 and hCRM1Q742T (Figure 7E–G). Though hCRM1Q742T is much more like hCRM1 than yCRM1T753Q in sequence, function-wise the opposite is true, suggesting that Q742 (T753 in yeast) is an important function-defining residue. Moreover, hCRM1Q742T displayed strong nuclear rim staining in all acquired images (Figure 7E), which might be due to the formation of weakly GAP-resistant CRM1-RanGTP-RanBP2 trimeric complex. Negative control using transfected mCherry-NLS displayed no localization changes under siCRM1 and different rescue conditions (Figure 7H).
Higher efficiency of nuclear transport in human cells
We previously showed that when CRM1 is limited, yeast proteins (that form tight trimeric complex) are less efficient than human proteins in nuclear export of cargoes. However, one might argue that yeast proteins are innately less efficient when used in human cells. We therefore performed a similar experiment using all yeast proteins, that is WT proteins that form trimer, and mutant yeast proteins that do not (Figure 8A). The mutations include yCRM1T753Q and yRanBP1V150A, which inhibits trimer formation (Figure 6D,E), and fusion of NESmRanBP1 to C-terminus of yRanBP1V150A to prevent nuclear accumulation of yRanBP1. Statistical analysis showed a faster nuclear export rate for mutant than WT proteins (Figure 8B), reconfirming that the nuclear export rate is higher when not forming tight trimer.

Mammalian nuclear transport system has higher efficiency.
(A) Nuclear export of GST-NES-NLS in the presence of yCRM1/yRan/yRanBP1 or their mutants (yCRM1T753Q, yRan, yRanBP1V150A and fused with mRanBP1’s NES). Protocol used in this experiment is similar as in Figure 3C. (B) Quantification of nuclear cargo intensity normalized by DNA in Figure 7E. Shown also includes unpaired student t-test between WT and mutant samples at each time point. Error bars represent standard error of measurements for each set of data containing measurements from at least 23 cells. Only 15 m and 30 m samples display statistical significances (** denotes p<0.01). (C) Representative images of GFP-NLS and mCherry-NES localization in human (HeLa) and yeast cells (W303.1a). pRS416 (for yeast transfection), pEGFP-C1 and pmCherry-C1 (for human transfection) plasmids were used to express fluorescent tagged NES or NLS proteins. mCherry-NES is constructed as mCherry-NESPKI-MBP-NLSSV40. GFP-NLS is constructed as GFP-NESPKI-MBP-NLSBPSV40. (D) Quantification and statistical analysis of nuclear cargo ratio in 8C.
By doubling the energy expenditure, animal cells may be able to do 'more work' and could export against a higher nucleo-cytoplasmic concentration difference. To test this hypothesis, we analyzed the subcellular localization of transfected GFP-NLS and mCherry-NES in human (HeLa) and yeast cells. Astonishingly, while mCherry-NES showed predominant cytoplasmic localization (22% nuclear) in human cells, the same protein in yeast cells showed much higher nucleus localization level (43% nuclear) (Figure 8C,D), though mCherry-NES bound to yeast and human CRM1 transportors with similar strength (Figure 8—figure supplement 1). Similarly, GFP-NLS, which displayed similar binding strength to human and yeast transportors (Figure 8—figure supplement 1), was much less nucleus localized in yeast cells (59% nuclear) compared to in human cells (82% nuclear) (Figure 8C,D). In addition, mCherry-NES were expressed at very low level in yeast cells compared to mammalian cells (Figure 8—figure supplement 2A), while the Ran and CRM1 concentrations in both cells are comparable (Figure 8—figure supplement 2B,C), suggesting that the lower export efficiency in yeast should not be due to saturation of export capacity. In summary, these results advocate the notion that nuclear transport efficiency is higher in human cells than in yeast cells.
Discussion
Mechanistic difference between fungi and animal RanBP1 nuclear export
Nuclear export of RanBP1 is essential for all eukaryotic cells since excess of RanBP1 in the nucleus sequesters nuclear RanGTP, inhibits nuclear transport and is toxic to cells (Izaurralde et al., 1997; Richards et al., 1996). In both yeast and human, RanBP1 is exported by nuclear export factor CRM1 (19). Though yeast and mammalian proteins are used in this work, the mechanisms revealed in this study should be applicable to fungi and animals. Due to the lack of NES, fungi RanBP1 should form trimeric complex through its RBD interacting with both RanGTP and CRM1. This explains the observation that intact RBD is required for its nuclear export (Künzler et al., 2000). Obviously, NES is not needed for its nuclear export because fungi RBD is sufficient for its nuclear export. In animals, NES but not RBD is required for its export because animal RBD-RanGTP does not bind to CRM1 at sufficient high affinity to be exported. We show that this is due to degeneration of the interface residues essential for the formation of trimeric complex.
Since nucleus is enriched with RanGTP, a tetrameric animal export complex of (RanBP1-RanGTP)-CRM1-RanGTP would form in animals, whereby RanBP1-RanGTP binds to the NES groove of CRM1 (through the NES of RanBP1) as an NES cargo. It should be noted that animal tetrameric complex probably exists only in the nucleus, whereas the fungi trimeric complex could exist both in nucleus and cytoplasm. In the nucleus, animal RanBP1 cargo dissociation activity is inhibited with excessive RanGTP, and it would not dissociate any CRM1 cargo or its own NES before reaching the cytoplasm. When animal RanBP1 tetrameric complex enters the cytoplasm, where RanBP1/RanGAP is present at high concentration and RanGTP at low concentration, the complex would probably be quickly dissembled (shutting off cytoplasmic YFP signals in the BiFC experiment).
