1. Cell Biology
  2. Physics of Living Systems
Download icon

Distinct roles of nonmuscle myosin II isoforms for establishing tension and elasticity during cell morphodynamics

  1. Kai Weißenbruch  Is a corresponding author
  2. Justin Grewe
  3. Marc Hippler
  4. Magdalena Fladung
  5. Moritz Tremmel
  6. Kathrin Stricker
  7. Ulrich Sebastian Schwarz  Is a corresponding author
  8. Martin Bastmeyer  Is a corresponding author
  1. Zoological Institute, Karlsruhe Institute of Technology (KIT), Germany
  2. Institute of Functional Interfaces (IFG), Karlsruhe Institute of Technology (KIT), Germany
  3. Institute for Theoretical Physics, University of Heidelberg, Germany
  4. BioQuant-Center for Quantitative Biology, University of Heidelberg, Germany
  5. Institute of Applied Physics, Karlsruhe Institute of Technology (KIT), Germany
  6. Institute for Biological and Chemical Systems - Biological Information Processing (IBCS-BIP), Karlsruhe Institute of Technology (KIT), Germany
Research Article
  • Cited 0
  • Views 1,416
  • Annotations
Cite this article as: eLife 2021;10:e71888 doi: 10.7554/eLife.71888

Abstract

Nonmuscle myosin II (NM II) is an integral part of essential cellular processes, including adhesion and migration. Mammalian cells express up to three isoforms termed NM IIA, B, and C. We used U2OS cells to create CRISPR/Cas9-based knockouts of all three isoforms and analyzed the phenotypes on homogenously coated surfaces, in collagen gels, and on micropatterned substrates. In contrast to homogenously coated surfaces, a structured environment supports a cellular phenotype with invaginated actin arcs even in the absence of NM IIA-induced contractility. A quantitative shape analysis of cells on micropatterns combined with a scale-bridging mathematical model reveals that NM IIA is essential to build up cellular tension during initial stages of force generation, while NM IIB is necessary to elastically stabilize NM IIA-generated tension. A dynamic cell stretch/release experiment in a three-dimensional scaffold confirms these conclusions and in addition reveals a novel role for NM IIC, namely the ability to establish tensional homeostasis.

Introduction

The morphodynamics of nonmuscle cells are strongly determined by the contractile actomyosin cytoskeleton, consisting of actin filaments and motor proteins of the nonmuscle myosin II (NM II) class (Burnette et al., 2014; Chen et al., 2010; Gumbiner, 1996; Ingber, 2003; Vicente-Manzanares et al., 2009). Individual NM II hexamers assemble into bipolar filaments of up to 30 hexamers with a typical size of 300 nm, termed myosin minifilaments. These minifilaments can generate tension between antiparallel actin filaments due to their ATP-dependent motor activity. NM II generated forces are transmitted throughout the cell by subcellular structures such as the actomyosin cortex and different stress fiber subtypes (SFs) (Burnette et al., 2014; Hotulainen and Lappalainen, 2006). Since SFs are anchored to the extracellular matrix (ECM) via integrin-based focal adhesions (FAs), adherent cells are able to sense the physical properties of their environment at the cell-substrate interface (Geiger et al., 2009), where high forces can be measured with traction force microscopy (Balaban et al., 2001; Oakes et al., 2017). In a reciprocal fashion, the cells adapt their actomyosin machinery and thereby remodel the cell shape during motion-dependent processes like cell spreading, cell division, or cell migration (Fenix et al., 2016; Svitkina, 2018; Taneja et al., 2020; Vicente-Manzanares et al., 2009; Yamamoto et al., 2019). Accordingly, actomyosin contractility has to be continuously adapted to provide both, short-term dynamic flexibility and long-lasting stability (Ingber, 2003; Mandriota et al., 2019; Matthews et al., 2006).

To precisely tune the contractile output, mammalian cells contain up to three different types of myosin II hexamers, which possess different structural and biochemical features. All hexamer-isoforms, which are commonly termed NM IIA, NM IIB, and NM IIC, contain the same set of light chains but vary with respect to their heavy chains, which are encoded by three different genes (Heissler and Manstein, 2013). While the cell type-dependent expression, structure, and function of NM IIC is still not clear, the loss of NM IIA and NM IIB causes severe phenotypes in the corresponding KO-mice (Conti et al., 2004; Ma et al., 2010; Takeda et al., 2003; Tullio et al., 1997; Tullio et al., 2001; Uren et al., 2000). On the cellular level, the loss of NM IIA drastically impairs SF formation, FA elongation, and cellular force generation, while the loss of NM IIB only causes mild deficiencies during SF and FA consolidation, cell shape stabilization, and force generation (Barua et al., 2014; Beach et al., 2017; Betapudi et al., 2006; Billington et al., 2013; Even-Ram et al., 2007; Jorrisch et al., 2013; Sandquist and Means, 2008; Sandquist et al., 2006; Shutova et al., 2012; Shutova et al., 2017; Vicente-Manzanares et al., 2008; Vicente-Manzanares et al., 2011; Vicente-Manzanares et al., 2007). In addition, NM IIA and NM IIB are well characterized with respect to their structural and biochemical differences: NM IIA propels actin filaments 3.5× faster than NM IIB and generates fast contractions (Kovács et al., 2003; Wang et al., 2000). NM IIB can bear more load due to its higher duty ratio (Pato et al., 1996; Wang et al., 2003). Cell culture studies furthermore revealed that NM IIA and NM IIB hexamers co-assemble into heterotypic minifilaments, with a NM IIA to NM IIB gradient from the front to the rear of the cell (Beach et al., 2014; Shutova et al., 2014). Recent publications provide detailed insights that the composition of these heterotypic minifilaments tune contractility during cell polarization and migration (Shutova et al., 2017) or cytokinesis (Taneja et al., 2020). Given such extensive cellular functions and the ubiquitous expression of the NM II isoforms, it is very important to decipher the interplay of the different NM II isoforms for cell shape dynamics and force generation.

Here, we address this challenge with a quantitative approach that combines cell experiments and mathematical modelling. Using CRISPR/Cas9 technology, we generated isoform-specific NM II-KO cells from the U2OS cell line, which is a model system for the investigation of SFs (Hotulainen and Lappalainen, 2006; Jiu et al., 2017; Lee et al., 2018; Tojkander et al., 2015; Tojkander et al., 2011). The phenotypes of NM IIA- and NM IIB-deficient cells have been extensively characterized on homogenously coated substrates. Here, we focus on structured substrates, which resemble more closely the physiological environment of mesenchymal tissues. We employ collagen gels (Cukierman et al., 2002), micropatterned substrates (Lehnert et al., 2004Bischofs et al., 2008; Kassianidou et al., 2019; Labouesse et al., 2015; Tabdanov et al., 2018; Théry et al., 2006; Zand and Albrecht-Buehler, 1989), and 3D-printed scaffolds (Brand et al., 2017; Hippler et al., 2020). Our results show that – in contrast to a homogenously coated surface – a structured environment can support a cellular phenotype with invaginated actin arcs even in the absence of NM IIA-induced contractility. A quantitative cell shape analysis reveals significant differences between WT, NM IIA-KO, and NM IIB-KO cells. A scale-bridging mathematical model explains these differences based upon the different crossbridge cycling rates of the NM II isoforms. Our analysis suggests that in structured environments, the main role of NM IIA is to dynamically build-up tension that later is elastically stabilized by NM IIB, which is in agreement with reports on homogenous substrates (Heuzé et al., 2019; Sandquist et al., 2006; Shutova et al., 2017; Taneja et al., 2020). A cell stretching assay in 3D-printed scaffolds reveals that this complementary interplay is necessary to generate a stable and long-lasting force output when cells are under mechanical stress. While NM IIC does not seem to play any role for shape determination of single cells, the cell stretching assay reveals that it is required for establishing tensional homeostasis.

Results

CRISPR/Cas9-generated isoform-specific NM II-KO cells reveal the expected phenotypes on homogenously coated substrates

To validate the impact of the different NM II isoforms on the cellular phenotype, we used U2OS cells as standard model for the investigation of SFs (Hotulainen and Lappalainen, 2006; Jiu et al., 2017; Lee et al., 2018; Tojkander et al., 2015; Tojkander et al., 2011) that expresses all three NM II isoforms (Figure 1—figure supplement 1A). We used CRISPR/Cas9 to target the first coding exons of MYH9, MYH10, and MYH14, encoding for NMHC IIA, NMHC IIB, and NMHC IIC, respectively. The loss of protein expression was confirmed by western blot analysis and immunofluorescence (Figure 1—figure supplement 1A and B). Additionally, DNA sequence analysis revealed frameshifts and pre-mature stop codons in exon 2 of MYH9 and MYH10 (Figure 1—figure supplement 1C and D).

Analyzing the NM II-KO phenotypes on substrates homogenously coated with fibronectin (FN) revealed comparable results to previous reports, where NM II isoforms were depleted via RNAi (Cai et al., 2006; Sandquist et al., 2006; Shutova et al., 2017; Thomas et al., 2015; Vicente-Manzanares et al., 2007) or genetic ablation (Bridgman et al., 2001; Conti et al., 2004; Even-Ram et al., 2007; Lo et al., 2004; Ma et al., 2010; Takeda et al., 2003; Tullio et al., 1997).Polarized U2OS WT cells form numerous SFs of different subtypes, as previously described (Hotulainen and Lappalainen, 2006; Figure 1A). Depletion of NM IIA leads to a markedly altered cellular phenotype with a branched morphology and several lamellipodia (Figure 1B; Doyle et al., 2012; Even-Ram et al., 2007; Sandquist et al., 2006; Shih and Yamada, 2010; Shutova et al., 2017). No ordered SF-network is built up and only few ventral SFs remain. Mature, elongated FAs are absent in NM IIA-KO cells (Figure 1E&F and Figure 1—figure supplement 2A and B). The effect of the NM IIB-KO is less severe and does not affect overall cell morphology (Figure 1C). All subtypes of SFs are present, but their distinct cellular localization is missing in many cells. Numerous mature FAs were observed throughout the cell body but their frequency was lower compared to WT cells (Figure 1E and F and Figure 1—figure supplement 2A and B). The depletion of NM IIC did not reveal any phenotypic differences compared to WT cells (Figure 1D–F and Figure 1—figure supplement 2A and B). In addition, the cell area does not significantly differ between WT and NM II-KO cells (Figure 1—figure supplement 2C).

Figure 1 with 4 supplements see all
Phenotypes of NM IIA, NM IIB, and NM IIC-KO cell lines on homogenously coated substrates are very distinct.

(A) U2OS WT cells show a polarized phenotype with prominent dorsal stress fibers (dSF) (1), transverse arcs (tA) (2), and ventral stress fibers (vSF) (3). Mature focal adhesions (FA) are visualized by elongated paxillin clusters that localize at the distal ends of dSF or both ends of vSF. (B) The NM IIA-KO leads to drastic morphological changes and the loss of most SFs and mature FAs. The overall actin structure resembles a dense meshwork of fine actin filaments (1). At the trailing edge, long cell extensions remain (2) and the only bundled actin fibers resemble vSF (3). (C) NM IIB-KO cells reveal slight changes in SF organization and FA structure. dSF (1), tA (2) and vSF (3) are present but their distinct localization pattern is disturbed. (D) The phenotype of NM IIC-KO cells is comparable to the WT. dSF (1), tA (2) and vSF (3) localize in a distinct pattern along the cell axis of polarized cells. (E) The mean FA area per cell is reduced for NM IIA-KO and NM IIB-KO cells, whereas FA density is only reduced in NM IIA-KO cells (F). Scale bars represent 10 µm for overviews and 2 µm for insets of (A) - (D).

To investigate if the loss of a certain NM II isoform has an impact on the remaining NM II paralogs, we compared the localization and intensity of NM IIA-C in WT cells and the respective NM II-KO cell lines (Figure 1—figure supplements 3E and 4). In polarized WT cells, NM IIA and NM IIC signals are uniformly distributed throughout the cell body whereas NM IIB signals are enriched in the cell center (Figure 1—figure supplement 3A), confirming previous findings (Beach et al., 2014; Kolega, 1998; Shutova et al., 2012; Shutova et al., 2014). Depleting NM IIA strongly alters the localization pattern of both remaining paralogs, NM IIB and NM IIC (Figure 1—figure supplement 3B). Only few NM IIB minifilaments cluster along the remaining SFs. The same trend was observed for NM IIC, where a large fraction of NM IIC minifilaments localize in the cell center. The intensities of NM IIB or NM IIC minifilaments are both slightly increased but not significantly different, when NM IIA is depleted (Figure 1—figure supplement 3E and Figure 1—figure supplement 4). In contrast, no altered localization of the remaining paralogs was observed in NM IIB-KO cells and only the intensity of NM IIC was slightly but not significantly increased (Figure 1—figure supplement 3C and E and Figure 1—figure supplement 4). No differences were observed for the localization and intensity of NM IIA or NM IIB in NM IIC-KO cells (Figure 1—figure supplement 3D and E and Figure 1—figure supplement 4). Thus, only the loss of NM IIA had an distinct impact on the paralog localization.

Overexpression of NM IIB does not compensate for the loss of NM IIA

Several studies identified NM IIA as the most abundant expressed isoform, while NM IIB and NM IIC are less strongly expressed (Beach et al., 2014; Bekker-Jensen et al., 2017; Betapudi et al., 2011; Ma et al., 2010). Thus, the knockout of NM IIA causes not only the loss of the motors distinct kinetic properties but also a drastic reduction of the totally available NM II hexamers. To determine the ratio of NM IIA to NM IIB minifilaments that assemble in WT cells, we generated fluorescent knock-in cells (Koch et al., 2018), where GFP is expressed under the endogenous promoter of NM IIA or B (Figure 2A). Given the heterozygous expression of GFP-NM IIA and B, respectively (Figure 2—figure supplement 1), our measurements do not represent absolute numbers of molecules but rather a relative estimation of the ratio of NM IIA and NM IIB hexamers in minifilaments. Measuring GFP signals along segmented actin fibers revealed that the ratio of NM IIA to NM IIB is roughly 4.5:1 (Figure 2A&B).

Figure 2 with 1 supplement see all
Overexpression of NM II B cannot compensate for the loss of NM II A.

(A) GFP intensities were measured along segmented actin fibers to compare the ratios of NM IIA and NM IIB in WT and NM IIB overexpressing NM IIA-KO cells. When expressed under the endogenous promoter, the mean GFP intensity of NM IIB is 4.5 times lower compared to NM IIA. To increase the total amount of NM IIB without the interference of NM IIA, NM IIA-KO cells were transiently transfected with exogenous GFP-NM IIB under the CMV promoter. Even in NM IIA-KO cells with high NM IIB expression, NM IIB filament distribution is less homogenous compared to NM IIA in WT cells. (B) Quantitative comparison of endogenous NM IIA and NM IIB in WT cells, and exogenous NM IIB in NM IIA-KO cells. (C) PRLC signal intensity was used as a marker for active NM II filaments. The quantitative comparison of WT, NM IIA-KO, and NM IIB overexpressing NM IIA-KO cells shows a substantial reduction of pRLC intensity in NM IIA-KO cells, which is not restored in NM IIB overexpressing NM IIA-KO cells. (D) NM IIB overexpression does not phenocopy the WT situation. Immunfluorescent labeling of the actin cytoskeleton (yellow) and the FA marker paxillin (magenta) revealed that SFs are still sparse and FAs are less mature. (E) Quantitative comparison of the mean FA size in WT, NM IIA-KO, and NM IIB overexpressing NM IIA-KO cells. The values for WT and NM IIA-KO are the same as for Figure 1E and are only shown for comparison. (F) AFM nanoindentation experiments were performed to measure the surface tension of the NM II-KO cell lines. Compared to the WT, NM IIA-KO cells possess a significantly lower surface tension, while it is significantly higher for NM IIB-KO cells. No difference was observed for NM IIC-KO cells. Scale bar represents 10 µm in (A and D).

To test whether larger amounts of NM IIB are able to phenocopy the WT situation in NM IIA-KO cells, we overexpressed GFP-NM IIB under a constitutive active promoter. The relative amount of overexpressed GFP-NM IIB is roughly 1.7-fold increased to endogenous GFP-NM IIA (Figure 2A and B) and in addition, these cells also express endogenous, unlabeled NM IIB. However, the distribution of NM IIB was still strongly clustered along single SF and does not compare to the distribution of NM IIA in WT cells (Figure 2A). We next used RLCs, phosphorylated at Ser19 (pRLC), as a isoform-independent marker staining for all active NM II molecules and compared the fluorescence intensities in WT-, NM IIA-KO-, and NM IIA-KO-cells overexpressing NM IIB-mApple. While the pRLC intensity was drastically reduced in NM IIA-KO cells, even strongest overexpression of NM IIB could not phenocopy the pRLC level of WT cells (Figure 2C). Similar results were achieved by comparing SF formation and FA maturation of GFP-NM IIB overexpressing NM IIA-KO cells to untransfected NM IIA-KO and WT cells (Figure 2D and E). Even high NM IIB levels did not induce the formation of an ordered actin cytoskeleton with bundled SFs of different subtypes. Similarly, FA maturation is still impaired when GFP-NM IIB is overexpressed (Figure 2E). In addition, we performed AFM nanoindentation experiments to compare the surface tension of WT and NM II-KO cells. While NM IIA-KO cells possess a significantly lower surface tension than WT cells, tension is significantly increased in NM IIB-KO cells (Figure 2F). No difference between WT and NM IIC-KO cells was observed. These results are in line with the interpretation that the different kinetic properties of NM IIA and NM IIB tune the contractile properties of the actin cortex and are supported by recently published data obtained by micropipette aspiration assays (Taneja et al., 2020). Thus, not only the absolute quantity of NM II molecules but rather the qualitative properties of both, NM IIA and B, are necessary for the formation of a fully functional actomyosin cytoskeleton.

Structured environments reveal distinct functions of NM IIA and NM IIB in cell shape determination

To investigate the impact of the NM II-KOs in a more physiological inhomogenous and structured environment (Ruprecht et al., 2017), we next cultured U2OS WT and NM II-KO cell lines in a 3D collagen matrix (Figure 3—figure supplement 1). To probe the contractile properties of our NM II-KO cells, we cultivated cell seeded collagen gels (CSCGs) in suspension for 20 hr and measured the gel area at the beginning (red circled area) and the end of the experiment (blue area) (Figure 3—figure supplement 1A). We found that the gel contraction was highest in WT and NM IIC-KO gels, followed by slightly reduced values when using NM IIB-KO cells, and almost no contraction for NM IIA-KO cells. To connect these observations to the cellular morphologies of our NM II-KO cells, we next encased the cells in collagen gels that were attached to the coverslip (Figure 3—figure supplement 1B–E). All cell lines flattened in the collagen gel and in contrast to the cell morphologies on FN-coated coverslips, we now observed phenotypes with concave, inward bent actin arcs that line the cell contour as previously described for various cell types (Bischofs et al., 2008; Brand et al., 2017; Kassianidou et al., 2019; Labouesse et al., 2015; Tabdanov et al., 2018; Théry et al., 2006). This phenotype was most pronounced for WT, NM IIB-KO, and NM IIC-KO cells, while the phenotype of the NM IIA-KO cells showed many lamellipodial protrusions. However, these protrusions are also often intersected by small actin arcs.

Since a quantitative evaluation of these actin arcs was not feasible in the structurally ill-defined collagen matrix, we next changed to micropatterned substrates, which allowed us to normalize the cellular phenotypes. We produced cross-shaped FN-micropatterns via microcontact printing, which restrict FA formation to the pattern but still provide a sufficient adhesive area for the spreading of U2OS cells (see Materials and methods section for details). Like in collagen gels, all cell lines adapted their shape to the pattern and gained a striking phenotype with concave, inward bent actin arcs that line the cell contour (Figure 3). In contrast to homogenously coated substrates, WT and all NM II-KO cell lines reveal a similar phenotype: Actin arcs bridge the passivated substrate areas and have a round shape, which we show to be very close to circular (Figure 3—figure supplement 2). NM II minifilaments localize along the circular actin arcs (Figure 3—figure supplement 3B–D), indicating that they are contractile SFs. From a geometrical point of view, the circularity results from two different NM II-based contributions to cell mechanics: tension in the cortex (surface tension σ) and tension in the actin arcs (line tension λ). Balancing these tensions can explain circular actin arcs with the radius R = λ/σ (Laplace law). Typical order of magnitude values have been shown to be R = 10 µm, λ = 20 nN and σ = 2 nN/µm, with the values for λ and σ being extracted from for example traction force microscopy on soft elastic substrates or on pillar arrays (Bischofs et al., 2009). In addition, R depends on the spanning distance d between two adhesion sites, with larger d leading to larger R values (Bischofs et al., 2008). This dependence can be explained by assuming an elastic line tension λ(d) (tension-elasticity model, TEM), suggesting that the mechanics of the peripheral SFs are not only determined by force generating NM II motors, but also by elastic crosslinking, for example by the actin crosslinker α-actinin.

Figure 3 with 4 supplements see all
Quantitative shape analysis on cross-shaped micropatterns reveals distinct phenotypes for NM IIA-KO and NM IIB-KO cells.

(A) U2OS WT cells show prominent invaginated actin arcs along the cell contour, with an invagination radius R and a spanning distance d (see inset). Quantitative image analysis reveals a positive R(d)-correlation (correlation coefficient r given at bottom right). Solid lines denote the bootstrapped mean fit of the dynamic tension-elasticity model (dTEM), black dashed lines denote the geometrically possible minimal radius. (B) U2OS NM IIA-KO cells form invaginated shapes on the cross-patterns despite their strongly perturbed shapes on homogenous substrates. The spanning distance of the arcs is shorter, but the positive correlation between R and d remains. (C) Actin arcs of U2OS NM IIB-KO cells are less invaginated compared to WT cells and their measured R(d)-correlation is very weak. (D) The phenotype of NM IIC-KO cells is comparable to WT and the R(d)-correlation is not affected. Scale bar represents 10 µm for (A) – (D).

To analyze potential differences in the NM II-KO cell lines, we measured arc radius R and spanning distance d and compared their correlation (Figure 3A insert; see methods section for details). WT cells regularly form actin arcs along all cell edges (Figure 3A). Both, NM IIA and NM IIB co-localize with the actin arcs (Figure 3—figure supplement 3B). Quantitative evaluation showed a positive correlation (r = 0.63 ± 0.06) of R with increasing d, as observed previously (Bischofs et al., 2008; Brand et al., 2017; Tabdanov et al., 2018). Surprisingly, NM IIA-KO cells formed circular arcs and also obeyed a clear R(d)-correlation (r = 0.61 ± 0.06) (Figure 3B), despite the fact that their phenotype was strongly affected on homogenously coated FN-substrates. This agrees with our observations in the collagen gels and shows that the structured environment can support an invaginated phenotype even in the absence of NM IIA-induced contractility. In detail, however, we noticed marked differences compared to WT cells. Although actin arcs along the cell edges are still visible, they do not form as regular as in WT cells. The cell body often covers smaller passivated substrate areas but rather spreads along the crossbars, leading to smaller arcs. Compared to WT cells, fewer internal SFs are present as shown by a weaker image coherency (Figure 3—figure supplement 3A). NM IIB minifilaments co-localize along the actin arcs in NM IIA-KO cells and the pRLC staining is almost completely absent, suggesting that contractile forces are low in these cells (Figure 3—figure supplement 3C). Surprisingly, in NM IIB-KO cells the R(d)-correlation was strongly reduced (r = 0.33 ± 0.09) (Figure 3C), caused by the presence of a mixed population of bent and almost straight arcs that develop independent of the spanning distance d. Along these arcs, staining for NM IIA minifilaments and pRLC was comparable to WT cells (Figure 3—figure supplement 3D). We also quantified the degree of internal SF formation but did not find a difference between WT and NM IIB-KO cells (Figure 3—figure supplement 3A). NM IIC-KO cells did not reveal any differences concerning their morphology and the R(d)-correlation was comparable to WT cells (r = 0.63 ± 0.06) (Figure 3D). Importantly, overexpressing GFP-NM IIB in NM IIA-KO cells did not restore the WT phenotype (Figure 3—figure supplement 4A). These cells still spread along the cross bars and do not span over large passivated areas. The R(d)-correlation (r = 0.63 ± 0.06) was comparable to WT and NM IIA-KO cells. Similarly, overexpressing GFP-NM IIA in NM IIB-KO cells did not significantly increase the R(d)-correlation (r = 0.49 ± 0.07) (Figure 3—figure supplement 4B). These results reveal opposing functions for NM IIA and NM IIB in cell shape determination on structured substrates. NM IIA-KO cells form actin arcs with small arc radii that are correlated to the spanning distance, while NM IIB-KO cells form actin arcs with large arc radii that are not correlated to the spanning distance.

NM IIA and NM IIB contribute to dynamic generation of tension and elastic stability, respectively

To better understand these experimental results, we used mathematical models that connect our experimental findings to force generation by NM II motors. The main difference in the crossbridge cycles are that NM IIA generates faster contractions (Wang et al., 2000; Kovács et al., 2003) and NM IIB bears more load (Wang et al., 2003; Pato et al., 1996). We developed a dynamical tension-elasticity model (dTEM) that connects the stationary cell shapes to the dynamic crossbridge cycling. Due to geometrical constraints, the circular arcs on our cross-shaped micropattern can have central angles of only up to 90°, which defines a minimal radius Rmin=d/2 possible for a given spanning distance d (Figure 4A). We consider the SF as a dynamic contractile structure that sustains a continuous transport of cytoskeletal material from the FA towards the center of the SF (Figure 4B). This flow can be observed experimentally in ventral SFs for cells on homogenously coated substrates and in peripheral arcs for cells on cross-shaped micropatterns (Figure 4—figure supplement 1 and Figure 4—animations 1 and 2) and, like retrograde flow, is believed to be driven by both actin polymerization in the FAs and myosin-dependent contractile forces (Endlich et al., 2007; Shutova et al., 2017; Oakes et al., 2017; Russell et al., 2011; Tojkander et al., 2015). Therefore, it should also depend on the isoform specific motor properties that result from the differences in the crossbridge cycles. Like in muscle cells, mature SFs are organized with sarcomeric arrangements of the myosin motors (Dasbiswas et al., 2018; Shutova et al., 2017; Hu et al., 2017). Accordingly, the number of serially arranged myosin motors increases linearly with SF length, and SF contraction speed should also increase with length. The stall force Fs, however, should not depend on the SF length because in this one-dimensional serial arrangement of motors, each motor feels the same force (Thoresen et al., 2013). Using an established model for the crossbridge cycle (Figure 4C) and the known differences between the powerstroke rates of NM IIA and NM IIB, we calculate the stall force Fs for homotypic and heterotypic minifilaments (Grewe and Schwarz, 2020a; Grewe and Schwarz, 2020b). With increasing NM IIB content, the stall force increases and the free velocity decreases, which is mainly an effect of the much smaller duty ratio of NM IIA (Appendix 1—figure 1). For the polymerization at FAs, we assume that its rate increases with force, as has been shown in vitro for mDia1, the main actin polymerization factor in FAs (Jégou et al., 2013). Combining these molecular elements with the geometrical considerations of the TEM (details are given in Appendix 1), we arrive at a surprisingly simple form for the R(d) relation:

Rd=ddm+dRmax
Figure 4 with 3 supplements see all
A dynamic tension-elasticity model (dTEM) connects the cellular phenotype to differences in the crossbridge cycling rates.

(A) Illustration depicting the geometrically possible minimal radius on the cross-shaped micropattern. The circular arcs on our cross pattern can have central angles of only up to 90°. (B) Schematics of the mathematical model. At each point along the cell contour, line tension λ and surface tension σ balance each other and thereby determine the circular arc shape. The insets show the frictional elements required to allow flow of the peripheral fiber (friction coefficients ξm and ξf for stress fibers and focal adhesions, respectively). The motor stall force is denoted as Fs. (C) Illustration depicting the three main mechanochemical states during the crossbridge cycle and the corresponding model rates. (D) Normalizing experimental results using the fit parameters from (A, B, C, D, E-H) yields a master curve. WT, NM IIA-KO, and NM IIC-KO cells fall into the linear regime, NM IIB-KO cells into the plateau regime, which corresponds to a loss of correlation. (E) dm/Rmax vs ratio of the maximum of the observed d-values to Rmax. The region marked in red shows where the central angle of the arc is smaller than 90°. Points denote bootstrapped fit results. (F–H) Distributions of differences between observed radius and minimum allowed radius normalized to the minimally allowed radius resemble Gaussian distributions with cut-offs. From this, we can estimate the fraction of non-formed rods (gray areas).

The maximal radius Rmax=Fs/σ is given by the ratio of stall force Fs and surface tension σ. It can be understood as the arc radius that would be observed if there was no reduction of the tension by the inflow from the FAs and corresponds to a static TEM, with the stall force Fs taking the role of the line tension λ in the Laplace law. As a NM II-KO is expected to affect both Fs and σ to a similar extent, our theory cannot predict directly how Rmax changes due to the loss of NM II. However, it predicts two regimes separated by the spanning distance at half maximal radius dm, which is determined by the friction coefficients (Appendix 1): a linear regime at low and a plateau regime at high spanning distance, respectively.

Fitting Equation 1 to the experimental data shown in Figure 3A-D yield the parameters Rmax and dm for each cell line (solid lines, dashed lines show the minimum radius resulting for a central angle of 90°). The mean fit values and standard deviations for the invaginated arcs are calculated from bootstraps and are listed in Table 1. By rescaling the experimental values using the fit parameters, the data points roughly follow a master curve (Figure 4D). For NM IIA-KO, we see that the data is in the linear regime with large dm values, corresponding to the high motor friction known for NM IIB (large duty ratio). This suggests that the measured radii for NM IIA-KO are smaller because the Rmax cannot be realized given the flow out of the FAs. We conclude that the main function of NM IIA is to dynamically generate tension. For NM IIB-KO, Figure 4D shows that the data is closer to the plateau regime. The small values for dm measured here corresponds to the low motor friction known for NM IIA (small duty ratio). This suggests that the measured radii for NM IIB-KO tend to be larger because the system can in fact dynamically sample Rmax. At the same time, the independence of spanning distance d also reflects the breakdown of the correlation, suggesting that NM IIB is required to elastically stabilize the arcs.

Table 1
Mean bootstrapped fit values for the invaginated arcs.
Cell lineRmax [µm]dm [µm]dm /Rmax
WT199 ± 5100 ± 50.50 ± 0.02
NM IIA-KO190 ± 24137 ± 220.72 ± 0.04
NM IIB-KO98 ± 1820 ± 90.19 ± 0.05
NM IIC-KO194 ± 19110 ± 140.56 ± 0.03
  1. The error is given as the standard deviation of the bootstrapped fit results. Note that the fit was bounded such that Rmax < 200 µm. Therefore, in cases where Rmax is close to 200 µm, the fit only gives reasonable error estimates for the quotient dm /Rmax.

To further separate the different phenotypes, we plot our data in the two-dimensional parameter space of dm/Rmax,d/Rmax (Figure 4E). The shaded region denotes allowed values due to the central angle being smaller than 90°. Strikingly, the ratio dm/Rmax, increases with the relative amount of NM IIB in the SF, from NM IIB-KO, over WT and NM IIC-KO cells to NM IIA-KO cells. This agrees with our theoretical finding that NM IIB stabilizes tension due to its slower crossbridge cycle (Grewe and Schwarz, 2020a; Grewe and Schwarz, 2020b).

Our results for the NM IIA-KO cells in Figure 4E are closest to the edge of the region with the theoretically permissible arcs, which suggests that in general some arcs cannot form because of geometrical constraints. Figure 4F–H show that the distribution of the difference of observed radius to the minimum radius, normalized to the minimum radius approximately follows a Gaussian distribution that is, however, cut off at zero difference. Assuming that the missing part of the distribution corresponds to the fraction of arcs that have not formed, we find that there should be approximately 10%, 18%, and 7% non-formed arcs for WT, NM IIA-KO and NM IIB-KO cells, respectively. This again suggests that NM IIA is the most important isoform for the formation of arcs, while NM IIB is more important for stabilization.

NM IIA-induced tension and NM IIB-derived elastic stability cooperate in the contractile output of cellular stress responses, while NM IIC mediates tensional homeostasis

We next investigated how the loss of NM II isoforms affects cellular contraction forces and the mechanoresponse upon extrinsic stretches (Figure 5). We applied our recently established method for the mechanical stimulation of single cells (Hippler et al., 2020). In brief, 3D micro-scaffolds composed of four non-adhesive walls, each with an inward directed protein-adhesive bar to guide cell attachment (schematically depicted in Figure 5C) were used to measure initial contraction forces. Cells cultured in these scaffolds attach to the bars, thus forming a cross-shaped morphology and pull the walls inwards. These movements were traced with time lapse microscopy for at least 1 hr, before the cells were detached by trypsinization (Figure 5A). Comparable to traction force microscopy on 2D substrates (Balaban et al., 2001), the displacement values were used to calculate the traction forces exerted by the cells and are in the following given as the sum of all four bars for each cell (Hippler et al., 2020). U2OS WT cells generated a mean initial force of 94 nN (Figure 5B and Figure 5—animation 1), while NM IIA-KO cells generated almost no traction forces (Figure 5—animation 2 and Figure 5—figure supplement 1B) with a mean value of 11 nN (Figure 5B). When measuring the initial forces of NM IIB-KO cells, we obtained a mean value of 112 nN (Figure 5B, Figure 5—animation 3 and Figure 5—figure supplement 1C), which did not significantly differ from WT cells. NM IIC-KO cells also showed no significant difference to the WT (Figure 5—animation 4 and Figure 5—figure supplement 1D) with a mean force value of 110 nN (Figure 5B).

Figure 5 with 10 supplements see all
Differential contributions of NM II isoforms to cellular mechanoresponse.

Cells were cultured 3D micro-scaffolds composed of four non-adhesive walls, each with an inward directed protein-adhesive bar to guide cell attachment. Cells attach to the bars, form a cross-shaped morphology and pull the walls inwards. (A) Initial cellular tractions forces were determined by detaching the cell from the scaffold using trypsin/EDTA and measuring the corresponding average beam displacement as indicated in the plot. (B) Comparison of the initial forces of the different cell lines. Data for WT and NM IIA-KO have been reproduced from (B) of Hippler et al., 2020, therefore only the mean values are shown (originally published under the Creative Commons Attribution-Non Commercial 4.0 International Public License (CC BY-NC 4.0; https://creativecommons.org/licenses/by-nc/4.0/. Further reproduction of this panel would need to comply with the terms of this license)). No significant differences were observed between WT (mean value = 94 nN), NM IIB-KO (mean value = 112 nN), and NM IIC-KO cells (mean value = 110 nN). A significant decrease was observed for NM IIA-KO cells (mean value = 11 nN). (C) Illustration depicting the stretch-release cycle applied to the cells. (D-G) Examples of average beam displacements (corresponding to Figure 5—animations 58) are plotted as a function of time. The blue area depicts the time frame, in which the corresponding cell was stretched. (D) WT cells actively counteract the stretch and increase their contractile forces until reaching a plateau after ~ 30–40 min. After releasing the stretch, cellular contraction forces remained high, but decreased to the initial level after 20–30 min. (E) No cellular force response is observed, when applying the stretch-release cycle to NM IIA-KO cells, even after longer stretch periods. (F) NM IIB-KO cells increase their force after stretching and reach a plateau after 30–40 min. The force increase is lower compared to WT cells. After releasing the stretch, NM IIB-KO cells also reduce their forces until the initial set point is reached. (G) NM IIC-KO cells increase their force upon the stretch but do not relax to the initial setpoint within the observed timeframe. (H) The quantification shows that a force decrease after the stretch release was observed for 78% of the WT cells but only for 22% of the NM IIC-KO cells. (I) Comparison of the force increase of WT and NM II-KO cells, after being mechanically stretched. Data for WT and NM IIA-KO reproduced from (D) of Hippler et al., 2020, therefore only the mean values are shown (originally published under the Creative Commons Attribution-Non Commercial 4.0 International Public License (CC BY-NC 4.0; https://creativecommons.org/licenses/by-nc/4.0/. Further reproduction of this panel would need to comply with the terms of this license)). A mean increase of 73 nN was observed for WT cells and no force increase for NM IIA-KO cells (mean value = 0.29 nN). Compared to WT cells, NM IIB-KO cells display a significantly lower force increase (mean value = 41 nN), while NM IIC-KO cells show a comparable mean value. However, higher variations in the force response are observed for NM IIC-KO cells. Scale bar represents 10 µm in (A).