Mechanistic difference between fungi and animal RanBP1’s cargo dissociation
In the cytoplasm, fungi and animal RanBP1 also use different mechanisms to displace CRM1 cargoes. Both fungi and animals use RBD domains for cargo dissociation, and we showed that NES of animal RanBP1 is dispensable for cargo dissociation. Fungi RanBP1 binds tightly to RanGTP-CRM1 and closes the NES groove to actively release bound NES. This ends up sequestering available CRM1, before RanGTP is hydrolyzed with the help of RanGAP. In animals, excessive RanBP1 (and RanBP2) in the cytoplasm sequesters RanGTP from the NES-CRM1-RanGTP complex, resulting in a transient low-affinity binary CRM1-NES complex, which dissembles automatically. However, we do not exclude the possibility that a transient complex of animal RanBP1-RanGTP-CRM1 forms like the fungi complex, which actively dissociates NES from CRM1, immediately followed by dissociation of RanBP1-RanGTP-CRM1. In fact, active displacement of cargo was observed previously with the yCRM1 mutant (P754D), which is defective in the stable yRanBP1-yRanGTP-yCRM1 ternary complex formation (Koyama and Matsuura, 2010). Consistent with the proposed cargo dissociation mechanisms, we show that in the presence of RanGAP and RanBP1, yeast but not human CRM1 partially inhibits RanGTP hydrolysis.
Besides dissociating cargo from CRM1, RanBP1 is essential for the disassembly of tightly-bound Ran-karyopherin complexes. In fact, the Ran-sequestering mechanism seems to be more prevalent among RanBP1 mediated RanGTP dissociation from different karyopherins. Only human and yeast Importin β1 (Lounsbury and Macara, 1997; Deane et al., 1997; Floer et al., 1997; Bischoff et al., 1995a), and yeast CRM1 (Künzler et al., 2000; Maurer et al., 2001), form very tight complexes with RanBP1-RanGTP, which are partially GAP resistant. For human importin β2 (Lounsbury and Macara, 1997), importin β3 (Deane et al., 1997), yeast importin 4 (Schlenstedt et al., 1997), human importin 7 (Görlich et al., 1997), human importin 8 (Görlich et al., 1997), human Exportin-1 (Paraskeva et al., 1999; Askjaer et al., 1999), human Exportin-2 (Kutay et al., 1997; Bischoff et al., 1995a) and human exportin-t (Kutay et al., 1998), their affinities with RanGTP-RanBP1 are relatively weak and are effectively dissembled in the presence of RanGAP. In the case of human and yeast KPNB1, NLS is required for efficient release of Ran-RanBP1 for GAP hydrolysis (Bischoff and Görlich, 1997; Floer et al., 1997). For yCRM1, there is no corresponding RanBP1-RanGTP release factor reported thus far.
Biological significances of forming trimeric or tetrameric complex
Apparently, one round nuclear export of fungi RanBP1 costs energy of hydrolysing one GTP, while one round nuclear export of animal RanBP1 costs energy of two GTPs. Since RanBP1 is a constantly shuttling protein, animals may spend significantly more energy than fungi in the long term. We believe that at the same time of suffering this disadvantage in energy consumption, forming tetrameric complex may also confer at least two advantages for animals. First, as mentioned above, forming tetrameric complex does not inhibit GAP mediated hydrolysis, which means faster recycling rate of nuclear export machinery. This possibly further implies less congestion of nuclear pore and faster rate of nuclear transport, or translated into a higher nucleo-cytoplasmic concentration difference of cargoes. Indeed, we found that both nuclear import and export of cargoes were substantially more efficient in human cells than in yeast cells (Figure 8C). Though we showed that this is not due to differences in binding strength to transport receptors nor cargo expression levels in two types of cells, our results do not eliminate other possibilities such as a leakier NPC in yeast; further experiments are needed to fully understand how much the yeast RanBP1 system (which partially inhibits GAP hydrolysis) contributes to the observed lower concentration gradient of cargoes. Second, the interface region and several other regions in fungi have to be conserved in order to maintain trimeric complex formation and export nuclear RanBP1. In animals, the existence of specialized NES in RanBP1 has eliminated that requirement, allowing multiple regions in both RanBP1 and CRM1 to diverge and participate in other yet-to-be discovered cellular functions. Compared with fungi, animals are readily mobile and more complex in cellular/tissue organization. Whether the appearance of RanBP1 NES in animals is involved in higher order cellular organization, tissue development or independent mobility, and whether the tetrameric complex plays roles in other processes warrant further studies.
Further, the different mechanisms observed in this study could aid in development of inhibitors against fungi by targeting the critical binding interfaces discussed above to inhibit the formation of trimeric RanBP1 nuclear export complex. Anti-fungal medicines developed by this strategy are potentially safe for human beings, since our RanBP1 nuclear export system does not rely on the formation of the trimeric complex.