Figure 5—source code 1

Matlab code for displacement tracking and force calculation.

https://cdn.elifesciences.org/articles/71888/elife-71888-fig5-code1-v2.zip

To investigate the mechanoresponse of single cells upon extrinsic applied forces, the above described 3D micro-scaffolds were complemented with a block of a guest-host based hydrogel (Hippler et al., 2020). Upon a chemical stimulus this hydrogel expands and pushes the walls apart, thus equibiaxially stretching the cell. Since the process is reversible, removing the stimulus causes a release of extracellular forces and a relaxation of the cell (Figure 5C). We applied the following workflow: WT or MN II KO cells were cultivated for 2 hr in the scaffolds to allow for attachment and equilibration of the cells. Then cells were imaged for 10–15 min before an equibiaxial stretch of ~ 20% was applied and the response (displacement in µm) was monitored for 30–60 min. After that time, the stretch was released and the cellular response again monitored for 20–40 min (Figure 5D–G). As previously described (Hippler et al., 2020), WT U2OS cells show a typical response to this stretch-release cycle: Cells counteract the stretch by increasing their traction forces over a time course of ~ 30 min until they settle on a new plateau value (Figure 5—animation 5 and Figure 5D). After releasing the stretch, WT cells decrease their traction forces again and settle at the initial force value. When applying the stretch-release cycle to NM IIA-KO cells, the cells show no reaction, even after increasing the stretch period to 70 min (Hippler et al., 2020; Figure 5E and Figure 5—animation 6). In contrast, NM IIB-KO cells revealed a clear response to the stretch-release cycle similar to WT cells (Figure 5F and Figure 5—animation 7). NM IIC-KO cells also increased their traction forces upon stretching and the values were comparable to WT cells. However, 80% of the NM IIC-KO cells did not decrease their intracellular forces after release within the monitored timeframe of 30 min (Figure 5G and H, Figure 5—animation 8 and Figure 5—figure supplement 2D).

As previously described (Hippler et al., 2020), displacements of the scaffolds can be transformed into cellular forces (Figure 5H). Quantifying the force increase (within the blue boxes in Figure 5D–G) showed a mean value of 72 nN for WT cells and no mean force increase for NM IIA-KO cells (Hippler et al., 2020). NM IIB-KO cells also revealed a force increase of 41 nN which was, however, significantly lower than in WT cells (Figure 5H). The force increase of NM IIC-KO cells did not significantly differ from WT cells, but the mean variation was higher. These data strongly support our hypothesis that NM IIA initiates cellular tension, while NM IIB contributes to this tension by providing elastic stability for a stable force output on longer time-scales, that is during the mechanoresponse of cells. In addition, NM IIC seems to play a role in the temporal control of the force relaxation, that is the mechanical homeostasis of cells.

Discussion

Here, we have systematically analyzed the roles of the three different NM II isoforms for cellular morphodynamics and force generation in structured environments with a combined experimental and theoretical approach. Using CRISPR/Cas9-technology and U2OS cells, we depleted for the first time all three isoforms from the same cellular background. Cell culture on homogenously coated substrates confirmed previous reports about NM IIA and NM IIB (Even-Ram et al., 2007; Sandquist et al., 2006; Shutova et al., 2017; Vicente-Manzanares et al., 2011; Vicente-Manzanares et al., 2007). Without NM IIA, cells lack global tension, SFs and mature FAs. The NM IIB-KO only leads to a less clear distinction between different types of SF and to smaller FAs. The amount of NM IIA in minifilaments is at least 4.5 times higher compared to its paralogs. However, we did not observe an upregulation of NM IIB or NM IIC upon the loss of NM IIA, and overexpressing NM IIB was not sufficient to compensate the observed effects, showing that the induced deficits are due to the loss of the distinct motor properties rather than the overall quantity of the NM II population.

To our surprise, the marked phenotypic differences of NM IIA-KO cells are dampened when the cells were cultivated in a structured environment. This suggests that NM IIA contributes in guiding the cellular phenotype in the absence of external guiding cues. Although NM IIA-KO and NM IIB-KO cells superficially look similar on the micropattern, the quantitative cell shape analysis revealed marked differences. NM IIA-KO cells form small arcs that are correlated to the spanning distance and fail to bridge larger passivated substrate areas. NM IIB-KO cells form large actin arcs, which are poorly correlated with the spanning distance. Similar opposing effects were observed in AFM nanoindentation experiments: While the surface tension was reduced in NM IIA-KO cells, it was increased when NM IIB was depleted. Since the phenotypes on the micropattern arise from the interplay of the two types of actomyosin-mediated tension, σ and λ (Bischofs et al., 2008; Brand et al., 2017), we hypothesize that the different properties of NM IIA and NM IIB tune the contractile and mechanical properties of both types of tension in a similar manner. Although we cannot distinguish the absolute values of NM IIA or NM IIB that contribute to σ or λ, our results show that the loss of NM IIA reduces both values, while the loss of NM IIB leads to an increase of both types of tension.

By connecting the experimental results to our dynamic tension-elasticity model (dTEM), we can explain our results for the micropattern by differences in the molecular crossbridge cycles. NM IIA-KO cells still possess NM IIB-derived elastic stability but lack dynamic tension leading to low intracellular forces. Without NM IIA motors, NM IIB is too slow to rearrange the contractile forces in accordance with the fast polymerization of actin filaments at FAs. Consequently, the arcs on the crosspattern are smaller and more bent inwards, since the actin polymerization rate overpowers the motor stall force and the surface tension increases the curvature. Since the generation of contractile actomyosin bundles is a mechanosensitive process (Tojkander et al., 2015), a polarized actomyosin cytoskeleton is missing in NM IIA-KO cells. The only remaining SF resemble ventral SF, because their turnover is lowest (Kumar et al., 2006; Lee et al., 2018). NM IIB-KO cells in contrast still possess NM IIA minifilaments, which generate sufficient but unbalanced intracellular forces. The low motor stall force of NM IIA overpowers the actin polymerization rate leading to low curvatures of the actin arcs, which arise independent of the spanning distance. Although the fast and dynamic motor activity of NM IIA is sufficient to induce the mechanosensitive assembly of all SF subtypes, their distinct localization is disturbed (Shutova et al., 2017; Vicente-Manzanares et al., 2008). Likewise, loss of NM IIB does not affect the formation of FAs, however, they do not grow to full size, since the actin templates are not sufficiently stabilized by the cross-linking properties of NM IIB (Vicente-Manzanares et al., 2011). No phenotypic change or disturbance in the R(d) correlation was observed when depleting NM IIC. Thus, our results indicate that NM IIC might be less important for the morphodynamics of single cells, at least in our cell line.

Our model focuses on the crossbridge cycle properties in the motor heads and is sufficient to explain the experimentally observed R(d) relations on the micropattern. It is important to note that in addition, the NM II isoforms differ in their tail regions, leading to marked differences in minifilament assembly/disassembly dynamics and intracellular localization patterns (Breckenridge et al., 2009; Juanes-Garcia et al., 2015; Kaufmann and Schwarz, 2020). Future work has to address how the isoform-specific phosphorylation pattern of the c-terminal tails influence cell shape determination in structured environments, for example by using NM II chimeras or phospho-mutants (Juanes-Garcia et al., 2015; Sandquist and Means, 2008).

We confirmed our results in cell stretching experiments, where the cellular force generation during mechanical stress was precisely monitored for all three NM II-KO cell lines. Measuring cellular contraction forces in microstructured 3D scaffolds revealed a complete loss of forces for NM IIA-KO cells but no reduction for NM IIB-KO and NM IIC-KO cells. Upon a stretch-release cycle, WT cells show a behavior that was previously described as mechanical homeostasis (Hippler et al., 2020; Webster et al., 2014; Weng et al., 2016). Upon stretch, intracellular forces increase by a factor of two and equilibrated on this new setpoint. When releasing the stretch, cellular contraction forces remain high for a short period, but decrease to the initial level after 20–30 min. As expected, NM IIA-KO cells did not respond at all to the stretch-release cycle (Hippler et al., 2020). A clear response was observed when stretching NM IIB-KO cells, however, the force increase did not reach the values of WT cells. After releasing the stretch, cellular contraction forces also decreased to the initial level, however, force decrease was accompanied with oscillations of contractile pulses in about 50% of analyzed traces (Figure 5—animation 7 and red trace in Figure 5—figure supplement 2) as compared to 10% in WT cells. Thus, we again conclude that NM IIB seems to regulate the spatiotemporal response of the actomyosin system by stabilizing NM IIA induced tension. We observed the same trend in collagen gels, where NM IIB-KO cells did contract the gel to a lower amount than WT cells, which is in good agreement with results of others (Meshel et al., 2005). Unexpectedly, also NM IIC-KO cells behaved differently from the WT and displayed a delayed response after the stretch was released. In about 80% of the analyzed NM IIC-KO cells, contraction forces did not relax to the initial setpoint within the observed timeframe of 30 min, while this was only the case for 20% of the WT cells. Because the cellular function of NM IIC reported here seems not to be directly related to differences in the powerstroke cycle, future experiments might reveal, whether the loss of NM IIC leads to a delay in the cellular mechanoresponse by interfering with the global organization of the NM II contractome. Structural in vitro analysis revealed that NM IIC minifilaments are smaller compared to their paralog counterparts (Billington et al., 2013). As it was reported that NM IIA and NM IIC co-localize throughout the whole cell body in U2OS cells (Beach et al., 2014), this could suggest that NM IIC has a role as a scaffolding protein during the formation of higher ordered NM IIA minifilament stacks (Fenix et al., 2016), comparable to the role of myosin-18B (Jiu et al., 2019).In epithelial sheets, NM IIC was shown to regulate the geometry of the epithelial apical junctional-line (Ebrahim et al., 2013) and the microvilli length (Chinowsky et al., 2020). Strikingly, Beach and colleagues showed that the phenotypic switch during EMT (epithelial-mesenchymal transition) and the subsequent invasiveness of murine mammary gland cells goes along with a downregulation of NM IIC and an upregulation of NM IIB (Beach et al., 2011). Thus, NM IIC might be of special interest for the structural organization and integrity of epithelial cell sheets.

In summary, we showed that the environmental guidance of the actomyosin system follows a logical order. The initiation depends on the presence of NM IIA. This motor can quickly repopulate newly formed protrusions and initiate new contraction sites (Baird et al., 2017), giving rise to heterotypic minifilaments and dynamizing NM IIB (Fenix et al., 2016; Shutova et al., 2017). Once the contraction is initiated, NM IIB co-assembles into the preformed contraction site and stabilizes the tension, as this motor is prone to maintain tension on longer timescales by staying longer bound to the actin cytoskeleton (Sandquist and Means, 2008; Vicente-Manzanares et al., 2008). Thus, the stability of the heterotypic minifilaments is facilitated by the relative composition of NM IIA and NM IIB (Kaufmann and Schwarz, 2020). NM IIC might contribute to this set-up as a structural regulator that controls force maintenance and relaxation, especially in a dynamical context, when external conditions change and homeostasis has to be ensured. In a physiological context, such a self-assembling system would be able to precisely tune the contractile output of single cells but also cell collectives. Since different studies showed prominent functions of NM IIB and NM IIC during EMT and invasiveness (Beach et al., 2011; Thomas et al., 2015), or the reinforcement of cell-cell adhesion sites (Heuzé et al., 2019), our insights should be transferred to the tissue context, e.g. to explain collective migration effects in development, wound healing or cancer (Scarpa and Mayor, 2016; Shellard and Mayor, 2019; Sunyer et al., 2016; Trepat and Sahai, 2018).

Materials and methods

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Gene (Homo sapiens)MYH9NCBINC_000022.11
Gene (Homo sapiens)MYH10NCBINC_000017.11
Gene (Homo sapiens)MYH14NCBINC_000019.10
Cell line (Homo sapiens)U2OSATCC# HTB-96
RRID:CVCL_0042
Cell line (Homo sapiens)U2OS
NM IIA-KO
This paperCRISPR/Cas9-generated knockout cell line; compare Materials section 2
Cell line (Homo sapiens)U2OS
NM IIB-KO
This paperCRISPR/Cas9-generated knockout cell line
Cell line (Homo sapiens)U2OS
NM IIC-KO
This paperCRISPR/Cas9-generated knockout cell line
Cell line (Homo sapiens)U2OS
GFP-NM IIA
This paperCRISPR/Cas9D10A-generated knock-in cell line; compare Materials section 2
Cell line (Homo sapiens)U2OS
GFP-NM IIB
This paperCRISPR/Cas9-generated Knock-in cell line
Transfected construct (Homo sapiens)CMV-GFP-NMHC IIARRID:addgene_11347PMID:11029059Gift from Robert Adelstein
Transfected construct (Homo sapiens)CMV-GFP-NMHC IIBRRID:addgene_11348PMID:11029059Gift from Robert Adelstein
Transfected construct (Homo sapiens)mApple-MyosinIIB-N-18RRID:addgene_54931RRID:Addgene_54931Gift from Michael Davidson
Recombinant DNA reagentpSPCas9(BB)−2A-Puro (PX459) V2.0RRID:addgene_62988PMID:24157548Gift from Feng Zhang
Recombinant DNA reagentpX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)RRID:addgene_42335PMID:23287718Gift from Feng Zhang
Recombinant DNA reagentpMK-RQ-MYH9This paperDonor sequence for HDR, compare Materials section 2 and 5
Recombinant DNA reagentpMK-RQ-MYH10This paperDonor sequence for HDR, compare Materials section 2 and 5
AntibodyAnti-Alpha-Tubulin (mouse monoclonal)Sigma-Aldrich#T5168
RRID:AB_477579
WB: (1:2000)
AntibodyAnti-fibronectin (mouse monoclonal)BD Biosciences#610077
RRID:AB_2105706
IF: (1:500
250 µg/ml)
AntibodyAnti-NMHC IIA (rabbit polyclonal)BioLegend#909801
RRID:AB_2565100
IF: (1:500)
WB: (1:1000
1 mg/ml)
AntibodyAnti-NMHC IIB (rabbit polyclonal)BioLegend#909901
RRID:AB_2565101
IF: (1:500)
WB: (1:1000
1 mg/ml)
AntibodyAnti-NMHC IIC (D4A7) (rabbit monoclonal)Cell signaling#8189S
RRID:AB_10886923
IF: (1:100)
WB: (1:1000)
AntibodyAnti-pMLC2 (Ser19) (mouse monoclonal)Cell signaling#3671S
RRID:AB_330248
IF: (1:200)
AntibodyAnti-Paxillin (mouse monoclonal)BD Biosciences#610619
RRID:AB_397951
IF: (1:500
250 µg/ml)
AntibodyAnti-GFP (rabbit polyclonal)abcam#ab6556
RRID:AB_305564
WB: (1:2000
0.5 mg/ml)
Peptide, recombinant proteinFibronectin from human plasmaSigma-Aldrich#F1056
RRID:AB_2830099
10 µg/ml
Peptide, recombinant proteinCollagen I and
Thin plate coating collagen I from rat tails
Enzo Life Sciences#ALX-522–435 and #ALX-522-440-00501 mg/ml final concentration
Chemical compound, drug1-Adamantanecarboxylic acidSigma-Aldrich#10639920 mM in DMEM pH 7
Software, algorithmDigital Image correlation and tracking
Version 1.2.0.0
MathWorks
MATLAB
(Eberl et al., 2006)
FileID 12413The custom-adapted script (see PMID:32967835) is provided as source code.
Software, algorithmCHOPCHOPhttps://chopchop.cbu.uib.no/
OtherPDMS Sylgard 184Dow Corning#000105989377For further instructions, see
PMID:23681634
Other1-OctadecylmercaptanSigma-Aldrich#O18581.5 mM in EtOH
OtherHS-C11-EG6-OHProChimia#TH-001-m11.n61 mM in EtOH
OtherTPE-TA TH-001-m11.n6Sigma-Aldrich#409073PMID:32967835
OtherPETASigma-Aldrich# 246794PMID:32967835
OtherHost-Guest system-based hydrogelHippler et al., 2020For detailed descriptions and composition, see PMID:32967835
OtherAlexa Fluor 488 or Alexa Fluor 647 coupled phalloidinThermoFisher Scientific#A12379 and #A22287

Cell culture

Request a detailed protocol

U2OS WT cells were obtained from the American Type Culture Collection (Manassas, USA). U2OS NM II-KO cell lines and U2OS GFP-NM IIA or B knock-in cell lines were generated as described in the following sections. All cell lines were tested for mycoplasma infection with negative results. For routine cultivation, cells were passaged every 2–3 days and maintained in DMEM (Pan-Biotech #P04-03590) supplemented with 10% bovine growth serum (HyClone #SH3054.03) at 37°C under a humidified atmosphere containing 5% CO2. Cells, plated on FN-coated coverslips or micropatterned substrates, were allowed to spread for 3 hr, cells in 3D micro-scaffolds for 2 hr.

Generation of NM II-KO and GFP-NM II knock-in cell lines

Request a detailed protocol

CRISPR/Cas9 was used to generate knock-out and knock-in cell lines. Guide sequences for the respective protein of interest were determined using the online tool ‘CHOPCHOP’ (https://chopchop.cbu.uib.no/). All used guide sequences are depicted in 5′-to-3′ direction in Table 2. Oligos for gRNA construction were obtained from Eurofins genomics (Ebersberg, Germany). NM II-KO cell lines were generated according to the guidelines in Ran et al., 2013, using the single plasmid system from Feng Zhang’s lab (Addgene #62988). All known splice variants of NMHC IIB and NMHC IIC were targeted by the respective sgRNA. To select for transfected cells, 5 µg mL−1 puromycin was added 48 hr post transfection to the culture medium and the cells were selected for another 48 hr. Single cells were derived by limiting dilution and cell colonies were screened for indels and loss of protein expression.

Table 2
Used gRNA and primer sequences.
Sequence (5 ‘→ 3‘)Target GeneDescription
GCACGTGCCTCAACGAAGCCTMYH9gRNA for DSB in
GCTGAAGGATCGCTACTATTCMYH10gRNA for DSB in Exon 2
GCGGAGTAGTACCGCTCCCGGMYH14gRNA for DSB in Exon 2
GCTTATAGCCAGGACCTAAGCMYH9gRNA for SSN in Exon 2
GTGCCGATAAGTATCTCTATGMYH9gRNA for SSN in Exon 2
GCAATTGCCTCTAAGAGAAGMYH10gRNA for SSN in Exon 2
GGCGCAGAGAACTGGACTCGMYH10gRNA for SSN in Exon 2
GCAAAGAGAAGAGGTGTGAGCMYH9Primer (fwd)_NM IIA-KO
AGTTCAAGGATGTCACCCCAMYH9Primer (rev)_NM IIA-KO
GTTAGTATGGCTGTGAAGAGGTMYH10Primer (fwd)_NM IIB-KO
TCAAAGAAAAGCAAGACATGGGTMYH10Primer (rev)_NM IIB-KO
AAGAAAGTTGTGCAGCCTGGMYH9Primer binding in LHA
GAGCCCTGAGTAGTAACGCTMYH9Primer binding in RHA
CATGTTTCTTGGAACCTGGCAMYH9Primer_5‘region of LHA_MYH9
GCAAACCCATCAGACAACCAMYH10Primer binding in LHA
ATTCTCTGCCAACTCCACCAMYH10Primer binding in RHA
CCTCTGCTAGCCCTTTGTGAMYH10Primer_5‘region of LHA_MYH10
GATGTTGCCGTCCTCCTTGAGFPPrimer (rev)_GFP
  1. Abbreviations: DSB = Double strand break; SSN = Single strand nick; fwd = forward; rev = reverse; LHA = Left homology arm; RHA = Right homology arm.

Fluorescent knock-in cell lines with GFP fused to the N-terminus of NMHC IIA or NMHC IIB were generated according to the guidelines in Koch et al., 2018. Briefly, a paired Cas9D10A nickase approach (Ran et al., 2013) was used to generate a double strand break in close proximity of the first coding exon (exon 2) of MYH9 or MYH10. The guide sequences were cloned into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Cong et al., 2013). The plasmid was a gift from Feng Zhang (Addgene #42335).

U2OS WT cells were transfected with the according sgRNAs and donor plasmids. GFP-positive cells were sorted using an FACSAria II cell sorter (BD Biosciences). Single cells were derived by limiting dilution and cells were screened for correct insertion of the eGFP by DNA sequence analysis, western blot and immunofluorescence.

Western blotting

Request a detailed protocol

A confluent monolayer of cells in a six-well plate was lysed in 150 µl ice-cold lysis buffer (187 mM Tris/HCl, 6% SDS, 30% sucrose, 5% β-mercaptoethanol), heated at 95°C for 5 min and centrifuged at 13.000 rpm for 10 min. Thirty µl of the supernatant was loaded onto an 8% gel. The proteins were resolved by SDS-PAGE and transferred to a PVDF membrane by tank blotting at 150 mA for 2 hr using the Miniprotean III System from Bio-Rad (Hercules, USA). The membrane was blocked for 1 hr with 5% skim milk in PBS containing 0.05% Tween-20. The following antibody incubation steps were also carried out in the blocking solution. Primary antibodies were applied over night at 4°C and secondary antibodies for 2 hr at room temperature. Between the antibody incubation steps, membranes were washed in PBS/Tween-20. Following primary antibodies were used: mouse monoclonal to α-Tubulin (Sigma-Aldrich #T5168), rabbit polyclonal to NMHC IIA (BioLegend, #909801), rabbit polyclonal to NMHC IIB (BioLegend, #909901), rabbit monoclonal to NMHC IIC (CST, #8189S), rabbit polyclonal to GFP (Abcam, #ab6556). Secondary horseradish peroxidase-coupled anti-mouse or anti-rabbit antibodies were from Jackson Immunoresearch (#711-036-152 and #715-035-150). The membranes were developed with the SuperSignal West Pico PLUS chemiluminescent substrate (ThermoFisher Scientific #34579) according to manufacturer’s instructions. Signal detection was carried out using an Amersham Imager 600 from GE Healthcare (Chicago, USA).

Sequence analysis

Request a detailed protocol

gDNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen #60506) and the target region was amplified via PCR. Primers were designed using the Primer3 freeware tool (Untergasser et al., 2012) and purchased from Eurofins genomics (Ebersberg, Germany). All used primers are listed in Table 2. PCR products were either cloned into the pCR II-Blunt-TOPO vector using the Zero Blunt TOPO PCR cloning kit (ThermoFisher Scientific #K2875J10) for subsequent sequencing or sequenced directly. Sequencing was carried out at LGC Genomics (Berlin, Germany) and the results were compared to WT sequences using the free available version of SnapGene Viewer (https://www.snapgene.com/snapgene-viewer/).

Transfection and constructs

Request a detailed protocol

Transfections were carried out using Lipofectamine 2000 (ThermoFisher Scientific #11668027) according to manufacturer’s instructions. The cells were transfected 48 hr prior to the experiment. CMV-GFP-NMHC IIA (Addgene #11347) and CMV-GFP-NMHC IIB (Addgene #11348) were gifts from Robert Adelstein (Wei and Adelstein, 2000). NMHC IIB-mApple was a gift from Michael Davidson (Addgene #54931). pSPCas9(BB)−2A-Puro (PX459) V2.0 (Addgene #62988) and pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene #42335) were gifts from Feng Zhang. Guide sequences for the generation of NMHC II depleted cells or GFP knock-in cells were introduced by digesting the plasmids with BbsI and subsequent ligation (Ran et al., 2013). pMK-RQ-MYH9 and pMK-RQ-MYH10 donor plasmids for homology directed repair were constructed by flanking the coding sequence of eGFP with 800 bp homology arms upstream and downstream of the double strand break near the start codon of MYH9 or MYH10 exon two and the plasmids were synthesized by GeneArt (ThermoFisher Scientific).

Fabrication of micropatterned substrates

Request a detailed protocol

Micropatterned substrates were prepared using the microcontact printing technique (Mrksich and Whitesides, 1996). Briefly, a master structure, which serves as a negative mold for the silicon stamp was produced by direct laser writing (Anscombe, 2010) and the stamp was molded from the negative using Sylgard 184 (Dow Corning #105989377). The stamp-pattern resembles a sequence of crosses with different intersections, a bar width of 5 µm and edge length of 45–65 µm. The pattern was either transferred using gold-thiol chemistry (Mrksich et al., 1997) or direct microcontact printing (Fritz and Bastmeyer, 2013). When using gold-thiol chemistry, the stamp was inked with a 1.5 mM solution of octadecylmercaptan (Sigma Aldrich #O1858) in ethanol and pressed onto the gold-coated coverslip, forming a self-assembled monolayer at the protruding parts of the stamp. For the subsequent passivation of uncoated areas, 2.5 mM solution of hexa(ethylene glycol)-terminated alkanethiol (ProChimia Surfaces #TH-001-m11.n6) in ethanol was used. Micropatterned coverslips were functionalized with a solution of 10 µg ml−1 FN from human plasma (Sigma Aldrich #F1056) for 1 hr at room temperature. For direct microcontact printing, stamps were incubated for 10 min with a solution of 10 µg ml−1 FN and pressed onto uncoated a coverslip. Passivation was carried out using a BSA-Solution of 10 mg ml−1 in PBS for backfilling of the coverslip at room temperature for 1 hr.

Fabrication of stimuli-responsive 3D micro-scaffolds

Request a detailed protocol

The fabrication and characterization of the stimuli-responsive 3D micro-scaffolds was described in detail in Hippler et al., 2020. Briefly: A commercial direct laser writing system (Photonic Professional GT, Nanoscribe GmbH) equipped with a 63×, NA = 1.4 oil-immersion objective was used for the fabrication process. In three consecutive writing steps, the various components of the micro-scaffolds were produced by polymerizing liquid photoresists in the voxel of a femto-second pulsed near infrared laser. By using different photoresists that possess hydrophilic or hydrophobic surface properties after polymerization, protein-repellent or protein-adhesive substructures were created. TPETA photoresist was used to write the protein-repellent walls and PETA photoresist for the protein-adhesive beams. For the stimuli-responsive hydrogel, a host-guest based photoresist was polymerized in the center of the scaffold. All mixtures and reagents can be found in Hippler et al., 2020. Before the sample was used for further experiments, it was immersed overnight in water with 20 mM 1-Adamantanecarboxylic acid (Sigma-Aldrich #106399). This solution triggered the swelling of the hydrogel that helped to remove unpolymerized residues from the material network.

Immunostaining

Request a detailed protocol

Samples were fixed for 10 min using 4% paraformaldehyde in PBS and cells were permeabilized by washing three times for 5 min with PBS containing 0.1% Triton X-100. Following primary antibodies were used: mouse monoclonal to FN (BD Biosciences, #610078), rabbit polyclonal to NMHC IIA (BioLegend, #909801), rabbit polyclonal to NMHC IIB (BioLegend, #909901), rabbit monoclonal to NMHC IIC (CST, #8189S), mouse monoclonal to Paxillin (BD Biosciences, #610619), mouse monoclonal to pRLC at Ser19 (CST, #3675S). All staining incubation steps were carried out in 1% BSA in PBS. Samples were again washed and incubated with fluorescently coupled secondary antibodies and affinity probes. Secondary Alexa Fluor 488-, Alexa Fluor 647- and Cy3-labeled anti-mouse or anti-rabbit antibodies were from Jackson Immunoresearch (West Grove, USA). F-Actin was labeled using Alexa Fluor 488- or Alexa Fluor 647-coupled phalloidin (ThermoFisher Scientific #A12379 and #A22287) and the nucleus was stained with DAPI (Carl Roth #6335.1). Samples were mounted in Mowiol containing 1% N-propyl gallate.

Fluorescence imaging

Request a detailed protocol

Images of immunolabeled samples on cross-patterned substrates were taken on an AxioimagerZ1 microscope (Carl Zeiss, Germany). To obtain high-resolution images of minifilaments, the AiryScan Modus of a confocal laser scanning microscope (LSM 800 AiryScan, Carl Zeiss) or a non-serial SR-SIM (Elyra PS.1, Carl Zeiss) were used. The grid for SR-SIM was rotated three times and shifted five times leading to 15 frames raw data of which a final SR-SIM image was calculated with the structured illumination package of ZEN software (Carl Zeiss, Germany). Channels were aligned by using a correction file that was generated by measuring channel misalignment of fluorescent TetraSpeck microspheres (ThermoFischer, #T7280). All images were taken using a 63×, NA = 1.4 oil-immersion objective.

For live cell flow measurements, the incubation chamber was heated to 37°C. Cells were seeded on FN-coated cell culture dishes (MatTek #P35G-1.5–14 C) or micropatterned substrates 3 hr prior to imaging. During imaging, the cells were maintained in phenol red-free DMEM with HEPES and high glucose (ThermoFisher Scientific #21063029), supplemented with 10% bovine growth serum and 1% Pen/Strep.

Flow analysis and intensity measurements

Request a detailed protocol

Flow in vSF or peripheral actin arcs was measured by creating kymographs from a ROI using the reslice function in ImageJ. From these kymographs, movement of individual, persistent minifilaments was tracked manually to determine the flow rate in nm/min.

Quantification of pRLC-, NMHC II-, and GFP-intensities were carried out by calculating the mean intensity along segmented SFs.

AFM nanoindentation experiments

Request a detailed protocol

We used a NanoWizard AFM (JPK Instruments) equipped with a soft silicon nitride cantilever (MLCT, Bruker) with a nominal spring constant of 0.03 N/m to perform the indentation experiments. The cells were allowed to spread for at least 8 hr in cell culture dishes (TPP # 93040) before the experiment was performed. For each cell, 16 individual measurements were performed above the nuclear region. A Hertz model was fitted to the resulting force displacement curves and the resulting Young’s moduli were averaged.

Quantification of FA parameters and R(d)-correlations

Request a detailed protocol

Quantification of FAs was performed using the pixel classification functionality of the image analysis suite ilastik (Berg et al., 2019). First, ilastik was trained to mark the cell area. In a separate classification project ilastik was trained to discern between FA and non-FA. The segmentations were exported in the npy file format for analysis in custom scripts. To determine the number of FAs connected component analysis was applied to the segmented FAs as implemented in openCV 3.4.1.

Quantifications of R(d)-correlations were carried out by manually fitting circles to the peripheral actin arcs of cells on cross-patterned substrates. The spanning distance d was defined as the cell area covering the passivated substrate area. In cases, where the cell was polymerizing actin along the functionalized substrate without surpassing the complete distance to the cell edges (as observed in the case of NM IIA-KO cells), only the distance of the cell body covering the passive substrate was considered.

Stretching experiments and force measurements

Request a detailed protocol

Live cell imaging was performed as described above using an LSM 800 equipped with a 40×, NA = 1.2 water-immersion objective and the motorized mechanical stage to sequentially move to all the positions during the time series. To exchange solutions during the experiment, the sample was mounted in a self-built fluidic chamber. For initial force measurements, cells were imaged for 30–60 min under steady-state conditions and then detached from the substrate using Trypsin/EDTA. For stretching experiments, the cells were first imaged for 10 min under steady-state conditions. To induce the mechanical stretch, the solution was exchanged to medium containing 20 mM 1-Adamantanecarboxylic acid and the cells were imaged in the stretched state for 30–70 min. Releasing the stretch was obtained by again replacing the medium with normal imaging medium and the cellular reaction was monitored for up to 30–50 min.

To calculate the initial and reactive forces, the images were analyzed by digital image cross-correlation based on a freely available MATLAB code (Eberl et al., 2006) (MathWorks) that was customized as described in Hippler et al., 2020. The code is available as source code file. In every scene, regions of interest were defined on the four beams and every frame of the time series was compared to a reference image at t = 0. The calculation of the maximum cross-correlation function resulted in the 2D local displacement vector. Four different positions per beam were tracked and averaged to obtain a mean displacement per beam as a function of time. Additional tracking of solid marker structures and reference scaffolds without cells was used to correct potential offsets and deviations that are not induced by cellular forces. Ultimately, the measured displacements were converted to cell forces by modeling the properties of the micro-scaffolds by finite element calculations (see [Hippler et al., 2020] for details).

Cell-seeded collagen gels

Request a detailed protocol

CSCGs were generated according to the guidelines in Provenzano et al., 2010. We used collagen I from rat tails (Enzo Life Sciences #ALX-522–435) and seeded 1.5×105 cells in collagen matrices with a final concentration of 1 mg/ml. As a neutralizing buffer, 0.1 M HEPES in 2×PBS was used in equal volumes to the collagen solution. 250 µl total volume were distributed in 18 mm glass bottom dishes and allowed to polymerize at 37°C. After 2 hr, the dish was backfilled with DMEM and the CSCG’s were cultivated in suspension for another 18 hr. After 20 hr total incubation time, CSCG’s were fixed in 4% PFA and the diameter was measured.

For gels fixed to the glass bottom, dishes were pre-coated with thin plate coating collagen I (Enzo Life Sciences #ALX-522-440-0050) and allowed to dry overnight. On the following day, CSCG’s were fabricated as described and polymerized on the pre-coated culture dishes.

Modeling

Request a detailed protocol

For more information about the dTEM and the parameters, we refer the reader to Appendix 1, where a detailed description can be found.

Appendix 1

Crossbridge cycle model for nonmuscle myosin II

In order to model the crossbridge cycle of the different isoforms of nonmuscle myosin II, we consider their three main mechanochemical states and the stochastic transitions between them, as depicted in Appendix 1—figure 1A. Our three-state model has been extensively tested and parametrized before (Erdmann et al., 2013; Erdmann et al., 2016; Erdmann and Schwarz, 2012; Grewe and Schwarz, 2020a) and is used here with a small modification. In brief, myosin heads bind from the unbound state to the actin filament with rate k01=0.2s-1. Recently it has been shown that this binding occurs in two steps, with a non-stereospecific state existing before the weakly bound state, which is stereospecific. The non-stereospecific intermediate state becomes relevant in the case of myosin II inhibition by blebbistatin (Rahman et al., 2018) which we do not consider here, but this observation motivates us to choose a larger value k10=0.4s-1 for the unbinding rate from the weakly bound to the unbound state (rather than 0.004s-1 as used before [Erdmann et al., 2013; Erdmann et al., 2016; Erdmann and Schwarz, 2012; Grewe and Schwarz, 2020b]). From the weakly bound state, the powerstroke occurs with the high rate k12=1.4106s-1. Furthermore, the powerstroke is associated with swinging of the lever arm, which is simulated by increasing the individual motor strain xi by the powerstroke distance d=8 nm. After having performed the powerstroke, myosin can either return to the weakly bound state with the relatively small rate k21=0.7s-1, or it can unbind from actin with a force- and isoform-dependent rate 

(A1) k20a/b(F)=k200a/0b[Δcexp(-kmxi/fc)+(1-Δc)exp(kmxi/fs)].
Appendix 1—figure 1
Crossbridge cycle model overview.