Materials and methods
Reagent type (species) or resource | Designation | Source or reference | Catalogue no. | Additional information |
---|---|---|---|---|
Genetic reagent (H. sapiens) | pcDNA 3.1(+) myc-RanWT-CYFP | this study | Used in BiFC | |
Genetic reagent (H. sapiens) | pcDNA 3.1(+) NYFP-RanWT-HA | this study | Used in BiFC | |
Genetic reagent (H. sapiens) | pcDNA 3.1(+) myc-RanCmut-CYFP | this study | Used in BiFC | |
Genetic reagent (H. sapiens) | pcDNA 3.1(+) NYFP-RanCmut-HA | this study | Used in BiFC | |
Genetic reagent (H. sapiens) | pcDNA 3.1(+) CFP-RanWT | this study | Used in FRET | |
Genetic reagent (H. sapiens) | pcDNA 3.1(+) myc-RanWT | this study | Used in FRET | |
Genetic reagent (H. sapiens) | pcDNA 3.1(+) hRanBP1Δlinker-NLS | this study | Used in FRET | |
Genetic reagent (H. sapiens) | pcDNA 3.1(+) hRanBP1ΔNES-NLS | this study | Used in FRET | |
Genetic reagent (M. musculus) | pcDNA 3.1(+) NLS-mRanBP1 | this study | Used in BiFC | |
Genetic reagent (M. musculus) | pcDNA 3.1(+) NLS-NESmut | this study | Used in BiFC | |
Antibody | Rabbit anti-HA | Cell Signalling | 3724 | |
Antibody | Mouse anti-Myc | ProteinTech | 60003–2-Ig | |
Antibody | Alexa 647 labelled Anti-Rabbit IgG | ThermoFisher | A-21244 | |
Antibody | Dylight 405 labelled Anti-mouse IgG | Beyontime | A0609 | |
Antibody | Anti-GST | Santa Cruz | sc-138 | |
Antibody | Anti-RanBP1 | ProteinTech | 27804–1-AP | |
Antibody | Anti-CRM1 | absin | 115104 | |
Antibody | Anti-NFκB | SAB | 48676–1 | |
Chemical compound | Digitonin | Abcam | ab141501 |
Cloning, protein expression and purification
Request a detailed protocolThe human, mouse or yeast RanBP1 (or their mutants) was cloned into a pGEX-4T1 based expression vector incorporating a TEV-cleavable N-terminal GST-tag fusion. The plasmid was transformed into Escherichia coli BL-21 (DE3) and grown in LB Broth medium. Expression of protein was induced by the addition of 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG), and the culture was grown overnight at 18 ˚C. Cells were harvested and sonicated in lysis buffer (50 mM Tris pH 8.0, 200 mM NaCl, 10% glycerol, 2 mM DTT, 1 mM EDTA and 1 mM PMSF). RanBP1 was purified on a GST column and eluted after TEV cleavage in a buffer containing 20 mM Tris pH 8.0, 200 mM NaCl, 10% glycerol, 1 mM EDTA and 2 mM DTT. This was followed by a Superdex 200 increase gel filtration column on the ÄktaPure (GE Healthcare) using the gel filtration buffer (20 mM Tris pH 8.0, 200 mM NaCl, 10% glycerol, 2 mM DTT). Eluted proteins were frozen at −80°C at 5–10 mg/ml. Alternatively, GST-RanBP1 was eluted with 20 mM Tris pH 8.0, 200 mM NaCl, 1 mM EDTA, 2 mM DTT, 10 mM reduced glutathione, and purified by Superdex 200 increase column. Both mouse and human RanBP1 have been used in this study and they are highly similar (95% identity, Figure 1—figure supplement 4). ΔC construct contains deletion of C terminal residues’ PGKNDNAEKVAEKLEALSVREAREEAEEKSEEKQ’. His-tagged proteins (human and yeast CRM1 and related mutants) were expressed in E. coli grown in TB Broth medium. The proteins were induced in the presence of 0.5 mM IPTG overnight at 25 ˚C, and purified by Nickel beads. 6 × His tagged proteins were eluted with 300 mM Imidazole pH 7.5, 300 mM NaCl, 10% glycerol, and 2 mM BME.
Pull down assay
Request a detailed protocolAll proteins used were purified by S200 prior to pull down. To assess different interactions, GST-tagged proteins were immobilized on GSH beads. For GST-RanBP1, a wash step was performed immediately after immobilization to remove unbound GST-RanBP1. Soluble proteins at indicated concentrations were incubated with the immobilized proteins in a total volume of 1 ml for two hours at 4°C. After two washing steps, bound proteins were separated by SDS/PAGE and visualized by Coomassie Blue staining. Each experiment was repeated at least twice and checked for consistency. The pull down buffer contains 20 mM Tris pH 8.0, 200 mM NaCl, 10% glycerol, 5 mM MgCl2, 0.005% Triton-X100, and 5 mM DTT if not specified. RanWT contains about 95% RanGDP and is used as RanGDP (Zhang et al., 2018). Human RanL182A and yeast RanL184A used in this paper are C-terminus destabilized, therefore loaded with more than 80% of GTP, and are used as RanGTP (Zhang et al., 2018).
Isothermal Titration Calorimetry (ITC)
Request a detailed protocolITC experiments were conducted at 20°C using ITC200 (Microcal) in a buffer containing 20 mM Tris pH 8.0, 200 mM NaCl and 5 mM MgCl2. Q69L and L182A double mutant of Ran were used in this assay because this Ran mutant is 100% GTP bound (Zhang et al., 2018). For animal complex, 250 µM Ran was titrated into the sample cell containing 20 µM hCRM1 and 20 µM mRanBP1. For yeast complex, 150 µM Ran was titrated into the sample cell containing 15 µM yCRM1 and 15 µM yRanBP1. Each experiment was repeated at least twice. Data were processed by NITPIC (Scheuermann and Brautigam, 2015) and fitted by SEDPHAT (Houtman et al., 2007).
Subcellular localization imaging
Request a detailed protocolpEGFP-C1 and pmCherry-C1 plasmids were used to express EGFP or mCherry-tagged CRM1 or RanBP1 constructs. HeLa and 293 T cells were obtained from the Cell Bank of Chinese Academic of Sciences (Shanghai, China). HeLa cells were maintained in Dulbecco’s modified Eagles medium (Hyclone) supplemented with 10% (vol/vol) fetal bovine serum (Biological Industries). For experiments without siRNA, cells were transfected with TurboFect transfection reagent (ThermoFisher) and fixed after 24 hr of transfection. For siRNA work, cells were first transfected with siRanBP1 (GGGCAAAACUGUUCCGAUUUG) or siCRM1 (CUCAGAAUAUGAAUACGAATT) using Lipo2000 (ThermoFisher) (Fan et al., 2011). After 24 hr, cells were transfected with different plasmids in the presence of polyethylenimine (PEI) transfection reagent. Cells were visualized 48 hr after the second transfection. Antibodies against RanBP1 (ProteinTech, 1:400), CRM1 (absin, 1:400), NFκB (SAB, 1:250), HA (CST, 1:1000), and Myc (ProteinTech, 1:1000) were used. Images were acquired by Olympus FV-1000 confocal microscope, and were analyzed using NIH ImageJ and Graphpad software.