(A) Mechanochemical crossbridge cycle for myosin II. (B) Tug-of-war of two mixed motor ensembles working against external springs. (C) Force-velocity relation for an ensemble (one half of a minifilament) with N=15 motors with varying numbers Na of NM IIA motors. The number of NM IIB motors is Nb=N-Na. (D) Force-free velocity v0 and (E) stall force Fs as a function of Na.

Here, k200a/0b are the transition rates at zero force of the A- and B-isoform, respectively. In particular, the rate for isoform A k200a=1.71s1 is much larger than the rate for isoform B k200b=0.35s1, which constitutes the mechanochemical difference between isoforms A and B in our model. The two terms in the brackets represent two different unbinding pathways, namely the catch-path and the slip-path, respectively. Transitions along the catch-path become slower with increasing force with force scale fc=1.66 pN. The force on the motor is calculated by the motor stiffness km and the motor strain xi. Conversely, transitions along the slip-path become faster with increasing force with force scale fs=10.35 pN. Δc is the fraction of transitions following the catch-path at zero force, while the complement is the fraction of transitions following the slip-path. Together, these two pathways model a catch-slip bond, so dissociation decreases with force at low loading (catch) and increases again at high loading (slip). Force dependence of the rates is only taken into account if the motor is loaded against its direction of movement, the transition rate defaulting to k200 for forces in the other direction. Note that in principle the force scales could also be modeled to depend on the isoform. In-vitro experiments suggest that the catch-path force scale for isoform B are lower than for isoform A (Kovács et al., 2007). Here, they are kept equal for simplicity, as the difference in the rate at zero force is the dominating effect at low forces.

In a minifilament, the different motor heads are mechanically coupled to form a bipolar structures with two ensembles pulling in opposite directions. This tug-of-war situation is depicted in Appendix 1—figure 1. We assume that in each minifilament half, N=15 motor heads are active (Grewe and Schwarz, 2020a). They work against external springs with strains z- and z+, respectively. In addition, each side of the minifilament consists of a variable number of NM IIA and NM IIB motors, Na,Nb,Na+andNb+, respectively, with Na-+Nb-=N and Na++Nb+=N. At all times the forces acting on the myosin heads of each sides are balanced against the forces in the external springs. This also yields the value for the motor strains xi required to evaluate Equation A1.

All model parameters are summarized in Appendix 1—table 1. The stochastic model is simulated using the Gillespie algorithm, which uses the assumed rates to determine the time until the next reaction takes place (Gillespie, 1976). From these simulations we obtain the force-velocity relations of the minifilaments with variable isoform content by averaging over many individual trajectories. As shown in Appendix 1—figure 1C, we obtain well-defined relations in all cases, which allow us to predict the free velocity v0 and the ensemble stall force Fs. We find that with increasing A-content, the free velocity v0 increases and the stall force Fs decreases, as shown in Appendix 1—figure 1D and E, respectively. This demonstrates that minifilament with more A-isoforms are more dynamic, but also less stable mechanically. As a third important quantity, we can extract an effective friction coefficient ξm from v(Fs)=-1/ξm, which is the steepness of the force-velocity relation at the stall force. This friction coefficient ξm decreases with increasing A-content, reflecting that the system becomes more dynamic.

Appendix 1—table 1
Model parameters.
ParameterSymbolValueReferences
Transition rates [s-1]k20a01.71Erdmann et al., 2016Stam et al., 2015
k20b00.35Erdmann et al., 2016Stam et al., 2015
k010.2Erdmann et al., 2016Stam et al., 2015
k100.4Rahman et al., 2018
k124.106Vilfan and Duke, 2003; Erdmann et al., 2016
k210.7Vilfan and Duke, 2003; Erdmann et al., 2016
Catch-path fractionΔc0.92Erdmann et al., 2016Stam et al., 2015
Catch-path force scale [pN]fc1.66Erdmann et al., 2016Stam et al., 2015
Slip-path force scale [pN]fs10.35Erdmann et al., 2016Stam et al., 2015
Neck-linker stiffness [pN/nm]km0.7Erdmann et al., 2016Stam et al., 2015
Powerstroke distance [nm]d8Vilfan and Duke, 2003; Erdmann et al., 2013; Erdmann and Schwarz, 2012
External springs [pN/nm]kf4Albert et al., 2014

Dynamic tension elasticity model (dTEM)

The invaginated shapes of strongly adherent cells have been shown before to result from actomyosin contractility (Zand and Albrecht-Buehler, 1989; Bischofs et al., 2008; Bar-Ziv et al., 1999). From a geometrical viewpoint, there are two actomyosin-related forces which balance each other along the invaginated arcs: an isotropic surface tension σ in the cortex and a line tension λ in the peripheral fiber. This leads to the Laplace law R=λ/σ for the arc radius (Bischofs et al., 2008; Bar-Ziv et al., 1999). Because experimentally it has been found that the radius R also depends on the spanning distance d of the invaginated arc, the line tension λ has been argued to also contain an elastic contribution (tension-elasticity model, TEM), leading to λ(d) and an increasing R-d relation, as observed experimentally (Bischofs et al., 2008). The line tension λ can be identified with the force F that acts in the fiber and in particular on the focal adhesions (FAs) by which it is anchored. Here we have confirmed the increasing R-d relation and in addition revealed that it also depends on isoform content. In order to make contact to the different crossbridge cycles of isoform A versus B, we now introduce a dynamic variant of the TEM (dTEM).

We consider a peripheral fiber of length L that is contracted by minifilaments that are distributed uniformely along its length. The contraction speed due to contractility is denoted by vc and should depend on both the force F inside the fiber and its length L (like for muscle, a longer fiber should contract faster). In order to be able to obtain a stationary situation, new length has to be generated in the FAs at which the fiber is anchored, as observed experimentally as flow out of the FAs (Endlich et al., 2007). The corresponding polymerization velocity is named vp and also should depend on fiber force F, but not on L, because it is a local property of the FAs. Specifically, it has been shown that the main polymerization factor in FAs, the formin mDia1, increases its polymerization rate with force (Jégou et al., 2013). Together, the two velocities lead to a length change

(A2) L˙=vp(F)-vc(F,L)

of the stress fiber, which is the central dynamic equation that we will analyze here.

The contractile speed of molecular motors can be modeled by a linearized force-velocity relation

(A3) vm(F)=1ξm(Fs-F)

with motor stall force Fs and effective friction coefficient ξm for a sarcomeric unit of reference length L0 (for a linear force-velocity relation, two parameters are sufficient and the free velocity follows as v0=Fs/ξm). Linear scaling of contraction speed with stress fiber length implies for a stress fiber of length L

(A4) vmL0=vc(F,L)Lvc(F,L)=LL0ξm(Fs-F).

This relates the contraction speed in the fiber to the properties of the motor ensemble. For the polymerization speed of actin at the focal adhesions we assume a linear force dependence

(A5) vp=Fξf

 where ξf is the effective friction coefficient inside the FAs.

The line tension that we obtain from the interplay of contraction and polymerization can now be related to the circular arc radius R with the Laplace law

(A6) R=Fσ.

This means that the dependence on F in Equation (A2) is in fact a dependence on the radius of curvature R, that in turn will depend on the length of the stress fiber L and the spanning distance d. To close Equation (A2), a geometrical equation that relates these quantities is required.

Stress fiber length L and the radius R are trivially related by the central angle φ as L=Rφ. The central angle is in turn dependent on spanning distance d and radius of curvature R. We then obtain

(A7) L={2Rarcsin(d2R)0φπ2R(π-arcsin(d2R))πφ2π

which is an implicit definition for R(L,d). While circular arcs with larger central angle than π cannot be observed on cross patterns, we do observe them on homogeneous substrates and in collagen gels. Therefore they are also included here in our discussion. In Appendix 1—figure 2A we plot R as a function of L as defined by Equation (A7) after rescaling all lengths with d. We see that the inversion is not unique and has two branches. This is due to d(L) not being uniquely defined by Equation (A7), which is visualized in Appendix 1—figure 2B. For large L/d, the angle φ is small, R/d is large and Ld. For φ=π (half-circle), we have L/d=π/2 and R=d/2. For larger φ, R/d increases again and finally diverges. On the cross patterns, we typically deal with the small angle case.

Appendix 1—figure 2
Geometrical relations between R, L and d.

(A) The arc radius R(L) is a function of arc length L on the interval L(d,). For L/d<π/2 it is monotonically decreasing and for L/d>π/2 it is monotonically increasing. Normalizing R and L to the spanning distance d yields a universal result. (B) Due to the geometry, L(d) is not a well defined function, as for each spanning distance there exist two solutions for a central angle 0<φ<2π.

By combining Equation (A2), (A4), (A5), (A6), we now obtain our central dynamical equation:

(A8) L˙=-LL0ξm(Fs-σR(L,d))+σR(L,d)ξf.

We non-dimensionalize this equation by measuring distance in units of Rmax=Fs/σ and time in units of τ=ξf/σ:

(A9) l˙=-llm[1-r(l,δ)]+r(l,δ)

where r is the dimensionless arc radius and δ is the dimensionless spanning distance. Moreover we have defined

(A10) lm=ξmL0ξfRmax=ξmL0σξfFs.

Appendix 1—figure 3 shows l˙ as a function of l. We see that for sufficiently small values of δ and lm, both a stable and an unstable fixed point exist, at small and large values of l, respectively. The stable fixed point at small l corresponds to a steady state. This state is lost through a saddle-node bifurcation for larger values of the dimensionless quantities δ and lm.

Appendix 1—figure 3
Stability analysis.

(A) Change in dimensionless arc length l˙ for a range of spanning distances δ as a function of l for lm=2. For small spanning distances there are two steady states. The one at lower l is stable, while the other one is unstable. For increasing δ the system approaches a saddle-node distribution, beyond which both steady states vanish and the length of the peripheral arc increases indefinitely. (B) l˙ For a range of lm and spanning distance δ=1. Again the two fixed points vanish in a saddle node bifurcation.

By solving for the stationary state with l˙=0, we arrive at a relation between the arc radius R and the steady state fiber length L, which we give both without and with dimensions: 

(A11) r=llm+l,R=LLm+LRmax.

Thus, the arc radius R initially increases linearly with arc length L and then starts to saturate towards Rmax=Fs/σ at the arc length of half maximal radius Lm=ξmL0/ξf. Here, the two competing length scales are the Laplace radius Rmax and the ratio of the slopes of the length-normalized force-velocity relation of the fiber and the force-velocity relation of the FA.

To compare with our experimental results, we finally have to convert the R(L) relation to a R(d) relation. Practically this can be done best by first fixing d, then finding the lower fixed point for l of Equation (A9) (if it exists) and finally calculating R from Equation (A11). Alternatively, one can use the approximation Ld for small central angles, which we did in the main text. We then arrive at

(A12) r=δδm+d,R=ddm+dRmax,

where we have renamed lm=δm and Lm=dm. This equation is the central result (1) in the main text. The result for δm<π is shown in Appendix 1—figure 4A. For the exact case we find R(d) relations that always start at R(0)=0. From there, the function increases monotonically while curving downward and approaching a plateau for low δm. In this regime, the approximation is reasonably accurate. At dhigh, where φ=π, the function stops approaching the plateau. Shortly after, at dcrit, the saddle-node bifurcation occurs and at higher spanning distances d no steady state exists anymore. For the parameters chosen in Appendix 1—figure 4A, dhighdcrit and for this reason, the region where central angles φ>π is very small.

Appendix 1—figure 4
Predicted R(d)-correlations.

(A,B) R(d) relationship predicted by the model. Blue solid lines are related to stable steady state lengths, where the arc is smaller than a half cicle, while dashed blue lines represent the result with approximation arcsinx=x. Solid orange lines represent stable steady states where the central angle φ>π and dotted orange lines represent unstable steady states. The dashed green line denotes d=2R, which corresponds to the circle of smallest radius by geometry. The colors in the phase diagrams represent parameter regions, where stable solutions can be found and represent arcs that are smaller (blue) and larger (orange) than half circles, respectively. In the white area, the arc curls inward and increases its radius indefinitely. (A) δm=1 (B) δm=3.5 (C) Phase diagram indicating whether the central angle is larger or smaller than π. The dashed vertical lines visualize the parameter range described by subfigure A and B, respectively.

For δmπ, the central angle φ>π. Again this cannot be observed on cross patterns, but we did experimentally observe this case in collagen gels. The R(d) relation again starts at zero for zero spanning distance and curves upward until reaching the critical value for d where the steady states do not exist anymore as shown in Appendix 1—figure 4B. Appendix 1—figure 4C gives a general overview of the parameter range indicating regions of upward curvature connected to central angles lower than π together with regions of downward curvature which are connected to central angles higher than π.

Using φr=l and sinφ/2=δ/2r in Equation (A11) we find

(A13) δ=2sinφ2(1-δmφ),

that is the contour lines of the central angle φ as a function of (δ,δm) are linear functions. In particular for φ=π, which is the situation of highest spanning distance given the radius, we find: 

(A14) dhigh=2(Rmax-dmπ).

For angles φ>π, the linear functions from Equation (A13) however intersect, which contour lines should never do. This implies, that the contour lines for φ have to be constrained more carefully. As the steady state central angle φ(δm,δ) is a smooth function that is well defined for low enough δm and δ and monotonically increases with δm and δ we can search for the maximum stable spanning distance δ w.r.t. central angle φ using Equation (A13). This yields,

(A15) δmmax=φ2cosφ2φcosφ22sinφ2,δmax=(2sinφ2)22sinφ2φcosφ2

which marks the border of stability of the system for πφ2π as shown in Appendix 1—figure 5. Contour lines of φ for φ>π start on this curve, with smaller δm having to be excluded from Equation (A13).

Appendix 1—figure 5
Phase diagram.

(a) Central angle φ and (b) Dimensionless radius r as a function of δ and δm. The white region represents unstable parameter configurations, while the colored areas represent the stable steady state central angle and radius respectively. The colored lines are contour lines of the central angle and indicate upper bounds for stability given that the maximum permissible central angle by the micropattern geometry.

Appendix 1—figure 5 shows the overall dependencies of the central angle φ and the radius r on the spanning distance and the respective length scale δm together with contour lines for the central angle φ, which can also be interpreted as upper bounds for stability given a specific micropattern geometry. The cross shaped micropattern yields maximum central angles of π/2 (blue line in Appendix 1—figure 5 and upper bound of the red region in Figure 3E of the main text) as illustrated in Figure 3B of the main text.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source files with the raw data are provided for all Figures, where quantifications are carried out.

References

Decision letter

  1. Pekka Lappalainen
    Reviewing Editor; University of Helsinki, Finland
  2. Anna Akhmanova
    Senior Editor; Utrecht University, Netherlands
  3. James R Sellers
    Reviewer; National Heart, Lung and Blood Institute, National Institutes of Health, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This study is of interest to researchers studying the actin cytoskeleton, cell adhesion, migration and morphogenesis. Through a combination of experiments and mathematical modelling, the authors provide interesting insights into the roles of three non-muscle myosin isoforms in cellular morphodynamics and force generation.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting your work entitled "Distinct roles of nonmuscle myosin II isoforms for establishing tension and elasticity during cell morphogenesis" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individual involved in review of your submission have agreed to reveal their identity: James R Sellers (Reviewer #1).

Our decision has been reached after consultation between the two reviewers and based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

This paper is of interest for scientists studying cell migration, adhesion, and mechanosensing. The work provides interesting new information on the roles of non-muscle myosin II paralogs (NMIIA and NMIIB) in the mechanics of contractile actomyosin bundles. Through generating NMIIA, NMIIB and NMIIC knockout cell-lines, and analyzing their phenotypes on homogeneous and micropatterned substrates, the authors provide evidence that NMIIA is responsible for the generation of intracellular tension, whereas NMIIB elastically stabilizes the NMIIA-generated tension. They also performed fluorescence-recovery-after-photobleaching experiments, combined with mathematical modeling, to elucidate the role of different exchange kinetics of NMIIA and NMIIB in myosin minifilaments.

The data presented in the manuscript are of good technical quality. However, some conclusions presented in the manuscript are not particularly strongly supported by the experiments, and thus the study is somewhat preliminary at this stage. The detailed comments by the two reviewers can be found below. In the discussions among the reviewers it was also considered that, although the manuscript certainly provides new information on the different roles of NMIIA and NMIIB, this study does not present such fundamental new insight into the functions of NMII paralogs that would make it a strong candidate for publication in eLife.

Reviewer #1:

This manuscript examines the role of nonmuscle myosin IIA and IIB in establishing tension and elasticity in cells. They use CRISPR/Cas9 technology to ablate the specific paralogs and grow cells on micropatterned surfaces.

An unaddressed point, both experimentally and in the discussion and modeling, is what are the relative amounts of NM IIA and NM IIB in the U2OS cells? Also does the level of expression of one paralog change in response to ablation of the other?