Bimolecular fluorescence complementation
Request a detailed protocolNYFP-RanWT-HA, Myc-RanWT-CYFP, NYFP-RanCmut-HA and Myc-RanCmut-CYFP were cloned into pCDNA3.1(+) expression vectors. 293 T cells were seeded in 24-well plates containing circular coverslips slides in Dulbecco’s modified Eagles medium (Hyclone) supplemented with 10% (vol/vol) fetal bovine serum (Biological Industries), 100 U/mL penicillin and 100 μg/mL streptomycin in a 5% CO2 atmosphere at 37°C. Twenty-four hours later, cells were transfected with plasmids in 1 mg/ml PEI (Polyethylenimine, Polysciences) transfection reagent. After another 24 hr, cells were treated with 25 µM biliverdin to boost the YFP signals. Two hours later, cells were fixed and incubated with the primary antibody anti-HA (CST, rabbit) and anti-Myc (ProteinTech, mouse), then with secondary antibody anti-mouse (Beyotime, Dylight 405) and anti-rabbit (ThermoFisher, Cy5). Images were acquired by Olympus FV-1000 confocal microscope, and analyzed using NIH ImageJ software.
GAP hydrolysis assay
Request a detailed protocolHuman (0.4 µM) or yeast wide type Ran (0.3 µM) protein was first mixed with hRanBP1 (1 µM) or yRanBP1 (1 µM), respectively. Then samples were briefly incubated with or without 1 µM CRM1 from respective species. Since Ran has a very slow intrinsic nucleotide exchange rate, 0.5 µM RCC1 and 100 µM of GTP was added to reload Ran with GTP after each cycle of GAP-mediated hydrolysis in all samples. The samples were then incubated with 0.3 µM yeast RanGAP for 0, 15, 45 and 75 min. Control samples were done with 1 µM CRM1, 1 µM GST-PKI and 0. 3 µM of Ran for both species. The amount of free phosphate generated was measured using GTPase assay kit (Bioassay) and Multiskan FC microplate reader (ThermoFisher). Each reaction was repeated four times in parallel.
In vitro nuclear export using semi-permeabilized cells
Request a detailed protocolWe performed in vitro nuclear export experiment with slight modifications (Cassany and Gerace, 2009). First, 1 µM GST-NESPKI-NLSIBB (GST-NES-NLS), 1 µM KPNB1, 1 µM NTF2, 1 × energy regeneration system (Cassany and Gerace, 2009), 0.01% Triton-X100, and 2 µM of hRan were added to semi-permeabilized HeLa cells and incubated at room temperature for 60 mins to accumulate nuclear cargoes. The very low concentration of Triton-X prevents non-specific cytoplasmic binding, but does not permeate nuclear envelopes (Figure 3—figure supplement 1). After washing, the cells were incubated with either human or yeast proteins (0.1 µM CRM1, 1 µM Ran and 1 µM RanBP1), energy regeneration system, 0.01% Triton-X, for different time points at room temperature with gentle shaking. After reaction, the cells were washed, fixed and visualized by immunostaining with GST antibody (Santa Cruz, 1:400). Statistics were based on measurements from at least 30 cells for each sample, and statistical significance was calculated by one-way ANOVA test in Graphpad software.
Conclusion
Request a detailed protocolIn summary, we have shown that animal RanBP1 binds to CRM1 only in the nucleus where there is excessive RanGTP, and forms a complex with CRM1 and two RanGTP proteins through its NES but not RBD. This complex is stable and is exported to the cytoplasm where it is dissembled by RBD containing proteins and RanGAP. In contrast to the CRM1-RanGTP sequestering cargo dissociation mechanism in fungi, animal RanBP1 dissociates cargo through stripping RanGTP from nuclear export complexes. The key difference between fungi and animals is that animal RanBP1-RanGTP does not bind to CRM1 as it does in fungi, due to degeneration of interface residues on both CRM1 and RanBP1, though either change is sufficient to reduce binding. The different mechanisms of RanBP1 nuclear export highlight how animals increase catalysis rate on the expense of more energy consumption. It is unexpected and interesting that while essential functions of orthologous proteins are conserved, profound differences exist in the underlining mechanisms.
Data availability
All data generated or analysed during this study are included in the manuscript and supporting files.
References
-
RanGTP-regulated interactions of CRM1 with nucleoporins and a shuttling DEAD-box helicaseMolecular and Cellular Biology 19:6276–6285.https://doi.org/10.1128/MCB.19.9.6276
-
The nuclear pore complex: understanding its function through structural insightNature Reviews Molecular Cell Biology 18:73–89.https://doi.org/10.1038/nrm.2016.147
-
Reconstitution of nuclear import in permeabilized cellsMethods in molecular biology 464:181–205.https://doi.org/10.1007/978-1-60327-461-6_11
-
Ran-binding protein 5 (RanBP5) is related to the nuclear transport factor importin-beta but interacts differently with RanBP1Molecular and Cellular Biology 17:5087–5096.https://doi.org/10.1128/MCB.17.9.5087
-
RanGTP targets p97 to RanBP2, a filamentous protein localized at the cytoplasmic periphery of the nuclear pore complexMolecular Biology of the Cell 8:2379–2390.https://doi.org/10.1091/mbc.8.12.2379
-
A supraphysiological nuclear export signal is required for parvovirus nuclear exportMolecular Biology of the Cell 19:2544–2552.https://doi.org/10.1091/mbc.e08-01-0009
-
Induction of ran GTP drives ciliogenesisMolecular Biology of the Cell 22:4539–4548.https://doi.org/10.1091/mbc.e11-03-0267
-
Disassembly of RanGTP-karyopherin beta complex, an intermediate in nuclear protein importJournal of Biological Chemistry 272:19538–19546.https://doi.org/10.1074/jbc.272.31.19538
-
Putative reaction intermediates in Crm1-mediated nuclear protein exportJournal of Biological Chemistry 274:16279–16286.https://doi.org/10.1074/jbc.274.23.16279
-
Atomic basis of CRM1-cargo recognition, release and inhibitionSeminars in Cancer Biology 27:52–61.https://doi.org/10.1016/j.semcancer.2014.03.002
-
A novel class of RanGTP binding proteinsThe Journal of Cell Biology 138:65–80.https://doi.org/10.1083/jcb.138.1.65
-
Dissection of a nuclear localization signalJournal of Biological Chemistry 276:1317–1325.https://doi.org/10.1074/jbc.M008522200
-
CRM1-mediated recycling of snurportin 1 to the cytoplasmThe Journal of Cell Biology 145:255–264.https://doi.org/10.1083/jcb.145.2.255
-
Random mutagenesis and functional analysis of the Ran-binding protein, RanBP1Journal of Biological Chemistry 275:4081–4091.https://doi.org/10.1074/jbc.275.6.4081
-
Facilitated nucleocytoplasmic shuttling of the ran binding protein RanBP1Molecular and Cellular Biology 20:3510–3521.https://doi.org/10.1128/MCB.20.10.3510-3521.2000
-
A nuclear export signal is essential for the cytosolic localization of the ran binding protein, RanBP1The Journal of Cell Biology 134:1157–1168.https://doi.org/10.1083/jcb.134.5.1157
Decision letter
-
Karsten WeisReviewing Editor; ETH Zurich, Switzerland
-
Detlef WeigelSenior Editor; Max Planck Institute for Developmental Biology, Germany
-
Naoko ImamotoReviewer; RIKEN, Japan
In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.
Thank you for sending your article entitled "Distinct RanBP1 nuclear export and cargo dissociation mechanisms between fungi and animals" for peer review at eLife. Your article has been evaluated by two peer reviewers and the evaluation has been overseen by a Reviewing Editor and Andrea Musacchio as the Senior Editor.
Summary:
This paper studies the mechanism of how RanBP1 triggers the cargo release from the nuclear export receptor Crm1. The authors find that – despite very high sequence conservation – animal RanBP1 functions differently than its yeast counterpart. Intriguingly, the animal protein seems to require two RanGTP molecules for complex dissociation, which would argue that nuclear protein export in animals requires twice as much energy as in yeast.
While the paper contains interesting observations for the field, there are several weaknesses that the authors will have to address before the paper can be considered for publication.
Essential revisions:
1) The paper largely describes the differences between the animal and yeast complexes but the physiological relevance of the findings remains unclear. The authors discuss some of the implications but it would be important to test at least some of these possibilities. Of note, by doubling the energy expenditure, animal cells should be able to do 'more work' and could export against a higher concentration difference. Is there any evidence that this is the case in animal cells?
2) On a similar note, can yeast cells lacking yCRM1 and yRanBP1 be complemented with the two animal counterparts (or vice versa)? Or does the triple mutant rescue the yeast deletion?
3) Why do both ΔNES and ΔC trigger cargo release, yet both these domains are required for efficient binding? What is the phenotype of ΔNES or ΔC mutants when expressed in tissue culture upon knockdown of the endogenous proteins?
4) It is not satisfying that the authors write, we 'believe' that the NES doesn't contribute to dissociation vial competition (subsection “Mouse RBD dissociates cargo through sequestering RanGTP”). That needs to be more vigorously tested. Similarly, they write that the C-terminus is 'required' for CRM1 cargo dissociation. It would be correct to say it is sufficient, but they don't show that it is required (as ΔC still dissociates in vitro). As mentioned above (point 1) it would be important to test whether the C-terminus is needed in vivo.
5) Why does the stable BIFC complex remain in the nucleus at steady state? If functional, it might be expected that the artificial Ran dimer might get stuck in the cytoplasmic after export? Is the BIF Ran complex functional and can it still shuttle? Also, the cells in Figure 5 (particularly the 3rd row) do not look very healthy and the results should be quantified.
6) The description of the in vitro nuclear export assay (in the Materials and methods) is not adequate and it remains unclear how these experiments were performed. Do they first perform nuclear import reactions, then a nuclear export reaction (after washing the cells)?
7) What is the export substrate for these transport assays (it cannot be IBB)?. Also, do they use similar a protocol in Figure 3 and Figure 7? Moreover, why do they use Triton-X100? Triton-X100 permeabilizes the nuclear envelope. If Triton-X100 is used, the authors need to include extensive control experiments to demonstrate that the nuclear envelope is intact in their assay system.
8) The authors need to show the evidence that their CYFP or NYHP tagged Ran is functional.
9) The authors claim "animal CRM1's H9 loop is far from NES groove, thus opening its NES groove for interaction with NES of RanBP1". The authors need to show the evidence for this claim.
10) The paper is very difficult to read. It is full of grammatical errors and needs extensive proofreading. Also, the authors start with a statement that they wanted to solve the X-ray structure of RanBP1 complexes but then they never did this or don't state why they didn't do this etc.
[Editors' note: further revisions were requested prior to acceptance, as described below.]
Thank you for resubmitting your article "Distinct RanBP1 nuclear export and cargo dissociation mechanisms between fungi and animals" for consideration by eLife. Your revised article has been reviewed by one peer reviewer, and the evaluation has been overseen by a Reviewing Editor and Ivan Dikic as the Senior Editor. The reviewers have opted to remain anonymous.
The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.
Whereas the reviewers still feel that the observations described in this manuscript are potentially of interest to the field, unfortunately, they were not satisfied by your revisions.
1) The choice of Triton X-100 for the in vitro transport assay remains problematic as it is expected to permeabilize the nuclear envelope and the provided supplementary figure is not sufficient to alleviate this concern. Why don't they use digitonin? For permeabilization with Triton X-100 additional control experiments are needed. That would include the addition of non-NPC permeable dyes to demonstrate that the nuclear envelope is fully intact.