On homogeneous substrates the authors show the localization of stress fibers and focal adhesions in both wild type and in the myosin paralog-specific KOs. They show the localizations of the myosin paralogs in the WT cells, but do not show the localizations of the remaining myosins in the paralog-specific KO cells. It would be informative to see this.

Line 190: I think there needs to be more discussion regarding the word "circular" as a description of arc shape.

Lines 195-197: Describe the origin of the values given for λ and σ.

NM IIA KO cells. The images shown in Figure 2—Figure supplement 1 does not appear to back up the statement that "only a few NM IIB minifilaments co-localize". It also makes me return to the first point made above about relative amounts of the myosins.

Modeling: The authors might want to use the term "duty ratio" to explain the difference in load bearing ability. Also, they do not mention the possibility of load-induced changes in the kinectis of these myosins. In this regard they should reference Kovacs et al. (2007)( doi: 10.1073/pnas.0701181104) which showed that the kinetics of both NM IIA and IIB are affected by load, but that NM IIB is more sensitive.

Lines 332-334. If the NM IIB filaments in the NM IIA KO cells are not phosphorylated, you might expect that blebbistatin might have little or no effect on these cells. Could this be tested?

Figure 3—figure supplement 2. I do not think these experiments add anything to the manuscript, unless more supporting information is provided. First of all, the details of this are not mentioned very prominently in the results. Second, the various mutants are used without any corroboration that they are actually behaving in the manner that is referenced. The authors should show (and quantify) the myosin filament localizations for these mutants.

Figure 5. Would you like to speculate on the "immobile" fraction of the myosin paralogs in the FRAP experiments? Do you envision that, perhaps, the myosin hexamers in the core of the filaments do not exchange? If so, that might not be consistent with your interpretations that these filaments can dissemble and form rapidly.

Line 388: There is actually quite a bit of controversy as to which kinetic step is correlated with force generation for myosins. Several studies suggested that force generation is associate with either ADP release or an isomerization of myosin-ADP states.

Blebbistatin inhibits the ability of myosin to enter a strongly bound state. In the presence of blebbistatin myosin binds only weakly to actin. If it inhibited the force-generating step then you would expect myosin to be strongly bound to actin in the presence of blebbistatin. Essentially, blebbistatin converts a phosphorylated, active NM II to a state that mimics unphosphorylated, inactive myosin.

Line 422. The Kovacs et al. (2007) paper mentioned above supports the notion that attachment lifetime of NM IIB is more force dependent than is that for NM IIA.

Reviewer #2:

This study investigates individual roles of three nonmuscle myosin II paralogs in U2OS cells using CRISPR/Cas9-mediated knockouts of each paralog. A novel aspect of this study is that the authors use cross-shaped fibronectin patterns to culture cells, which allowed them to evaluate quantitative aspects of the resulting phenotypes. As key metrics, they used a relationship [R(d)] between the curvature and the length of the lateral actin arcs formed on such patterns. The underlying hypothesis is that these parameters are defined by a competition between the surface tension all over the cell and the line tension in the arc. The authors also developed mathematical models to evaluate the ideas that the differences in both R(d) and the exchange rate of two myosins, NM IIA and NMIIB, result from distinct kinetics of their motors. These data reveal certain aspect about individual functions of NMII paralogs, although additional clarifications about underlying biology would be very helpful. Besides this main line of investigations, authors also present other observations, from which they draw conclusions, which are not sufficiently well justified.

1. The benefits of R(d) as the main parameter to characterize the differences in KO phenotypes are not obvious. Indeed, the difference between the IIA KO and IIB KO phenotypes is visually quite obvious, but it is not revealed by R(d). Can this parameter inform us about how the surface tension and/or the line tension changes in each case?

2. On the patterns, actin and myosin localize not only to arcs, where they apparently generate the line tension, but also to the cytoplasm over the passivated substrate, where they might generate surface tension. After IIB KO, more actin (Figure 2C) seems to move to the cytoplasm relative to how much remains in the arcs. Can it mean that these cells have higher surface tension and lower line tension relative to wild type? In this is the case, according to the proposed model, such redistribution should result in a higher curvature of the arcs, but the actual result was opposite – straighter arcs, which should mean that the line tension overwhelms surface tension. Does it mean then that IIB is mainly responsible for the surface tension? Is there a biological explanation for this result?

3. The assumption of a slower inflow from focal adhesions in the absence of IIA predicts straighter arcs. Conversely, a faster inflow in the absence of IIB should lead to more curved arcs. However, the results are opposite. Why do these intuitive considerations conflict with the conclusions of the model?

4. While interpreting the IIA KO phenotype, authors need to take into account that total amount of myosin II is significantly reduced in KO cells, as IIA is the major isoform in U2OS cells, suggesting that the phenotype could be well explained by a lower quantity, not by a different quality of the remaining myosin. A proper control would be to use cells that express IIB in the IIA KO cells at approximately the same level as total myosin II in WT cells.

5. The conclusion that IIA is necessary to initiate assembly of IIB filament is not supported by the data, which show that peripheral myosin II filaments in the cells have 75% of IIA subunits and 25% of IIB subunits (Figure 4-s2F), thus suggesting that all filaments initially contain both IIA and IIB, but their ratio changes over time and distance from the cell edge. No homotypic IIA filaments have been demonstrated in the study. Despite the conclusion saying "we found that all heterotypic minifilaments arise from homotypic NM IIA minifilaments" (p. 15, ll. 349-350). Available data in the literature show that IIB can polymerize by itself both in vitro and in cells lacking IIA. The claim that IIA or IIAΔIQ "restore" IIB filaments is not validated quantitatively. In fact, in figure 4-s1A, a NM IIA-KO cell that does not express GFP-NM IIA-WT has abundant NM IIB filaments. Moreover, the authors show that overexpression of IIB also restores NMIIB filaments (Figure 4-s1D), suggesting that a low levels of IIB is likely responsible for the low amount of IIB filaments in IIA KO cells, rather than their inability to form filaments in the absence of IIA.

6. The conclusions that IIA triggers RLC phosphorylation and that IIB can form filaments with unphosphorylated RLC are so extreme that their validation requires comprehensive analyses, extensive quantifications using proper normalizations to myosin levels, as well as alternative approaches. At the present state of knowledge, it is hard to imagine that myosin filaments would form without RLC phosphorylation. The idea that myosin II can somehow trigger a feedback loop to activate RLC phosphorylation is theoretically possible, but requires solid evidence, which is not provided here. The observations instigating the above conclusion are more likely explained by some technical issues. For example, IIB filaments may contain double-phosphorylated RLC, which is not recognized by the used antibody, or the amount of IIB is too low, or there is a problem with signal detection. The authors show that the pRLC level does increase linearly with overexpression of IIB although with a different slope compared with IIA. However, data in Figure 4-s1B and 4-s1E must come from different experiments, thus making pRLC staining intensities incomparable.

7. The significance of using the IIA mutants is hard to understand. First, it is not clear what mutants are meant in different statements, e.g. mutants with "prolonged NM IIA dwell times in the minifilaments" (p. 14, l. 313), or "mutants, in which the disassembly of the NM IIA hexamers was blocked" (p. 14, l. 315), or "constitutively active NMHC IIA construct" (p. 14, l. 317). They all seem to refer to mutants with impaired disassembly (ΔIQ2, ΔNHT and 3xA). Yet, they are contrasted to each other (p. 14, ll. 315-317 and in Figure 3-s2). Second, what is the idea behind using the ΔACD mutant? What does it reveal? Third, none of these mutations affects motor activity of IIA. They only affect its polymerization. Given that the mathematical model considers only motor activities of IIA and IIB, how do these experiments test the model? Finally, since IIB was not a part of these experiments, how did authors arrive to the following conclusions from these data: "This demonstrates that spatially and temporally balanced ratios of active NM IIA and NM IIB hexamers in heterotypic minifilaments are mandatory to adjust the contractile output in SFs and the relation between tension and elasticity. Therefore, the specific biochemical features of the isoforms and not their overall expression are important for the generation of tension and elastic stability, respectively." (p. 14, ll. 318-322) and "the specific intracellular force output is precisely tuned by the ratio and dwell time of individual NM IIA and NM IIB hexamers in the heterotypic minifilaments." (p.22, ll. 518-520)?

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Distinct roles of nonmuscle myosin II isoforms for establishing tension and elasticity during cell morphodynamics" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Anna Akhmanova as the Senior Editor. The following individual involved in review of your submission have agreed to reveal their identity: James R Sellers (Reviewer #1). Please note that because the original reviewer #2 was unable to evaluate the new submission, the manuscript was reviewed by another expert in the field.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

While the reviewer #1 found the revised manuscript significantly improved, the reviewer #2 stated that large part of the data are confirmatory and that the most novel findings were not sufficiently well presented in the manuscript. Thus, the manuscript should be extensively rewritten to address the points raised by reviewer #2.

1). The study should be put better into a context of earlier work on NMII isoforms. The parts of the manuscript presenting confirmatory data should be shortened, and the most novel findings should be better explained to make them also accessible for a non-specialist reader. Making the manuscript shorter and more focused will increase its impact.

2). Also the 'Introduction' should be shortened and focused only on the published literature. Instead of extensively discussing new findings in the 'Introduction', these should be only briefly mentioned in the end of 'Introduction'.

Reviewer #1:

I am satisfied with the presentation of the data.

Reviewer #2:

This manuscript, previously revised in eLife, but not by this reviewer, describes the different effects of NMII isoforms in mechanical adaptation to different microenvironments. The approach consists of U2OS cells depleted of each specific isoform by CRISPR/CAS9. Based on the rebuttal, the authors had, in their previous version, data on NMIIA mutants as well as FRAP data, which have been removed from this iteration. Instead, the authors provide modeling to show that NMIIA is the "first responder" in generating tension; whereas NMIIB stabilizes elastic tension. The authors propose a novel role for NMIIC in establishing tensional homeostasis.

This manuscript contains important information regarding the role of NMII isoforms in cellular responses. The manuscript seems have changed mightily from its previous incarnation. Insomuch as this reviewer did not see the previous version, what follows is an appraisal on the current version.

Overall, the manuscript is well done, and experimentation is of high caliber. However, the study takes a long time getting into actually novel data, and its amount is limited. A significant part of the manuscript is confirmatory, including the role of NMIIA in force generation (Jorrisch et al., 2013, PMID 23616920, for example), adhesion elongation (many reports); and of NMIIB in adhesion "consolidation". The other reviewers asked about the relative amount of NMII isoforms, which was a good point. The authors have solved this by overexpressing NMIIB in NMIIA KO cells, which does not restore any effect observed in these cells, which actually confirms that the ability of NMIIB filaments to form is limited in these cells.

The authors engaged in an argument with the previous reviewers on the importance of the levels of NMII isoforms. While I'm convinced by the argument of the authors (NMIIB overexpression in NMIIA KOs is a good experiment), I'm curious as to more NMIIC has effects on the elastic recoil observed in the last experiment of the paper. Also, include mass spec data as in Ma et al. (2010) would be useful.

The novel part starts in figure 3, in which the authors observe a subtle change in the bending of actin bundles in cross-shaped patterns. The graph is quite counterintuitive. A and D look similar, and the graphs look similar. This is understandable. However, B and C (NMIIA and NMIIB Kos) are somewhat similar, yet the graphs are opposite, with dTEM converging on Rmin on NMIIA KOs; and away from Rmin in NMIIB KOs. The text explanation (pages 10 and 11) works, but the representative cell is head scratching.

I haven't seen the RLC phosphorylation data, but I'm intrigued. The manner the previous reviewers wrote about it makes it hard to understand what was going on. I'm guessing the authors will pursue this in future work.

In Figure 4, the authors propose a model that correlates dynamic tension and elasticity with actomyosin crossbridging. They propose that the short duty ratio of NMIIA correlates with the generation of dynamic tension; and the higher duty ratio of NMIIB explains the elastic behavior of the actomyosin arches. While it is entirely possible this may be true, the cellular behavior of myosin II chimeras (e.g. as published by Tony Means and Rick Horwitz) is not dominated by the duty ratio (which depends entirely on actin-myosin binding); but by myosin filamentation, which depends on the tail domains of the heavy chains. I would require the authors to integrate this in their model, which may be correct theoretically, but would hardly explain the behavior of the cell outside a cross-shaped pattern.

The most interesting argument is the potential role of NMIIC in the mechanical response of cells. The authors seem to consider NMIIC as an oscillatory dampener that controls force relaxation. However, this is a very undeveloped part of the manuscript, which merits further exploration. I don't think this is particularly easy.

In summary, while I find a lot of merit in this paper, I find that more than half the study is confirmatory, and the novel part will appeal only to hardcore specialists in the field. Thus, I am not convinced it represents a sufficient general advance for publication in eLife.

https://doi.org/10.7554/eLife.71888.sa1

Author response

[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

This paper is of interest for scientists studying cell migration, adhesion, and mechanosensing. The work provides interesting new information on the roles of non-muscle myosin II paralogs (NMIIA and NMIIB) in the mechanics of contractile actomyosin bundles. Through generating NMIIA, NMIIB and NMIIC knockout cell-lines, and analyzing their phenotypes on homogeneous and micropatterned substrates, the authors provide evidence that NMIIA is responsible for the generation of intracellular tension, whereas NMIIB elastically stabilizes the NMIIA-generated tension. They also performed fluorescence-recovery-after-photobleaching experiments, combined with mathematical modeling, to elucidate the role of different exchange kinetics of NMIIA and NMIIB in myosin minifilaments.

The data presented in the manuscript are of good technical quality. However, some conclusions presented in the manuscript are not particularly strongly supported by the experiments, and thus the study is somewhat preliminary at this stage. The detailed comments by the two reviewers can be found below. In the discussions among the reviewers it was also considered that, although the manuscript certainly provides new information on the different roles of NMIIA and NMIIB, this study does not present such fundamental new insight into the functions of NMII paralogs that would make it a strong candidate for publication in eLife.

We thank the two editors and the two reviewers for their constructive and detailed comments, which motivated us to completely rework our project. We agree that our initial submission was somehow preliminary and now have added the results from new experiments that confirm our earlier statements on the cellular functions of the NM II paralogs. Strikingly, our new experiments even led to the identification of a novel cellular function for NM IIC. Our new advances became possible because we now complement our shape analysis by a force generation analysis:

– We have conducted new shape and force generation experiments for cells in 3D collagen gels and confirmed that NM IIA-KO cells can spread in a structured environment (as observed earlier for micropatterned substrates), but also that their invaginated arcs seem to be smaller, indicating smaller cortical tension. A gel contraction experiment then confirmed that they cannot generate global tension, in marked contrast to NM IIB-KO cells. In these experiments, no phenotype was observed for NM IIC-KO cells.

– In order to address the dynamics of force generation, we conducted new experiments in which single cells are dynamically stretched and relaxed in a 3D-printed stretching apparatus. As expected, we find that NM IIA-KO cells cannot generate forces in response to the changed environment. Strikingly, NM IIB-KO cells initially behaved similar to WT cells, but then generated significantly less force upon a mechanical stretch. Very surprisingly, however, we now found for the first time a phenotype for NM IIC-KO cells, namely the inability to establish tensional homeostasis after stretch release.

In response to the comments by the reviewers, we now have also conducted NM IIB overexpression experiments that demonstrate that although NM IIA is much more abundant than NM IIB, their different functions as reported by us is qualitative in nature and does not depend on the exact expression level. Because our new experiments now increase the focus on the cellular function of the different NM II paralogs, we decided to leave out our preliminary results on RLC-phosphorylation and exchange dynamics, which we will improve and publish in future work.

In summary, we have completely reworked this manuscript by performing several new types of experiments. We believe that they have strengthened the validity of our earlier results on the distinct functions of NM IIA and B by clarifying the role of expression levels, physiological 3D environments and force generation. In addition, we have discovered a new and formerly unknown cellular function of NM IIC. Together, these results make our revised manuscript much very interesting to the general readers of eLife and we hope that you will be able to reconsider our revised manuscript for publication.

Reviewer #1:

This manuscript examines the role of nonmuscle myosin IIA and IIB in establishing tension and elasticity in cells. They use CRISPR/Cas9 technology to ablate the specific paralogs and grow cells on micropatterned surfaces.

An unaddressed point, both experimentally and in the discussion and modeling, is what are the relative amounts of NM IIA and NM IIB in the U2OS cells? Also does the level of expression of one paralog change in response to ablation of the other?

We thank the reviewer for these questions, which we were able to answer in additional experiments. We have generated GFP-NMHC IIA and GFP-NMHC IIB fusion proteins with the GFP expressed under the endogenous promoter of the paralog. This enabled us to precisely quantify the relative protein amounts of NM IIA and NM IIB without overexpression or antibody binding artifacts. We added the quantification in the new Figure 2B to clarify this aspect. We also measured the change of expression of the paralogs in response to the ablation of the other, as suggested by the reviewer and added this info to the new Figure 1—figure supplement 3E. As expected by the reviewer, we find that NM IIA is much more abundant than NM IIB (in fact 4.5 times more abundant), but that this abundance does not change the qualitative difference between the two paralog functions, namely that NM IIA is required to establish tension and that NM IIB stabilizes it.

On homogeneous substrates the authors show the localization of stress fibers and focal adhesions in both wild type and in the myosin paralog-specific KOs. They show the localizations of the myosin paralogs in the WT cells, but do not show the localizations of the remaining myosins in the paralog-specific KO cells. It would be informative to see this.

The localization of the remaining paralog (for NM IIA and NM IIB) had been shown in Figure 4 of the initial submission. Since we have now included new experiments in our revised manuscript, we not only have substantially rewritten the text, but also rearranged the figures accordingly. We removed old Figure 4 and instead provide a more detailed analysis about the localization of the remaining paralogs in new Figure 1—figure supplement 3. These data now provide the information requested by the reviewer. In summary, we find that the depletion of NM IIA does not significantly increase the amount of NM IIB or NM IIC minifilaments along SFs. However, the loss of NM IIA leads to a changed localization pattern of NM IIB and NM IIC. Since such changes in paralog localization were not observed for NM IIB-KO and NM IIC-KO cells, these results again strengthen our interpretation, namely that NM IIA initiates new contraction sites and guides the actomyosin system in the absence of external guidance cues.

Line 190: I think there needs to be more discussion regarding the word "circular" as a description of arc shape.

We now provide a quantification of circularity as new Figure 3—figure supplement 2. First the cell contours were fit with the ImageJ/Fiji-plugin JFilament and then circular arcs very fitted using a custom-written script. Next the root mean squared deviation between points on the contour and the fitted circle was measured and converted into a relative error statement. We find that for each cell type the average error was always below 2 percent, demonstrating that these arcs are indeed strongly circular, as observed first in our earlier paper Bischofs et al. Biophysical Journal 2008 (10.1529/biophysj.108.134296) and later confirmed by many other groups. The error was largest for the NM IIA-KOs, in agreement with our main result that these cells cannot generate tension.

Lines 195-197: Describe the origin of the values given for λ and σ.

This statement is based on model fits that have been performed by many groups with roughly similar results. We now cite some of the corresponding papers for these values. The basic idea is that the radius of the circular arc should follow the Laplace law R=λ/σ. Because R can be easily measured by circle fitting, one still has to estimate either λ or σ from another process. This can be done e.g. with traction force microscopy on soft elastic substrates or on pillar arrays, compare our paper Bischofs, Schmidt and Schwarz, Physical Reviews Letters 2009 (10.1103/PhysRevLett.103.048101), which we now cite in the revised version. In the current work, we do not provide explicit estimates for λ or σ and only the order of magnitude values are given as in the initial submission. It is important to understand that NM II KO will change both λ and σ and therefore we cannot predict changes on radius R=λ/σ. From our earlier work on cell shapes (10.1016/j.celrep.2019.04.035; 10.1529/biophysj.108.134296), we know that blebbistatin inhibition of NM II tends to affect λ more than σ, leading to smaller radii. As we show here, the same reasoning cannot be applied directly to the NM II-KOs, because besides force, also flow seems to play an important role (NM IIB has a larger stall force, but also a higher effective friction, and these effect work against each other in our model). We leave it to future work to directly measure exact values for λ or σ for the NM II-KOs investigated here. Our main focus here is to show that in principle, the experimentally measured R-d-relations can be explained directly from the known differences in the NM IIA and B crossbridge cycles.

NM IIA KO cells. The images shown in Figure 2—Figure supplement 1 does not appear to back up the statement that "only a few NM IIB minifilaments co-localize". It also makes me return to the first point made above about relative amounts of the myosins.

As stated above, we have improved this part by including measurements about the paralog intensities. Although we did not find a significantly decreased intensity of the NM IIB filaments when NM IIA was depleted, their localization was changed. The NM IIB filaments in NM IIA-KO cells are, however, so densely packed that we were not able to extract the number of filaments along the peripheral actin arcs. We believe that this issue is now clarified by the other changes.

Modeling: The authors might want to use the term "duty ratio" to explain the difference in load bearing ability. Also, they do not mention the possibility of load-induced changes in the kinectis of these myosins. In this regard they should reference Kovacs et al. (2007)( doi: 10.1073/pnas.0701181104) which showed that the kinetics of both NM IIA and IIB are affected by load, but that NM IIB is more sensitive.

Thank you for this suggestion. We now mentioned in the main text that NM IIA has a much smaller duty ratio than NM IIB. We note that our model in principle includes the load dependance of the different myosins (compare theory supplement), but that our simulations show that the faster release rate of NM IIA is the dominating aspect. In our model, the load-dependent rates mainly affect the mechanics of the motor in such a way that a higher affinity to actin at higher loads leads to increases in the convexity of the force-velocity relation and the stall force. This effect is negligible for the low duty ratio of NM IIA, while it becomes appreciable for NM IIB (see the theory supplement Figure S1C). Reducing the catch-bond force scale fc for NM IIB (i.e. increasing the affinity to actin at high forces further) only strengthens this behavior. We now included this discussion in the theory supplement.

Lines 332-334. If the NM IIB filaments in the NM IIA KO cells are not phosphorylated, you might expect that blebbistatin might have little or no effect on these cells. Could this be tested?

It was never our intention to create the impression that NM IIB filaments are not phosphorylated in general and we apologize if our statements and conclusions were misleading in this context. Our initial speculation was that NM IIA induces a feedback loop which might enhance the phosphorylation of NM IIB. We agree with the reviewer that this could be tested by using blebbistatin. However, because we now have shifted the focus of this work to cellular effects, we decided to not cover this interesting question here, but to investigate it further in future work.

Figure 3—figure supplement 2. I do not think these experiments add anything to the manuscript, unless more supporting information is provided. First of all, the details of this are not mentioned very prominently in the results. Second, the various mutants are used without any corroboration that they are actually behaving in the manner that is referenced. The authors should show (and quantify) the myosin filament localizations for these mutants.

We thank the reviewer for pointing this out. Indeed, the description of this part was very condensed due to space limitations. We have now decided to remove this figure supplement as part of our effort to improve the manuscript’s focus towards cell mechanical issues.

Figure 5. Would you like to speculate on the "immobile" fraction of the myosin paralogs in the FRAP experiments? Do you envision that, perhaps, the myosin hexamers in the core of the filaments do not exchange? If so, that might not be consistent with your interpretations that these filaments can dissemble and form rapidly.

This is a very interesting suggestion that should be addressed with super-resolution approaches in the future. Even if there was a core that did not disassemble, that smaller assembly could more easily rearrange and reassemble. We now have removed the FRAP experiments from our manuscript to improve the focus on cell mechanics, but will address this important issue in future work.

Line 388: There is actually quite a bit of controversy as to which kinetic step is correlated with force generation for myosins. Several studies suggested that force generation is associate with either ADP release or an isomerization of myosin-ADP states.

Blebbistatin inhibits the ability of myosin to enter a strongly bound state. In the presence of blebbistatin myosin binds only weakly to actin. If it inhibited the force-generating step then you would expect myosin to be strongly bound to actin in the presence of blebbistatin. Essentially, blebbistatin converts a phosphorylated, active NM II to a state that mimics unphosphorylated, inactive myosin.

Many thanks for these explanations. We agree that blebbistatin inhibits the transition to the strongly bound state and in our model this is represented by reducing the rate k12. As we now have removed the FRAP-part of our manuscript, this part is no longer needed, but will be used in a future publication. However, in the theory supplement we briefly comment on the non-stereospecific binding of myosin II to actin discovered in the context of blebbistatin inhibition and cite the corresponding paper by the Mansson group.

Line 422. The Kovacs et al. (2007) paper mentioned above supports the notion that attachment lifetime of NM IIB is more force dependent than is that for NM IIA.

Many thanks for this comment. In our model, the main effect of A versus B is the fast rate for dissociation from the filament. This step is force-dependent as explained in the supplement, but we do not assign different force scales to the two isoforms. However, there is an indirect effect in our model consistent with the Kovacs-paper, namely that the slowly cycling B is stronger force-dependent because it spends more time on the filament, and therefore the powerstroke becomes more important, although here we take it not to be explicitly force-dependent. In principle, we could further adapt our model according to this suggestion by also assigning different force scales to A versus B. This might in fact be an important aspect when addressing different loading situations, but in general, we take it from our simulations that the dominating effect will be the differences in dissociation rates as already implemented and sufficient for our main conclusions. In the absence of more quantitative data, we prefer to keep the simple model.

Reviewer #2:

This study investigates individual roles of three nonmuscle myosin II paralogs in U2OS cells using CRISPR/Cas9-mediated knockouts of each paralog. A novel aspect of this study is that the authors use cross-shaped fibronectin patterns to culture cells, which allowed them to evaluate quantitative aspects of the resulting phenotypes. As key metrics, they used a relationship [R(d)] between the curvature and the length of the lateral actin arcs formed on such patterns. The underlying hypothesis is that these parameters are defined by a competition between the surface tension all over the cell and the line tension in the arc. The authors also developed mathematical models to evaluate the ideas that the differences in both R(d) and the exchange rate of two myosins, NM IIA and NMIIB, result from distinct kinetics of their motors. These data reveal certain aspect about individual functions of NMII paralogs, although additional clarifications about underlying biology would be very helpful. Besides this main line of investigations, authors also present other observations, from which they draw conclusions, which are not sufficiently well justified.

We thank the reviewer for this candid assessment and believe that these issues are all addressed in the revised version. Please note that we now have added several types of additional experiments (overexpression experiments, cell shape and force generation in 3D collagen gels, dynamics of force generation in 3D scaffolds) that confirm and deepen our conclusions obtained with the micropattern experiments.

1. The benefits of R(d) as the main parameter to characterize the differences in KO phenotypes are not obvious. Indeed, the difference between the IIA KO and IIB KO phenotypes is visually quite obvious, but it is not revealed by R(d). Can this parameter inform us about how the surface tension and/or the line tension changes in each case?

We first note that the phenotypes on homogeneous and structured substrates are complementary and that this is a major and very important result of our work. While the observations on the homogeneous substrates seem to suggest that NM IIA-KO cells cannot establish a contracted and structured phenotype, the micropatterns demonstrate that in a structured environment, these cells do establish a distinct phenotype and build up some level of tension, because also here they form invaginated arcs. The observations on the homogeneous substrates seem to suggest that NM IIBKO cells are rather similar to WT, but the micropatterns demonstrate that the R-drelation breaks down, revealing that NM IIB is required for stabilization. We conclude that the phenotypes on homogenous and structured substrates complement each other and irrespective of the exact values extracted for σ and λ, the micropattern assay reveals important functions of the different paralogs that cannot be deduced directly on the homogenous substrates. Note that with the cell stretching experiments, we now also have found a way to identify a cellular function of NM IIC. In addition, we now have added the collagen experiments to demonstrate that the conclusions drawn from the micropatterns also manifest themselves in the more physiological context of a tissue environment.

Regarding the exact values of the two parameters, the Laplace law R=λ/σ can be used only to extract the ratio of the two, thus one needs additional experiments to determine absolute values. In our previous paper Bischofs, Schmidt and Schwarz Physical Review Letters 2009 (10.1103/PhysRevLett.103.048101), we showed how this could be done with traction forces on pillar arrays. This line of research, however, is not the focus of the work presented here, where we aimed at explaining the R-d relation directly from the known differences between the crossbridge cycle of A versus B without having to specify values for σ and λ.

In order to make progress towards a better understanding of cell mechanics as a function of NM II-KO, we now have performed additional nanoindentation experiments using AFM force spectroscopy to confirm changes in σ after KO (shown in Figure 2F of our new manuscript). We found that on the dorsal side above the nuclear region, where only surface tension should contribute to the actomyosin contractility, NM IIAKO cells are significantly softer than WT cells, while NM IIB-KO cells are significantly stiffer. Because these experiments measure an effective Young’s modulus by fitting to a Hertz indentation curve, we cannot extract specific values for σ, but it is clear from these experiments that σ is strongly reduced in the NM IIA-KO cells because without NM IIA, the whole force generating machinery does not work properly. This is also confirmed by the cell stretching experiments, in which NM IIA-KO could not generate any force.

2. On the patterns, actin and myosin localize not only to arcs, where they apparently generate the line tension, but also to the cytoplasm over the passivated substrate, where they might generate surface tension. After IIB KO, more actin (Figure 2C) seems to move to the cytoplasm relative to how much remains in the arcs. Can it mean that these cells have higher surface tension and lower line tension relative to wild type? In this is the case, according to the proposed model, such redistribution should result in a higher curvature of the arcs, but the actual result was opposite – straighter arcs, which should mean that the line tension overwhelms surface tension. Does it mean then that IIB is mainly responsible for the surface tension? Is there a biological explanation for this result?

We agree with the reviewer that one might get the impression from the mentioned figure that more actin is translocated to the cytoplasm over the passivated area and we therefore followed up on this interesting comment. When quantifying the amount of actin fibers by averaging the coherency of the structure tensor as an indirect measure of fiber density, we found a trend towards more actin fibers over the passive area in case of NM IIB-KO cells. However, the difference was not significant between WT and NM IIB-KO cells (now shown in Figure 3—figure supplement 3A) and we want to emphasize that such high actin densities are not abundant in each and every NM IIBKO cell, thus reflecting the high heterogeneity of the cells, as also stated in the manuscript.

The question regarding the surface tension and line tension in NM IIB-KO cells is an interesting point that is, however, not easy to answer. First, we want to point out that the internal actin fibers above the passivated area resemble ventral stress fibers, which in this case should not contribute to the surface tension, since they are attached to the substrate at both ends on the ventral side of the cell (see Figure 3). However, the assumption that the cortical (surface) tension should also be influenced by the loss of NM IIB is plausible and an increase in cortex tension was recently postulated in Taneja et al. 2020 (https://doi.org/10.1016/j.celrep.2020.03.041). Since this paper, however, dealt with the process of cytokinesis, the cells were in suspension during the analysis, therefore lacking any stress fibers. In our set-up, both, stress fibers (line tension) and cortex (surface tension) contribute to force generation and we believe that both are driven by a global pool of NM II molecules that generate the force output. This is supported by our new data from the AFM nanoindentation experiments, where a higher surface tension was measured in NM IIB-KO cells and a lower surface tension in NM IIA-KO cells. Although we cannot deduce the proportions of NM II molecules contributing to surface or line tension from these experiments, these data suggest that a loss of NM IIB leads to both, higher surface tension and higher line tension, while it is the opposite for NM IIA-KO cells, where both tensions are reduced.

Finally, we want to highlight that a differential distribution of the different NM II paralogs to surface tension or line tension might still be possible and it would be a very interesting phenomenon to tackle. We refrain from giving explicit values for λ and σ in this study and leave this important subject to future work.

3. The assumption of a slower inflow from focal adhesions in the absence of IIA predicts straighter arcs. Conversely, a faster inflow in the absence of IIB should lead to more curved arcs. However, the results are opposite. Why do these intuitive considerations conflict with the conclusions of the model?

We thank the reviewer for this interesting question. Our theory shows that the situation is more complex and requires to consider both flows and forces. Put simply, however, one can argue in the following manner. For NM IIA-KO, when only NM IIB is present, the flow is slower (larger friction) and the focal adhesions give out more length (at constant force) than can be accommodated by the slowly flowing fiber. Therefore the fiber has to grow longer and its length increases, leading to smaller radii, as observed experimentally. Note that this reasoning does not replace the full theory as given in the supplemental.

4. While interpreting the IIA KO phenotype, authors need to take into account that total amount of myosin II is significantly reduced in KO cells, as IIA is the major isoform in U2OS cells, suggesting that the phenotype could be well explained by a lower quantity, not by a different quality of the remaining myosin. A proper control would be to use cells that express IIB in the IIA KO cells at approximately the same level as total myosin II in WT cells.

Many thanks for raising this important point, which was also brought up by the other reviewer. As pointed out in the response to the comments of reviewer 1, we measured ratios of NM IIA to NM IIB and found that the ratio of NM IIA to NM IIB along SFs is approx. 4.5 to 1. To address the concerns of the reviewers that the total amount of NM II molecules rather than the different quality of the isoforms is the reason for the different phenotypes, we did some additional experiments, including the suggested control. We measured the amount of NM IIA in WT cells that express GFP under the endogenous NM IIA promotor and subsequently overexpressed NM IIB-GFP in NM IIA-KO cells under a constitutively active promotor to reach maximal expression of NM IIB. We measured NM IIB intensities along SFs that were 1.7 fold higher than the intensity of GFP-NM IIA in WT cells. Additionally, NM IIA-KO cells express endogenous NM IIB, which was not taken into account in these measurements. Thus, the real number of NM IIB molecules was even higher. However, even under these conditions, NM IIB was not able to phenocopy the NM II filament distribution, the pRLC intensity, the SF formation, the FA size or the morphology of WT cells. Moreover, overexpression of NM IIB did also not affect the R(d)-Relation on the micropattern (Figure 3—figure supplement 4). Finally, as already stated above, our AFM nanoindentation experiments show that the loss of NM IIA and NM IIB lead to opposite effects, namely a loss of surface tension in NM IIA-KO cells and an increase of surface tension in NM IIB-KO cells. These results are not consistent with the idea that reduced quantities of NM II molecules lead to the observed phenotypes, since in this scenario one would expect similar effects of different amplitudes rather than opposite outcomes. Our new results are now shown in Figure 2.

5. The conclusion that IIA is necessary to initiate assembly of IIB filament is not supported by the data, which show that peripheral myosin II filaments in the cells have 75% of IIA subunits and 25% of IIB subunits (Figure 4-s2F), thus suggesting that all filaments initially contain both IIA and IIB, but their ratio changes over time and distance from the cell edge. No homotypic IIA filaments have been demonstrated in the study. Despite the conclusion saying "we found that all heterotypic minifilaments arise from homotypic NM IIA minifilaments" (p. 15, ll. 349-350). Available data in the literature show that IIB can polymerize by itself both in vitro and in cells lacking IIA. The claim that IIA or IIAΔIQ "restore" IIB filaments is not validated quantitatively. In fact, in figure 4-s1A, a NM IIA-KO cell that does not express GFP-NM IIA-WT has abundant NM IIB filaments. Moreover, the authors show that overexpression of IIB also restores NMIIB filaments (Figure 4-s1D), suggesting that a low levels of IIB is likely responsible for the low amount of IIB filaments in IIA KO cells, rather than their inability to form filaments in the absence of IIA.