2) The reviewers were concerned about the functionality of the N- and C-terminally tagged Ran variants. The provided pull-down experiment does not fully address this concern. The appropriate experiment would be to perform an endogenous Ran knockdown to test for rescue by the Ran-variants used in this study.
3) The interpretation of the import experiments examining the nuclear/cytoplasmic localization of expressed SV40 T-NLS or PKI-NES substrate in mammalian cells and yeast cells is difficult. The SV40 T NLS has a weaker binding activity for yeast importin α compared to mammalian importin. Also, although the PKI NES apparently display a similar binding activity with yeast CRM1 and mammalian CRM1 in Figure 8—figure supplement 1, binding was only examined at one protein concentration (this is not "affinity"). In addition, the expression levels of NES substrate versus endogenous CRM1/RanGTP proteins in yeast and mammalian cells should be examined.
https://doi.org/10.7554/eLife.41331.031Author response
Essential revisions:
1) The paper largely describes the differences between the animal and yeast complexes but the physiological relevance of the findings remains unclear. The authors discuss some of the implications but it would be important to test at least some of these possibilities. Of note, by doubling the energy expenditure, animal cells should be able to do 'more work' and could export against a higher concentration difference. Is there any evidence that this is the case in animal cells?
We really thank the reviewer for this comment. We measured the nuclear-cytoplasmic ratio for transfected cargoes in yeast and human cells, and compared them. Interestingly, the same cargoes that predominantly localize to the cytoplasm and nucleus in animals cells are localized at much lower nucleo-cytoplasmic concentration difference, suggesting possibly more efficient nuclear transport system in animals (new Figure 8C), though these cargoes binds to transport receptors with similar affinity (new Figure 8—figure supplement 1). These are added as Figure 8C, D, and we added a few lines of discussion (subsection “Biological significances of forming trimeric or tetrameric complex”) and a new paragraph describing the obtained results in the subsection “Higher efficiency of nuclear export and import in mammals”.
2) On a similar note, can yeast cells lacking yCRM1 and yRanBP1 be complemented with the two animal counterparts (or vice versa)? Or does the triple mutant rescue the yeast deletion?
We thank the reviewer for this suggestion. We failed to obtain temperature sensitive yeast strains. However, we successfully performed knock down experiments of the endogenous CRM1 or RanBP1 in mammalian cells and rescues with either human or yeast constructs mentioned. Though yRanBP1 is an essential gene, human RanBP1 knock down and co-comitant transfection of various mammalian or yeast RanBP1 proteins (WT or mutants) did not affect cellular localization of CRM1, nuclear export cargo (NFκB) and nuclear import cargo (GFP-NLS), likely because that there is functional redundant gene RanBP2 in mammals (PMID: 27160050). This result also indicates that the expression level of RanBP1 is probably too low to disrupt cellular RanGTP gradient, in order to show any cargo localization defects. These results are added as Figure 7—figure supplement 1.
On the other hand, cytoplasmic localization of endogenous RanBP1 and NFκB was perturbed by siCRM1, which could be rescued by expression of either hCRM1 and yCRM1T753Q but not yCRM1 and hCRM1Q742T (new Figure 7E-G). It is quite surprising because hCRM1Q742T is much more like hCRM1 than yCRM1T753Q in sequence, however function-wise the opposite is true. This suggests that the mutation hCRM1Q742T (or yCRM1T753Q) play important roles in protein function. Negative control using transfected mCherry-NLS displayed no localization change under siCRM1 and different rescue conditions (new Figure 7H). These results were described in a new paragraph in the subsection “Identified mutations play important roles in RanBP1 localization and nuclear export of cargo”.
3) Why do both ΔNES and ΔC trigger cargo release, yet both these domains are required for efficient binding? What is the phenotype of ΔNES or ΔC mutants when expressed in tissue culture upon knockdown of the endogenous proteins?
We actually demonstrated that ΔNES and ΔC are neither essential (Figure 1E) nor sufficient (Figure 1C) for binding to CRM1-RanGTP (subsection “Mouse RanBP1’s NES is necessary for CRM1 binding and its nuclear export”).
Knock down endogenous RanBP1 and rescue with ΔNES and ΔC mutants mis-localized the protein to the nucleus (Figure 1F, Figure 7—figure supplement 1). As explained in (2), it did not affect the nuclear transport of cargo, probably due to the presence of functionally redundant RanBP2 and relatively low expression level.
4) It is not satisfying that the authors write, we 'believe' that the NES doesn't contribute to dissociation vial competition (subsection “Mouse RBD dissociates cargo through sequestering RanGTP”). That needs to be more vigorously tested. Similarly, they write that the C-terminus is 'required' for CRM1 cargo dissociation. It would be correct to say it is sufficient, but they don't show that it is required (as ΔC still dissociates in vitro). As mentioned above (point 1) it would be important to test whether the C-terminus is needed in vivo.
Thank you for this comment. We performed a more vigorous cargo dissociation experiment (Figure 2A) with a concentration gradient of different RanBP1s to support our argument. This is the new Figure 2—figure supplement 1. We also rewrote this paragraph as: “Pull down assay showed that ΔC or NESmut dissociated cargoes as potently as WT mRanBP1 (Figure 2A, Figure 2—figure supplement 1), suggesting that NES of mRanBP1 is dispensable for cargo dissociation. […] Taken together, we conclude that mRanBP1 does not dissociate cargo through direct competition of cargo’s NES.”
We actually wrote that “ΔC” is required, not “C terminus”. We replaced ‘ΔC’ with ‘the Ran binding domain’ to avoid confusion. Without C-terminus, the proteins is mis-localized to the nucleus. Please refer to our replies to point 2 and 3.
5) Why does the stable BIFC complex remain in the nucleus at steady state? If functional, it might be expected that the artificial Ran dimer might get stuck in the cytoplasmic after export? Is the BIF Ran complex functional and can it still shuttle? Also, the cells in Figure 5 (particularly the 3rd row) do not look very healthy and the results should be quantified.
Thanks for this comment. Only nucleus has high concentration of RanGTP, which is the prerequisite of RanBP1 tetramer formation. At steady state, probably a fraction of the tetramer is unexported (yet to be exported), which is observed. The transiently formed YFP would probably dissociate after Ran dimer dissociated from the complex in the cytoplasm, since we did not observe cytoplasmic YFP signal. As CRM1 is untouched, we believe that the complex could still shuttle through the NPC as other CRM1 complexes. The tetramer might have undiscovered function in the cytoplasm (or the nucleus). The tetramer should have short cytoplasmic life, and probably would be quickly dissembled, though a small fraction might be able to shuttle back to the nucleus before being dissembled. We modified/added more discussion as: “In the nucleus, animal RanBP1 cargo dissociation activity is inhibited with excessive RanGTP and it would not dissociate any CRM1 cargo or its own NES before reaching the cytoplasm. When animal RanBP1 tetrameric complex enters the cytoplasm, where RanBP1/RanGAP is present at high concentration and RanGTP at low concentration, the complex would be probably quickly dissembled (shutting off cytoplasmic YFP signal in the BiFC experiment).”
We repeated the whole experiment in Figure 5, replaced those figures with better quality figures and quantify those results as suggested.
In addition, we performed FRET analysis using florescent labelled Ran proteins to demonstrate tetramer formation in the nucleus. The data showed that FRET is stronger for cells transfected with RanBP1Δlinker-NLS than RanBP1ΔNES-NLS (new Figure 5—figure supplement 2), suggesting the existence of nuclear tetramer. A few sentences describing the data is added in the subsection “Detection of RanBP1 tetramer in the nucleus”.
6) The description of the in vitro nuclear export assay (in the Materials and methods) is not adequate and it remains unclear how these experiments were performed. Do they first perform nuclear import reactions, then a nuclear export reaction (after washing the cells)?
Thanks for this comment. The export is done after nuclear import and washing the cells. We rewrote this paragraph with reference to the previous studies and made further description/explanations in the subsection “In vitro nuclear export using semi-permeabilized cells”.
7) What is the export substrate for these transport assays (it cannot be IBB)?. Also, do they use similar a protocol in Figure 3 and Figure 7? Moreover, why do they use Triton-X100? Triton-X100 permeabilizes the nuclear envelope. If Triton-X100 is used, the authors need to include extensive control experiments to demonstrate that the nuclear envelope is intact in their assay system.
Thanks for the reviewer that pointed this out. The export substrate is GST-NESPKI-NLSIBB but not GST-IBB. We corrected this error in the Materials and methods (subsection “In vitro nuclear export using semi-permeabilized cells”). Yes we used similar protocols in Figure 3 and Figure 7 (added in Figure 8 legend). The very low concentration of Triton-X is used to prevent non-specific cytoplasmic binding. We provided control images to prove that the nuclear envelope is intact (see Figure 3—figure supplement 1).
8) The authors need to show the evidence that their CYFP or NYHP tagged Ran is functional.
Thanks for suggesting this experiment. We performed a RanBP1 pull down and western blot experiment to show that the two tagged Ran proteins are functional (Figure 5—figure supplement 1).
9) The authors claim "animal CRM1's H9 loop is far from NES groove, thus opening its NES groove for interaction with NES of RanBP1". The authors need to show the evidence for this claim.
Sorry for this misleading sentence. It is known that when NES is bound, its H9 loop should be shifted away from NES groove to allow NES binding (PMID: 24631835). We rewrote these sentences as “In this model, unlike the yRanBP1 that contacts both yCRM1 and yRanGTP, animal RanBP1’s RBD only binds RanGTP (but not CRM1). Further, in contrast to H9 loop stabilized closure of NES groove in yeast (17), animal CRM1’s H9 loop would be shifted away from the NES groove (as in pdb 3NC0)(30), opening its NES groove for interaction with NES of RanBP1 (Figure 4A).”
10) The paper is very difficult to read. It is full of grammatical errors and needs extensive proofreading. Also, the authors start with a statement that they wanted to solve the X-ray structure of RanBP1 complexes but then they never did this or don't state why they didn't do this etc.
Thanks for this suggestion. We sent this manuscript to a professional language editor to correct the grammar errors and we made several proof readings. We attempted to solve the crystal structure, but we failed since that it did not form a good complex (Figure 1—figure supplement 2). We rewrote those sentences in the subsection “Mouse and yeast RanBP1 bind to CRM1-RanGTP differently”.
[Editors' note: further revisions were requested prior to acceptance, as described below.]
[…] Whereas the reviewers still feel that the observations described in this manuscript are potentially of interest to the field, unfortunately, they were not satisfied by your revisions.
1) The choice of Triton X-100 for the in vitro transport assay remains problematic as it is expected to permeabilize the nuclear envelope and the provided supplementary figure is not sufficient to alleviate this concern. Why don't they use digitonin? For permeabilization with Triton X-100 additional control experiments are needed. That would include the addition of non-NPC permeable dyes to demonstrate that the nuclear envelope is fully intact.
We used Digitonin to permeabilize the cell membrane. Low concentration of Triton-X100 was used to prevent non-specific binding. Triton-X is much cheaper than digitonin, and more stable than BSA and Digitonin when prepared in large stock on shelf. As the reviewer suggested, we now used anti-PARP antibody to test whether the nuclear envelope are permeabilized. The results showed that the envelope is intact in low Triton-X100 condition. (added in Figure 3—figure supplement 1) Together with previous data (nuclear import level is similar in the presence of BSA or low Triton-X), we hope it is acceptable that low concentration of Triton-X could be used as a buffer supplement for preventing non-specific binding. We thank the reviewer for suggesting this experiment.