The reviewer is correct in stating that NM IIB filaments can also assemble on their own and this also happens in our cells as shown in the new Figure 1—figure supplement 3 and Figure 3—figure supplement 3. We apologize if there existed misleading statements in this regard. Our point is, however, that NM IIB filaments seemingly arise in much lower numbers when NM IIA is not present and as suggested by the reviewer itself in the next bullet point, we believe that NM IIA can somehow trigger a feedback loop to enhance RLC phosphorylation and NM IIB filament distribution. However, we also agree that this hypothesis requires solid evidence, which was not provided in our initial manuscript. We therefore decided to follow up on this very interesting biochemical topic in future work and to shift the scope of this study towards the cellular effects.

6. The conclusions that IIA triggers RLC phosphorylation and that IIB can form filaments with unphosphorylated RLC are so extreme that their validation requires comprehensive analyses, extensive quantifications using proper normalizations to myosin levels, as well as alternative approaches. At the present state of knowledge, it is hard to imagine that myosin filaments would form without RLC phosphorylation. The idea that myosin II can somehow trigger a feedback loop to activate RLC phosphorylation is theoretically possible, but requires solid evidence, which is not provided here. The observations instigating the above conclusion are more likely explained by some technical issues. For example, IIB filaments may contain double-phosphorylated RLC, which is not recognized by the used antibody, or the amount of IIB is too low, or there is a problem with signal detection. The authors show that the pRLC level does increase linearly with overexpression of IIB although with a different slope compared with IIA. However, data in Figure 4-s1B and 4-s1E must come from different experiments, thus making pRLC staining intensities incomparable.

We again apologize that we have not clearly communicated our statement. We do not believe that NM IIB filaments form without RLC phosphorylation. As pointed out above, our data point towards the direction that there might be a positive feedback loop (as also suggested by the reviewer) that is initiated by NM IIA rather than NM IIB. However, to entangle the complete molecular mechanism underlying such a system is beyond the scope of this study. We still believe that these data provide interesting new insights that do not arise from technical issues and that might help to entangle such mechanisms in the future. Yet we removed the according data to publish it in the future, when all necessary controls are done. This allowed us to focus more on the mechanistic roles of the isoforms and we included the new data regarding the force generation and reactive forces upon mechanical stress in 3D environments. As already stated above, we thus believe that due to these adjustments, our manuscript has significantly improved in both, distinctness and relevance.

7. The significance of using the IIA mutants is hard to understand. First, it is not clear what mutants are meant in different statements, e.g. mutants with "prolonged NM IIA dwell times in the minifilaments" (p. 14, l. 313), or "mutants, in which the disassembly of the NM IIA hexamers was blocked" (p. 14, l. 315), or "constitutively active NMHC IIA construct" (p. 14, l. 317). They all seem to refer to mutants with impaired disassembly (ΔIQ2, ΔNHT and 3xA). Yet, they are contrasted to each other (p. 14, ll. 315-317 and in Figure 3-s2). Second, what is the idea behind using the ΔACD mutant? What does it reveal? Third, none of these mutations affects motor activity of IIA. They only affect its polymerization. Given that the mathematical model considers only motor activities of IIA and IIB, how do these experiments test the model? Finally, since IIB was not a part of these experiments, how did authors arrive to the following conclusions from these data: "This demonstrates that spatially and temporally balanced ratios of active NM IIA and NM IIB hexamers in heterotypic minifilaments are mandatory to adjust the contractile output in SFs and the relation between tension and elasticity. Therefore, the specific biochemical features of the isoforms and not their overall expression are important for the generation of tension and elastic stability, respectively." (p. 14, ll. 318-322) and "the specific intracellular force output is precisely tuned by the ratio and dwell time of individual NM IIA and NM IIB hexamers in the heterotypic minifilaments." (p.22, ll. 518-520)?

We agree with the reviewer regarding the description of the mutants and apologize for not stating this more clearly in the manuscript due to space limitations. We now understand that we have tried to pack too many results into our manuscript and we have now removed the supplemental figure and explanations regarding it completely to improve the focus of the paper towards cell mechanical phenomena.

[Editors’ note: what follows is the authors’ response to the second round of review.]

Essential revisions:

While the reviewer #1 found the revised manuscript significantly improved, the reviewer #2 stated that large part of the data are confirmatory and that the most novel findings were not sufficiently well presented in the manuscript. Thus, the manuscript should be extensively rewritten to address the points raised by reviewer #2.

1). The study should be put better into a context of earlier work on NMII isoforms. The parts of the manuscript presenting confirmatory data should be shortened, and the most novel findings should be better explained to make them also accessible for a non-specialist reader. Making the manuscript shorter and more focused will increase its impact.

2). Also the 'Introduction' should be shortened and focused only on the published literature. Instead of extensively discussing new findings in the 'Introduction', these should be only briefly mentioned in the end of 'Introduction'.

We agree that our revised version was unnecessarily detailed and contained many explanations and repetitions that were not needed for a concise presentation. We now have generated a significantly shortened version with a strong focus on the newly achieved results. In particular, we emphasize already in the abstract that the novel aspect is the quantitative analysis of the cells in a structured environment, and how this allows us to extract statements on the different dynamical roles of the different NM II isoforms. The confirmatory parts in the main text have been drastically shortened to increase the focus of the work and the novel findings are highlighted to make them more accessible for non-specialized readers. The Introduction has also been heavily shortened and now focuses on the necessary background literature. All carried out changes are highlighted in the DOCX text file using the track changes function with the following color code: Removed parts are marked in red, novel parts in green, and adjusted parts are in blue.

Reviewer #2:

This manuscript, previously revised in eLife, but not by this reviewer, describes the different effects of NMII isoforms in mechanical adaptation to different microenvironments. The approach consists of U2OS cells depleted of each specific isoform by CRISPR/CAS9. Based on the rebuttal, the authors had, in their previous version, data on NMIIA mutants as well as FRAP data, which have been removed from this iteration. Instead, the authors provide modeling to show that NMIIA is the "first responder" in generating tension; whereas NMIIB stabilizes elastic tension. The authors propose a novel role for NMIIC in establishing tensional homeostasis.

This manuscript contains important information regarding the role of NMII isoforms in cellular responses. The manuscript seems have changed mightily from its previous incarnation. Insomuch as this reviewer did not see the previous version, what follows is an appraisal on the current version.

Overall, the manuscript is well done, and experimentation is of high caliber. However, the study takes a long time getting into actually novel data, and its amount is limited. A significant part of the manuscript is confirmatory, including the role of NMIIA in force generation (Jorrisch et al., 2013, PMID 23616920, for example), adhesion elongation (many reports); and of NMIIB in adhesion "consolidation". The other reviewers asked about the relative amount of NMII isoforms, which was a good point. The authors have solved this by overexpressing NMIIB in NMIIA KO cells, which does not restore any effect observed in these cells, which actually confirms that the ability of NMIIB filaments to form is limited in these cells.

Although similar results have been described before using RNA-interference and genetic ablation in mice, this is to our knowledge the first time that CRISPR/Cas9-based depletions of all three isoforms were generated from the same cellular background and analysed in such a comparable manner. After intense discussions, we are convinced that it is necessary to show the analysis for homogeneous substrates (Figure 1) because these data provide a basis for our main results. In the revised manuscript, we have drastically shortened the confirmatory text sections and now clearly state that these results are not shown because of their novelty, but for the sake of comparison. In principle, it would also be possible to move Figure 2 with the overexpression data into the supplement, but this part of the revised manuscript was earlier suggested by both reviewers and also appreciated now by the new reviewer. Because we now have strongly shortened the main text, we believe that the figures can remain as they are, but if advised otherwise, we are happy to move Figure 2 into the supplement.

The authors engaged in an argument with the previous reviewers on the importance of the levels of NMII isoforms. While I'm convinced by the argument of the authors (NMIIB overexpression in NMIIA KOs is a good experiment), I'm curious as to more NMIIC has effects on the elastic recoil observed in the last experiment of the paper. Also, include mass spec data as in Ma et al. (2010) would be useful.

We agree with the reviewer that such data would be very interesting. However, as also pointed out correctly by the reviewer his last comment, these experiments require extensive amounts of additional work and experiments. To systematically and quantitatively analyze NM IIC overexpression in our cell stretching assay, the cells should stably overexpress NM IIC, which would at least take three months. Following the editorial advice, we now focus on producing a concise version of our manuscript, which will be more accessible for the general reader of eLife.

The novel part starts in figure 3, in which the authors observe a subtle change in the bending of actin bundles in cross-shaped patterns. The graph is quite counterintuitive. A and D look similar, and the graphs look similar. This is understandable. However, B and C (NMIIA and NMIIB Kos) are somewhat similar, yet the graphs are opposite, with dTEM converging on Rmin on NMIIA KOs; and away from Rmin in NMIIB KOs. The text explanation (pages 10 and 11) works, but the representative cell is head scratching.

We agree with the reviewer that it is difficult to select representative images for a statistical analysis. After intense discussion, we are convinced that our choices for NM IIA-KO and NM IIB-KO cells make sense, because they reflect two of our major findings: First, the phenotype of NM IIA-KO cells is dampened on the cross-shaped micropattern and more closely resembles the WT phenotype than on homogenous substrates. Second, although the phenotype of NM IIB-KO cells is comparable to the WT situation by visual inspection, the quantification shows a marked difference, namely the loss of R(d) correlation, which arises from the mixed population of bent and almost straight actin arcs. In Figure 3C, we have chosen a cell that in our opinion reflects this heterogeneity, since it shows two almost straight and two more bent arcs. However, we again want to highlight that this striking result can only be revealed by the statistical analysis. We have added some more clarifying statements in the text, making this more transparent.

I haven't seen the RLC phosphorylation data, but I'm intrigued. The manner the previous reviewers wrote about it makes it hard to understand what was going on. I'm guessing the authors will pursue this in future work.

We are happy that the reviewer was already intrigued regarding the response to our pRLC data, as we are also excited and wish to present these data soon in a follow-up publication. Since the data were deemed too preliminary by the former reviewer(s), we removed these data to increase the focus of our revised manuscript.

In Figure 4, the authors propose a model that correlates dynamic tension and elasticity with actomyosin crossbridging. They propose that the short duty ratio of NMIIA correlates with the generation of dynamic tension; and the higher duty ratio of NMIIB explains the elastic behavior of the actomyosin arches. While it is entirely possible this may be true, the cellular behavior of myosin II chimeras (e.g. as published by Tony Means and Rick Horwitz) is not dominated by the duty ratio (which depends entirely on actin-myosin binding); but by myosin filamentation, which depends on the tail domains of the heavy chains. I would require the authors to integrate this in their model, which may be correct theoretically, but would hardly explain the behavior of the cell outside a cross-shaped pattern.

We completely agree that our explanations only concern the heads and not the tails. As now explained in more detail in the manuscript, there are two reasons for this approach. First, the focus on force generation rather than minifilament polymerization is a logical consequence of our earlier work to explain the R(d)-relation by force generation in bundles (line tension λ) and networks (surface tension σ). Second, the differences in the crossbridge cycles are sufficient to explain our data observed on the micropatterns. This being said, we share the concerns of the reviewer and plan to extend our experimental and modelling approaches in this direction in the future. This is now being stated in the discussion, where we also write that experiments with chimeras would be the way to go forward.

The most interesting argument is the potential role of NMIIC in the mechanical response of cells. The authors seem to consider NMIIC as an oscillatory dampener that controls force relaxation. However, this is a very undeveloped part of the manuscript, which merits further exploration. I don't think this is particularly easy.

We completely agree. These results have been found in response to the comments of the first revision and are very exciting, but need further scrutiny in future work, e.g. generation of cell line stably overexpressing NM IIC. However, as the reviewer again pointed out correctly, this will not be particularly easy but requires some in-depth analysis with advanced techniques. Given the focus of the current manuscript, we make a very clear statement that certainly is of large interest for the readers of eLife: NM IIC has no measurable role in cell shape determination, but in tensional homeostasis, which is a more dynamic process. We now emphasize this aspect in more detail in the discussion.

In summary, while I find a lot of merit in this paper, I find that more than half the study is confirmatory, and the novel part will appeal only to hardcore specialists in the field. Thus, I am not convinced it represents a sufficient general advance for publication in eLife.

We believe that our revised manuscript has significantly increased its focus and accessibility. We hope that in its new version it is now suited for publication in eLife.

https://doi.org/10.7554/eLife.71888.sa2

Article and author information

Author details

  1. Kai Weißenbruch

    1. Zoological Institute, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    2. Institute of Functional Interfaces (IFG), Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Visualization, Methodology, Writing - original draft, Writing - review and editing
    Contributed equally with
    Justin Grewe
    For correspondence
    kai.weissenbruch@kit.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9463-6725
  2. Justin Grewe

    1. Institute for Theoretical Physics, University of Heidelberg, Heidelberg, Germany
    2. BioQuant-Center for Quantitative Biology, University of Heidelberg, Heidelberg, Germany
    Contribution
    Conceptualization, Data curation, Software, Formal analysis, Validation, Methodology, Writing - original draft, Writing - review and editing
    Contributed equally with
    Kai Weißenbruch
    Competing interests
    No competing interests declared
  3. Marc Hippler

    1. Zoological Institute, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    2. Institute of Applied Physics, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    Contribution
    Conceptualization, Data curation, Software, Validation, Investigation, Visualization, Methodology
    Competing interests
    No competing interests declared
  4. Magdalena Fladung

    Zoological Institute, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    Contribution
    Data curation, Validation, Visualization
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4213-2891
  5. Moritz Tremmel

    Zoological Institute, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    Contribution
    Data curation, Validation
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8901-9362
  6. Kathrin Stricker

    Zoological Institute, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    Contribution
    Data curation, Validation
    Competing interests
    No competing interests declared
  7. Ulrich Sebastian Schwarz

    1. Institute for Theoretical Physics, University of Heidelberg, Heidelberg, Germany
    2. BioQuant-Center for Quantitative Biology, University of Heidelberg, Heidelberg, Germany
    Contribution
    Conceptualization, Supervision, Funding acquisition, Investigation, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    schwarz@thphys.uni-heidelberg.de
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-1483-640X
  8. Martin Bastmeyer

    1. Zoological Institute, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    2. Institute for Biological and Chemical Systems - Biological Information Processing (IBCS-BIP), Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
    Contribution
    Conceptualization, Resources, Supervision, Funding acquisition, Investigation, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    bastmeyer@kit.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3471-8400

Funding

Deutsche Forschungsgemeinschaft (EXC 2082/1-390761711)

  • Ulrich Sebastian Schwarz
  • Martin Bastmeyer

Deutsche Forschungsgemeinschaft (EXC 2181/1 - 390900948)

  • Ulrich Sebastian Schwarz

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Alisha Rapp (KIT) for her help with the analysis of GFP- and pRLC intensities. This work is supported by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) under Germany's Excellence Strategy through EXC 2082/1-390761711 (the Karlsruhe-Heidelberg 3DMM2O Excellence Cluster, to USS and MB) and EXC 2181/1–390900948 (the Heidelberg STRUCTURES Excellence Cluster, to USS). USS is a member of the Interdisciplinary Center for Scientific Computing (IWR) at Heidelberg. JG acknowledges support by the Research Training Group of the Landesstiftung Baden-Württemberg on Mathematical Modeling for the Quantitative Biosciences.

Senior Editor

  1. Anna Akhmanova, Utrecht University, Netherlands

Reviewing Editor

  1. Pekka Lappalainen, University of Helsinki, Finland

Reviewer

  1. James R Sellers, National Heart, Lung and Blood Institute, National Institutes of Health, United States

Publication history

  1. Preprint posted: October 9, 2020 (view preprint)
  2. Received: July 2, 2021
  3. Accepted: August 9, 2021
  4. Accepted Manuscript published: August 10, 2021 (version 1)
  5. Version of Record published: August 26, 2021 (version 2)

Copyright

© 2021, Weißenbruch et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,416
    Page views
  • 133
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Cell Biology
    2. Developmental Biology
    Spencer R Katz et al.
    Research Advance

    We previously described X-ray histotomography, a high-resolution, non-destructive form of X-ray microtomography (micro-CT) imaging customized for three-dimensional (3D), digital histology, allowing quantitative, volumetric tissue and organismal phenotyping (Ding et al., 2019). Here, we have combined micro-CT with a novel application of ionic silver staining to characterize melanin distribution in whole zebrafish larvae. The resulting images enabled whole-body, computational analyses of regional melanin content and morphology. Normalized micro-CT reconstructions of silver-stained fish consistently reproduced pigment patterns seen by light microscopy, and further allowed direct quantitative comparisons of melanin content across wild-type and mutant samples, including subtle phenotypes not previously noticed. Silver staining of melanin for micro-CT provides proof-of-principle for whole-body, 3D computational phenomic analysis of a specific cell type at cellular resolution, with potential applications in other model organisms and melanocytic neoplasms. Advances such as this in whole-organism, high-resolution phenotyping provide superior context for studying the phenotypic effects of genetic, disease, and environmental variables.

    1. Cell Biology
    Sho W Suzuki et al.
    Research Article

    Membrane protein recycling systems are essential for maintenance of the endosome-lysosome system. In yeast, retromer and Snx4 coat complexes are recruited to the endosomal surface where they recognize cargos. They sort cargo and deform the membrane into recycling tubules that bud from the endosome and target to the Golgi. Here, we reveal that the SNX-BAR protein, Mvp1, mediates an endosomal recycling pathway which is mechanistically distinct from the retromer and Snx4 pathways. Mvp1 deforms the endosomal membrane and sorts cargos containing a specific sorting motif into a membrane tubule. Subsequently, Mvp1 recruits the dynamin-like GTPase Vps1 to catalyze membrane scission and release of the recycling tubule. Similarly, SNX8, the human homolog of Mvp1, which has been also implicated in Alzheimer's disease, mediates formation of an endosomal recycling tubule. Thus, we present evidence for a novel endosomal retrieval pathway that is conserved from yeast to humans.