2) The reviewers were concerned about the functionality of the N- and C-terminally tagged Ran variants. The provided pull-down experiment does not fully address this concern. The appropriate experiment would be to perform an endogenous Ran knockdown to test for rescue by the Ran-variants used in this study.
Thanks for suggesting this experiment. We tried to test Ran to look for differences in cargo nuclear export (hopefully this is what the reviewer requested). However, no statistical cargo distribution difference was found (Author response image 1, obviously the rescue experiments also showed similar localization). It is possible that Ran knock down impaired nuclear import and export to similar extent.

Nuclear export of NFκB in the presence of Ran knock down and rescues with Ran fusions.
In addition, we observed that the expressed Ran fusions is much less compared to the WT protein (Author response image 2). Thus, it may be hard to observe a rescue of cellular phenotypes.

Expression level (HeLa cells) of Ran fusions in comparison with endogenous Ran.
The transfection efficiency for each plasmid was about 30%. The bands were stained with Ran antibody. The Ran fusion bands were verified by HA and MYC antibodies.
Since one of the most important functions of Ran is to bind to RanBP1, we devised a more sophisticated pull down assay to show that the two Ran fusion could rescue binding to GST-RanBP1 in the presence of Ran WT knock down (Figure 5—figure supplement 1, replaced the old figure). With these data and similar cellular localization pattern (Figure 5—figure supplement 3), we argue that the Ran variants are not mis-folded when expressed, and that their specific binding to RanBP1 made it possible for us to observe what was presented in Figure 5B, which suggest that Ran could form RanBP1 tetramer in the nucleus.
3) The interpretation of the import experiments examining the nuclear/cytoplasmic localization of expressed SV40 T-NLS or PKI-NES substrate in mammalian cells and yeast cells is difficult. The SV40 T NLS has a weaker binding activity for yeast importin α compared to mammalian importin. Also, although the PKI NES apparently display a similar binding activity with yeast CRM1 and mammalian CRM1 in Figure 8—figure supplement 1, binding was only examined at one protein concentration (this is not "affinity"). In addition, the expression levels of NES substrate versus endogenous CRM1/RanGTP proteins in yeast and mammalian cells should be examined.
We agree with the reviewer that the interpretation of the comparison between mammalian and yeast cells is difficult (subsection “Biological significances of forming trimeric or tetrameric complex”). We repeated the NES/NLS binding assays with more concentrations, which showed that the binding affinities are very comparable between yeast and human (Figure 8—figure supplement 1B). Indeed, SV40NLS binds to human importin α slightly stronger, which would imply more nucleus localization level in human compared to yeast for mCherry-NES. However, Figure 7C right panel showed the opposite, suggesting that the mCherry-NES localization difference was not due to binding strength difference. These were explain in the main text and Figure 8—figure supplement 1 legend.
We observed that the expression level of NES in yeast is rather low compared with mammalian cells (huge difference by western as in Figure 8—figure supplement 2A and by the fact that mCherry signal in yeast is hardly observable under microscope). Unfortunately, our human CRM1/Ran antibodies did not recognize yeast proteins (Figure 8—figure supplement 2B). Published reports showed that CRM1 and Ran are expressed at comparable levels in yeast and human cells (Figure 8—figure supplement 2C). Thus, the lower transport efficiency seen in yeast should not be due to saturating amount of expressed cargoes. This discussion is added to main text as: “In addition, mCherry-NES expression level was about 30 times less in yeast cells compared to mammalian cells (Figure 8—figure supplement 2A), while the Ran and CRM1 concentrations in both cells are similar (Figure 8—figure supplement 2B, C), suggesting that the lower export efficiency in yeast should not be due to saturation of export capacity.”
https://doi.org/10.7554/eLife.41331.032Article and author information
Author details
Funding
National Natural Science Foundation of China (80502629)
- Qingxiang Sun
National Natural Science Foundation of China (31671477)
- Da Jia
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank Dr. Chong Chen, Dr. Yinglan Zhao and Dr. Bao Rui from Sichuan University for helpful discussions. Thanks Dr. Lei Qiu for proofreading this manuscript. This research is supported by Natural Science Foundation of China (NSFC) grants (#80502629 and #31671477).
Senior Editor
- Detlef Weigel, Max Planck Institute for Developmental Biology, Germany
Reviewing Editor
- Karsten Weis, ETH Zurich, Switzerland
Reviewer
- Naoko Imamoto, RIKEN, Japan
Publication history
- Received: August 22, 2018
- Accepted: April 24, 2019
- Accepted Manuscript published: April 25, 2019 (version 1)
- Version of Record published: May 17, 2019 (version 2)
Copyright
© 2019, Li et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 1,477
- Page views
-
- 199
- Downloads
-
- 7
- Citations
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Download links
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Further reading
-
- Biochemistry and Chemical Biology
- Structural Biology and Molecular Biophysics
Doublecortin (DCX) is a microtubule (MT)-associated protein that regulates MT structure and function during neuronal development and mutations in DCX lead to a spectrum of neurological disorders. The structural properties of MT-bound DCX that explain these disorders are incompletely determined. Here, we describe the molecular architecture of the DCX–MT complex through an integrative modeling approach that combines data from X-ray crystallography, cryo-electron microscopy, and a high-fidelity chemical crosslinking method. We demonstrate that DCX interacts with MTs through its N-terminal domain and induces a lattice-dependent self-association involving the C-terminal structured domain and its disordered tail, in a conformation that favors an open, domain-swapped state. The networked state can accommodate multiple different attachment points on the MT lattice, all of which orient the C-terminal tails away from the lattice. As numerous disease mutations cluster in the C-terminus, and regulatory phosphorylations cluster in its tail, our study shows that lattice-driven self-assembly is an important property of DCX.
-
- Biochemistry and Chemical Biology
- Microbiology and Infectious Disease
Listeria monocytogenes uses respiration to sustain a risky fermentative lifestyle during infection.